The Biotechnology of Cannabis sativa (Full Text)

Sam R. Zwenger

April, 2009

stem

callus

[7

transgenic Cannabis rooting

This book is dedicated to the future of humankind. Please distribute it at no

charge.

"I smoke pot, and I like it."

-Anonymous

Table of Contents:

Introduction

1. The Botany of Cannabis sativa

2. Plant Biotechnology

3. Tissue Culture

4. Agrobacterium tumefaciens

5. The GFP Leaf

6. Woody Cannabis

7. Terpene Production

8. The THC Pathway

9. Smoking Roses and Other Proposals

10. Cannabis DNA Sequencing

11. Molecular Tools

12. Marijuana Laws, Regulations, and Education

Appendix A: Representative list of interesting genes to be used for

Cannabis transformation.

Appendix B: Vendors of biotechnology equipment and reagents.

Glossary

Introduction

Marijuana, whose scientific name is Cannabis sativa, is perhaps the most

famous plant

ever discovered by humans. Since its discovery it has been used by millions

of people for

both inducing pleasure and alleviating pain. Cannabis has a rich history,

complex biology

and a fascinating physiology.

Molecular biology and plant biotechnology are only beginning to uncover the

secrets of

this plant. Scientists now have the opportunity to grow Cannabis plants in

vitro (in a test

tube or Petri dish), thereby being able to genetically modify these plants in

dozens of

ways. Fluorescent Cannabis, THC-producing roses, Cannabis that climbs like a

vine, and

phenomenal increases in branch number and flower size are only a few of the

ways in

which this plant can be enhanced through biotechnology.

Many would benefit from Cannabis biotechnology. For example, producing

genetically

transformed, THC-containing weed species might be an effective way to bypass

legal

issues and still allow sufferers of chronic illnesses to self-medicate. In

other words, with

biotechnology the legalities concerning Cannabis cultivation diminish. Within

the next

few years, through biotechnology, a surrogate plant will soon be created that

synthesizes

THC. This might lead some policy makers to increase their vigilance against

the THC

molecule itself. Conversely, they may finally put their war on this

beneficial plant to rest.

The purpose of this book gives insight into the possibilities that

biotechnology can

provide to the Cannabis community and the world. It begins with a botanical

introduction

and continues with an explanation of biotechnology and techniques, examples

and

purpose for genetically modifying Cannabis, THC biosynthesis and cellular

interaction,

and information on some necessary molecular biology techniques.

The tools of biotechnology, such as DNA sequencing and gene cloning, are

speeding up

the reality that this highly controversial plant will continue to make an

impact on human

societies for generations to come. This book covers advances and techniques

on how to

grow plant tissue in vitro, genetically modify this tissue, and re-grow it in

order to

produce a transgenic Cannabis plant. Anyone who wants to know what the future

holds

for Cannabis sativa and marijuana should read this book.

1. The Botany of Cannabis sativa

Before explaining the features of plant biotechnology, it is important to

have an

understanding about what parts of the plant may be genetically modified.

Therefore, by

introducing some concepts in plant anatomy and physiology, this chapter

serves as a

platform for how a biotechnology experiment may modify the Cannabis plant.

Within the great diversity of life there exists the plant kingdom. This

kingdom covers a

vast array of different species, some used by humans and others not yet

discovered or

their potentials unrealized. The plant kingdom is unlike the animal and fungi

kingdoms.

Plants make their own carbon compounds, such as sugars and starches, through

their

ability to perform photosynthesis. They do this via intricate biochemical

machinery that

has developed through more than 2 billion years of evolutionary forces.

The evolution of Cannabis represents a fascinating phenomenon. Early in the

evolution

of life on earth, some floating cells in the ocean swallowed tinnier cells.

This lead to the

theory of endosymbiosis, which states that these prehistoric larger cells

were unable to

digest the smaller cells they had engulfed (Reyes-Prieto et al., 2007). This

process

explains why plants have both chloroplasts (for photosynthesis) and

mitochondria (for

respiration). Both of these organelles are easily observed with any compound

microscope

and represent living proof of the past event of endosymbiosis.

Grasses'! DM YA

Evolution

Photos vnthetic bacteria 3.5BYA Land plants 3S0MYA

I I

Cannabis -34MYA

J ,

origins of Earth 4.5b YA AriRiosperms 130MYA Humans -2MYA

This timeline shows that Cannabis is thought to have first arisen about 34

million

years ago based on work by McPartland and Nicholson (2003).

Thus, evolutionary change through time has pushed plants, like other

organisms, to

become very efficient in their environmental interactions. Plants stand out

from other

organisms not only because they do photosynthesis, but also because they have

a cell

wall with depositions of cellulose, an incredibly large carbohydrate that

functions like

rebar in concrete slabs. This is one reason that plants were able to make the

transition

from water to land; they had better cellular structures (i.e., a rigid cell

wall) to hold

themselves upright. The development of lignin, the compound that gives wood

its

characteristic strength, came later in evolution and gave plants an added

benefit for living

on land.

However the fundamental distinguishing characteristic, which sets plants

apart from all

other organisms, is their alternating life cycles between a diploid

sporophyte and a

haploid gametophyte. Diploid means that an organism has two copies of each

chromosome and haploid means it has only one copy of each chromosome. These

alternate between the organism and its reproductive cells. Hence, plants have

an

alternation of generations. The large pine that might be observed in a city

park or a

neighbor's front yard is the diploid spore-bearing generation. The pollen you

see in the

spring is the haploid gametophyte.

With this considered, the Cannabis plant is a sporophyte that releases

gametes, which

includes the pollen. When pollen is released its main objective is to

fertilize the ovule,

which upon fusing together, yields a diploid embryo. Wondering how plants to

new areas

then, it follows that the marijuana embryo develops into a mature storage

capsule (a seed)

that can be transported by birds, or in some cases, the postal service. This

is, of course,

with the gracious assistance of seed companies.

The plant kingdom is nicely divided into many subdivisions, but perhaps the

most

important one to many plant taxonomists is the family level. Plant families

include the

sunflower family (Asteraceae), the bean family (Leguminosae), and the grass

family

(Poaceae). There are more than 300 plant families but the one we will concern

ourselves

with, at least in this book, is the hops and cannabis family (Cannabaceae).

Domain

Eukaryota

Eukaryota

Kingdom

Planta

Animalia

Phylum

Angiosprems

Chordata

Class

Dicotyledones

Mammalia

Order

Cannabales

Primates

Family

Canabaceae

Hominidae

Genus

Cannabis

Homo

species

C. sativa

H. sapiens

Comparison of how marijuana and humans are placed according to current

biological classification.

The Cannabaceae family is composed of two genera. Humulus, the plant used for

making

beer taste "hoppy", has two species within its genus. The genus Cannabis has

only one

species C. sativa. However, this has been greatly debated. Some researchers

argue that a

second species originating in India (C. indica) is a valid species. Others

content that C

indica is a subspecies and should be treated as a variety rather than an

independent

species. Years ago, the wild type variety of hemp was referred to as C

ruderalis. The

origins of Cannabis have been examined using genetic tools (Mukherjee et al.,

2008).

Because much of the debate continues on how many species of Cannabis exist,

we will

leave it to rest for the time being.

One reason Humulus and Cannabis are placed in the same family is that hops

and

marijuana both grow in similar sexual morphs. They are dioecious plants,

which means

they have separate male and female flowers. Dioecy occurs in -5% of flowering

plants

(Thomson, 2006).

Nearly three-fourths of flowering plants have perfect flowers, due to having

both male

(stamens) and female (pistil) parts within the same flower. Strangely,

Cannabis and a few

other plants are outside of this normalcy; their male and female flowers grow

on

completely separate individuals (i.e., they have imperfect flowers). Because

there is a

male plant and a female plant, out-breeding (exchanging genetic material

between non-

related individuals) is maximized, and may be seen as an evolutionary

advantage because

it allows for more genetic diversity.

The female plant is what marijuana smokers are most interested in, unless

they are

sexually propagating a new variety. The male plant is interesting too, from

an

economical, environmental, and agricultural perspective. Indeed, many books

have been

published on hemp (Robinson, 1996; Herer, 2000; Conrad, 1997). However, only

a

limited number of governments have realized the strength of hemp fibers and

have

subsequently allowed industrial production. China is by far the largest

producer of hemp

in the world today (Wang and Shi, 1999)

Hemp is not considered to have large amounts of resin, the material that

contains the

psychoactive compounds most breeders desire. Resin, a sticky and chemically

complex

substance, is often secreted through glandular trichomes on Cannabis leaves

and flower

surfaces. There are two basic types of trichomes, glandular and non-

glandular. Non-

glandular trichomes, in most species, are small, hair-like projections of a

modified

epidermal cell that have evolved to restrict water loss from the leafs

stomatal pores,

which function similarly to the pores in human skin (i.e., they regulate

internal

temperature). Although stomata often serve to transpire water vapor from the

organism

and thus, facilitate a cooling effect, the plant eventually loses this water

to the

atmosphere. The process of transpiration also helps distribute soil ions,

water, and

nutrients through the plant. When plants lose water they eventually need

additional water

at a later time for growth and cellular processes. Therefore to reduce this

loss, non-

glandular trichomes help retain at least some of the plant's water before it

leaves the

stomata. Often plants that are adapted to arid or dry habitats are covered

with non-

glandular trichomes.

Most important to Cannabis cultivators are glandular trichomes. These too are

modified

epidermal cells but function in secreting resin. There are many functions of

the resin.

Some have asserted that it aids in capturing pollen, however there is

presently no research

that supports this belief. It seems more logical, and in fact has been

correctly asserted,

that resin plays some role in attracting pollinators for the flower

(Armbruster, 1984).

For example, if the female Cannabis is kept free from pollination, glandular

trichomes

will secrete more resin. The subsequent resin production attracts pollinators

through this

method. The sticky resin secreted by the glandular trichomes continues

production as

long as pollen is prohibited from landing on the stigma. Subsequently, this

is the reason

that many Cannabis growers seek to prohibit male plants from interfering with

pollinating their female plants. That is, keeping males plants out of

Cannabis gardens

increases resin production in female plants.

When pollen is used it is often in the form of a controlled crossing

experiment. Crossing

different plant species is difficult because the pollen grain has exterior

surface proteins

that must match up with a genetically compatible female stigma of the same

species,

similar to key fitting into a lock (it simply occurs on a molecular level).

The stigma,

which is the top part of the pistil that the pollen lands on, also has

recognition proteins on

its surface. Sometimes this method is faulty and different plant species by

mistake

successfully interbreed, although this is a rare event.

A typical flower (lily) with bracts labeled. The ovary (not shown) is at the

base

and along with the stigma and style comprises the flower's pistil.

Many genes control resin production. However many genes also control the

genetic path

for plant development. Flowers are no exception to this and many genes have

been

8

identified that play a role in the flowering process. The most popular model

for flower

development is known as the ABC model (Soltis et al, 2007). This is based on

the fact

that there are four whorls in a typical flower. The first whorl is the

sepals. The petals

make up the second whorl and as one travels towards the center of the flower

the next

two whorls are the stamens (male parts) and pistil (female part),

respectively. The flowers

of Cannabis are interesting in themselves in that they lack petals but have

retained their

sepals. Collectively, the sepals are termed the calyx and it is the calyx

that surrounds the

fruit. Within the plant kingdom, various types of fruits exist, the

description of which, is

beyond the scope of this botanical overview. Suffice it to say Cannabis

produces a fruit

called an achene, where the seed and pericarp (outer fruit wall) are attached

at the

funiculus (small stalk).

stamen

i

r

1

SS

pedicel

This shows the basic parts of a typical flower. The pedicel functions as the

stalk of the flower. Different plants have evolved different sizes and

numbers

of each part. For example, a Cannabis flower lacks petals and usually has

male

(stamens) and female (pistil) parts on separate plants.

In many cases, transcription factors are needed to give the signal for

turning a DNA

sequence into a functioning protein. The ABC model describes transcription

factors,

which are proteins that act like an on/off switch for the genes that allow

development of

flower parts. The exact function of the A, B, and C transcription factors has

been

determined through creating mutated plants that have lost various functions

of each of

these genes. By carefully tracking the mutational defects and the associated

observable

trait, the function of each gene has been deciphered. Transcription factors

for floral

development are normally initiated by alternating periods of light and dark,

called the

photoperiod.

Transcription factor

A

B

C

Parts encouraged to grow

Sepals and petals

Petals and stamens

Stamens and carpels

Gene regulators involved in the ABC model of flowering. Each transcription

factor is a small protein that activates other genes, stimulating different

flower parts to develop.

Photoperiod has been shown to play a crucial role in plant flower

development. Indeed,

this is a primary reason Cannabis continues vegetative growth in a light

cycle of 14-16

hours. During the vegetative stage most indoor Cannabis growers keep their

plants on a

long light cycle, in some cases the lights are never turned off. When the

light is decreased

to 12 hours or less key signaling events occur within the plant that trigger

the ABC

transcription factors that allow up-regulation, or turning on, of flowering

genes.

With the diversity of plants on earth (-280 million species) it is a well-

grounded

assumption that each plant species has evolved to respond in a slightly

different way to

varying photoperiods. This partly explains the diversity in strains that have

the ability to

flower early or late. Still, the ABC model of flowering applies to nearly all

plants.

There also exists within Cannabis and other plants a protein called

cytochrome (Bou-

Torrent et al., 2008). Cytochromes are protein molecules that harbor a

chromophore, a

color-absorbing molecule. Depending on the wavelength of light striking the

plant

surface, the phytochromes are converted between different states or forms.

When the

phytochromes receive red light (660nm) they become the Pf r type, which is

active and

allow flowering to proceed. If far-red light (730nm) is detected the

phytochrome becomes

the P r type. The P r type is a biologically inactive form and so flowering

cannot proceed.

An indoor gardener can use this principle to initiate flowering even in a

light cycle of 14

or more hours. During the dark period of a plant's life, they can be given a

brief pulse of

red light. This changes the P r type into the Pf r form and allows flowering

to begin.

Interestingly, these same phytochrome proteins play a crucial role in seed

germination.

10

For instance, the Pf r form of phytochrome allows germination to proceed.

Therefore, if

one is having difficulty germinating recently purchased Cannabis seeds, they

should try

exposing them to a short period of red light before planting them.

Transcription factors and cytochromes are still just part of a larger system

within the

plant cell. Plant hormones are another important part of Cannabis development

and

biochemistry and play a crucial role in its genetic modification. There are

five prominent

classes of plant hormones, which include auxins, cytokinins, gibberellins,

ethylene, and

abscisic acid. An imbalance in any of these can cause strange morphologies

within a

plant (Robert-Seilianiantz et al., 2007). The hormones all act as chemical

regulators of

gene expression and thus, guide development and the morphology (observable

shape) of

Cannabis. After all, the word hormone means "to set motion to".

Indole-3 -acetic acid (IAA) and 2,4-dichlorophenoxyacetic acid (2,4-D) are

perhaps the

most widely known auxins. The amino acid tryptophan is enzymatically modified

to

produce indole-3 -acetic acid. Auxins are commonly found in developing leaves

and

seeds. They function to control apical dominance, which is cell division at a

terminal bud

or stem. They also play an important role in stimulating flowering and fruit

development,

stimulate adventitious roots (growing from the stem) in asexual cuttings

(clones), and can

induce ethylene synthesis.

Cytokinins also have many identified structures, perhaps the most common one

in plants

is zeatin. Cytokinins are synthesized in the roots and are moved through the

xylem to the

shoots to regulate mitosis. Artificial application can induce lateral buds to

branch.

Cytokinins will be discussed later due to their important role in culturing

Cannabis in

vitro. Cytokinins can also cause a delay in leaf senescence.

Gibberellins were used early on in plant experiments. They elicit perhaps one

of the most

dramatic effects on a plant. If two plants are grown in separate pots, side

by side and

gibberellins are applied to one plant, that plant will grow several

magnitudes taller than

the other. Gibberellic acid is one of the most important and common

gibberellins in

plants. Gibberellins are produced from mevalonate, a precursor in synthesis

of terpenes (a

class of plant metabolites). They are found in immature Cannabis leaves and

seeds. In

most species gibberellins help in elongating shoots and regulate some seed

enzymes,

which are proteins that speed up a reaction.

Ethylene (C2H4) is a gas, which functions as a plant hormone. The amino acid

methionine

is the precursor, which leads to formation of ethylene. Because ethylene is a

small

molecule, it can easily move from cell to cell via diffusion. This hormone

gave rise to the

old adage that one bad apple can spoil the whole bunch. Ethylene is most well

known for

hastening fruit ripening. When tomatoes are picked and shipped, they are

green. Just prior

to arrival at the grocery store the tomatoes are sprayed with this gas,

ripening and

reddening the tomato fruits.

Like gibberellins, abscisic acid is also synthesized from mevalonate. It is

an important

regulator of stomates and plays a role in seed dormancy. By applying abscisic

acid to

11

seeds, they can be kept dormant for shipping, so as not to allow them to

mistakenly

sprout.

It should be noted to the reader that only a basic introduction to plant

hormones is

provided here. For example, there are additional classes of plant hormones,

but limited

knowledge exists on their synthesis and function. These include jasmonates,

systemin,

salicylic acid, and the brassinolides. For the purposes of this book, the

focus will be on

auxins and cytokinins, since they are used in plant biotechnology.

In Cannabis tissue culture, auxins and cytokinins are used to control root

and shoot

formation of a young tissue growing in vitro. From a scientific view it is

interesting to

know how Cannabis plants are growing and being maintained within their cells.

Hormones regulate nearly every response and function within the marijuana

plant. Most

importantly, because many synthetic hormones are available for anyone to

purchase,

experiments with Cannabis and any of these plant hormones can easily be

performed by

anyone with a basic understanding of plant biology.

When flowers appear on the plant, more energy is delivered into the flower

cells rather

than the vegetative cells. Plants in nature start to lose their flowers and

begin seed

production each season when their genetic makeup interacts with environmental

cues.

These cues are signaling events that prepare the flower for seed production,

seed

maturation, and eventually plant death (annuals) or dormancy (perennials).

The plant roots are important in taking up minerals, ions, and water. There

exist small

root hairs on the roots to increase surface area. Therefore, when

transferring Cannabis

plants from one container to another, one should be very cautious to keep the

soil-root

interface in tact. Disturbance of this interface diminishes the capability

for the plant to

take up its needed supplies for metabolism.

Polymer

lipids

proteins

carbohydrates

nucleic acids

Monomer(s)

fatty acids, glycerol

amino acids

monosaccharide

nucleotide bases, sugar,

phosphate

Example

cell membrane

THCA synthase

glucose

DNA, RNA

Macromolecules of life divided into their monomer subunits and

representative examples.

Metabolism includes both breaking down materials (catabolism) and building

materials

(anabolism). These processes are needed to construct new cells and cellular

structures

such as organelles (e.g., mitochondria and chloroplasts). Cellular structures

are either

12

made up of lipids, proteins, carbohydrates, or nucleic acids. Each of these

four large

molecules necessary for life is found in every living organism and vary in

their

arrangement and concentration. Each is also a polymer (multiple units)

composed of

smaller monomers (single units).

Light gives plants the ability to make their own food through the process of

photosynthesis. The chromophore (absorbing pigment) in plant chloroplasts

that captures

light is chlorophyll. This molecule absorbs strongly at the red and blue ends

of the visible

light spectrum. This spectrum represents part of a larger electromagnetic

spectrum. Since

energy travels in waves, this spectrum is divided according to its

wavelength. Visible

light ranges from -400-700 nanometers (nm), where one nanometer is a

billionth of a

meter. That's pretty damn tiny! Plants have a difficult time using

wavelengths in the

middle of the visible spectrum (~500nm), which is reflected and seen by most

humans as

the color green.

Perhaps the most important and familiar structure in the Cannabis plant is

the nucleus.

This is the organelle that houses the DNA. Cannabis has twenty chromosomes

and is

diploid. This means that it has two copies of each chromosome. By comparison,

humans

have 23 chromosomes and are diploid. Genes along the DNA strand code for the

proteins

that direct cellular development, flower development, etc. This is discussed

in more detail

later, since it deserves its own chapter.

All of these botanical features and how they relate to Cannabis have not been

described

in vain. They serve as a platform for the remainder of this book and

facilitate a robust

background to host extending ideas on the genetic modification of Cannabis.

13

2. Plant Biotechnology

In many ways plant biotechnology first began when humans initiated

cultivating and

genetically crossing varieties of plant species to intentionally produce

desired results. For

example, imagine a human ten thousand years ago collecting the pollen from a

wheat

plant that was slightly taller then the other wheat plants then dusting this

onto the female

flowers of other wheat plants. Over many years of collecting and dusting

pollen from the

tall offspring and putting this pollen onto more wheat plants, most of the

wheat plants

would be tall.

Nearly every crop food eaten today, including tomatoes, rice, potatoes, corn,

barley,

apples, etc., all began as very strange looking varieties of undomesticated

plants

thousands of years ago. Only when people recognized that there were patterns

of

inheritance did they begin spreading select genes to other plants. Although

the primitive

state (short height and small fruit size) of food crops offered our ancestors

some gain in

nutrition, the capability to produce more food (taller height and large fruit

size) has been

constantly pushed to the limits. Recent gains in realizing the genetic

components of crop

species has led to a broader understanding of how foods have been improved

over time

(Vaughan et al., 2007).

In fact most scientists today have optimistic views on food production. With

biotechnology there are few limits as to what sort of food can be grown. This

means the

boundaries of plant genetic manipulation are still expanding. Biotechnology

today is what

applying pollen onto flowers was for humans thousands of years ago. It has

allowed our

species to gain larger yields of food on smaller areas of land.

The same basic ideas and patterns of inheritance of crop production have been

applied to

marijuana plants. It logically follows that biotechnology should also be

applied to

Cannabis crops. There are many benefits that biotechnology can offer Cannabis

growers,

whether they are indoor or outdoor growers. The details of how this can be

accomplished

are fairly basic but require a fundamental understanding of plant

biotechnology to at least

have an intelligent conversation or carry out a reliable experiment. As

stated by Albert

Einstein, imagination can be more powerful than knowledge. However

imagination is

cultivated more easily through concepts of knowledge, making both imagination

and

knowledge necessary for maximum progress.

One of the most fundamental components of plant biotechnology is the ability

to

introduce foreign genes. Most high school students have seen the image of a

glowing

tobacco (Nicotiana tobaccum) plant. This marked an important event in plant

biotechnology in that it stimulated public interest and created a deeper

curiosity for plant

transgenics. Prior to fluorescing tobacco, people in the United States were

introduced to

the Flavr Savr tomato, one of the first genetically modified foods introduced

to

consumers (Marks, 2007). Boasted as having a longer shelf life in grocery

stores, the

Flavr Savr tomato had little taste and left little to savor. This transgenic

tomato remained

a poor seller on the market and so was pulled from shelves and discontinued.

14

Among the agricultural industry, perhaps the most popularized gene that has

been

introduced to plants is the gene that produces an insect toxin (Romeis et

al., 2006). The

toxin, called Bt, is only toxic to certain insects and has no negative

effects on humans.

Insects and humans have different proteins lining their digestive tracts. It

was one of

these proteins to which the Bt toxin could bind to in insects. Humans lack

this protein in

their digestive tract, and thus the toxin cannot bind and disrupt metabolism

the way it

does in insects. This was the main reason it was allowed into corn plants.

Researchers

subsequently found that insects avoided eating transgenic crop plants with

the Bt gene, so

the plants were able to be grown without pesticide or stress from insect

infestations. This

provided a huge savings to farmers who were commonly spraying their fields

with

expensive pesticides. It also reduced the amount of chemicals going into the

croplands.

In another example, quite different than the Bt gene, researchers have put

genes into

plants that made them resistant to pesticides, which also grabbed the

attention of the

agriculture industry. To give a specific example, the herbicide called

glyphosate

(Roundup) kills plants but does not harm animals. Roundup kills plants by

inhibiting a

metabolic pathway that only plants have (the pathway to make aromatic amino

acids). So

when scientists put the Roundup resistance gene into crop plants, they gave

it resistance

to the herbicide. When farmers sprayed with the Roundup pesticide, they did

not kill their

crop plants. Instead, all other plants that did not have the Roundup

resistance gene died,

including petulant weeds and unwanted invasive plants. The result was a happy

crop

plant with no weedy competitors. This biotechnology advancement was so

successful that

soybean and corn with Roundup resistance gene are now the most abundant

transgenic

food crops grown in the US.

The US has been quick to embrace transgenic crops. Other countries have not

been so

quick. At least part of this is due to the work of environmental groups such

as Green

Peace, who is strongly opposed to GM (genetically modified) crops. Groups

such as

Green Peace argue that some of these genes that are put into the plants can

behave in

unpredictable ways. For example, suppose a person were to plant transgenic

corn that had

the Roundup gene. Since all corn releases pollen during its flowering stage,

that pollen

carries the gene for Roundup resistance. If the pollen with this gene were to

then become

incorporated into a weedy or invasive plant species, there may be some

concern. Imagine

a farmer that uses Roundup corn and then when they go to spray to kill the

weeds, they

find that the weeds will not die; they have acquired the resistance to the

pesticide. It has

been argued that the accidental incorporation of the resistance gene may

produce such

"super weeds".

Groups such as Green Peace often give both of these scenarios; transgenic Bt

crops

killing beneficial insects or herbicide resistance genes being incorporated

into other

plants to make "superweeds". The process of genes migrating from genetically

modified

plants into other non-genetically modified plants is known as gene pollution.

Certainly

genetic pollution of the environment should be a concern. The emergence of

transgenic

weeds that are resistant to an herbicide is not desirable by either the

farmers or the

corporations selling the herbicides. In fact, preventing weedy plants from

acquiring the

pesticide resistance genes is a major goal of agricultural biotechnology

industries. This is

15

because they have a vested interest in assuring that their pesticide

continues to retain its

effectiveness.

Arguably, genetically modified crops need more research in order to

understand their

complete role and influence on the natural environment. However, many

countries have

moved ahead, confident that genetically modified crops are the best way to

obtain food

and other raw materials such as cotton. Based on current statistics the

United States is by

far the largest producer of transgenic crops (James, 2005). Argentina,

Brazil, Paraguay,

and Canada are the next largest producers. Cotton is the most common

transgenic non-

food crop while soybean is the largest transgenic food crop (Stewart, 2008).

The great majority of plant genetic research and information on plant

biotechnology in

the last few decades was aided with a small mustard plant called Arabidopsis

thaliana.

Many researchers like Arabidopsis because it offers a short life cycle of

about six weeks

from seed to maturity, is easy to grow, is small and therefore easy to work

with, and has a

small genome (-157 Mbp) (Johnston et al., 2005). An organism's genome is the

complete

set of genes, which all reside on the chromosomes, that it posses.

Arabidopsis has served

as a model organism quite well, so well in fact, plant researchers around the

world use it

for genetic, developmental, and evolutionary studies.

The model plant Arabidopsis thaliana. This small mustard plant is used

extensively in genetic studies for understanding traits of the plant kingdom.

There has been a wealth of information from this little mustard plant.

Fortunately, much

that has been learned from Arabidopsis can be applied to Cannabis. There are

many

genes that have been identified in Arabidopsis that are now waiting to be

found in

16

Cannabis (see Appendix A). Once these genes are found in Cannabis (called

homologous

genes), they can be manipulated and induced to have a higher expression rate

or knocked

out of the plant altogether. The result will be a plant of almost any form,

with any trait

desirable. These genes are more exciting than the genes that stop insect

damage or

provide herbicide resistance. In fact, the most difficult part of genetically

modifying

Cannabis is going to be deciding on which gene to manipulate! The process of

creating a

transgenic plant can often be tedious and time consuming. Fortunately, there

only needs

to be one person to make transgenic Cannabis plants and then the seeds can be

shared

with others. Regardless, it is important to understand the process of making

a transgenic

Cannabis plant.

17

3. Plant Tissue Culture

Tissue culture is a method where living tissue is sustained apart from an

entire organism.

It allows for growing organs (i.e. roots) or cell masses in vitro, which

literally means, "in

glass". This requires the tissues be placed on a special growth media that

contains all the

necessary ions and sugars to sustain its growth and energy needs. This is

called plant

tissue culture. Fortunately for plant biotechnologists, plant tissues grown

on this type of

media are also very susceptible to taking up foreign DNA. This is how

transgenic plants

are often created.

Plant tissue culture has emerged as a way to genetically modify crop plants;

hence many

techniques are available for specific species (Smith, 2008). There are three

well-

understood methods for delivering a foreign gene into a plant. These are the

floral dip,

the gene gun, and the bacteria, Agrobacterium tumefaciens. Each has

advantages and

disadvantages and varies in use among institutions and researchers.

The floral dip is the easiest way to insert a foreign gene. When Arabidopsis

is flowering,

it can be dipped upside down into a liquid broth culture of Agrobacterium.

Agrobacterium is a special type of bacteria that is able to transfer its DNA

to the plant

(discussed more later). This means that some of the Arabidopsis flowers will

be infected

with the Agrobacterium DNA. The floral dip is most commonly performed only

with

Arabidopsis. Limited information exists on its efficacy on other plants.

Considering the

size that Cannabis can become, this method may not be desirable. However,

empirical

research is needed before this claim can be justified.

The second mode of introducing genes into plants is through the use of a gene

gun. This

is a device that shoots microscopic metallic beads that are covered in a

gene. The metal

beads are shot at a high enough velocity into a living plant so that some of

the beads

penetrate the plant cell nucleus and the genes on the beads are incorporated

into the plant

genome. The device costs a fortune (~15,000USD) and is therefore not used by

the

majority of labs.

Perhaps the most pragmatic and cost-effective method of introducing a gene

circles

around plant tissue culture. This method of plant transformation has proven

to be quite

useful for many different species of plants. Although it takes many months

from the start

tissue culture to the final product of a genetically modified plant, the

method is very

affordable and most labs can accommodate the technical requirements. This

method is

also the oldest of the three gene delivery methods, having its beginnings in

the early

1900's in Germany from work by Heldebrant (Thorpe, 2007).

Successful transfer of a foreign gene using plant tissue culture depends on a

bacterium

known as Agrobacterium. The way Agrobacterium works is described in the next

chapter

so will not be discussed in detail here. For now, it is important to know

some plant

physiology pertaining to plant tissue culture.

18

Plants have a meristematic region where cell division is actively occurring.

The meristem

is similar to the stem cells of humans in that they can divide many times.

This tissue also

has what is called totipotency, which is the ability to divide and develop

into any plant

cell type. Tissue culture takes advantage of meristems by allowing the

researcher to grow

a piece of stem on sterile growth media, which supports the meristematic

tissue's

nutritional and energy needs.

Plant meristems play an important role in not only biotechnology but also

plant

biology. These areas within plant tissues are commonly found on the tips or

stems

and roots. Perhaps the most familiar type of meristem is aptly called the

apical

meristem. Apical simply refers to the location of the tissue; it is found on

the plant's

apex (or ends). Dividing cells within the root apical meristem are what allow

the

plant root to grow farther down into the soil. Similarly, the shoot apical

meristem

allows for vertical growth, or tallness, of the plant. When Cannabis

elongates its

roots and shoots the apical meristems act as guiding forces.

Another meristematic region is known as the lateral meristem. While they are

similar in harboring actively dividing cells, lateral meristems differ from

apical

meristems by providing lateral growth. The cell division is occurring just

under the

plant's epidermal tissues along stems and branches, hence it increases the

thickness

of these parts. For instance, lateral meristems in Cannabis give the plant

sturdiness

and ability to hold large flowers later in its life cycle. Cannabis growers

who have

selected for incredibly large buds often desire thick lateral meristems in

order to

keep their plants from falling over.

Meristems are hormonally controlled by auxin. Therefore, changing the plants

auxin

levels involved in signaling affects its meristematic regions. The auxin acts

locally on

the apical meristem by inducing cell division but when it travels to other

bud

regions, the auxin inhibits them from growing. In the realm of plant

physiology this

mechanism is called apical dominance, and is the main reason that plants

often grow

taller than wide. If a person was to remove the dominant apical meristem (the

tip of

the longest part of the main branch), lateral buds would be allowed to

develop and

the plant would take on a bushy appearance.

The lateral meristem is perhaps the most important meristem used in to plant

biotechnology. Again, this is because the lateral meristem that contains the

totipotent

actively dividing cells. It is these cells that are allowed to grow on plant

tissue culture

Petri plates.

19

Two types of culture methods for growing plant tissue in vitro, a traditional

Petri dish on the left and a Magenta culture box on the right. The Magenta

box

is like a tall Petri dish that maintains sterile conditions and allows

vertical

expansion of a transformed plant.

Just prior to initiating tissue culture, a plant is diced along its stem and

the pieces, called

explants, are placed onto tissue media. Conditions must remain sterile so

that the stem

pieces are not contaminated with microscopic dust particles that often

contain fungal

spores and bacteria. If improper technique is used and sterility is not

achieved, fungal or

bacterial contamination will be obvious in several days to a few weeks.

Because sterility of tissue culture is of the upmost importance, the details

of the technique

need to be described. First, it is highly recommended that the plant stem be

young (4-5

weeks). The Cannabis seedling should also be grown indoors as the outdoor air

is filled

with spores and bacteria that will easily cling to the surface of the cut

plant. If this

happens contamination will be noticeable a few days after the plant has been

diced and

placed onto culture media.

Collection of the stem should be carried out with a few simple tools. A small

tweezers is

used to clasp the plant at the base. Similarly, one might prefer to gently

pinch the top of

the plant to keep it steady. A scissors is used to snip the young plant at

the base. Any

leaves that have developed are trimmed off. Careful attention is given so

that at no time

will the stem come into contact with the soil or any surface. The final

product should be a

20

slender, and preferably straight Cannabis stem. This is placed in a sterile

tube and

capped. After capping the tube the stem is ready to be lightly washed with a

mild

detergent and 70% alcohol solution. These solutions can be directly added to

the tube.

Washing is just as crucial as cutting and trimming the stem. If the wash

steps are too

long, the plant cells will die. If the washes are too short, any microbial

contaminants will

remain and fungus or bacteria will overrun the growth media. Therefore, a

delicate

balance must be achieved to successfully wash the stem without killing the

plant cells.

Generally, an initial wash with 70% alcohol (e.g., 3mL water and 7mL 100%

alcohol for

a total of lOmL) is used with a drop of tween20, a mild detergent. The

detergent is not

always necessary, but it does aid in working the alcohol into the grooves on

the outside of

the stem. The tube is capped and shaken vigorously and allowed to sit at room

temperature for 5 minutes. The tube is washed with sterile water and a second

wash is

implemented in the same fashion as the first wash but without the detergent.

A final wash

with a 1% bleach solution (lmL bleach and 99mL water, using only lOmL of

this) is

preferred in some tissue culture methods, however when dealing with stems

obtained

from indoor-grown plants this may be superfluous.

Sterile water is used for a series of no more than ten rinses to guarantee

that the alcohol

and bleach have been completely washed from the stem. The closed tube is

placed in a

sterile laminar flow hood. If you do not have access to a flow hood, you can

make a

sterile hood-like environment. I have seen these in a few of my friends'

houses who do

experiments at home. However, biotechnology at home is its own endeavor and

will not

be discussed in this book. Tissue culture media should be prepared ahead of

time so the

stem can be carefully removed from the sterile tube, diced and placed onto

the media.

21

A laminar flow hood is used for working in sterile conditions. Sterile air is

moved down from the top and out of the hood on the sides to avoid

contamination by unwanted fungal and bacterial spores.

Preparing the growth media for Cannabis is not as difficult as one may think.

Many

companies sell a powder form of mixed micro and macronutrients, which is

mixed with

water and sterilized.

There are two types of media commonly used in plant tissue culture. The first

is called

callus media. This is because after placing Cannabis meristematic tissue on

it, the

appearance takes on tissue formed over a wound. Because callus media is the

first media

used in a plant tissue culture experiment and it forces the plant tissue to

form a callus, the

media is aptly named callus initiation media.

The second type of media in plant tissue culture is used at a later stage in

the process.

This growth media is called MS media. In the 1970's two researchers whose

last names

were Murashige and Skoog developed this nutrient media (Murashige and Skoog,

1962).

Skoog was an undergraduate working in Dr. Murashige' s lab when he discovered

this

media. It is now called MS media in their honor. Both of these media types

will be

explained in greater detail. For now, concern will be given to proper

preparation of the

media.

22

This table shows the ingredients in MS media, which is needed for growing the

plant tissue from a non-differentiating callus into a callus with roots.

Name of Chemical

Molecular Formula/Description

ammonium nitrate

NH4NO3

calcium chloride

CaCl 2

magnesium sulfate

MgS0 4

manganese sulfate

MgS0 4

Potassium phosphate

KH 2 P0 4

ferrous sulfate

FeS0 4

zinc sulfate

ZnS0 4

potassium nitrate

KNO3

potassium iodide

KI

cupric sulfate

CuS0 4

boric acid'

H3BO3

cobalt chloride

C0CI2

sodium molybdate

Na 2 Mo0 4

niacin

a coenzyme

pyridoxine (vitamin B6)

a coenzyme

ethylenediamine tetra-acetic acid

acts as a metal chelator

inositol

a sugar

thiamine

a coenzyme

glycine

an amino acid

indole acetic acid (IAA)

root hormone

kinetin

shoot hormone

sucrose

a common sugar

agar

solidifies media

23

Callus initiation media and MS media can be ordered from most any web

resource that

deals with biological supplies. As in all other growth media, the contents

are shipped in a

dry state, so they must be weighed and mixed with the appropriate amount of

deionized

water. Deionized water is important to use because chlorine and other ions in

tap water

may interfere with the growth of the explants. After measuring the proper

amount of

deionized water, the contents of the media mixture (water and dry media

powder) are

stirred and autoclaved.

The autoclave is an oven-like chamber that reaches high pressure and

temperatures. The

highest temperature most autoclaves reach is 121°C/250°F. Such high

temperatures are

needed because boiling sometimes does not kills bacterial endospores, a type

of survival

state used by some bacteria. Prior to autoclaving, agar is also added to the

media mixture.

Agar acts as a solidifying agent when the media cools. This too is a powder

and is

weighed, usually adding 15 grams per Liter of water. Upon adding and mixing

all

ingredients, the opening of the flask or glass container must be covered with

aluminum

foil.

24

The autoclave is a large oven-like chamber, which is used to sterilize lab

equipment.

After the mixture of water, plant nutrients and agar is autoclaved it is

allowed to cool

inside a laminar flow hood. The laminar flow hood creates a negative pressure

that aids in

25

keeping the work area sterile. Above the working area, sterile air is blown

down. The

flow of air is aided by perforations in the back of the hood and lower front

part of the

hood opening that pull on the flowing air.

It is important to remember that the laminar flow hood is the only safe place

for carrying

out any work that must be kept free from contamination. Petri dishes are

often purchased

in bulk, so that media can be made on demand and MS media plates can be used

when

needed. These Petri dishes are disposable, however reusable glass Petri

dishes are

available.

Some of the basic materials needed to begin Cannabis transformation; 1)

Erlenmeyer flask, 2) graduated cylinder, 3) MS and callus media, 4) agar, 5)

parafilm, 6) Petri dishes, 7) scale, 8) tweezers and small scissors, 9)

antibiotic.

Pouring plates is the method of removing the Petri dishes from a clear

plastic sleeve,

making stacks of 4-5 plates (i.e., Petri dishes), and carefully opening them

one at a time

(starting from the bottom of the stack) while pouring molten media into each

plate. It is

one of the first techniques a new lab student learns. Only about 10-20mL of

media is

needed for each plate, which is just more than enough to cover the bottom

surface of the

plate. Callus media is used in the first part of the experiment, however

these techniques

apply to MS media (used later in tissue culture) as well.

26

The media used to culture calluses of Cannabis has yet to be published in any

scientific journal. However, a recipe that has worked well for many plants is

carrot

callus initiation media. Similar media can also be used for shoot initiation,

which is

called carrot shoot development media. Both of these can be ordered online

from

Carolina Biological Supply (see appendix B). This company provides premixed

packets of dry media, which can be poured, along with dry agar, into a Liter

of water.

After autoclaving the hot liquid media is poured into the Petri dishes, as

just

described.

The plates are then carefully lifted one at a time from the stack and laid

out inside the

laminar flow hood in a grid-like fashion. As they are placed onto the surface

of the flow

hood, the lids are slightly tipped to the side to allow the media to cool

faster and excess

moisture to escape. During placement and movement of the plates containing

molten

media it is important to not splash media onto the inside lid of the plate.

If this happens, it

increases the chance for contamination when working with the plates at a

later time.

When the plates have cooled the lids are tipped correctly back into place and

they are

restacked into one column. The sleeve is placed back on top of them and they

are covered

and the entire contents can be inverted and are kept refrigerated at

4°C/39°F. The entire

process of making media and pouring plates takes approximately 2 hours,

although the

time is greatly reduced with practice.

Which brings us back to the sterile tube with the Cannabis stem. The tissue

culture plates

with the media should be made the day before the stem clipping and washing

steps. Prior

to preparing the stem, the sterile plates should be removed from the

refrigerator and

placed inside the flow hood. Inside the laminar flow hood there should also

be a small

sterile scissors and tweezers. These should both be autoclaved, usually

wrapped in

aluminum foil, to guarantee their sterility, and then opened only in the flow

hood. In fact,

these items can be autoclaved along with the media.

There should also be an alcohol dish and a flame. Before use, the ends of the

scissors and

tweezers are dipped in the alcohol after which the alcohol is burned off.

Keeping them

from touching any part of the hood, the stem is removed with the tweezers and

held

steadily over an uncovered Petri dish containing tissue media. Small sections

(l-2mm) of

the plant are clipped with the scissors and allowed to fall onto the callus

media. Often,

latex gloves are used as a precaution to allowing skin cells or bacteria to

fall onto the

plate.

When 5-15 pieces of stem have fallen onto the plate, the sterile tweezers can

be used to

manipulate and move the pieces of Cannabis stem. They should be placed

equidistant

from one another and gently pushed down to ensure complete contact with the

media.

The lid can then be placed back onto the Petri dish. Parafilm, a stretchy

plastic film, is

wrapped along the edge of the plate and its lid. This helps in retaining

moisture and

keeping the contents sterile.

27

The tissue cultures are put away from any disturbance and are kept at room

temperature

(22°C/72°F). They do not need light. After a few weeks the bits of Cannabis

stem will

slowly start to change into an amorphous aggregate of totipotent cells. This

is called a

tissue callus and contains the genetic components of Cannabis, but has the

distinct

quality of being able to develop into any plant organ (totipotency).

Plants, due to their meristematic regions, are unlike animals, which have

stem cells, in

that they can be asexually propagated. Using conventional techniques in the

laboratory, a

cat's ear could not be grown into a new cat because there is an absence of

meristematic

cells. Additionally, complications would arise due to the nutrient and energy

demands of

the cat ear. Plant tissue culture is unique in that it allows rapid

production of clones of a

desired species with minimal demands required for the growth media.

When the calluses have grown into masses that lack resemblance to the

original bits of

stem, they can be inoculated with a few drops of the infectious plant

bacterium,

Agrobacterium tumefaciencs .

28

4. Agrobacterium tumefaciens

Much progress has been gained in research through the fundamental

understanding that

microbes (bacteria and fungi) are ubiquitous. Bacterial and fungal species

are in the air,

water, soil, on all types of surfaces, and can thrive in the human body. Each

species has

evolved the molecular machinery to sustain their energy and nutrient needs.

For these

reasons they have often been looked at to provide potentially beneficial

industrial

applications (Pontes et al., 2007).

In order to reproduce, bacteria divide in a process called binary fission.

This creates two

identical offspring, sometimes in as little time as twenty minutes. Fungal

spores often

take much longer than this to reproduce. Regardless, the power of microbes

should be

respected. Although they are often only a few micrometers in length, they

have the power

to overtake a body with a weakened immune system. They have the ability to

feed on raw

sewage with glee and a small percentage even smile in the face of

antibiotics. It should

not be a surprise, then, that bacteria have found a way to colonize and

infect plant tissue.

If the outer epidermal tissue is pierced and the delicate tissue of the plant

is exposed to

the outside air, bacterial infection might result. This is often seen on the

crown of the

plant, which is the base where the trunk meets the soil. The crown is a

likely point of

entry because it is dividing and growing to support the weight of the tree,

therefore the

outer layers of tissue are prone to splitting. Among the billions of bacteria

that have been

discovered and described is a species known as Agrobacterium tumefaciencs .

This bacterium has evolved the molecular machinery to infect plants in a very

interesting

way. It lives in the rhizosphere, which is the area directly around plant

roots, and enters

and infects the plant when an opportunity arises. Interesting research has

shown that the

relationship between Agrobacterium and some plants involves complex signaling

events

(Yaun et al., 2008). The result of this cross talk is what most gardeners

call crown root

gall but a plant biotechnologist thinks of as an expected and welcomed tool

of

biotechnology.

29

The base of a tree trunk with arrows pointing to sites of infection by

Agrobacterium shows the characteristic knobs (tumors).

Like other bacteria, Agrobacterium has a genome that contains nearly all its

genes needed

for routine metabolism and growth. What makes this bacterium unique is that

it has an

extra chromosomal piece of DNA about 200 thousand bases (kb) in size. This

extra

chromosomal piece is technically referred to as a plasmid, and can come in

various

lengths depending on the bacterial species. It is also important to note that

plasmids are

often circular in shape. Interestingly, a part of the plasmid within

Agrobacterium can be

transferred to the genome of a plant, thereby passing bacterial genes to a

"higher"

organism.

30

Plasmid

ari Region

Gene of your choice

Kan (kanamycin resistance gene)

20D h 00l> base pairs

TDNA f-23kb)

Diagram of an Agrobacterium plasmid (not to scale).

The ori region, shown on the plasmid above, stands for the origin of

replication. This is

the sequence on the DNA that has a specific base sequence that allows for an

enzyme to

bind and begin copying the plasmid. Remember, the plasmid DNA must be copied

before

a cell divides. Therefore, the enzyme that polymerizes a new plasmid must be

able to find

this ori region. The enzyme is (not surprisingly) called DNA polymerase

because it is

polymerizes DNA.

Most importantly to Cannabis biotechnology, plasmids can also take up new

pieces of

DNA. Consider any gene and call it your gene of choice (or if you can't think

of one, see

Appendix A). This foreign gene can be first transferred to the plasmid, the

plasmid

transferred to Agrobacterium, then the Agrobacterium transferred to a plant

cell. This is

partly due to that when at the right size and stage, Cannabis callus cultures

can be

intentionally infected with Agrobacterium containing the plasmid that

contains your gene

of choice. Whew, now that's a mouth full! Now that your imagination is

blossoming with

potential genes to insert, it is important to know some details on these

mechanisms. The

31

remainder of this book deals with inserting genes into plasmids, infection of

calluses with

Agrobacterium, gene delivery (transformation), and maturing the callus

cultures into an

adult transgenic plant.

There are many different strains of Agrobacterium that are available for

purchase to

infect plant calluses. Different strains have various positive and negative

aspects, such as

the ability to only infect a certain species or type of plant. Many of these

strains can be

ordered directly from Internet companies (see Appendix B). Some strains are

designed

with part of the transferred DNA (T-DNA), which is the DNA segment that gets

transferred to the plant. For example, the T-DNA might contain the gene that

encodes for

a protein with the ability to fluoresce visible light. However, many other

genes can also

be chosen for transferring to the Cannabis plant genome. Additionally, many

other genes

are necessarily transferred to the calluses. For instance, notice that the

Agrobacterium

plasmid has a small gene coding for an enzyme that breaks down the antibiotic

kanamycin. This will become very important later in the transformation

process.

The transferred DNA (T-DNA) also contains sequences of nucleotides that code

for

enzymes that make two important components that the bacterium will need to

survive in

the plant cell (McCullen and Binns, 2006). The first set of genes is for

enzymes to make

plant growth hormones, which confuse the plant into dividing and growing its

own tissue.

This ultimately results in a crown gall, a knobby protrusion that provides a

nice home for

the Agrobacterium. This is fascinating because what is happening is that the

Agrobacterium hijacks control of the plant cell and dictates to the plant

cells on how to

grow.

The second set of enzymes on the T-DNA is for enzymes that synthesize opines,

rare

amino acids that Agrobacterium needs in order to grow. Opines are so unusual

that plants

do not have enzymes that recognize them and therefore, cannot use them. Only

the

bacteria can use them, which provides an advantage. The total size of the T-

DNA

transferred to the plant is about 23kb.

In addition, the Agrobacterium has regions on the plasmid besides the T-DNA

region.

There is a virulence region that is ~40kb and codes for proteins that help

guide the T-

DNA into the nucleus of the plant cell. There is also what is called an

origin of

replication, or ori region, which simply allows for plasmid replication.

Although there are

many more regions of the Agrobacterium plasmid, we will concern ourselves

with the T-

DNA segment, since that is of the upmost concern for transforming Cannabis.

After infecting the Cannabis callus with Agrobacterium, the tissue is allowed

to remain

in its Petri dish for two days. This is called co-cultivation and gives the

Agrobacterium

ample time to infect the plant cells. It is during this time that the T-DNA

is inserted into

the plant genome.

When the two days of co-cultivation have passed, the callus tissue is

transferred to new

callus growth media. Again, working in the flow hood and sterile conditions

are

necessary to keep microbes from landing on the growth media. The new growth

media

32

contains two antibiotics. One is to kill the Agrobacterium. This is important

because

letting the Agrobacterium continue its growth on the callus will eventual

result in plant

cell death. Since the T-DNA has had time to be incorporated into the Cannabis

genome,

the death of Agrobacterium is of no concern. A common antibiotic used is

timentin,

which kills the Agrobacterium, but has no effect on plant cells.

The antibiotics in the media are not only present to kill Agrobacterium, but

also to select

for transgenic plants. Part of the T-DNA passed to the plant genome confers

resistance to

kanamycin and if a plant cell has taken up the T-DNA it will grow on media

that has had

antibiotic added. Antibiotics are added to warm media after removing the

media from the

autoclave. The temperature of the molten growth media should not be more than

55°C/13 1°F so as not to destroy the molecular structure of the antibiotic.

Plant cells do not tolerate kanamycin and therefore it kills them. Only

transformed plant

cells containing the kanamycin resistance gene can survive on the kanamycin

antibiotic

media. It is the kanamycin that kills any non-transformed callus cells and

allows for only

those calluses that have been genetically modified to survive. This helps in

selecting for

only plant calluses that have been genetically modified for subsequent

manipulation.

The calluses at this point in the transformation process are very brittle and

resemble

small, rough-shaped pieces of soap. When squeezing them with a tweezers they

will

easily break into multiple pieces. Sometimes this is desired; many pieces of

callus will

lead to many plants. However, many plants may not be necessary, so it is up

to the plant

biotechnologist to decide how to distribute the calluses onto the new media.

33

Calluses growing on Petri dish with callus media with kanamycin and timentin

added. In this photo, UV light was shinned to induce fluorescence in order to

confirm that the GFP gene was successfully transferred.

To make sure all the Agrobacterium have died and only transformed plant cells

remain,

the calluses are transferred every 7-14 days to a new Petri dish with callus

media and the

two antibiotics (kanamycin and timentin).

After 4-5 weeks of this process the calluses can be transferred for a final

time. They are

moved once again using sterile technique. This time each callus is placed on

media that

has plant hormones imbedded in it in addition to the antibiotics. The

hormones will tell

the calluses that it is time to differentiate into specific cells (leaves,

roots, shoots, etc.).

Instead of a Petri dish a taller container with MS media (with hormones) can

be used.

This taller container, called a Magenta box, allows for more area that the

roots and shoots

will need to grow.

34

Petri dish with fungal contamination. The arrow is pointing to the advancing

edge of the fungal colony, which has already surrounded larger calluses to

the

lower left area of the dish.

To help the calluses develop shoots and roots, a cytokinin (e.g., zeatin) is

present to

induce shoot formation while an auxin (e.g., indole acetic acid) is present

to induce root

development. These can be used in different ratios, depending on what is

desired. For

example, a high auxin to cytokinin ratio favors shoot formation.

Choosing the correct auxin: cytokinin ratio is for the biotechnologists to

decide and

depends on the species one is using in the experiment. In some tissue culture

powders,

hormones are added, allaying any concentration or ratio concerns that the

plant

biotechnologist may have. Manipulating plant hormones within the tissue media

is the

underlying reason that a callus changes from being totipotent to initiating

organogenesis,

or shoot and root formation. The Cannabis tissue cultures are placed under a

suitable

grow light in order to allow the transformed calluses to begin manufacturing

chloroplasts

used in photosynthesis.

In as little time as a month small points and protrusions will be seen on the

Cannabis

calluses. These are the young shoots and roots beginning to emerge. The

calluses are

allowed to continue growing on the MS media until their shoots and roots are

at a healthy

size. They will still be very delicate at this point. Just prior to removing

the young

genetically modified plants from the Petri dish or Magenta box, they need to

be exposed

to the external air. To do this, the lid of the container is opened and air

is allowed to

35

circulate through passive diffusion. This process, which lasts about two

days, also helps

in hardening the plants in preparation for much lower humidity levels outside

of the Petri

dish or Magenta box.

Photograph of calluses growing on root initiation media with arrows pointing

to developing roots. Some chlorophyll (green) pigmentation is also present.

The small root hairs, which increase surface area for optimal water uptake,

are also visible. The inset photo is an enlargement of the rooting callus.

It is important to consider that once the developing plants are moved to soil

their organs

will have to sustain a young plant. Care should also be taken to minimize

exposure of the

young plants to pests or harsh environmental conditions such as temperature

fluxuations.

Therefore, before transferring the developing plants consider where they will

be grown.

An indoor growth chamber with adequate light is necessary in nearly all

situations of

plant transformation. This provides a steady, equilibrated environment with

an adequate

light source. Most plant growth chambers allow for temperature, light and

sometimes

even CO2 control.

36

A Cannabis callus that has been genetically modified with the GFP gene is

shown

growing in a Magenta box. When its roots, shoot and leaves have further

developed,

it can be placed in soil and moved to a growth chamber.

If moving the transformed Cannabis to a greenhouse or an outdoor area, they

need time

to slowly adjust. Small increases of time in exposure to less favorable

conditions are

made gradually over several weeks. This is extra work and lends itself to

possible plant

death, wasting many months of hard work. Therefore using a growth chamber

provides

the best chance for keeping the transgenic Cannabis alive.

37

A refrigerator-sized growth chamber used for growing transformed plants

with delicate new roots and shoots.

38

A smaller growth chamber, which performs equally well compared to that of

the larger refrigerator-sized chamber, can also be used for optimizing tissue

culture conditions.

39

Obtain Cannabis stem and callus media

/work is flow hood)

Sterilize stem

70% Ethanol, -lOmin

Dice and place on Petri dish

[-3 months

Infect withAffrotacterium

days, ca -cultivation

on selective (antibiotic) media

ielect for transformed callu ses

Transfer calluses to shoot/root initiation media

-3 months

Transfer to soil

Grow to flowering sta^e

Further breeding

ilizt

¥

ace

*■■

lAgr

ve [ "

hoot

i-

sfci

V

Flow chart of Cannabis tissue culture method progressing from the original

stem of the Cannabis plant to further breeding. Each step shown here is often

slightly modified according to the type of plant species one is working with.

40

5. The GFP Leaf

The simplest Cannabis transformation involves using Agrobacterium that has

the green

fluorescent protein (GFP) gene in its T-DNA region. The GFP gene codes for a

protein

that fluoresces ~500nm (green) wavelengths of light when exposed to blue

light. In

respect to its size and relation to other protein molecules it is a

relatively modest protein,

composed of only 238 amino acids. Agrobacterium that contains this gene (and

an array

of other genes) can be readily purchased (see Appendix B).

Similar to the cytochrome discussed earlier, GFP contains a chromophore. The

chromophore has electrons that are excited by the blue light. Upon exposure

to blue light

the electrons in the chromophore are elevated to a higher energy state. As

they lose

excitation they release energy in the form of visible light, which is the

cause of the

fluorescence. This brings us back to the concept of electromagnetic

radiation, discussed

in the opening chapter. Visible light is a small part of a spectrum of

different frequencies

of energy. High-energy waves have a higher frequency and a smaller

wavelength. Low

energy waves of the spectrum have less energy and a lower frequency.

Gamma rays and X-rays are on the high-energy end of the spectrum while radio

waves

are on the opposite end and have less energy. Visible light is somewhere in

the middle of

these two extremes. At just a higher frequency than visible light is

ultraviolet light, which

damages cells due to its high-energy nature. The colors on the visible part

of the spectrum

can be divided into specific frequencies and have distinct wavelengths.

Violet, next to

ultraviolet, is a higher frequency than red, while green is in between these

two. An easy

way to remember the order of light and its frequencies is with the pneumonic,

ROY G

BIV (red, orange, yellow, green, blue, indigo, and violet).

From knowing the colors and their associated wavelengths, understanding

fluorescence is

straightforward. When something fluoresces it emits a lower energy color than

the

incident, or incoming, wavelength that first strikes it. For example, shining

a blue light on

something with fluorescent properties results in a lower energy wavelength of

light being

emitted, such as green. The fluorescence itself arises due to an electron

being

momentarily excited to a higher energy state and then falling back to a lower

energy

state. The transition of energy states results in a particle of light (a

photon) being

released. Humans see this as fluorescence.

The green fluorescent protein gene was first isolated from a jellyfish in the

1990's. It has

since found many uses in plant biotechnology (Sheen et al., 1995; Davis and

Vierstra,

1998). Its main use is to act as a reporter gene. This means that when

performing a plant

transformation experiment, the GFP gene can be attached to the T-DNA region

of the

plasmid. This then allows for visual confirmation of a successful plant

transformation

experiment. Green fluorescent protein has become so important in many

experiments that

the discoverers of GFP were awarded the Nobel Prize in Chemistry in 2008

(Cantrill,

2008).

41

Since its discovery the GFP gene has been inserted into many other organisms,

including

animals. This has included making glowing fish (Danio sp.), and mice. Many

pet stores

now sell GFP fish to put into home aquariums. Perhaps the strangest creation

of all has

been the GFP pig.

Induced mutations of the GFP gene make a protein that emits slightly

different

wavelengths of light. Available in the biotech market today, there exists a

GFP reporter

gene that will result in a protein that fluoresces nearly every color of the

rainbow.

Transforming these genes into Cannabis would result in a plant with colorful

buds when

under a black light.

The pragmatical reasons for doing a Cannabis-GFP transformation are difficult

to argue.

However, science is not just about pragmatism, it's also about discovery,

exploration, and

excitement. When tobacco was first transformed with a firefly gene (that

encoded for the

protein luciferase), everyone including the public sector as well as school

kids were all

suddenly interested in how plant biotechnology might affect their lives. The

same reasons

might be argued for creating a glowing Cannabis plant.

However, in some cases such as the creation of GFP mice was not simply for

show. It

has, in fact, led to an important new method of studying brain function.

Using different

variants of the GFP gene that emitted different wavelengths (colors) of light

has allowed

scientists to study individual cells and differentiate between single

neurons. Since brains

are often quasi-organized, but often with indiscernible entanglements,

variation in neuron

color helps to distinguish individual neurons. Perhaps making a GFP Cannabis

plant with

the same variety of fluorescence could lead to better viewing of the xylem

and phloem.

The GPF experiments offer insight into how biotechnology provides advances in

knowledge and discovery. However, cutting a gene out of one organism and

putting it

into another organism requires skill, proper knowledge and the proper lab

equipment.

First, the experiment must be decided. The sequence of the gene of interest

must at least

partially be known, which allows isolation and amplification of the gene.

Second, a

potential organism to be transformed must be decided. Usually this is

selected from a

choice of model organisms whose genome composition, ability to be

transformed, and

growth conditions have been well established. Finally, one must then decide

on the

vector, or the way that the gene will be transferred. We have previously

discussed the

Agrobacterium plasmid as the vector for Cannabis transformation.

Inserting the gene into the chosen organism can only be done after the gene

has been

ligated, or enzymatically linked, to a vector. Perhaps the most well

established vector for

transforming plant calluses is the plasmid of Agrobacterium. Therefore, in

order to

deliver the gene from Agrobacterium into plant calluses, the plasmid must be

ligated to

the gene. Many molecular biology kits to carry this reaction out are

commercially

available from a wide range of companies.

After ligation, the plasmid containing the gene can then be inserted into the

Agrobacterium in one of two ways. The plasmid with the ligated gene can be

mixed with

42

Agrobacterium cells and placed in a small tube called a cuvette. An electric

shock is

given that forces the Agrobacterium to take up the plasmid. This process is

known as

electroporation.

An electroporator, which is used to make Agrobacterium take up the plasmid.

The upper left corner shows the cuvette. After placing Agrobacterium and the

plasmid into the cuvette, the cuvette is inserted into the pod and a small

pulse

of electricity is given.

Selection for transformed Agrobacterium can then be carried out on antibiotic

containing

Petri dishes that only allow Agrobacterium that has a plasmid to grow. This

is because

the plasmid will have an antibiotic resistance gene, as previously discussed.

The second way to make Agrobacterium take up the ligated plasmid is called

heat shock.

In this method, the Agrobacterium and plasmid are mixed in a small tube. This

mixture is

transferred from ice to a warm water bath, then back to ice. The cells are

then spread onto

the Petri dish, much like after doing an electroporation reaction.

After growing the Agrobacterium on a Petri dish, some of the cells can be

picked off with

a sterile wire and dipped into a broth (liquid) culture, which is a growth

media similar to

the Petri dish but without the solidifying agar. This broth is allowed to

grow for two days,

or until the Agrobacterium reach a desired cellular density.

43

A few drops of the broth culture cells can be dropped onto plant tissue

callus. By their

nature, they will infect the plant callus tissue and insert the genes from

the plasmid (the

T-DNA). This is the basis of genetically transforming the plant cells. If so

chosen, the

Agrobacterium that was grown in broth can be grown in bulk and small aliquots

frozen

for future use. Now that you have been provided the basics on how to make a

transgenic

Cannabis plant, it seems necessary to divulge into some of the candidate

genes.

44

6. Woody Cannabis

Nearly all plant cells have a rigid, outer protective layer called a cell

wall that provides

support and protection for the cellular contents. The cell wall is not a

static entity. It has

enzymes imbedded that perform a wide array of biochemical functions. The main

component of plant cell walls is cellulose, a large polysaccharide made up of

glucose

monomers.

Almost anyone who has taken a basic biology class knows that a cell is the

smallest unit

of life. On a microscopic scale, cells are small factories where thousands of

biochemical

process are occurring each second. All plant cells also have a plasma

membrane, made up

of lipid-derived molecules. Seeing how the plasma membrane helps keep a cell

together

can be understood when looking at oil and vinegar salad dressing. Notice that

in this

dressing there are two distinct layers, an oily (water insoluble) phase and a

liquid (lipid

insoluble) phase. You have to shake the bottle of dressing to try and bring

the two layers

together. But after time, the layers separate again. A cell membrane is

similar to the bottle

of oil and vinegar salad dressing in that it keeps the liquid phase, which

contains all of the

cell's machinery, together by making the oily outer layer called the plasma

membrane.

The plasma membrane then is like an oil shell, providing a fairly constant

internal

environment. Imbedded in this oily shell are proteins with various functions.

In a plant cell, in addition to the plasma membrane, part of keeping the

internal parts

from bursting out from the oily shell layer (nucleus, mitochondria,

chloroplast, etc.) is

provided by the most exterior layer called the cell wall. Integrity of the

cell is maintained

by keeping the cell in tact by the rigid external layer of cellulose, a major

component of

the cell wall. The cell wall also keeps the inner plasma membrane and its

contents

protected from external environmental onslaught such as salinity changes or

pressure

changes. It also protects the cell from popping due to internal pressure from

water

accumulation. In fact, the cell wall was a crucial evolutionary step in the

transition of

plants from their aquatic ancestors to colonize land.

There are two components to the cell wall, a primary and a secondary cell

wall. The

primary wall is established first, early in the cell's life. As time

progresses the cell

matures and the secondary wall is established. This wall is laid down inside

of the

primary wall. The secondary cell wall is the portion that often contains

higher amounts of

lignin and is at least partly responsible for what is known as wood. Laying

down lignin in

the cell wall is called lignification. Both the primary and secondary wall

contain cellulose

but differ in concentration of lignin and the types of proteins. Between each

plant cell and

on the outside of the cell wall there is a layer of a substance called

pectin, which is a

carbohydrate that essentially glues adjacent cells together. Pectin is also

the substance

that is used in thickening jellies and jams.

All of this is important because an interesting discovery occurred with

researchers who

wanted to understand how lignin, the main component of wood, is produced in

large trees

(Kirst et al., 2003). They examined the gene sequences of Arabidopsis, which

usually

doesn't produce wood.

45

Using the tools of bioinformatics, which uses computers to understand

sequences in

databases, they first found and identified several genes that played a role

in secondary

xylem, or wood production. The researchers then started comparing the

sequences of the

tree genes with Arabidopsis genes. To their surprise, they found remarkable

similarities.

Although their morphological appearances were strikingly different, both

shared the

genes needed for wood production. For some unknown reason, the lignin genes

have

been turned off 'in Arabidopsis.

Since Arabidopsis, the small herbaceous mustard plant, had the genes for wood

production in its genome, other researchers have postulated that if these

genes were to be

expressed, wood formation might occur. Indeed, research in this avenue has

already

begun with some success (Mitsuda et al., 2007). Although Arabidopsis is

usually thought

of as a herbaceous (non-woody) plant, this has been changed through the tools

of

biotechnology.

Searching for the gene for wood production in Cannabis could prove to be

difficult

considering that there is limited genomic information available. However, it

would

indeed be possible to use the Arabidopsis study as a stepping-stone to reach

the goal of

producing a woody Cannabis plant. The DNA sequence of a gene for one species

is often

similar to the same gene in a different species. This is called gene

homology, or as

sometimes referred to-two genes are homologous if they share similar

sequences and are

found in different species. The gene for wood production is most likely

hidden

somewhere in the Cannabis genome, much like it was hidden in the Arabidopsis

genome.

The gene simply needs to be detected and properly expressed.

The construction of the plant cell wall and lignification depends on the

activity of

enzymes responsible for synthesis of cellulose, lignin and other polymers.

Most people

are familiar with plants, whether they are found in gardens, in homes, front

yards, dinner

tables, or in a pipe, people are often directly interacting with plants.

Interacting indirectly

with plants is inevitable, since breathing the oxygen they release is

fundamental to most

life on earth. However, the great majority of people are less familiar with

the plant cell.

Since Cannabis already has the machinery to produce primary and secondary

cell walls,

the only necessary genetic changes would be to up-regulate lignin production

in the

secondary wall. The challenge is to find and isolate the gene in Cannabis,

which is

entirely possible through bioinformatics and understanding gene homology.

Transforming Cannabis with a gene for increased lignin production would be a

practical

application of biotechnology. Having a woody plant would allow an outdoor

gardener to

have a perennial Cannabis plant. Buying and planting new seeds to sew each

year could

be eliminated. Cuttings to propagate a favorite strain would also be easier

to obtain and

share among friends.

With the correct genes for both wood production and size, an extreme case of

an entire

forest of Cannabis trees is possible. This would have ecological

ramifications beyond

46

releasing a genetically modified crop organism into the wild. For instance,

imagine a

forest fire where the smoke has enough THC to get every man woman and child

in an

adjacent city stoned. Firefighters rushing to the scene may find themselves

unable to

focus on extinguishing the fire. Although an extreme scenario, this helps

articulate the

fact that regulations of genetically modified organisms are indeed important.

Since hemp is already used as a sustainable crop in some countries, they may

want to

consider growing hemp varieties with higher lignin production. These

genetically

modified varieties could be useful for more durable goods than that made from

traditional

hemp strains. The current hemp varieties are in fact better than trees for

making paper

due in part because they have a lower lignin density. The lower lignin

concentration

makes hemp an attractive plant because the higher lignin in trees requires

more harsh

chemicals used in processing. In fact, it is because of the lignin that hemp

is often

preferred over trees. Hemp also has a higher cellulose density than trees,

making it great

for increasing product yields.

For these reasons one may argue against making a woody Cannabis plant.

However, if

the countries where hemp is currently cultivated could be grown to increase

lignin

production the country would surely benefit. A country with much of its land

mass given

over to desert or dry area is often able to grow hemp. If these same areas

could produce

lignin within their countries, they could rely less on the import of forest

products. This in

turn would slow the destruction of forests in other countries. An advantage

of higher

lignin content is also given to the plant. Many organisms cannot tolerate

eating lignin and

therefore a transgenic hemp plant with higher lignin content may provide

herbivore

resistance.

But other benefits abound for humans. A high lignin-producing hemp plant

could provide

raw materials for building more durable goods than presently available from

contemporary hemp varieties. The current list of products made from hemp

ranges in the

hundreds. Increasing lignin content could expand this list. Based on the

current rate of

forest destruction, it may be absolutely necessary to make a transgenic hemp

plant that

makes large amounts of lignin.

47

7. Plant Secondary Metabolites and Terpene Production

Knowing the biochemistry that presently occurs in plants is vital to

understanding plant

biotechnology. There are hundreds of biochemical pathways that lead to a

plant product.

Knowing all of these pathways is unnecessary and can be time consuming (and

impossible) to learn. Therefore, one should primarily concern themselves with

the

pathways that lead to important Cannabis compounds (e.g.,

tetrahydrocannibinol). To

begin this exploration the terpene pathway is introduced. However, it is also

important to

know other plant secondary metabolites.

Previously we discussed plant primary metabolites. These consist of proteins

(amino

acids), carbohydrates (sugars), fats and lipids, and DNA and RNA (nucleic

acids).

Primary metabolites are crucial to plant survival. Without these four basic

metabolites, a

plant could not carry out the daily requirements and processes of life.

Secondary metabolites differ from primary metabolites in that they are not

always

necessary for plant survival. However, they are often advantageous or provide

some

benefit to the plant. There are three major groups of plant secondary

metabolites;

phenolics, alkaloids and terpenes. Phenolics are distinct in that they have a

carbon ring

structure with a hydroxyl group (-OH derivative) attached. Lignin, a huge

polymer of

phenolic rings, is the most common phenolic compound among plants. Other

important

phenolic compounds include tannins, vanilla, nutmeg, capsaicin (the spicy hot

molecule

in peppers), and anthocyanins (plant pigments).

Alkaloids represent another class of secondary metabolites. Alkaloids are

bitter tasting

nitrogenous compounds. A popular alkaloid in the 1980's was cocaine. Other

well-known

alkaloids in include atropine, caffeine, psilocybin, strychnine, quinine, and

morphine.

Terpene synthases are the enzymes that synthesize terpenes, the third and

final class of

secondary metabolites. Terpene enzymatic pathways have been described in

detail

(Pichersky et al., 2006). Terpenes provide a wide array of functions in

plants. For

example, the tail portion of the chlorophyll molecule is composed of the

terpene called

phytol, which is a diterpene. Citrus smells are possible because of limonene,

a

monoterpene. In total there are about 60,000 known phenolics, alkaloids, and

terpenes.

Terpenes make up the largest proportion of plant secondary metabolites.

The most important terpene, at least in this book, is geranyl diphoshpate,

which is needed

for tetrahydrocannibinol (THC) biosynthesis. The basic enzymatic pathways

leading to

molecules of terpenes incorporate carbon molecules based on multiples of

fives.

Therefore, a nomenclature system has emerged that follows this pattern.

48

Terpene name

Formula

Molecular weight

Isoprene units

Example

Hemiterpene

C5H16

76.2

0.5

2-methylbutane

(isoprene)

Monoterpene

C10H16

136.2

1.0

pinene

Sesquiterpene

C15H24

204.4

1.5

farnesol

Diterpene

C20H32

272.5

2.0

phytol

Sesterterpene

C25H40

340.6

2.5

leucosceptrine

Triterpene

C30H48

408.7

3.0

squalene, THC

Tetraterpene

C40H64

544.9

4.0

carotenoids

Polyterpene

OoofloO

100,000-1,000,000

1,500-15,000

natural rubber

Similarly, a nomenclature system exists for enzymes, the proteins that act as

a catalyst to

speed reaction rates. One only needs to add the suffix '-ase' onto a

protein's function to

give it a name. For example, a transferase is an enzyme that transfers one

molecule to

another and a decarboxylase is an enzyme that removes a carbon. Most of the

steps

leading from one molecule to another involve an enzyme. These enzymes are

desirable to

understand because over expression of anyone of these protein's genes could

lead to

higher THC production in Cannabis.

The five carbon units for building terpenes consist of the phoshporylated

(has a

phosphate added) starting materials isopentenyl diphosphate (IPP) and

dimethylallyl

diphosphate (DMAPP). These can be joined in either "tail to tail" or "head to

tail"

reactions. In the case of the atmosphere and its terpene constituents, the

low molecular

weight terpenes have been shown to play are larger role, and hence have been

more

widely studied in global climate.

Additionally, it has been observed that plants can produce terpenes

(anabolism) and then

consume them by breaking them down (catabolism). Often, large terpene

compounds can

be metabolically broken down and released in smaller (reduced molecular

weight) forms.

The reactions of terpene biosynthesis are an important part of Cannabis

biochemistry.

49

Shown above is a single isoprene molecule (C5H16) is the primary constituent

of

all terpenes.

There are two pathways, which lead to production of terpenes. The mevalonate

(MVA)

pathway for terpene production in higher plants occurs in the cell cytoplasm

and leads to

sesquiterpenes and triterpenes. The second pathway is called the 1-deoxy-D-

xylulose

(DXP or non-MVA) pathway and occurs in the plastid. This pathway can lead to

monoterpenes and diterpenes.

PLANT CELL

CYTOPLASM

MVA Path

i

Sesquiterpenes

Geranyl diphosphate

V

Plant cell showing each terpene pathway. Geranyl diphosphate is used in THC

synthesis.

50

To begin the MVA pathway, thiolase catalyzes the synthesis of acetylacetyl-

CoA by

fusing two acetyl-CoA molecules. HMG-CoA synthase synthesizes acetylacetyl-

CoA

with a third acetyl-CoA to produce 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA).

A

final reaction catalyzed by HMG-CoA reductase uses 2 NADPH to reduce HMG-CoA

to

the six-carbon molecule mevalonate (MVA).

The high-energy molecule, adenosine triphosphate (ATP) is required for the

next three

reactions, which ultimately lead to isopentenyl diphosphate. These reactions

involve

MVA kinase, MVAP kinase, and MVAPP decarboxylase, and proceed with MVA,

mevalonic acid 5-phosphate (MVAP), mevalonic acid 5-diphosphate (MVAPP), and

isopentenyl diphosphate (IPP), respectively.

The plastidial pathway is initiated with the joining a pyruvate molecule to a

glyceraldehyde 3-phosphate molecule facilitated by the enzyme DOXP synthase.

This

forms l-deoxy-D-xylulose-5-phosphate (DOXP). This is reduced by the enzyme

DOXP

reductoisom erase (DOXP-R) to form 2-C-methyl-D-erythritol 4-phosphate (MEP).

A

cytidine triphosphate then incorporated to form 4-(cytidine-5-diphoshpo)-2-C-

methyl-D-

erythritol (CDP-ME) via the enzyme CDP-ME synthase.

An ATP is used to add a phosphate to form 4-diphosphocytidyl-2C-methyl-D-

erythritol

2-phosphate (CDP-ME-2P). The enzyme that catalyzes this reaction is CDP-ME

kinase.

This product is then cyclized to form 2-C-methyl-D-erythritol 2,4-

cyclodiphosphate

(CDP-ME diphosphate) via CDP-ME diphosphate synthase. After removing a water

molecule, (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate (HMBPP) is formed via

HMBPP synthase. The final step removes an additional water molecule while

simultaneously reducing (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate to yield

isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).

51

Plant Cell

Cytoplasm

MVAPath

3 Acetyl-CiaA

HMG-CoA Synthase

ML- CoA

HMG-CoA Reductase

mevaJojiate

M VA Kinase

mevalonate phosphate

MVAP Kinase

mevaknate diphosphate

. MVAPF Decarboxylase

EPP < I > DMAFP <<

MG

l<

?vaJ'

I'

late

1

3te<

T

Polyisoprene Synthase

sesquiterpenes

Non-MVA Facta

GA-3-P + pyruvate

, DOXP Synthase

DOXP

' DOXP Reductoisomerase

MEP

CDP-ME Synthase

DP-ME

CDP-ME Kinase

P-ME-2P

CDP-ME Diphosphate Synthase

CDP-ME diphosphate

HMBFP Synthase

HMBPP

I'

do:

Ml

I

~DP

IP*

I'

bill]

I PI'

T

DMA]'?

jiio rioter penes

(gcranyl diphosphate)

Outline of the cytosolic terpene pathway and the plastidial terpene pathway.

Note the cross talk between each pathway. Geranyl diphosphate is perhaps the

most relevant molecule to THC biosynthesis.

Since they are phosphorylated, the IPP and DAMPP can be used in the so-called

"head to

head" or "tail to tail" combinations to build terpenes. DAMPP can also be

produced from

IPP by the enzyme isopentenyl-diphosphate isomerase (IPP isomerase).

Dimetheylallyl

transferase uses either IPP or DMAPP to form geranyl diphosphate or farnesyl

dihposphate via polyisoprene synthase. Geranyl diphosphate and farnesyl

diphosphate are

monoterpenes and sesquiterpenes, respectively. It is geranyl diphosphate,

which lends

52

itself to THC synthesis. Finally, it is important to note that there can be

exchange of

products between the cytosolic and plastidial pathways.

Many biochemical reactions taking place within plant cells are not carried

out in such

sequential steps. Although biochemical pathways occur when precursor

molecules initiate

the pathway, things can only proceed as fast as products are made. This is

because

enzymes are often suspended within an intracellular matrix (the cytoplasm) or

attached to

a cellular membrane, so that reactants must somehow join with the correct

enzyme.

A complex interaction between enzymes and their substrate concentration is

played out

where an enzyme may only be produced on demand. It follows from this that

increasing

the concentration of the substrates can cause an increase the concentration

of the

products. All of this has led to something called a rate-limiting step. This

says that the

rate of any reaction depends on the previous reaction. When thinking about

THC

production, it relies on previous steps within the THC biosynthetic process.

The HMG-

CoA reductase enzyme is often considered a rate-limiting step.

The enzymatic reactions taking place within the plant cell all occur very

rapidly and

depend heavily on the temperature and concentration of reactants and enzymes.

The

terpene pathway is one of many plant biosynthetic pathways. Therefore it is

not too

surprising that the terpene pathway also overlaps with other plant pathways,

including

plant hormone synthesis. For example, gibberellins and auxins are both formed

starting

with a molecule of mevalonate derived from the MVA pathway.

Since THC is the most active component of marijuana smoke, the importance of

its

molecular synthesis cannot be overstated. Like the terpene pathway, the THC

pathway

consists of different enzymatic steps and has intermediate molecules, for

example it is

synthesized via a terpene. Each of these enzymes plays a crucial role in the

overall

formation of plant secondary metabolites.

Becoming familiar with both the terpene pathway and the THC pathway allows

one to

understand not only key enzymes, but also the genes that encode those

enzymes. This is

crucial to relating the ways in which Cannabis can be genetically

transformed. For

example, in order to increase the concentration of the psychoactive component

of

Cannabis, an increase in IPP or DMAPP is needed. These molecules are produced

in the

terpene pathway. The gene coding for the protein that synthesizes IPP or

DMAPP needs

to be over expressed in Cannabis. Choosing any gene that codes for any enzyme

within

the terpene pathway might produce a similar increase, but needs to be

experimentally

verified. The important component to remember from these complex pathways of

THC

synthesis is that transferring any of these genes is possible with today's

biotechnology

tools. Before detail on these tools and techniques are provided, a review of

the THC

pathway is necessary.

53

8. The THC Pathway

The terpene pathway is important to understand both because it serves as a

model for the

other biosynthesis reactions, such as the THC pathway, and because the

terpene geranyl

diphosphate is needed in THC biosynthesis. Similar reactions, albeit at

different rates and

locations, occur within plant cells that result in production of THC. The

chemical

structure of THC was first determined in the 1930's (Pertwee, 2006). Knowing

the

complete pathway to its production is considered an important piece of

Cannabis

biotechnology.

THCA

THC

Shown here is the molecular structure of THCA and THC with arrows pointing

to the variation in the side group. THCA is the component in Cannabis plants

and it is not until it is burned that THC is formed.

Interestingly, it is not until THCA is burned that it becomes chemically

modified into a

more psychoactive form, which is THC (Hazekamp et al., 2005). The burning

causes a

decarboxylation reaction, or a loss of a carbon group that is on the THCA

molecule,

thereby converting it to the more psychoactive THC molecule.

However, the THCA component of Cannabis is the precursor of THC, so its

formation

and accumulation within the plant influences the amount of THC when the plant

is

smoked. Again, part of the THCA molecule is derived from the terpene geranyl

54

diphosphate. Synthesis of THCA begins when a molecule of geranyl diphosphate

(a

monoterpene) is joined to a phenolic ring (a circular molecule with six-

carbons). This is

why THC is sometimes referred to as a terpenophenolic. Because it has a few

extra

molecular attachments, the phenolic ring is called olivetolic acid and it is

through the

enzyme geranylpyrophosphate:olivetolate geranyltransferase that forms

cannabigerolic

acid, or CBGA. The final product after CBGA formation is THCA by way of

tetrahydrocannabinolic acid (TCHA) synthase. Subsequently, high levels TCHA

are

found in Cannabis trichome cavity (Sirikantaramas et al., 2005).

Cannabis Cell

r

CYTOPLASM

olivetolic add

+

geranyl diphosphate ^

\

THCA

A look inside the Cannabis cell, showing geranyl diphosphate and olivetolic

acid combining to yield THCA.

The pathway leading to olivetolic acid is most likely synthesized from three

molecules of

hexanoyl-CoA. However, work remains to be done to in order to understand the

synthesis

of THCA in its fullest extent. Details on each enzymatic reaction, their

substrates and

their products have been recently provided (Taura et al., 2007).

With all this biochemistry comes the curiosity of why Cannabis has evolved to

produce

THC -like molecules. It has been hypothesized that the molecules can act as a

sunscreen

for the plant (Lydon et al., 1987). In fact, research has shown that THC can

absorb UV

light, thus the plants are protected from harmful radiation. Additionally,

THC precursors

have believed to have antimicrobial activities, therefore these cannabinoids

may also play

a role in plant defense.

Since the part of the biochemical pathway of THC has been elucidated, picking

some of

the genes from the pathway for transgenic manipulation is possible. For

example, if

55

THCA synthase is attached to the CAMV35S promoter it will be highly over

expressed.

This would produce transgenic lines of Cannabis that are loaded with THCA.

Putting these genes into other plants may serve useful to people in countries

where

Cannabis cultivation is illegal. One species of plant that might be desirable

to genetically

modify with THC genes is the weed species, Amaranthus retroflexus. This plant

is in the

family Amaranthaceae, also known as the pigweed family. The common name for

this

plant is redroot pigweed and is consumed as a food in some parts of the world

(Kong et

al., 2009).

One reason for its candidacy for genetic modification stems from the fact

that it is a

weed; it grows along railroad tracks, in ditches, and even between cracks in

the middle of

parking lots. Therefore, very little labor would be required from the

cultivator to maintain

healthy pigweed plants.

A second reason for its candidacy is that the flowers of pigweed are large

and bulky. This

would provide the obvious advantage of producing large quantities of finished

product.

Additionally, it needs little water, grows rapidly, produces lots of seed,

and tolerates poor

soil and harsh growing conditions. In many respects it behaves like Cannabis,

but is

legal. Growing a few plants of pigweed would not send the police to your

house. For

instance, growing pigweed next to your tomato plants in your garden would not

seem that

strange. Neighbors would not give the situation a second thought.

56

Amaranthus retroflexus, a candidate for genetic modification with the THCA

synthase gene. The top left corner shows an up-close view of the large flower

clusters of this plant.

57

The prospect of growing a legal THC-containing plant might also seem alluring

to

medical marijuana users. Within the US, medical marijuana is currently legal

in only a

handful of states. While other countries have legalized or promoted the use

of medical

Cannabis, the US Food and Drug Administration (FDA) has historically declared

marijuana to have only limited medical potential. This is contrary to

continuing scientific

findings and the fact remains many patients currently use medicinal marijuana

with or

without a doctor's recommendation.

The inflorescence (flower) of pigweed can be much larger and bulkier than

marijuana,

which would allow for production of large amounts of medication for medical

marijuana

patients. The biotechnology for producing transformed, THC-containing plants

might be

an effective way to bypass legal issues and still allow sufferers of chronic

illnesses to

self-medicate. Since Amaranthus is known to harbor terpenoid biosynthetic

pathways,

inserting the THCA synthase gene should result in THC production.

Transforming a plant with one gene is relatively straightforward. Inserting

multiple

genes, called gene stacking, has proven to be more difficult. In the past

researchers had to

do laborious transformations starting with one gene, then grow the plant into

an adult,

and breed it for multiple generations. Only then could they use this stem

tissue for

creating calluses and insert a second gene. Success was far and few between.

Fortunately,

many new vector systems, mainly in the form of plasmids, have shown to be

more

versatile in their capacity to deliver multiple genes simultaneously (Dafny-

Yelin and

Tzfira, 2007). The emergence of artificial plant chromosomes has allowed

putting several

genes together and inserting them into a vector. With time, the complete THC

pathway

will undoubtedly be inserted into other plant species.

58

9. Smoking Roses and Other Proposals

There are limitless ways in which Cannabis and biotechnology will influence

one

another. Having a basic knowledge of science and biology is imperative, but

having an

imagination might prove equally as important. However, thinking of concepts

and

applying logical ideas to them begins with a solid science education. This

allows one to

gather reasonable arguments as to possibilities of Cannabis transformation

that may arise

in the near future.

Work has already begun with yeast cells (Taura et al., 2007). These small

fungi were

genetically modified to express the THCA synthase gene. Workers from the same

lab

were also responsible for transforming tobacco, albeit under special

conditions

(Sirikantaramas et al., 2004). For example, the THCA synthase enzyme had to

be

provided with the THCA precursor molecule (cannabigerolic acid). The tobacco

cells

were also grown in vitro. Nevertheless, the gene for THCA synthesis has been

shown to

have the ability to successfully transfer and expressed in organisms other

than Cannabis.

Some of the fastest advances in improving Cannabis and other plants have been

through

application of chemicals or hormones. For example, inducing chromosomal

duplications

in plants has been occurring since the discovery of colchicine. This chemical

interferes

with the proteins that pull chromosomes apart during cell division. Applying

colchicine

has been shown to cause complete genome duplications. Sometimes this leads to

doubling of all gene products and not just the genes. It follows, then, that

a Cannabis

plant treated with colchicine might result in production of twice as much THC

than an

untreated plant.

Although colchicine is commercially available, performing more drastic

genetic

experiments are not so easily available. These require special aseptic

conditions and

access to the necessary technology. Once these obstacles are overcome,

transforming

Cannabis with any gene is simply a game of experimentation.

It is indeed possible to control genes and cause them to be upregulated in

order to

increase their gene product. To do this, the known gene has to be attached,

or ligated, to a

special region that communicates this to the Cannabis cell. This region is

called a

promoter region, since it promotes the expression of that gene. The promoter

region sits

just ahead of the gene along the chromosome.

Some promoter regions have been found to have such strong expression

activity, that they

are routinely used in plant biotechnology. One such promoter is called the

CaMV 35S

promoter (Venter, 2007). This promoter was first found in a virus, then

carefully

removed, and finally ligated to a plant gene. When researchers did this they

found that

whatever gene was attached resulted in a constant expression of that gene.

The CaMV

35S promoter has since proven to be a useful promoter to make transgenic

plants that

express large amounts of a foreign gene.

Since there is overlap of the THC and terpene biosynthetic pathways, adding

an

59

additional two or three terpene genes to Cannabis will likely result in that

terpene

product. For example, many fruit scents and flavors are terpenes. Most anyone

is familiar

with the citrus smell of an orange, grapefruit or lemon. This smell is the

result of a

terpene known as limonene.

The biosynthesis of limonene is so well understood that there are multiple

transgenic

plants that have been made expressing limonene. Putting the limonene gene

into

Cannabis would give the buds a citrus-like smell. While some may find this

aesthetically

appealing, others might simply enjoy something different. From a practical

standpoint,

the paranoia of indoor growers might decrease upon learning that the smell

their

neighbors are complaining about is lemons rather than from marijuana

cultivation.

Since the precursor molecules needed early in the pathway of THC are known,

increasing

these initial pathway substrates might result in more THC production. IPP and

DMAPP

are the starting materials for terpenes. Upregulating the genes (isopentenyl

diphosphate

synthase and dimethylallyl diphosphate synthase) would provide this

possibility. These

gene sequences are known in other plants, therefore a model for isolation and

amplification of the Cannabis IPP and DMAPP synthase genes is available.

Another interesting experiment focuses around Cannabis flowers. Many roses

are

currently sold as so called, double roses. This is because they have two

whorls of petals,

not just one, as in typical roses. This was brought about not by genetic

modification, but

through discovery of a mutant double flowered rose. The mutant was

subsequently bred

with other roses to distribute the mutation through the offspring. Selection

for double

roses and crossing between double roses produced only double roses, so much

in fact,

that there are complete genetic lines of double flowered roses.

One of the most prominent desires from Cannabis growers is to increase yield.

Many

cultivators would rather grow one plant that yields 2 kilos than to grow five

or six plants

that produced this same amount. Luckily for Cannabis growers, a single gene

controls

flower size, at least in some plant species. Upregulating this gene then,

would be of huge

importance to the Cannabis community.

A different approach to making larger flowers in Cannabis would be to express

the gene

for petals. The transcription factors of the ABC flowering model could be

exploited to

facilitate this goal. Although Cannabis lacks petals, manipulation of the ABC

transcription factors could overcome this barrier.

Conversely, ignoring the petals and focusing on the sepals could produce a

similar

outcome. Luckily enough, the A transcription factor controls both sepal and

petal

production. Therefore, up-regulating the A transcription factor would likely

result in buds

with enlarged petals and sepals. Ultimately, different experiments would be

required to

find the best combination of which genes to up-regulate. In addition to

larger buds,

producing many more buds seems just as important.

60

Perhaps the goal should not be to make larger flowers or have more of them.

Considering

how plants make their food might equally result in an increase in growth of

its buds or at

least the time needed. For example, if the genes for photosynthesis are

upregulated,

conferring hyper-photosynthetic ability, may shorten the time needed to grow

Cannabis

in the vegetative stage. Cannabis producers could have the vegetative state

of Cannabis

finish in two months instead of four months.

The possibility also exists that one can manipulate the genetic expression of

trichomes.

The gene for trichome production has been found and described in detail. With

trial and

error, a Cannabis plant with twice as many trichomes might result in twice as

much THC.

Alternatively, the entire Cannabis plant can be discarded. Inserting THC-

synthesizing

genes into any plant that can be cultured in vitro is a possibility. Roses

with THC-

producing flowers may soon be available to everyday gardeners. The benefits

would be

obvious. Since roses are perennials, their flowers can be harvested every

year, sometimes

more than one time a year. Roses also have the unique characteristic of being

able to

bloom multiple times in a season, which would provide a continuous supply of

TCH-

containing flowers.

Before Cannabis consumers celebrate these transgenic advances with too much

excitement, there remains a caveat. If marijuana seed companies choose, they

might use a

method similar to that which the agricultural biotech seed companies have

chosen. For

example, in some transgenic food crops a suicide gene is inserted into the

seed so the

person harvesting the crop will be unable to use seed from that crop for

planting the

following year. The suicide gene essentially renders the seed infertile. This

was the

method that the large agricultural giant Monsanto used in their "terminator"

technology.

If a seed company has invested many months or years developing a plant, they

may deem

it necessary to protect its secrets and stay in business. For now at least,

marijuana seed

companies appear to be following a different philosophy than that of today's

corporate

agricultural giants.

61

10. Cannabis DNA Sequencing

All life uses deoxyribonucleic acid (DNA) to transmit information to its

offspring. In

eukaryotes (e.g., Cannabis and humans) DNA is contained in a nucleus, while

prokaryotes (e.g., Agrobacterium and other bacteria) lack a nucleus.

Bacterial DNA floats

within a localized region, often called the nuclear region. The DNA

represents the

organism's genetic material. The scale of view transforms along a finer

gradient from

chromosomes (or plasmids) to DNA to gene and finally to nucleotide bases.

Understanding how the order of nucleotide bases (adenine, thymine, guanine

and

cytosine) contributes to an organism is fundamental to understanding an

organism.

DNA sequencing began with scientists counting one base at a time. The bases

were

translated as patterns or marks on paper and identifying a base was done

manually. The

process was long and difficult, partly because it required the use of small

amounts of

radioactive materials.

The development of automated sequencing resulted in a rapid increase in the

number of

base pairs that could be read. Additionally, the accuracy and reliability

increased.

However, the DNA had to be moved through large slabs of a gel. The process

was less

labor intensive than counting manually and by hand as they did in the

beginning of

sequencing projects but still consisted of hours of careful work.

Recently there has been rapid progress in DNA sequencing technologies. This

has

claimed the name, next generation sequencing and represents most of the tools

currently

used in sequencing labs. However, the technology continues to evolve,

becoming

cheaper, faster, less labor intensive and more reliable. Researchers are now

trying to get

the enzyme that polymerizes (extends or makes more of) DNA to do sequencing

for

them. In this way, sequencing a DNA strand can be accomplished in real time

through the

work of an enzyme. Because enzymes are so fast in their reactions, using DNA

polymerase would throttle sequencing speeds to an unprecedented rate.

Currently, there is a mad race to learn the sequence of as many organisms as

possible.

Although this started with sequencing a bacterial virus, the trend quickly

spread to

include the human and model organisms (e.g., Arabidopsis, mouse, and yeast).

Knowing

an organism's genetic sequence provides a blueprint for manipulating and

experimenting

in order to discover biological secrets.

Since there is so much DNA sequencing data being discovered, there has

evolved large

databases to in which to deposit this digital data. The European Molecular

Biology

Laboratory (EMBL) is centralized in Heidelberg, Germany but also has other

extensions

across Europe. The portion of EMBL involved in DNA sequencing is often

referred to as

EMBL Nucleotide Sequence Database or, more succinctly, EMBL-Bank. It is

important

to understand that there is a physical laboratory and then there is also a

digital storage

component. This is the same situation for another large laboratory in Japan

called the

DNA Database of Japan (DDBJ).

62

The final database is called GenBank (in Bethesda, Maryland), which is part

of the

National Center for Biotechnology Information (NCBI). EMBL-Bank, DDBJ and

GenBank are the three large constituents that comprise an international

consortium of

bioinformatics data (essentially digital data). Each database is linked to

one another and

they exchange information daily. For instance, although the scientists who

sequenced

THCA synthase were from Japan and deposited their gene sequence data in DDBJ,

people in Europe and North America also have access to this sequence. In

fact, anyone

with an Internet connection has free access to any sequence data deposited in

any of these

three databases.

1 atgaattget cageatttte ettttggttt gtttgcaaaa taatattttt etttetetea

61 tteaatatee aaattteatt agetaatect caag a&aact t-CGttaaatg cttctcggaa

121 tatattccta acaatccagc aaateeaaaa tteatataca eteaacacga ccaattgtat

181 atgtctgtec tgaattcgac aatacaaaat ettagatt-ea c-ctctgatac aaceecaaaa

241 ecactcgtta ttgtcaetee ttcaaatgte tcecatatee aggccagtat tctctgetec

301 aagaaagttg gtttgeagat tcgaaetega agcggtggee atgatgctga gggtttgtec

361 taeatatctc aagtcceatt tgctatagta gacttgagaa acatgcatac ggtcaaagta

421 gatattcata gecaaaetgc gtgggttgaa gccggageta cccttggaga agtttattat

481 tggatcaatg agatgaatga gaattttagt tttcctggtg ggtattgccc tactgttggc

541 gtaggtggac actttagtgg aggaggctat ggageattga tgcgaaatta tggccttgcg

601 get gat a at a teattgatge acacttagtc aatgttgatg gaaaagttet agatcgaaaa

661 tccatgggag aagatctatt ttgggctata egtggtggag gaggagaaaa ctttggaatc

721 attgeagcat ggaaaatcaa acttgttgtt gtcccateaa agccLactat atteagtgtt

781 aaaaagaaca tggagataca tgggcttgtc aagttattta acaaatggca aaatattget

B41 tacaagtatg acaaagattt aatgctcacg actcacttca gaaetaggaa tattaeagat

901 aatcatggga agaataagac tacagtacat ggttaettct cttccatttt tcttggtgga

961 gtggatagfcc tagttgactt gatgaacaag agetttcefcg agfctgggtat taaaaaaact

1021 gattgeaaag aattgagctg gatfcgataca accatcttct acagtggtgt tgtaaattac

1081 aacactgeta attttaaaaa ggaaattttg cttgatagat cagctgggaa gaagaegget

1141 ttctcaatta agttagacta tgttaagaaa ctaatacctg aaactgcaat ggtcaaaatt

1201 ttggaaaaat tatatgaaga agaggtagga gttgggatgt atgtgttgta cccttacggt

1261 ggtataatgg aigagatltc agaatcagca alLccaH.cc ctcafccgagc tggaataatg

1321 tabgaacttt ggtacactgc lacctgggag aagcaagaag ataacgaaaa gcatataaac

1381 tgggttcgaa gtgtttataa tfctcacaacg ccttatgtgt cccaaaatcc aagattggcg

1441 tatctcaatt atagggacct tgafctfcagga aaaactaabc ctgagagtcc taataattac

1501 acacaagcac gtatttgggg tgeaaagtat tttggtaaaa attttaacag gttagttaag

15&1 gtgaaaacca aagctgatcc caataatfctt tttagaaacg aacaaagtat cccacctctt

1621 ccaccgcatc atcat

The DNA sequence of THCA synthase, the protein responsible for THCA

synthesis. The sequence of nucleotides is translated into an amino acid

sequence, which constitutes the THCA enzyme.

63

5 Nucleotide

( Go ) ( Clear)

ATCT

TCTV

Limits | Preview/Index | History | Clipboard | Details |

Format: GenBank FASTA Graphics More Formats T

GenBank: AB212639.1

Cannabis sativa gene for tetrahydrocannabinolic acid synthase, partial cds,

strain:066

Features Sequence

LOCUS

DEFINITION

ACCESSION

VERS I OH

KEYWORDS

SOURCE

ORGANISM

REFERENCE

AUTHORS

TITLE

JOURNAL

PUBMED

REFERENCE

AUTHORS

TITLE

JOURNAL

AB2 12839 1635 bp DNA linear PLN 01-AUG-2006

Cannabis sativa gene for tetrahydrocannabinolic acid synthase,

partial cds, strains066.

AB2 12839

AB212839.1 Gl!81158001

Cannabis sativa (hemp)

Cannabis sativa

Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;

Spcrmatophyta; Magnoliophytaj eudicotyledons; core eudicotyledons;

rosids; eurosids I; Rosales; Cannabaceae; Cannabis.

1

Kojoma,M., Seki,B., Yoshida,S. and Muranaka,T.

DNA polymorphisms in the tetrahydrocannabinolic acid (TBCA)

synthase gene in "drug-type" and "fiber-type" Cannabis sativa L

Forensic Sci. Int. 159 (2-3), 132-140 (2006)

16143478

2 (bases 1 to 1635)

Ko joma,M.

Direct Submission

Submitted ( 05-MAY-2005 ) Hareshige Kojoma, The University of Tokyo;

457 kano, minami-izu 415-0304, Japan

( E-mail : ko j oma@ uf .a. u-tokyo.ac. jp, Tel ! 81-558-62-002 1)

Screenshot of the NCBI web site. Searches can be performed many different

ways including key words, nucleic acid sequences, or proteins sequences.

There are thousands of different proteins, all encoded by different sequences

of

nucleotides (e.g., adenine, guanine, cytosine, and thymine). Imagine finding

a DNA

sequence that coded for an enzyme that gobbled up hazardous waste, rapidly

removed

carbon from the atmosphere and could combat global climate change,

synthesized a life-

saving drug, or that could break down garbage in city dumps or pollutants in

streams.

These examples highlight just a few of the reasons why knowing as many

sequences as

possible is beneficial. Knowing the sequence of an organism allows

researchers and

bioinformaticists to tease out these important protein biomachines. There are

many

methods of DNA sequencing, with so-called next generation sequence methods

gaining

popularity because of its affordability and increase in data output.

Before a complete Cannabis genome sequence is provided to the public, a more

affordable and abbreviated sequence may arrive first. This technique is

called a cDNA

library, much like a library where people borrow books. When a plant makes a

protein it

64

must obey the central dogma of biology and the central dogma is fundamental

to any

biology student. The central dogma is logical in its flow and can be easily

understood

upon closer inspection.

The central dogma of biology states that a gene is the sequence of nucleotide

bases that

resides on a chromosome within the nucleus. A gene has the ability to be

turned on or off.

When a gene is turned on, it produces a transcript called messenger RNA, or

mRNA.

This mRNA is moved from the nucleus to the cell cytoplasm where it is

translated by

ribosomes. Ribosomes clasp the mRNA, which then allow binding of amino acid-

carrying molecules called transfer RNA, or tRNA. This is an extremely

macroscopic

view, as the actual events are based on subatomic interactions that happen in

a fraction of

a second.

The amino acids that arrive on the tRNA are attached in an order that

compliments the

sequence of the mRNA strand. Each amino acid brought to the mRNA has a unique

side

chain that interacts with its environment. The interaction with all of these

different side

chains (one for each of the 20 amino acids) elicits different properties that

make it unique

to the function of the protein to which they are incorporated. Since every

DNA sequence

is slightly different, organisms can produce a huge variety of amino acid

sequences that

fold into many different enzymes.

Regardless, the entire central dogma starts with a gene, which is then

changed into

mRNA, and ends with a gene product (a protein). One important tool used in

sequencing

today is the cDNA library. This is the representation of all or most of the

expressed genes

in a tissue at any given time. To make a cDNA library the mRNA is first

isolated from a

tissue or organ. Using enzymes within a small reaction tube, this mRNA strand

is reverse

transcribed back into DNA. The molecule remaining is complimentary DNA, or

cDNA.

Thus, a collection of cDNA sequences is called a cDNA library. These can be

sequenced

and compared to known sequences in the large public databases such as

GenBank.

65

Constructing a cDNA Library

Isolate Cannabis mRNA

jverse trans

1^

I

ce s_

I'

Outsource sequencing

1-2 weeks

Obtain sequences

Analysis

Use data to create transgenic lines

*

An overly simplified depiction of how to sequence expressed genes from

Cannabis. cDNA library construction is routinely done for many organisms and

often found in databases as expressed sequence tags (ESTs).

Obviously, there will be many different genes being produced in any cell at

any time. For

instance, flowers will have different cDNA sequences then sequences from a

root cell.

Different biotechnology companies provide complete cDNA construction kits,

and all

cost relatively modest amounts. However, one can also choose to send isolated

Cannabis

RNA to a company that will construct and sequence a cDNA library for an extra

charge.

However, some Cannabis cDNA sequences do exist. As mentioned, the public

database

GenBank is a repository full of digital information and can be freely

searched. Currently,

the majority of sequences available in this database are from a hemp plant,

what most

Cannabis cultivators would not find very interesting. However, it can be used

to study

other aspects of Cannabis. There are also a handful of Cannabis sequences

from other

researchers as well. Since this information is publically available, anyone

with an Internet

connection has access. With such huge amounts of genetic data and so few

researchers

mining the information, potential discoveries are waiting to be found this

very moment.

66

11. Molecular Tools

There are a plethora of molecular tools being used in molecular biology

today. Covering

them all would be far beyond the scope of this book. However a few important

and

common methods are covered. Reading this chapter will certainly help in

understanding

greater detail on how transgenic plants are made.

Perhaps the tool that any individual wanting to learn plant biotechnology

must become

familiar with is the polymerase chain reaction (PCR) This process was

developed in the

1970's and has been a crucial advancement to the development in all areas of

molecular

biology and biotechnology. Starting with a DNA sample, any sequence from that

sample

can be amplified in sufficient quantities to perform further experiments. The

entire

process takes only a few hours.

It is important to make many copies of a DNA segment (a gene) because the

gene of

interest must be amplified in large numbers before any other experiment can

proceed.

Since there are many different genes along a DNA strand, the first step is

identifying at

least a portion of the gene sequence that one is interested in isolating.

For example, isolating the THCA synthase gene requires starting with a sample

of DNA

that contains the specific DNA sequence that codes for the THCA synthase

protein. This

particular sequence on the DNA would be found in virtually any Cannabis

plant. The

total genomic DNA (DNA isolated from the nucleus) is placed in a small test

tube. In

addition, single stranded DNA fragments are added called primers that are 20

bases long.

The primers are added in very high concentrations because they get used up

each time the

gene is amplified. Because the primers have the exact opposite sequence of

the gene of

interest they bind and are able to anneal (or bind to) to the DNA molecule.

Ideally, the

primers flank the sides of the gene.

Primer 1- tacttaacgagtcgtaaaag

Primer 2- cacttttggtttcgactaggc

In the test tube there is also an enzyme called DNA polymerase. This was

discussed

previously when discussing how plasmids replicate at the oh region. As is the

case with

both making more plasmid or more of a gene, DNA polymerase can only bind to

double

stranded DNA. Therefore, when the primers bind to their complementary sites

along the

DNA sample, DNA polymerase is then allowed to attach and begin to polymerize

a new

fragment of DNA. Momentarily, however, in order to allow the DNA polymerase

to

make more of the gene of interest, such as the THCA synthase gene, the double

helix of

DNA must first become a single helix to allow primers to bind.

The details of this mechanism rely on manipulation of temperatures. To

separate out the

DNA double helix in the sample, the sample tube is heated to 94°C/201°F. The

high

67

temperature melts the two genomic DNA strands apart from one another. A

sudden drop

in temperature to ~55°C/131°F allows the smaller primers to find and anneal

to the single

stranded genomic DNA. Once the primers are in place, the temperature rises to

72°C/162°F and the DNA polymerase is activated and polymerizes a new strand

of DNA,

in our example, the sequence for THCA synthase. Since the primer is at a much

higher

concentration than genomic DNA, repeating the series of temperature cycles

allows DNA

polymerase to amplify a specific fragment of genomic DNA.

Often the PCR is carried out in a small machine that is automated to change

temperatures

very quickly. The changes in temperature that allow for separating the double

helix

strands, allowing primers to bind and activating DNA polymerase, can continue

for many

cycles. The more cycles of this pattern of temperatures will allow for more

gene product

to be amplified. Even if a homologous sequence is known, primers can be made

based on

that sequence and a researcher can at least try to amplify a desired gene.

This amplified gene product, or PCR product, can then be slightly modified

and

successfully transferred and ligated into a suitable vector such as a

plasmid. This is

because the PCR product is a perfect double stranded piece of DNA with a

single base

overhang on each end. This makes the ends "sticky", which means they are able

to fit

attach to another, complimentary end of DNA. For this reason, some plasmids

are

designed to have a single base overhang that compliments the PCR product.

Putting the

plasmid into a small tube with the PCR product provides the chance for these

two pieces

of DNA to stick together. The enzyme DNA ligase seals the bond between the

overhangs

that have hopefully found one another.

The ligated plasmid can then be successfully put into Agrobacterium . This

can be done

via electroporation or heat shock. Once Agrobacterium takes up the plasmid,

successful

genetic transformation of plant calluses can occur.

Often, when the PCR method is finished, the DNA polymerase, ions, and bits of

small

nucleotides (like excess primers) must be removed before the PCR product can

be used.

This requires using a small block of gel that rests within a box. The PCR

reaction is put

into a small hole, or well, of the gel. The box is able to harbor a current

of electricity so

the DNA molecules separate. Since DNA contains lots of negatively charged

phosphates,

it migrates toward the positively charged end of the box. This procedure is

aptly called

gel electrophoresis.

68

A gel electrophoresis apparatus used for separating DNA bands of various

sizes. DNA moves towards the positive (red) end and away from the negative

(black) end.

The image taken from a gel electrophoresis is often shown on popular TV

programs.

Usually this follows a crime scene investigation. There are apparent bands,

which mean

nothing to the actors, and the viewers are supposed to infer some meaning.

Television

grossly exaggerates reality and fails to explain anything with any clarity.

In the real

world, understanding what the bands mean and how they became apparent is in

fact

necessary.

Importantly, the rate that the PCR product moves through the gel depends on

its length. A

longer piece of DNA will not be able to travel very fast through the gel, and

so remains

closer to the end of the box where it was inserted into the gel well. Smaller

fragments of

DNA travel faster through the gel and so a band farther down from the well

implies the

fragment is smaller in length. The size of each band infers something about

the size of the

DNA molecule, which represents the actual band. To make the bands become

visible a

special dye is added to the gel and a light is applied, similar to eliciting

the green

fluorescence from GFP. The difference is that the bands glow and a picture

can be taken

and later analyzed.

If desirable, the band of DNA can be cut from the gel using a sharp blade.

The small

piece of gel is placed in a tube and a series of clean up reactions is

performed to remove

69

the gel but leave the DNA behind. This DNA can be used in further

biotechnological

applications or assays.

The US Drug Enforcement Agency (DEA) employs scientists who use specific

primers

that bind to particular regions of Cannabis DNA. They often use many

different

sequences of primers, which yields many different banding patterns. Since the

Cannabis

has genetic varieties across the nation and globe, not all primers will bind

to the same

regions of Cannabis DNA and, thus, patterns of bands will naturally be

observed. This is

what is referred to as the genetic fingerprint. The genetic fingerprint can

be helpful in

tracking where marijuana supplies are flowing from and, with enough samples,

even

specific routes of transport can be elucidated.

Determining if a gene has been successfully transferred and is being

expressed in a

Cannabis plant requires extraction of the RNA. The gene in the plant should

be present

and if expressed, it will be in the form of mRNA. If the expression of the

gene is

detected, then one can rightfully confirm successful transformation. As most

molecular

biologists know, working with RNA can often be tricky due to ubiquitous

degradating

enzymes. However, techniques can be employed to ensure proper experimental

control.

In any case, if one is careful enough, a procedure called a northern blot can

be carried out

for confirming that a transformation experiment was successful. Once the

Cannabis

mRNA is extracted it can be separated on a gel and then transferred to a

nylon

membrane. Similarly, it can be directly spotted onto a nylon membrane. A

single stranded

DNA probe that has the capability of fluorescence or radiating a mark onto a

special film

is applied to the nylon membrane. If the single stranded DNA probe finds an

opposite

sequence of mRNA on the nylon membrane, it will successfully bind. The nylon

membrane is washed in special reagents. When placed under light a signal of

fluorescence will be detected if the mRNA was originally present.

Methods and machines also exist to quantify the amount of mRNA at any given

time. In a

process called quantitative real time PCR (QRT-PCR), an RNA sample is

amplified,

similar to regular PCR. However, the PCR machine used is connected to a

detector that

can monitor the accumulation of the PCR product. This results in the ability

to work in

reverse and determine the original quantity or RNA that was present. Again,

if the RNA

is not present, the primers will not be able to bind and amplify anything, so

nothing will

be detected by the QRT-PCR machine.

Another method similar to the northern blot is called a southern blot. It

uses similar

principles but is used with DNA instead of RNA. Western blots are also used

in

molecular biology. These use neither RNA nor DNA and instead are used in

studying and

detecting proteins.

Many techniques also exist to take a gene back out of a plasmid. This might

be desirable

if a person was to put their plasmid into a bacterial cell, then grow the

bacterial cell in

bulk. After spinning the bacteria and removing the media, a basic plasmid

extraction can

be performed. This leaves the researcher with a pellet of plasmid DNA that

contains a

70

gene of interest. The sites flanking the insert is known, so unique enzymes

that will snip

the insert out of the plasmid can be used. The resulting reaction can be

separated on a gel

as described earlier. The bands can be cut and cleaned for future use.

Some techniques rely on previously determined sequence data. If a cDNA

library is made

from Cannabis, then short sequences of ~50bp from these sequences can be

attached to a

glass slide in a matrix-like array, properly called a microarray. A person

can then isolate

mRNA from any Cannabis plant and place that mRNA sample onto the microarray.

Often, the plant sample obtained has recently been under salt stress, drought

stress, or any

biotic or abiotic influence. The mRNA is then added onto the microarray. The

glass slide

containing the ~50bp fragments may contain hybridized mRNA sequences and this

can

be confirmed by using a microarray scanner. Fluorescence is observed where

there are

hybridization points. This method can provide an entire genomic expression

profile for a

plant. From this, metabolic pathways, developmental regulation, and

environmental

response genes can be studied for expression patterns and levels.

One of the newest fields of molecular biology is using RNA molecules to bind

to and

inhibit mRNA sequences from making their way to the ribosome. For this reason

the

technique has been dubbed RNA interference (RNAi). Research has since shown

that the

joining of a 20-25 base pair long RNA molecule to a complimentary mRNA

strand,

initiates a degradation pathway, destroying the mRNA. In other words, the

mRNA leaves

the transcribed gene unable to make its way to the ribosome to be translated.

Because the

mRNA molecule is the blueprint for manufacturing a protein, the cell can't

function

properly and dies.

There are potentially detrimental effects RNAi could have on Cannabis

growers. For

example, RNAi could be used as an herbicide (targeting Cannabis). This might

consist of

applying plant vectors or naturally occurring plant viruses that have an RNAi

sequence.

The vector would then need to insert the RNAi into the plant cell.

Genetically modified

plant viruses could one day carry out this process.

RNAicide, a term coined from RNAi and herbicide, might someday replace

conventional

herbicides. In the case of eradication of Cannabis fields, RNAicide would

need to be

directed at a sequence-specific (and species-specific) mRNA target, thereby

initiating the

gene-silencing pathway. This view represents an extreme case of plant

biotechnology,

and is not yet being tested.

However, rather than targeting marijuana with a pesticide, just the opposite

is possible.

The gene for pesticide resistance can be inserted into marijuana. This has

been done for

multiple crop species including soybean and corn. The gene for pesticide

resistance also

has been inserted into cotton. In fact, of all the transgenic crops produced

in the world,

pesticide resistance is the most common trait that has been exploited. At

first glance it

may seem odd that humans have inserted a gene for pesticide resistance into

the major

crop species. Further inspection reveals the logic behind this situation.

71

Throughout history pesticides have been used to fight unwanted weed and

insect species

from encroaching on cultivated food. Pesticides include both insecticides

that target

insects and herbicides that target herbaceous plants (weeds). Chemical

companies

profited from pesticides by making billions of dollars, farmers could better

control their

land, governments obtained larger profits and less land was needed to obtain

greater

yield. It was not until Monsanto, perhaps now the worlds largest

agribusiness, inserted a

gene for herbicide resistance into crops that ultimately led to such

unforeseeable profits.

The most common gene used in pesticide resistant crops is resistance to

glyphosate.

Glyphosate is more commonly known as Roundup. What glyphosate does is it

inhibits a

plant's ability to manufacture amino acids that have an aromatic ring (a six

carbon circle)

attached. By inhibiting this metabolic pathway, which is called the shikimic

acid

pathway, a plant cannot manufacture functional proteins and dies.

Subsequently, the

enzyme is called 3-enolpyruvylshikimate-5-phosphate synthase, or EPSPS for

short.

Transgenic crops with glyphosate resistance have a variant form of EPSPS and

so are not

affected by glyphosate. The glyphosate herbicide is non-specific that is it

can inhibit any

green plant from making aromatic amino acids.

If a crop species such as corn is not inhibited by glyphosate a farmer is

able to apply this

herbicide across an entire field. Since the entire crop of corn has this gene

for glyphosate

resistance only the weeds surrounding the field will be killed. This leaves

more sun,

water and soil for the crop species and allows for easier production of the

crop.

This process has large implications for marijuana growers. First, if

cultivators are

growing their crop on many acres, glyphosate-resistant Cannabis could be

sprayed with

glyphosate and reduce competition from surrounding plants. This would

ultimately yield

larger quantities and therefore may require smaller space to produce more

Cannabis.

Secondly, the US government carries out glyphosate spraying on Cannabis

crops. If

producers were growing genetically modified Cannabis, application of

glyphosate would

have no effect on the plants. In fact, the US government would be doing a

favor to

growers by limiting the surrounding vegetation. One may wonder when the

successful

drug lords will begin investing in Cannabis biotechnology.

In summary, the mechanism for glyphosate resistance has been described in

greater

detail. The molecular function of the gene for resistance, EPSPS, has also

been described

in detail. Since this gene can be inserted into plants, glyphosate resistance

is potentially

less than a year from being reality. Other herbicides sprayed on Cannabis

crops also have

known resistance genes. Therefore, it is up to the researchers working on the

betterment

of Cannabis to transform these genes, in addition to glyphosate resistance,

in order to

preserve the vast fields of Cannabis product.

72

12. Marijuana Laws, Regulations, and Education

Before beginning any Cannabis research it is important to know the laws and

regulations.

Research laws vary among countries. Some states within the US have some of

the most

stringent laws on simple possession of marijuana while other states are more

progressive.

For example, California legalized medical marijuana in the mid 1990's.

Recently there

has been legislation initiated within California and Massachusetts to

legalize marijuana to

increase state revenues, possibly providing more than a billion dollar in

revenue.

The ease people can grow marijuana is obvious. After all, it evolved as a

weed and shows

its resilience by taking up residence in waste sites and along roadsides.

Among the plant

kingdom, its large equatorial range is difficult to surpass. It seems hopeful

that research is

becoming more progressive and research on Cannabis is becoming less

restricted.

Japan has produced some of the most recent research on elucidating the THC

pathway

and potentials for THC in biotechnology (Sirikantaramas et al., 2007).

However, science

is an international phenomenon and listing all who have contributed to

Cannabis research

is far beyond the scope of this book.

In other countries, especially in the United States, governments limit or

prohibit

Cannabis research. At least in the United States, this may be due to the fact

that the

politicians are making a portion of their salaries from alcohol sales tax.

Many people

think that marijuana, if legalized for recreational purposes, might be

incredibly difficult

to regulate by a government.

Limitations have also been placed on medical marijuana clubs and

repositories, which

were routinely raided by federal officials under the Bush Administration.

Since President

Barack Obama has taken office, his administration, specifically the Attorney

General Eric

Holder, has publically announced they will not interfere with state medical

marijuana

laws (i.e., no more federal raids). The Obama Administration has seemed so

progressive

on marijuana laws that the slogan, "Yes we cannabis" has emerged. (His

popularized

campaign slogan was "Yes we can".)

Much of the debate around marijuana seems to have emerged partly from the

U.S. anti-

marijuana campaign. This misinformation has greatly distorted the science

behind

marijuana. However, informative and objective literature has been circulating

among

scientific circles on the potentials of Cannabis and its influence on the

brain.

What is currently known about the physiological influences is that

marijuana's

psychoactivity can be attributed to cannabinoids, small molecules with a

distinct

molecular conformation that bind to distinct mammalian cell receptors. The

highest

concentrations of these cannabinoids are found in Cannabis flowers. Humans

too, make

cannabinoid-like compounds internally, called endocannabinoids. We have

subsequently

evolved cell receptors (proteins on our cells' plasma membranes) for these

internally

produced (endogenous) molecules to bind and cause a cascade of biochemical

reactions.

This reaction ultimately provides the euphoric feeling, or high, after

smoking. However,

73

the binding of THC to our cells' receptors is actually due to cross-

reactivity. In other

words, it's due to sheer chance that THC binds to cell receptors that

originally evolved to

allow endogenous molecules to bind.

While the cannabinoid-like compounds in our bodies (called endocannabinoids)

elicit the

same euphoric response as THC, they have a noticeably different molecular

structure.

Still, they have enough similarity in their overall molecular structures that

THC cross-

reacts and can bind the receptors to elicit a euphoric effect. The details of

the physiology

and underlying mechanisms of reactivity have recently been outlined in

explicit detail

(Berghuis, 2007).

Previous studies, which have warned of the negative effects of smoking

marijuana, were

exaggerated with faulty claims (Ponto, 2006). On the contrary, it has been

demonstrated

that mice given cannabinoids stimulates neuronal activity within certain

regions of their

brains. Indeed, endocannabinoids have been shown to play a large role in

facilitating

neuronal growth and development (Harkany et al., 2008). I have often wondered

if high-

ranking officials suppress marijuana because of its potential to produce new

ideas and

make people feel more spiritually empowered. If people were indeed able to

think for

themselves, they would not be so heavily dependent on a government's

direction on how

to live their lives through societal servitude.

Scientifically studying how Cannabis interacts with our nervous system could

be helpful

in many ways to the public. The diminishing use of alcohol would serve a

larger benefit

to all of society. This logic has repeatedly been presented from many

different groups

trying to both prohibit alcohol and to legalize marijuana. The fact remains

that drunk

drivers, child and spousal abuse, binge drinking, violence and harsh crimes,

cancers and

liver failure, and public stupidity almost always involve alcohol

consumption. In addition

to the nearly infinite list of dangers that alcohol offers, it is a

biological toxin and is used

routinely to kill microbes on surfaces, in wounds, etc. With so many negative

effects

stemming from alcohol, one should logically expect to see politicians

embracing safer

alternatives to alcohol, such as marijuana.

Public education has largely remained a grass-roots effort to discuss the

benefits and

science of marijuana, although Oxford University Press has recently published

the second

edition of, The Science of Marijuana. Popular culture (e.g., High Times) has

also aided

the effort to spread the facts on marijuana. Taken together, these means of

education

seem to be effective enough to have allowed marijuana to persist in our

culture. With the

rise of the biotechnology of Cannabis sativa, more people will undoubtedly

become

involved in working to understand and discuss potential benefits.

My own use of marijuana has helped stimulate an interest in the sciences and

ask more

questions about life. When I was in high school my interest level in learning

was below

zero. I barely graduated my senior year. Whether I was bored or not, I can't

remember. It

was a time of confusion and fear, not knowing much about myself and listening

to what

older people were telling me to do. There was little room for independent

thought.

74

When I was finished with high school, I joined the US Army. This wasn't odd,

considering many kids from my town used that as an option for immediate

escape into

the world. The military provided comfort in that I was with people my own

age, with

similar educational and socioeconomical background, and making friends came

fairly

easily. But then I ended up with a life-changing experience while I was

serving, one so

radical that many would not believe my story and so I dare not discuss it

within the

framework of this book.

I left the military and went back to my hometown. There, I learned about the

local

university, where kids were able to take classes of their choice and

interest. I enrolled and

within a few weeks I knew that college would be one of the most stimulating

things I

may ever encounter. But then, not long after I started my freshman year, I

met someone

who smoked marijuana. He was a regular user, probably more than regular

actually. I

smoked with him a few times and then I bought a small bag from him.

It was very unfamiliar to me. It was dry, smashed, and smelly. I took it home

to the

apartment where I lived alone. I didn't touch it for a few days. I read a

little more about

what it was and learned that it was a flower from a plant. Eventually, after

I was finished

reading for my modern world civilization class, I loaded a small pipe I had

bought, went

to my living room and I took some hits. My house suddenly became very quiet.

The small

sounds of the creaky floor and the wind against the windows were very crisp,

I was very

alert. At the same time my mind seemed to be speeding through hundreds of

ideas each

second.

First I was thinking about Akbar from the ancient Middle East, then Diderot

and his

encyclopedia, and then suddenly it was my houseplants and how they were

responding to

the dim light of my living room. My mind was simultaneously brought to an

ease that I

had never felt before. These two extremes, rapid flow of thoughts and

calmness of my

mind, switched back and forth repeatedly for quite some time. Everything in

my life

seemed to suddenly make sense and my purpose became obvious. I wanted to

learn as

much as I could while in college and make the most out of my life.

I also fell in love that night with a plant called Cannabis sativa. I had

found meaning to

my life, and the smoke from my pipe had given me clarity and purpose for

college. I

wanted to study my history more, while thinking of the role marijuana played

in shaping

it. I wanted to study my human anatomy and physiology book and think about

how

marijuana travels through and is metabolized by the human body. I wanted to

study my

plant taxonomy book and figure out where Cannabis fit into the diverse

kingdom. I

wanted to learn everything I could about everything there was.

Since my undergraduate years have passed, I have smoked less and less

marijuana.

However, I have not forgotten its effect on my life. I am grateful for this

plant and in

many ways I feel I am indebted to it. It has allowed me to grasp abstract

ideas in a more

concrete way and provided me opportunities that I otherwise would have never

had. It

has given me motivation and drive to learn. I know that this is not the

experience

everyone has after smoking marijuana. Some people who are introduced to it

smoke and

75

are not motivated to do anything. For me, the best times of my undergraduate

years were

reading quietly for long hours alone in my apartment then smoking and

thinking about

what I had just read. For others, they are caught in a vicious and

unproductive cycle of

television and video games; they use marijuana to zone out, to avoid the rest

of the world.

I can't say this is wrong, but I do wonder why Cannabis has opposite effects

on each

person. We need to give more scientific study this plant, both for its

biochemistry and its

potential in biotechnology.

Biotechnology may not be limited to Cannabis. For instance, those with the

ability to

invest large amounts of money into creating their own labs and hiring

competent plant

biotechnologists, may be able to create any plant with any drug they want.

Production of

a cocaine-producing plant that is tolerant of conditions in North America

would bring

billions in drug sales. It may also wipe out communities and increase

instability among

otherwise stable regions. This is not to say Cannabis biotechnology should

not be

pursued. Its use however should remain up to the individual.

One drawback of marijuana use may be when an individual shares their pipe or

other

device with friends they may also be sharing oral diseases. A recent opinion

article

argued that there might be an increase in the rate of oral cancers among

marijuana

smokers. This may not be due to marijuana smoke; rather it is possibly due to

passing

virus particles and germs from an infected individual to an uninfected

individual

(Zwenger, 2009). For instance, oral human papilloma virus (UPV), commonly

associated

with warts in all areas of the body but now being increasingly found in the

mouths of

younger people, might be one reason for the increase in oral cancers. UPV has

previously

been linked with vaginal and oral cancers.

Therefore, marijuana smokers should be cautious about sharing with anyone,

since

detection of UPV is uncommonly reliable by sight alone. This should not

discourage one

from smoking with friends. Rather it should serve as beneficial advice. It

should serve as

a warning to anyone who cares about his or her future health and safety to

retain their

own smoking device for themselves.

Knowledge such as this should not be looked upon as depressing. Indeed,

knowledge is a

good thing to posses, whether it is about how the universe operates, the

meaning of life,

or Cannabis (which often is the meaning of life for some people).

Understanding more

about Cannabis, which is one of the most intriguing plants that humankind has

ever

discovered, could allow humans to prosper far beyond their present state.

Changing the

genetic structure could prove even more beneficial by discussing its science,

chemistry,

and importance to human mental health.

The future is bright for Cannabis biotechnology. There could be no better

time to create

transgenic plants harboring select genes. This book has touched on some of

the unique

Cannabis plants that are waiting to be created. I leave it to the student of

plant

biotechnology to decide when to bring these ideas to reality. Improving

Cannabis

through biotechnology will most likely occur within the next decade. The only

question

that remains is, who will be the first to smoke if!

76

References:

Armbruster, W. S. "The role of resin in angiosperm pollination: ecological

and chemical

considerations.," Amer J Bot (71) 1986, pp. 1149-1160.

Berghuis, P., Rajnicek, A. M., Morozov, Y. M., Ross, R. A., Mulder, J.,

Urban, G. M.,

Monory, K., Marsicano, G., Matteoli, M., Canty, A., Irving, A. J., Katona,

I., Yanagawa,

Y., Rakic, P., Lutz, B., Mackie, K. and Harkany, T. "Hardwiring the brain:

endocannabinoids shape neuronal connectivity.," Science (316:5828), 2007, pp.

1212—

1216.

Bou-Torrent, J., Roig-Villanova, I. and Martinez-Garcia, J. F. "Light

signaling: back to

space.," Trends Plant Sci (13:3), 2008, pp. 108-114.

Cantrill, S. Nobel Prize 2008: Green fluorescent protein.," Nature Chem

doi:10.1038/nchem.75, 2008.

Conrad, C. Hemp for health: The medicinal and nutritional uses of Cannabis

sativa."

1997, Healing Arts Press.

Dafny-Yelin, M. and Tzfira, T. "Delivery of multiple transgenes to plant

cells.," Plant

Physiol (145:4), 2007, pp. 1 1 18-1 128.

Harkany, T., Keimpema, E., Barabas, K. and Mulder, J. "Endocannabinoid

functions

controlling neuronal specification during brain development.," Mol Cell

Endocrinol

(286: 1-2 Suppl 1), 2008, pp. S84-S90.

Hazekamp, A., Ruhaak, R., Zuurman, L., van Gerven, J. and Verpoorte, R.

"Evaluation

of a vaporizing device (Volcano) for the pulmonary administration of

tetrahydrocannabinol.," J Pharm Sci (95:6), 2006, pp. 1308-1317.

Herer, J. "The Emperor Wears No Clothes: The Authoritative Historical Record

of

Cannabis and the Conspiracy Against Marijuana.," 2000, Quick American

Archives.

James, C. "Global Status of Commercialized Biotech/GM Crops: 2005.," 2005,

ISAAA,

Ithica, NY.

Johnston, J. S., Pepper, A. E., Hall, A. E., Chen, Z. J., Hodnett, G.,

Drabek, J., Lopez, R.

and Price, H. J. "Evolution of genome size in Brassicaceae.," Ann Bot (Lond)

(95: 1),

2005, pp. 229-235.

Kirst, M., Johnson, A. F., Baucom, C, Ulrich, E., Hubbard, K., Staggs, R.,

Paule, C,

Retzel, E., Whetten, R. and Sederoff, R. "Apparent homology of expressed

genes from

wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis

thaliana.," Proc

Natl Acad Sci USA (100:12), 2003, pp. 7383-7388.

77

Lydon, J., Teramura, A. H. and Coffman, C. B. "UV-B radiation effects on

photosynthesis, growth and cannabinoid production of two Cannabis sativa

chemotypes.," Photochem Photobiol (46:2), 1987, pp. 201-206.

Marks, L. A., Kalaitzandonakes, N., Wilkins, L., Zakharova. "Mass media

framing of

biotechnology news.," Public Under st Sci (16:2), 2007, pp. 183--203.

McCullen, C. A. and Binns, A. N. 'Agrobacterium tumefaciens and plant cell

interactions

and activities required for interkingdom macromolecular transfer.," Annu Rev

Cell Dev

Biol (22), 2006, pp. 101-127.

Mitsuda, N., Iwase, A., Yamamoto, H., Yoshida, M., Seki, M., Shinozaki, K.

and Ohme-

Takagi, M. "NAC transcription factors, NST1 and NST3, are key regulators of

the

formation of secondary walls in woody tissues of Arabidopsis.," Plant Cell

(19: 1), 2007,

pp. 270-280.

Mukherjee, A., Roy, S., De Bera, S., Jiang, H., Li, X., Li, C, Bera, S.

"Results of

molecular analysis of an archaeological hemp (Cannabis sativa L.) DNA sample

from

North West China.," Genet Resour Crop Evol (55:4), 2008, pp. 481-485.

Murashige T. and Skoog, F. "A revised medium for rapid growth and bioassays

with

tobacco tissue cultures.," Physiol Plant (15:3), 1962, pp. 473-497.

Pertwee, R. G. "Cannabinoid pharmacology: the first 66 years.," Br J

Pharmacol (147

Suppl 1), 2006, pp. S163-S171.

Pichersky, E., Noel, J. P. andDudareva, N. "Biosynthesis of plant volatiles:

nature's

diversity and ingenuity.," Science (311:5762), 2006, pp. 808-811.

Pontes, D. S., Lima-Bittencourt, C. I., Chartone-Souza, E. and Nascimento, A.

M. A.

"Molecular approaches: advantages and artifacts in assessing bacterial

diversity.," JInd

Microbiol Biotechnol (34:7), 2007, pp. 463-473.

Ponto, L. L. B. "Challenges of marijuana research.," Brain (129:Pt 5), 2006,

pp. 1081-

1083.

Reyes-Prieto, A., Weber, A. P. M. and Bhattacharya, D. "The origin and

establishment of

the plastid in algae and plants.," Annu Rev Genet (41), 2007, pp. 147—168.

Robert-Seilaniantz, A., Navarro, L., Bari, R. and Jones, J. D. G.

"Pathological hormone

imbalances.," Curr Opin \ Plant Biol (10:4), 2007, pp. 372-379.

Robinson, R. "The great book of hemp: The complete guide to the

environmental,

commercial, and medicinal uses of the world's most extraordinary plant.,"

1996, Park

Street Press, Rochester, VT.

78

Romeis, J., Meissle, M. and Bigler, F. "Transgenic crops expressing Bacillus

thuringiensis toxins and biological control.," Nat Biotechnol (24: 1), 2006,

pp. 63—71.

Sheen, J., Hwang, S., Niwa, Y., Kobayashi, H. and Galbraith, D. W. "Green-

fluorescent

protein as a new vital marker in plant cells.," Plant J (8:5), 1995, pp. 777—

784.

Sirikantaramas, S., Morimoto, S., Shoyama, Y., Ishikawa, Y., Wada, Y.,

Shoyama, Y.

and Taura, F. "The gene controlling marijuana psychoactivity: molecular

cloning and

heterologous expression of Delta 1-tetrahydrocannabinolic acid synthase from

Cannabis

sativa L.," J Biol Chem (279:38), 2004, pp. 39767-39774.

Sirikantaramas, S., Taura, F., Morimoto, S. and Shoyama, Y. "Recent advances

in

Cannabis sativa research: biosynthetic studies and its potential in

biotechnology.," Curr

Pharm Biotechnol (8:4), 2007, pp. 237-243.

Sirikantaramas, S., Taura, F., Tanaka, Y., Ishikawa, Y., Morimoto, S. and

Shoyama, Y.

"Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana

psychoactivity,

is secreted into the storage cavity of the glandular trichomes.," Plant Cell

Physiol (46:9),

2005, pp. 1578-1582.

Smith, R. "Plant tissue culture: Techniques and experiments.," 2008, Academic

Press.

Soltis, D. E., Ma, H., Frohlich, M. W., Soltis, P. S., Albert, V. A.,

Oppenheimer, D. G.,

Altman, N. S., dePamphilis, C. and Leebens-Mack, J. "The floral genome: an

evolutionary history of gene duplication and shifting patterns of gene

expression.,"

Trends Plant Sci (12:8), 2007, pp. 358-367.

Stewart, S. "Plant biotechnology and genetics: Principles, techniques and

applications.,"

2008, Wiley-Interscience.

Taura, F., Dono, E., Sirikantaramas, S., Yoshimura, K., Shoyama, Y. and

Morimoto, S.

"Production of Delta(l)-tetrahydrocannabinolic acid by the biosynthetic

enzyme secreted

from transgenic Pichia pastoris.," Biochem Biophys Res Commun (361:3), 2007,

pp. 675—

680.

Taura, F., Sirikantaramas, S., Shoyama, Y., Shoyama, Y. and Morimoto, S.

"Phytocannabinoids in Cannabis sativa: recent studies on biosynthetic

enzymes.," Chem

Biodivers (4:8), 2007, pp. 1649-1663.

Thomson, J. "Tactics for male reproductive success in plants: contrasting

insights of sex allocation theory and pollen presentation theory.," Integr

Comp Biol

(46:4), 2006, pp. 390-397.

Thorpe, T. A. "History of plant tissue culture.," Mol Biotechnol (37:2),

2007, pp. 169-

180.

79

Vaughan, D. A., Balazs, E. and Heslop-Harrison, J. S. "From crop

domestication to

super-domestication," Ann Bot (Lond) (100:5), 2007, pp. 893--901.

Venter, M. "Synthetic promoters: genetic control through cis engineering.,"

Trends Plant

Sci (12:3), 2007, pp. 118-124.

Wang, Q. and Guanming S. "Industrial Hemp: China's experience and global

implications.," Rev Ag Eco, (21:2), 1999, pp. 344-57.

Yuan, Z.-C, Haudecoeur, E., Faure, D., Kerr, K. F. and Nester, E. W.

"Comparative

transcriptome analysis of Agrobacterium tumefaciens in response to plant

signal salicylic

acid, indole-3 -acetic acid and gamma-amino butyric acid reveals signalling

cross-talk and

Agrobacterium-plant co-evolution.," Cell Microbiol (10:11), 2008, pp. 2339-

2354.

Zwenger, S. "Bogarting that joint might prevent oral F£PV among Cannabis

users.," Curr

Oncol. (16), 2009. In Press.

80

Appendix A

Presented here is a representative list of genes with the potential to be

used for

transforming (or up-regulating) into Cannabis plants. Gene symbols are given

along with

the complete name, which also may describe the function. Although these were

originally

described in the model plant Arabidopsis thaliana, they most likely have

analogous

sequences in Cannabis sativa. It should be noted that this is not an

exhaustive list and

many other genes could be transformed into Cannabis. For example, the gene

for the

ability to make tendrils, which are simply modified leaves, is not listed.

Gene Symbol

Complete Gene Name

ABC

Aberrant chloroplasts

ABS

Abnormal, aborted seeds

ACW

Altered cell wall

ADO

Adagio

AESP

Separase

AFO

Abnormal floral organs

ALAC

Alarm clock

ALE

Abnormal leaf shape

AN

Angustifolia

AS

Asymmetric leaves

BAL

Ball

BAM

Big apical meristem

BDY

Buddy

BIF

Bifid stigma

BLB

Blueberry

BNS

Bonsai

BPE

Bigpetal

BSH

Bushy plants

BST

Bristled

BUD

Bulkhead

BUS

Bushy

CA

Caespitosa

CAF

Carpel factory

CBB

Cabbage

CEL

Callus expression of RBCL

CHP

Chlorophyll mutant

CLV

Extra carpels

CLY

Early flowering

COD

Cone head

CTS

Comatose

CUT

Altered epicuticular wax

CYL

Cyclops

DFL

Dwarf in light

81

DIS Distorted trichomes

DLS Delayed leaf senescence

DM Dangerous mix

DPR Drought and pathogen resistant

DRA Dracula

DRO Drought tolerant

DSR Dark green leaves, stunted roots

DVL Devil

DWG Dwarf gigantica

DYA Dyad

EAF Early flowering

ECL Early curly leaf

EEP Early extra petals

ELF Early flowering

ELG Elongated

ELL Extra long lifespan

ER Erecta

ERH Ectopic root hair

ERT Early trichomes

ESI Elongated, stout internodes

ESK Eskimo

EXC Extra cells

EXI Exigua

FAC Embryonic factor

FAF Fantastic four

FAX Fewer axillary branches

FDH Fiddlehead

FE Late flowering

FEY Forever young

FIT Flower in flower

FIL Filamentous flower

FKD Forked

FLH Flowering H

FLK Flaky pollen

FTR Fat root

GCT Grand central

GGL Gargoyle

GI Gigantea, late flower

GLM Gollum

GLO Glabrous, chlorotic

GMB Gumby

GRA Grandifolia

GRE Glyphosate responsive

GRM Gremlin

GTR Glassy trichome

HAP Hapless

82

HBT Hobbit

HCA High cambial activity

HIC High carbon dioxide

HIO High oil (altered seed content)

HOR High expression of abiotic responsive gene

HRT Heartless

HST Hasty

HYV High vigour

IAD Increased apical dominance

ICA Icarus

ICU Incurvata

IKU Haiku

IMP Impotent

IRN Yellow-green

ITN Increased tolerance to NaCl

IVR Invasive root

JAG Jagged

JAW Serrated leaves

JSN Jason

KAK Kaktus

KEG Keep on going

KEU Keule

KIP Kinky pollen

KJK Kojak

KYP Kryptonite

KNB Knobhead

LAD Late anther dehiscence

LEM Leaf morphogenesis disrupted

LHW Lonesome highway

LIT Lions tail

MAA Magatama

MAD Male gametophytic defective

MAL Marbled leaves

MFO Multifolia many leaves

MIC Mickey

MOD Mosaic death

MSH Many shoots

NOC No cotyledons

NOT Loves-me-not

NPG No pollen germination

NSM Insomniac

NZZ Nozzle

OLT Old timer

OMO Odd man out: male meiosis defective

ORB Orbiculata

PAC Pale cress

83

PAN

Extra perianth organs

PBH

paintbrush

PBO

Peek-a-boo

PBR

Polar bare

PCK

Peacock

PCL

Phytoclock

PEP

Pepper

PHD

Pothead

PI

Pistillata

PIC

Pinocchio

PKL

Pickle

PLT

Plethora

PLU

Pluto

PNT

Peanut

POL

Poltergeist

PRA

Prairie

PRK

Peter Parker

PRS

Pressed flower

QBL

Quibble

QRT

Quartet

QUA

Quasimodo

RAT

Resistant to Agrobacterium transformation

RBE

Rabbit ears

RBY

Ruby

RCK

Rock-n-rollers

RCU

Recurvata

RD

Rotundata

RED

Red light elongated

RFI

Rastafari

RGM

Rapid germination

RLP

Revertant for leafy petiole

RNT

Runt

RON

Rotunda

ROU

Rouge

RTY

Rooty

RUG

Rugosa

SAB

Sabre

SAG

Sagittatus

SAW

Sawtooth

SCA

Scabra

SCF

Scarface

SCN

Supercentipede

SDD

Stomatal density, distribution

SEA

S errata

SHD

Shepherd

SHI

Short internodes

84

SHN

Shine

SHV

Shaven

SLK

Seuss-like

SLO

Slowcoach

SLOMO

Slowmotion

SMB

Sombrero

SML

Stamen loss

SNO

Snoball

SNV

Supernova

SPCH

Speechless

SPK

Spock

SPR

Spiral

SPS

Supershoot

SPT

Spatula

SRB

Shoot and root branching

SSE

Shrunken seed

STA

Satchel

SUP

Superman

SWE

Sweetie

TARA

Tarantula

TASTY

Tasty

TAX

Trichome anthocyanin expansion

TBR

Trichome birefringence

TCU

Transcurvata

TDL

Trichome density locus

TFA

Things fall apart

TIL

Tilted

TIN

Tinman

TIO

Two-in-one

TLZ

Tlazolteotl

TMM

Too many mouths

TNY

Tiny

TOAD

Toadstool

TOP

Tower of Pisa

TPL

Topless

TRL

Troll

TRN

Tornado

TRY

Triptychon

TWD

Twisted dwarft

UCN

Unicorn

ucu

Ultracurvata

UFO

Unusual floral organs

ULA

Hula

ULT

Ultrapetala

UMA

Umami

URM

Unarmed

85

URO

Upright rosette

UTC

Up the creek

Uzi

Unzipped

VAR

Variegated

VCH

Vertically challenged

VEP

Vein patterning

VHE

Van Helsing

VHI

Vascular highway

VIR

Virescent

WAG

Wag

WAR

Wax restorer

WCO

White cotyledons

WDY

Woody

WER

Werewolf

WHG

Warthog

WIG

Wiggum

WLC

Wavy leaves, cotyledons curled back

WOL

Wooden leg

WOW

Wonderwoman

WVS

Wavy sepal

WYR

Wryd

XS

Extra-small sisters

XTG

Extinguisher

YAB

Yabby

YAK

Yakka

YDA

Yoda

YEL

Yellow

YI

Yellow inflorescence

YOR

Yosemite resistance

YSV

You're so vein

YUC

Yucca

ZEU

Zeus

ZIG

Zig zag stem

ZLL

Zwille

ZPL

Zeppelin

ZPY

Zippy

ZWG

Zwergerl

ZWI

Zwichel

86

Appendix B

Provided here is a small representation of the many biotechnology companies

that are

currently selling useful products for plant biotechnology research. Each

company varies

by product and location, while some companies specialize in only certain

products.

Needless to say, there are many other companies in addition to the ones

listed here.

-Bio-Rad, http://www.bio-rad.com

This company sells electroporation equipment, although these devices are

often very

expensive. They also sell a huge variety of molecular research tools and

reagents for labs

ranging from labs with high-tech needs to high school labs.

-Carolina Biological Supply Company, http://www.carolina.com

This is primarily a company that specializes in classroom kits and products.

However,

they also sell callus initiation media, containers and dishes for plant

tissue culture, and

pre-made sterile media.

-Eppendorf, http ://www. eppendorf . com

This is perhaps one of the world's largest suppliers of biotechnology

equipment and sells

plastic-ware and pipettors to distribute cells and small amounts of liquid.

-Lucigen Corporation, http://www.lucigen.com

This international company sells different kits to splice and cut genes into

different

vectors and have established themselves as a reliable source for

biotechnology research.

Additionally, they offer cDNA library construction.

-pGreen, http://www.pgreen.ac.uk

pGreen is part of the biotechnology resources for Arable Crop Transformation

(BRACT),

located in the UK. This is one of the best resources for purchasing strains

of

Agrobacterium. Agrobacterium cells that have been transformed with GFP can be

purchased here as well.

-Hoffmann-La Roche, http://www.roche.com

Although best known for its biomedical supplies, this Swiss company is a

giant in the

biotechnology industry and sells enzymes and cells, which may be pertinent to

some

experiments in plant biotechnology.

-Sentryair Purification Systems, http://www.sentryair.com

This company specializes in providing sterile working conditions, that is

crucial in plant

biotechnology experiments. They offer a huge selection of laminar flow hood

models and

sizes.

Sigma-Aldrich, http://www.sigmaaldrich.com

A huge chemical supply company with locations in multiple countries that

sells

chemicals of all kinds. Some of its newest products focus on RNAi research.

87

-Streamline Laboratory Prodcuts, http://www.streamlinelab.com

This company offers laminar flow hoods, PCR hoods, ductless hoods, and tissue

culture

hoods. They supply many different models with a variety of price ranges.

88

Glossary

2,4-dichlorophenoxyacetic acid (2,4-D)- an auxin hormone that causes cell

division and

root formation

abscisic acid- a cytokinin used to promote cell division and shoot formation

achene- a type of fruit that has

agar- polysaccharide used to solidify media

Agrobacteirum- bacteria used to infect plants and transfer foreign DNA

alternation of generations- the life cycle of plants that alternates between

a haploid

gametophyte and a diploid sporophyte

annual- a plant that lives for only one year

antibiotic- chemical that can inhibit cells from growing

apical dominance- the case where a terminal bud suppresses the growth of

lateral buds

archaea- one of the three domains of life that is composed of extremophiles

asexual propagation- process where cuttings of a plant can be re-grown into

complete

organisms

Asteraceae- the sunflower or composite plant family

auxin- plant hormone involved in root formation and used in tissue culture

bacteria- one of the three domains of life that contains most bacteria; a

single celled

prokaryote

biotechnology- the process where cells are manipulated for desirable genetic

outcomes

bud- a general term for a flower

callus- an undifferentiated mass of plant cells

callus media- growth substrate used for growing bits of plant stem into

calluses

calyx- term used for that includes all of the sepals

Cannabaceae- the Cannabis and hops plant family

89

Cannabis sativa- the scientific name for marijuana plant

carbohydrate- an organic molecule such as cellulose or glucose that can be

used for

energy

carpel- the female reproductive part of the flower

cDNA library- a collection of sequences that represent actively transcribed

genes

cell- the smallest unit of life; many cells constitute a tissue

cell wall- the outer layer of the cell that serves to protect and maintain

the contents of the

cell

cellulose- large polysaccharide that is the main constituent of plant cell

walls

central dogma of biology- fundamental process of biology where a gene is

transcribed

into mRNA, which is then translated into a protein

chromosome- the piece of DNA that harbors genes, it is composed of many

nucleic acids

co-cultivation- process in plant tissue culture that allows time for the

Agrobacterium to

infect the callus

complimentary DNA (cDNA)- reverse transcribed mRNA that represents an

expressed

gene

corolla- term for all the flower petals combined

cytochromes- plant proteins responsible for detecting various wavelengths of

light

cytokinins- plant hormones that can induce cell division and shoot formation

cytoplasm- the intracellular matrix in which organelles, proteins and

molecules are

suspended in

deoxyribonucleic acid (DNA)- a polymer that is the genetic material of all

life

dimethylallyl pyrophosphate/diphosphate (DMAPP)- molecule used in the

synthesis of

terpenes

diploid- having two copies of each chromosome

electroporation- process where Agrobacterium is induced to take up foreign

DNA using

an electric shock

90

endosymbiosis- an even that occurred early in the evolution of life and led

to eukaryotic

organisms

enzyme- a protein that acts as a catalyst to speed up a reaction

epidermis- the outermost layer of plant tissue

ethylene- a small gaseous molecule that is also a plant hormone that speeds

fruit ripening

eukaryote- an organisms that has double-membrane structures and a nucleus

explant- term used for the bits of plant stem that are placed onto the

culture media

family- a classification groups that many plant taxonomists are familiar with

flower- the reproductive structure of angiosperms

funiculus- the small stalk that connects the seed to the pericarp

gene- sequence on DNA that can code for a protein

gene gun- device used to transfer foreign DNA into cells using high velocity

microbeads

gene stacking- transferring many foreign genes simultaneously

genome- the complete set of genes an organism posses

gibberellins- plant hormones that can increase height of a plant

glucose- a carbohydrate monomer that is used for energy or in biosynthesis to

create

larger polymers

green fluorescent protein (GFP)- a barrel-shaped protein

haploid- having a single copy of a gene

heat shock- process of briefly heating a bacterium to make it take up foreign

DNA

hemp- a low THC-containing Cannabis plant known for its tough fibers

homology- having similar sequence or structure in two different species

indole-3 -acetic acid (IAA)- an auxin plant hormone that stimulates root

production and

cell division

isopentenyl pyrophosphate/diphsphate (IPP)- a carbon building block used in

terpene

91

biosynthesis

isoprene- a five carbon molecule, which is often the product of terpene

degradation

kanamycin- antibiotic used to select for transgenic calluses

kilobase (kb)- a thousand bases

kingdom- one of the highest ranks of classification, which includes plants,

fungi, animals

and protists

laminar flow hood- an enclosed chamber that uses a negative air pressure to

maintain

sterile working conditions

Leguminosae- plant family of beans

lignification- the process of laying down lignin in the cell wall

lignin- a polysaccharide that gives strength and rigidity to the plant cell

lipid- one of the four macromolecules of life that are the main constituents

of cell

membranes

meristematic region- location of actively dividing cells

messenger RNA (mRNA)- the molecule synthesized from the DNA template used to

make a protein

mevalonate- the end product of the mevalonate terpene pathway that occurs in

the

cytoplasm

microbe- a microscopic organism, usually refers to either bacteria or fungus

molecule- a compound made up of multiple elements, e.g. a water molecule

morphology- the overall appearance or shape

morph- abbreviation for morphology

Musharige-Skoog (MS) media- the most commonly used plant tissue culture media

for

developing calluses into plants

nanometer (nm)- a billionth of a meter

northern blot- technique used to confirm expression of a gene

92

nucleotide base- component of nucleic acids that can be either adenine,

guanine, cytosine,

thymine, or uracil

nucleus- the area of a eukaryotic cell where chromosomal material is stored

organogenesis- the process by which totipotent cells develop into shoots and

roots

perennial- a plant that lives more than one year

pericarp- the outer layer of the fruit

petal- floral whorl in plants often colored to act as an attractant

Petri dish- plastic or glass plate used to culture or keep cells

phenolic ring- a circularized six carbon molecule

photoperiod- the length of daylight that is one method plants use to detect

seasonality

photosynthesis- the process of converting radiant energy into chemical energy

plasmid- an extra chromosomal piece of DNA, often circular in shape

plastid- a plant organelle in the cytoplasm that can make or store food

polymerase chain reaction (PCR)- a series of heating and cooling that results

in

amplification of a gene product

polysaccharide- a polymer of sugar subunits

prokaryote- a single celled organism that lacks a nucleus; a bacteria

promoter- region of a gene that helps dictate the rate at which mRNA is made

protein- a polymer of amino acids that is often an enzyme

reporter gene- a gene used in biotechnology to confirm transformation

resin- a complex mixture of plant secondary metabolites in a liquid matrix

reverse transcription- process where an mRNA molecule is made back into DNA

root hairs- often microscopic protrusions of the roots that increase surface

area

secondary xylem- wood

sepal- a subunit of the calyx; the floral bract at the base of most flowers

93

southern blot- molecular biology tool that allows detection of a gene

species- the classifying unit in biology that falls under genus

spore- a microscopic asexual unit capable of generating an entire organism

stamen- the male reproductive part of a flower

terpene- a large class of plant secondary metabolites

tetrahydrocannabinol (THC)- the main psychoactive component of Cannabis

THCA synthase- the enzyme responsible for converting cannabigerolic acid to

THCA

tissue- similar cells working together

tissue culture- technique where plants can be grown in vitro

totipotency- having the capability to turn into any type of cell

transcription- conversion of DNA to mRNA

transcription factor- small protein that helps regulate transcription

transfer DNA (T-DNA)- part of the DNA that is transferred from Agrobacterium

to a

plant cell

transfer RNA (tRNA)- small RNA molecule that carries the amino acid to the

site of

protein synthesis

transgenic- term used for an organism that has been genetically modified

transpiration- process where water moves from roots and through the xylem and

out of

the stomata

trichomes- modified epidermal cells that can help in water retention

tween20- a mild detergent used to wash freshly cut stems

up-regulation- process where a gene is expressed at a higher rate

western blot- method used in molecular biology to study proteins

xylem- part of the vasculature of plant that conducts water

94

GGTCTCGAAACJLTTGGAAG<yUirrTTCAACATTG<^TACTGGGCCAGTCTAAAACTTK^TAAAAAaCCGTTAA«

. i. l"l 'J . -"1 AGATCAAG GGCAACATCTGCAATTGTTAAAGG GAGC AG GC IV _' . G

iAGCAGGGTCTrGCCCATTAXTGTAAAGGATT'l rAAATACCCCGI rCAC _Y.l

I hope you enjoyed this scientific-based book on the exciting field of plant

biotechnology

with a special focus on its relationship with Cannabis sativa, commonly known

as

marijuana. This world-renowned herb has captured the interest of nearly every

culture on

every continent for hundreds, and in some instances, thousands of years.

Although, now

in the twenty first century, crop plants are being genetically modified to

better suit the

needs of society, marijuana has not received the same level of attention.

This book describes the merging of two important subjects, marijuana and

plant

biotechnology. Marijuana's role in the biotechnology age is outlined and

described in this

book with the equal hopes of encouraging research to improve this plant and

to inspire

young people to pursue a lifetime of learning.

About the Author:

Sam is a graduate student studying plant biotechnology at the University of

Northern

Colorado. Although his research focuses on plant terpenoids, he has secondary

interests

that include astronomy, music, and the role of science in society.

95