the construction of gfp fusion genes for transgenically ......olfactory formation will then be...

Christine has taken advantage ofmany on-campus resources thatsupport undergraduate researchat UCI. She first got involved inresearch in 2000, as part of theBridge to Biomedical ResearchProgram. In the following aca-demic year, Christine began herown project, for which shereceived a UROP grant. Shepresented her findings at the2002 UCI UndergraduateResearch Symposium and forthe School of BiologicalSciences’ Excellence inResearch Program. She hopesto continue her research in anM.D./Ph.D. program and oneday practice medicine. Christineis active on campus as a mem-ber of the American MedicalStudent Association, and offcampus as a volunteer in theemergency room of GardenGrove Hospital. Two types of cells populate the nervous system: neurons and glial

cells. In the traditional view, glial cells are primarily supporting cellsthat function in simple ways to support the neuronal signalingunderlying nervous system function. Recent studies have revealedunexpectedly direct and complex interactions between glial cellsand neurons, however, and indicate that glial cells may undergo pro-found changes in structure in the course of their normal activity.

Christine Vo’s work enables this class of cells to be imaged and studied at the singlecell level in living organisms. Her work sets the stage for experiments now beginningto study glial patterning in the central nervous system of the zebrafish. Christine’sexample shows how intellectual curiosity, hard work, and a commitment by UCIundergraduates can help establish new research directions for the laboratory in whichthey work.

Key Te r m s

Fusion Genes Glial Fibrillary AcidicProtein (GFAP) Gene

Glomerulus/Glomeruli Green Fluorescent Protein (GFP)

Olfactory Bulb

The Construction of GFP FusionGenes For Transgenically LabeledGlial Cells in Zebrafish

Christine VoBiological Sciences

The olfactory bulb is the brain region responsible for the sense of smell. Previousstudies suggest that glial cells play an important role in the formation and pat-

terning of the olfactory bulb. This project was conducted to further investigate theroles and behaviors of glial cells in olfactory bulb formation. Zebrafish were used dueto their transparent anatomy and rapid rate of development. The primary experi-mental approach was to construct fusion genes to transgenically label glial cells withgreen fluorescent protein (GFP). To accomplish this, the promoter region of the glialfibrillary acidic protein (GFAP) gene, which encodes a protein specifically expressedin glial cells, was isolated by screening a zebrafish genomic DNA library via poly-merase chain reaction (PCR). Subsequent restriction mapping and Southern blothybridization were used to localize the promoter region of GFAP within the PCR-positive clones. A GFP fusion gene was constructed from a vector containing theGFP gene and another vector containing a polylinker and polyadenylation site. In sub-sequent experiments, the fusion gene construct will be injected into zebrafish embryosand screened for GFP expression. The movement of the labeled glial cells duringolfactory formation will then be visualized in living embryos under the confocalmicroscope. These future studies will serve to further elucidate the involvement ofglial cells in olfactory bulb development.

5 1T h e U C I U n d e r g r a d u a t e R e s e a r c h J o u r n a l

A u t h o r

A b s t r a c t

F a c u l t y M e n t o r

Oswald StewardCollege of Medicine

Introduct ion

The sense of smell is mediated by a region of the braincalled the olfactory bulb. This structure possesses hundredsof processing units, called glomeruli, arrayed on its surface.These spherical structures contain the sites of synaptic con-tact between sensory neurons from the nose and projectionneurons connecting to higher levels of the brain. In addi-tion, there is a layer of glial cells that separates glomerulifrom each other. During olfactory function, each glomeru-lus responds to a specific set of odorants. The position ofglomeruli that respond to the same set of odorants is con-served between different individuals (Mombaerts et al.,1996). Ultimately, the brain relies on this stable pattern ofglomeruli in order to generate olfactory perceptions. Inorder to study the formation of the olfactory bulb, it isimportant to understand how glomeruli are formed andarranged in the correct spatial pattern.

Previous studies indicate that glial cells participate in theformation of the olfactory bulb, and more specifically arerequired for glomerular development (Tolbert et al., 1989).In insects, removal of glial cells by irradiation causes imma-ture glomeruli to stop development and rapidly disassemble.Circumstantial evidence suggests that glial cells may also berequired for very early stages of insect glomerular develop-ment. In rodents, the possible initiating step in glomerularformation may occur when glial cells accompany sensoryaxons as they project to their nascent targets. Moreover,some populations of glial cells change shape and orienta-tion near the future sites of glomerular formation (Valverdeet al., 1992). Other experiments by Bulfone et al. (1998) sug-gest that glial cells may actively participate in the patterningof glomeruli across the surface of the bulb. The mutation-al removal of two of the principal cell types of the olfacto-ry bulb, projection neurons (also known as mitral cells) andinhibitory neurons, clearly showed that these olfactory bulbcell types are not involved in glomerular patterning. Asthese cells do not contribute to glomerular patterning, theremaining cell types must instead contribute spatial infor-mation for the patterning of the bulb. Taken together,these studies strongly support a model of olfactory devel-opment in which glial cells are the most likely candidates forcontributing essential spatial information used to constructthe stereotyped glomerular map.

The hypothesis of this project is that glial cells not onlycontribute to the formation of the olfactory bulb in gener-al, but also actively participate in the patterning of the intri-cate sensory map contained within the bulb. The zebrafishembryo is a suitable system in which to study these pro-

cesses due to its transparent anatomy and fast rate of devel-opment. In addition, the stereotyped olfactory sensory mapcan be imaged in living zebrafish during embryonic devel-opment. Using zebrafish, this hypothesis will be addressedby visualizing the movement of glial cells during the pat-terning of the olfactory bulb, and ultimately by specificallymanipulating glial cells in living embryos. The experimentalapproach was to transgenically label glial cells with greenfluorescent protein (GFP). The first step in this approachwas to isolate the promoter from glial fibrillary acidic pro-tein (GFAP) gene that encodes a protein specificallyexpressed in glial cells. GFAP is typically expressed in astro-cytes, a glial cell subtype, and has been previously clonedfrom zebrafish (Dynes, unpublished data). This promoterregion was fused to the GFP gene’s open reading frame andthe resulting construct will be used for generating trans-genic zebrafish.

Methods and Mater ia ls

P1 Artificial Chromosome Library Organizationand PCR ScreeningThe P1 Artificial Chromosome (PAC) library (obtainedfrom C. Amemiya) was constructed with Sau 3A partially-digested zebrafish genomic DNA (average insert fragmentsize of 115 kb) that was cloned into the PAC vectorpCYPAC 6. The library contains 271 pools of clones with384 clones in each pool. The pools were arrayed in a matrix,and those pools lying along each row and column weremixed to form individual superpools (17 horizontal and 16vertical superpools).

Basic molecular biology techniques were performed accord-ing to Maniatis et al. (1982). Four different primers, PCR 1-PCR 4, were designed to bind to the GFAP 5' untranslated-region (UTR). GFAP sequences were amplified viaPolymerase Chain Reaction (PCR) using a HybridOmnigene PCR machine with the designed primers andFastStartTaq polymerase (Roche). Library fractions wereamplified using a 55 °C annealing temperature and either 35or 39 cycles. Fragments amplified from the PAC librarywere size-separated using agarose gel electrophoresis andcompared to fragments amplified from genomic DNA(positive control) and 1 kb ladder (Life Technologies). PAClibrary pool DNA for PCR screening was isolated using anEppendorf DNA preparation kit. After positive cloneswere identified, filters for hybridization were custom-spot-ted using a programmable spotter. The filters werehybridized, washed at high stringency, and exposed asdetailed below.

52 T h e U C I U n d e r g r a d u a t e R e s e a r c h J o u r n a l

TT H E CC O N S T R U C T I O N O F GG F P FF U S I O N CC E L L S F O R TT R A N S G E N I C A L L Y LL A B E L E D GG L I A L CC E L L S I N ZZ E B R A F I S H

Restriction Mapping and Southern BlotHybridizationRestriction digests of positive PAC DNA were size-separat-ed on an agarose gel and blotted onto a nylon membrane.The GFAP 5' UTR hybridization probe was isolated by PCRand radioactively labeled with 32P-dCTP using the randomhexamer method (TaKaRa). Next, the labeled probe andhybridization solutions (formamide and 3x SSC) were addedto the membranes for hybridization at 37 °C. Afterovernight hybridization, filters were washed at 37 °C at highstringency and the hybridized fragments were detectedusing a phosphorimager (Molecular Dynamics).

Construction of Promoter-testing Vector CV-1 andGFAP-GFP Fusion GeneVector JLD 111 (Dynes, unpublished) contains the EF-1apromoter, IRES region, unc-76, EGFP gene, and Ampicillinresistance marker. Vector pEGFP-NI (CloneTech) containsthe EGFP gene and a multiple cloning site. These vectorswere cut with Xho I and Not I restriction enzymes, and thegenerated fragments were purified and ligated together usingTaKaRa ligation kit. The ligation mixture was transformedinto the Escherichia coli strain DH5a, and the construct wastermed CV-1. To clone a promoter fragment into this vec-tor, CV-1 was cut with Nco I and Sac I. A 10 kb fragmentof the PAC positive clone 239-9P was generated by cuttingwith Nco I. The digested fragment was gel-purified and fur-ther digested with Sac I. The GFP gene was ligated to theGFAP promoter sequence from the PAC and transformed asabove, resulting in the clone 2.0 GFAP-CV1.

In situ HybridizationSolutions and reagents for in situ hybridization were preparedusing Schilling’s laboratory protocol (personal communica-tion). Zebrafish embryos at 36 hr post-fertilization werefixed in 4% paraformaldehyde overnight at 4 °C. Theembryos were dehydrated in methanol, re-hydrated, andhybridized with an RNA probe. The RNA probe was madeby in vitro transcription using digoxigenin-labeled nucleotides.The detection system contained digoxigenin antibody cou-pled to alkaline phosphatase, 4-nitroblue tetrazolium chloride(NBT), and 5-bromo-4-chloro-3-indolyl phosphate (BCIP).The stained embryos were then visualized for GFAP expres-sion using bright field and Nomarski microscopy.

Results

Screening the PAC Library Using PCR andSouthern Blot HybridizationPolymerase chain reaction (PCR) was used to screen thelibrary for positive pools containing the GFAP promoter

gene sequence. Initially, the superpools were screened inorder to identify potential positive pools. Once positivepools were identified, they were screened by hybridizationto identify the individual positive clones. For these experi-ments, PCR amplification of zebrafish genomic DNA wasused for the positive control, and PCR amplification of amixture without DNA was used for the negative control.

53T h e U C I U n d e r g r a d u a t e R e s e a r c h J o u r n a l

C h r i s t i n e V o

5 end cDNA → PCR 1 → PCR 3

CCACGCGTCCGAAAGCAGAGCAACTCCGGAGTAACTCAGAAGACTGCAAACCAACTCTTTAG

CACGAGGGTATCAATAGGATTTTCTCTGACTCACTGTGAAAAGAGGCAGTCAGGAGACTGGCT

GGACAAGCACCAAACAATTGCGGGCTCACAAACACCCCCTCGGCCTTTGCCCTCCCCATCAGA

CCCCCCCTTTCTCTTTCACCCCCCACATCAACTCTATAAAAACCCAGAGTTCACCCCCACTCGA

TCTCATTCTCCTCCACCATGGAGTCCCAGCGTTCCTTCTCATCC…

← PCR 2 START ← PCR 4

Primer combination Genomic Size (bp) cDNA Size (bp) Difference (bp)

1+2 315 247 68

1+4 345 275 70

3+2 222 78

3+4 325 250 75

300

/

Figure 1The GFAP 5' UTR primer binding sites and the expected sizes of theamplified fragments. The genomic sizes are derived from theagarose gels in Figures 2 and 3.

Figure 2(The following agarose gel pictures are in the invertedcolor format to make themmore legible.) Comparison ofPCR-amplified fragments fromcDNA and genomic DNA tem-plates, and titration of genom-ic template DNA. Positive con-trol is from the promoter regionof a zebrafish odorant recep-tor. Asterisk (*) indicates a 1kb ladder (Life Technologies).

Figure 3 PCR-amplification of genomicDNA with four different primercombinations (PCR 1-PCR 4).Asterisk (*) indicates a 1 kbladder (Life Technologies).

All four pair-wise combinations of primers (PCR 1-PCR 4)were then used to amplify the 5' UTR region of GFAP.These primer combinations amplified fragments that wereabout 70 bp larger than predicted from the cDNAsequence. This finding was consistent with the presence ofa 70 bp intron in the 5' UTR (Figures 2 and 3). Usingprimers PCR 1 and PCR 2, 8 positive superpools (2, 5, 7, 8,16, 23, 24, 32) were identified (Figure 4).

The four potential positive pools (90, 104, 239, and 254)were identified in subsequent PCR screenings using differ-ent primer combinations (Figures 5 and 6). Individualclones from these positive pools, 384 clones per pool, werespotted in pairs onto a filter and screened using radioactivehybridization.

The film exposure showed pairs of spots that were used toidentify positive clones (Figure 7). The three identified pos-itive clones were 90-12M, 104-20C, and 239-9P. Cloned239-9P was randomly selected for further study.

Using restriction mapping and Southern blot hybridization,the proximal portion of the promoter region in the positivePAC clone 239-9P was identified (Figure 8). A GFAP 5'UTR probe hybridized to a 10 kb Nco I and a 2 kb Nco I -Sac I fragment. These fragments were chosen for sub-cloning and testing because they were small enough to becloned easily, yet large enough to potentially contain theentire set of cis-acting regulatory sequences. In addition, bysumming the sizes of fragments generated by restrictionenzyme digestion, the genomic DNA insert size wasapproximated as 75 kb. Analysis of Nco I - Not I doubledigest identified the fragments at the ends of the genomicDNA insert. These fragments are termed junction frag-ments and are 6 and 3.5 kb in size.

Two plasmids were made for testing promoter activity in theGFAP-hybridizing restriction fragments. The first vectorconstruct was CV-1, which is composed of Xho I - Not Ifragment of vectors JLD 111 (containing the polylinker andpolyadenylation sites) and pEGFP-NI (containing the GFP



Figure 7Radioactive hybridization of arrayed clones from positive pools 90,104 and 239.

Figure 5PCR screening of posi-tive pools with differentprimer combinations.Positive pools are num-bered (90, 254).Asterisk (*) indicates a1 kb ladder (LifeTechnologies).

Figure 6PCR screening of posi-tive pools 104 and 239with different primercombinations. GenomicDNA, bacterial DNA andnegative PAC DNA areused as controls.Asterisk (*) indicates a1 kb ladder (Life Tech-nologies).

Figure 4PCR screening of thezebrafish genomic PACsuperpools: 1-17 verti-cal superpools and 18-33 horizontal super-pools. Arrows indicatethose positive super-pools that were ultimate-ly confirmed byhybridization. Asterisk(*) indicates a 1 kb lad-der (Life Technologies).



gene region). The 2.0 kb Nco I - Sac I fragment was fusedto EGFP in CV-1 at the start codon, which is overlapped byan Nco I site. This clone, 2.0 GFAP-CV1, will be injectedinto zebrafish blastomere in future experiments to test forpromoter activity.

Parallel to the GFP fusion gene construction, in situhybridization was performed to visualize the protein expres-sion of GFAP mRNA by using an RNA probe. The stainedembryos were visualized for GFAP expression using brightfield and Nomarski microscopy. GFAP expression wasrobust in the developing forebrain, midbrain and hindbrainregions, as well as in the spinal cord when compared to thenegative control embryos.

Discussion andConclusions

The initial approach of this project wasto localize and isolate the promoterregion of the GFAP gene from a PAClibrary. In these experiments, we saw ahigh level of background amplification,potentially due to contamination, butultimately positive pools and superpoolscould be identified. In retrospect, itappears that there was a contaminationof one of the PCR reagents. The size ofthe contaminating fragment was consis-tent with the amplification using thecDNA as a template. In order to avoidthis problem, four different combina-tions of primers were used in the subse-quent screening processes. Based on thesize difference between the fragmentsamplified for cDNA and genomic DNA,we concluded that there was an intronwith an approximate size of 70 bp in thegenomic 5' UTR of GFAP. Ultimately,four potential positive pools were identi-fied, but pool 254 was excluded fromsubsequent processing due to an error inidentifying the pool number. The identi-fied positive pools and clones potentiallycontain the promoter of the GFAP gene.

Restriction mappings and Southern blothybridization indicated that the GFAPpromoter is at least partially containedwithin the 10 kb Nco I fragment.Because additional junction fragments of

6 and 3.5 kb lie between the 10 kb Nco I fragment and thePAC vector the size of the promoter fragment contained inclone 239-9P is 13.5 kb at minimum. Fragments in the 2-13kb size range are expected to be large enough to contain allnecessary cis-acting DNA sequences to recapitulate GFAPgene expression. This expectation is based on the findingthat a 2.2 kb 5'-flanking sequence from the human GFAPgene was sufficient to direct astrocyte-specific expression intransgenic mice (Brenner et al., 1994). In addition, the con-struction of GFP fusion genes (Figure 9) was simplified bythe finding of an overlapping Nco I site at the start codonof both GFP and GFAP. Currently, zebrafish embryos arebeing injected with 2.0 GFAP-CV1 vector in order to deter-mine whether the 2.0 kb Nco I - Sac I fragment is able torecapitulate the GFAP expression pattern.

500 bp 1000 bp 1500 bp 2000 bp 2500 bp 3000 bp 3500 bp

MCS GFAP Promoter Insert GFP Poly-A

Sac I Nco I AmpR

Figure 9The GFP-GFAP fusion genes construct.

Figure 8Restriction Mapping and Southern blot hybridization of the PAC positive clone 239-9P

In parallel experiments using in situ hybridization, GFAPexpression was shown to be robust in the embryoshybridized with GFAP antisense probe (Figure 10) in con-trast to the control embryos hybridized with GFAP senseprobe (Figure 11). As the isolation of the GFAP gene fromzebrafish has not been published, the GFAP expression thatwas visualized in these experiments via in situ hybridizationcould not be compared to other published data. However,similar results were found by using antibodies against theGFAP protein (Marcus and Easter, 1995). In this study, thefirst immunopositive cells in the central nervous systemwere identified in the embryo hindbrain at 24 hr post-fertil-ization. Furthermore, initial patterning events occur inzebrafish between 36 and 48 hr (Dynes and Ngai, 1998).Therefore, it was expected that 36-hr embryos wouldstrongly express GFAP throughout the central nervous sys-tem. The results from using GFAP antibodies suggest thatglial cells contribute to the development and organization ofthe central nervous system by supporting early axon out-growth and by forming the boundaries around the tractsand between neuromeres. It should be noted that thesegeneral findings mirror the hypothesis of glial cell functionin olfactory development. The expression pattern of ourcloned GFAP promoter is expected to be the same as theexpression pattern detected using in situ hybridization. Themain advantage of the fusion gene approach is that the

movement of glial cells can be visualized in living embryos,which is impossible when using in situ hybridization.

Finally, the construction of fusion genes that express GFPin glial cells will be useful for studying glial cell functionthroughout the nervous system. This project has focusedon the olfactory system, as it has been particularly useful inimaging approaches to studying neural development andfunction. However, this project indirectly benefits the studyof spinal cord injury as well. Because GFAP expression isalso found along the spinal cord, glial cells might be impor-tant for the study of cell regeneration after injury.

Many potential experiments can be performed in the futurewith the functional GFAP-GFP fusion gene construct.Individual GFAP and glial cells can be studied using trans-genic manipulation, ablation, or molecular genetic approach-es. With a better understanding of glial cells and the mech-anism of their regeneration, it may be possible to findimproved treatments for conditions such as spinal cordinjury, which involve massive cellular damage.

Acknowledgements

I would like to thank Professor Oswald Steward for allow-ing me to pursue this project. I deeply appreciate all theguidance and support of postdoctoral scientist JosephDynes throughout my research experience. Also, thanks toProfessor Thomas Schilling, Chris Amemiya, EdwardModaferi, and Kelli Sharp for all their help in the laborato-ry. This project was supported by the SummerUndergraduate Research Program at UCI.



Figure 11 In situ hybridization ofcontrol embryos probedwith sense GFAP probe

Figure 10 In situ hybridization ofembryos probed withantisense GFAP probe

Works Ci ted

Brenner, M.K., W.C. Kisseberth, Y. Su, F. Besnard, and A.Messing. “GFAP Promoter Directs Astrocytes-SpecificExpression in Transgenic Mice.” Neuroscience 14 (1994):1030-1037.

Bulfone, A., F. Wang, R. Hevner, S. Anderson, T. Cutforth, S.Chen, J. Meneses, R. Pedersen, R. Axel, and J.L.R.Rubenstein. “An Olfactory Sensory Map Develops in theAbsence of Normal Projection Neurons or GABAergicInterneurons.” Neuron 21 (1998): 1273-1282.

Dynes, J., and J. Ngai. “Pathfinding of Olfactory Neuron Axonsto Stereotyped Glomerular Targets Revealed by DynamicImaging in Living Zebrafish Embryos.” Neuron 20 (1998):1081-1091.

Marcus, R.C., and S.S. Easter Jr. “Expression of Glial FibrillaryAcidic Protein and its Relation to Tract Formation inEmbryonic Zebrafish (Danio rerio).” Journal of ComparativeNeurology 359 (1995): 365-381.

Maniatis, T., E.F. Fritsch, and J. Sambrook. Molecular Cloning––ALaboratory Manual. New York: Cold Spring HarborLaboratory, 1982. 107-217.

Mombaerts, P., F. Wang, C. Dulac, S.K. Chao, A. Nemes, J.E.Mendelsohn, and R. Axel. “Visualizing an Olfactory SensoryMap.” Cell 87 (1996): 675-686.

Tolbert, L.P., and L.A. Oland. “A Role for Glia in Developmentof Organized Neuropilar Structures.” Trends inNeurosciences 12 (1989): 70-75.

Valverde, F., M. Santacana, and M. Heredia. “Formation of anOlfactory Glomerulus: Morphological Aspects ofDevelopment and Organization.” Neuroscience 49 (1992):255-275.



the construction of gfp fusion genes for transgenically ......olfactory formation will then be...

Documents