THE EFFECT OF GLUTATHIONE ON HIGH MOLECULAR WEIGHT ADIPONECTIN SECRETION FROM 3T3-L1 ADIPOCYTES DURING ENDOPLASMIC RETICULUM

STRESS

By

BRANDON EUDY

A THESIS PRESENTED TO THE GRADUATE SCHOOL

OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2016

© 2016 Brandon Eudy

To persistence

4

ACKNOWLEDGMENTS

I want to first thank Dr. Percival for accepting me into her lab and making my

endeavors possible. Your willingness to let me pursue this project and discover its ins

and outs of pursuing this work on my own have allowed me to learn so much. I also

appreciate Dr. Henken and Dr. Anton for serving on my committee and offering

encouragement and providing me with additional insight to my project. I thank all of my

lab and class mates who have made this experience even more enjoyable. Cheryl,

thank you for trying to keep me in line. Mom and Dad, I appreciate your support

throughout the past two years and for helping me make this possible.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ............................................................................................ 4

LIST OF TABLES ..................................................................................................... 6

LIST OF FIGURES ................................................................................................... 7

LIST OF ABBREVIATIONS ....................................................................................... 9

ABSTRACT ............................................................................................................ 12

CHAPTER

1 INTRODUCTION ................................................................................................. 14

Introduction, Obesity, and the Metabolic Syndrome ............................................. 14

Endoplasmic Reticulum Stress in the Adipocyte .................................................. 15

Adiponectin ...................................................................................................... 19

Glutathione....................................................................................................... 20

Glutathione and ER Stress ................................................................................ 22

Specific Aims.................................................................................................... 25

2 MATERIALS AND METHODS .............................................................................. 28

Cell Culture and Treatments .............................................................................. 28

Measurement of Total Glutathione ..................................................................... 29

Measurement of Total and HMW Adiponectin ..................................................... 29

Western Blot Analysis ....................................................................................... 30

RNA Isolation and RT-qPCR ............................................................................. 31

Oil Red O Staining ............................................................................................ 31

3 RESULTS ........................................................................................................... 34

Glutathione Uptake Into 3T3-L1 Adipocytes and Effect of ER Stress on Glutathione Concentrations ............................................................................ 34

Effect of Glutathione Pre-treatment on UPR Markers in 3T3-L1 Adipocytes During ER Stress ........................................................................................... 35

Glutathione Does not Attenuate the Decrease in HMW Adiponectin Secretion Caused by Treatment With Palmitate .............................................................. 36

Glutathione Pre-treatment Lowers Ero-1α Gene Expression ................................ 36

4 DISCUSSION ...................................................................................................... 45

LIST OF REFERENCES ......................................................................................... 54

6

BIOGRAPHICAL SKETCH ...................................................................................... 61

7

LIST OF TABLES Table page 2-1 Primer sequences used for RT-qPCR. ........................................................... 33

8

LIST OF FIGURES

Figure page 1-1 Thiol-mediated protein retention. Proteins such as adiponectin may form

disulfide bonds with the ER chaperone ERp44................................................ 27

3-1 Oil Red O staining of 3T3-L1 adipocytes......................................................... 38

3-2 Glutathione uptake into 3T3-L1 adipocytes ..................................................... 39

3-3 Intracellular glutathione concentrations in 3T3-L1 adipocytes during ER stress ........................................................................................................... 40

3-4 GSH pre-treatment prevents induction of CHOP during palmitate-induced ER stress ........................................................................................................... 41

3-5 GSH pre-treatment does not decrease XBP1s mRNA expression during palmitate induced ER stress .......................................................................... 42

3-6 Adiponectin secretion, Total and HMW ........................................................... 43

3-7 GSH pre-treatment decreases ERo-1α mRNA expression ............................... 44

4-1 Hypothetical mechanism of action explaining how increased intracellular glutathione alters UPR signaling .................................................................... 53

9

LIST OF ABBREVIATIONS

µg microgram

µL microliter

µM micromolar

ARE Antioxidant response element

ATF4 Activating transcription factor 4

ATF6 Activating transcription factor 6

AMPK adenosine monophosphate kinase

ANOVA Analysis of variance

BCL2 B-cell lymphoma 2

Bid BH3 interacting-domain death protein

BMI Body mass index

BSA Bovine serum albumin

C Celsius

CHOP CAAT/enhancer binding homologous protein

ddH2O Double distilled water

DM1 Differentiation medium 1

DM2 Differentiation medium 2

DMEM Dulbecco’s Modified Eagle Media

DR5 Death receptor 5

DsbA-L Disulfide bond A oxidoreductase-like protein

DXM Dexamethasone

eIF2α Eukaryotic translation initiation factor 2 alpha

10

ELISA Enzyme-linked immunosorbent assay

ER Endoplasmic reticulum

ERp44 Endoplasmic reticulum resident protein 44

Ero-1α Endoplasmic reticulum oxidoreductase alpha

GCL Glutamate cysteine ligase

GRP78 78 kDa glucose-regulated protein

GR Glutathione reductase

GSH Reduced glutathione

GSSG Oxidized glutathione

GSTP Glutathione-S-transferase Pi

HDL High-density lipoprotein

IBMX Isobutyl-1-methylxanthine

IRE1 Inositol requiring kinase 1

IRS-1 insulin receptor substrate-1

JNK c-Jun N-terminal kinase

kDa Kilodalton

KEAP1 Kelch like-ECH-associated protein 1

HMW High-molecular weight

MetS Metabolic syndrome

MPA Metaphosphoric acid

mRNA Messenger RNA

Nmoles nanomoles

NAC n-acetyl-cysteine

11

NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells

NRF2 Nuclear factor (erythroid-derived 2)-like 2

PBS Phosphate-buffered saline

PDI protein disulfide isomerase

PERK Double stranded RNA-activated protein kinase-like ER kinase

PPARα peroxisome proliferator-activated receptor alpha

RIPA Radio immunoprecipitation assay

RNA Ribonucleic acid

RNS Reactive nitrogen species

ROS Reactive oxygen species

RT-qPCR Real time quantitative polymerase chain reaction

RPL13A Ribosomal Protein L13a

SDS Sodium dodecyl sulfate

siRNA Small-interfering RNA

TNF-α Tumor necrosis factor alpha

TZD Thiazolidinedione

UPR Unfolded protein response

WAT White adipose tissue

WT Wild-type

XBP1 X-box binding protein 1

12

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

THE EFFECT OF GLUTATHIONE ON HIGH MOLECULAR WEIGHT ADIPONECTIN SECRETION FROM 3T3-L1 ADIPOCYTES DURING ENDOPLASMIC RETICULUM

STRESS

By

Brandon Eudy

August 2016

Chair: Susan S. Percival Major: Food Science and Human Nutrition

Obesity and metabolic syndrome are serious conditions afflicting many in the US

and worldwide. These conditions are often associated with chronic low-grade

inflammation, oxidative stress, and endoplasmic reticulum (ER) stress. Glutathione

(GSH) is an important intracellular antioxidant and also assists protein folding in the ER.

Little attention has been given to GSH concerning possible roles in metabolic health.

GSH has been shown to be associated with higher levels of the insulin-sensitizing

adipokine, adiponectin, in human plasma. Adiponectin exists in several isoforms. The

high molecular weight (HMW) form of adiponectin is thought to have the most potent

insulin sensitizing effect. Whether GSH plays a role in adiponectin secretion and

oligomerization has not been previously investigated. GSH may protect against

metabolic dysregulation by ameliorating ER stress and increasing HMW adiponectin

secretion in stressed cells. The aims of this study were to determine the effects of

intracellular GSH concentration on ER Stress and HMW adiponectin secretion in 3T3-L1

adipocytes. ER stress was induced by treatment with palmitate (1 mM) and the effect of

GSH pre-treatment (1 mM) was also investigated. To show that palmitate induced ER

13

stress, XBP1s mRNA expression and CHOP protein expression were measured. mRNA

expression of the ER chaperone ERO-1α was measured to evaluate the effects of

palmitate and GSH treatment on protein folding. Adiponectin was measured by ELISA.

GSH pretreatment did not spare secretion of HMW adiponectin into the cell culture

medium. GSH pre-treatment prevented induction of CHOP and ERO-1α, but had no

effect on splicing of XBP1. Given that CHOP is implicated in ER stress associated cell

death, the intracellular GSH concentration may direct cell fate in response to ER stress.

14

CHAPTER 1 INTRODUCTION

Introduction, Obesity, and the Metabolic Syndrome

Our current food environment is characterized by nutritional abundance. The typical

Western diet is comprised of meals high in fat and carbohydrates, and includes a great

deal of snacking. Taken together, these factors have played a part in the increased

prevalence of chronic disease observed over the past several decades including obesity

and diabetes. These disease states are part of the metabolic syndrome (MetS), a term

used to characterize the presence of a combination of the following conditions: high

blood glucose, high blood pressure, low high-density lipoprotein (HDL), high body mass

index (BMI), and high serum triglycerides (1). These pathologies can wreak havoc in

overall health and are a serious problem in US. Data from the 2003-2006 National

Health and Nutrition Examination Survey show prevalence of MetS in the US to be

approximately 34% (2). Numerous lifestyle interventions, drugs, and surgeries are

available as treatments, but vary in effectiveness. Obesity represents a particularly

difficult condition to treat. This may stem from the multi-factorial nature behind what

causes this pathology. Although excess energy consumption is certainly implicated,

genetics and other factors also play a role (3-5). For example, obesity is accompanied

by oxidative stress and chronic low-grade inflammation. Furthermore, obese individuals

have been shown to have altered gut microbiota and altered ratios of important

hormones including leptin and adiponectin (6-8).

Another perturbation that occurs at the cellular level in response to chronic over nutrition

is endoplasmic reticulum (ER) stress. Indeed, adipose tissue isolated from obese mice

and humans show heightened markers of ER stress (9). Furthermore, ER stress

15

causes induction of the unfolded protein response (UPR), which may potentially activate

several inflammatory pathways. Therefore, ER stress may provide a crucial link

between obesity, adipose tissue inflammation, and insulin resistance.

Insulin resistance is a hallmark of metabolic disease. Of interest is the adipokine,

adiponectin. Adiponectin is secreted by white adipose tissue (WAT) and plays roles in

glucose metabolism and insulin sensitivity. However, higher BMI is known to be

associated with lower concentrations of circulating adiponectin. In particular, the high-

molecular weight (HMW) isoform of adiponectin seems to be closely correlated with

metabolic health. Treatment of diabetic subjects with thiazolidinediones (TZDs)

improves insulin sensitivity by increasing circulating HMW adiponectin concentrations.

Therefore, novel treatment for obesity and related pathologies may focus on increasing

HMW adiponectin secretion from adipocytes. Glutathione is an important intracellular

antioxidant and may be protective against ER stress. For example, GSH may regulate

ER chaperones which are involved in the synthesis and secretion of HMW adiponectin

from the ER. The aim of this study is to determine whether increased glutathione

concentrations in adipocytes may favorably modulate the UPR induced by palmitate

treatment and blunt the decrease in HMW adiponectin seen in this condition.

Endoplasmic Reticulum Stress in the Adipocyte

The ER is an organelle found in all eukaryotic cells and serves as the location for

synthesis, assembly, and secretion of new proteins. Homeostasis of this system must

be carefully maintained in order to meet cellular protein demand, while avoiding

overwhelming the secretory pathway. In times of increased stress, UPR signaling is

induced primarily by activation of three ER transmembrane proteins in response to

accumulation of misfolded proteins in the ER lumen: double stranded RNA-activated

16

protein kinase-like ER kinase (PERK), inositol requiring kinase 1 (IRE1), and activating

transcription factor 6 (ATF6.) Although each of these proteins activates its own unique

signal transduction pathway, they share the same means of activation and converge

upon many of the same transcriptional targets. Therefore, these pathways together

encompass the entire UPR signaling pathway. These proteins normally bind to 78 kDa

glucose-regulated protein (GRP78), the master regulator of the UPR. When

concentrations of misfolded proteins are high inside of the ER lumen, GRP78

dissociates from these proteins and binds misfolded proteins instead, allowing for

activation of PERK, IRE1, and ATF6. Increased phosphorylation of PERK and IRE1 are

strong indicators of ongoing ER stress, as is proteolytic cleavage of ATF6 (10).

UPR activation is a dynamic process that determines cell fate during ER stress. The

UPR begins as an adaptive pathway with emphasis on cell survival. However, as

greater amounts of cellular stress accrue, the UPR experiences a paradigm shift

towards promoting cell death (11). The dynamics of the UPR involved in determining

cell fate are complex and this introduction will only briefly highlight key targets. In short,

splicing of the X-box binding protein 1 (XBP1) transcript by IRE-1 promotes cell survival

by increasing lipid synthesis and upregulating ER chaperones (12, 13) The PERK

pathway is also implicated in cell survival. PERK phosphorylates the transcription factor

Nuclear factor (erythroid-derived 2)-like 2 (NRF2), which triggers its dissociation from

Kelch like-ECH-associated protein 1 (KEAP1.) Free NRF2 then interacts with

antioxidant response elements (ARE) in the promoter regions of many antioxidant

genes causing their upregulation. PERK is also thought to be protective by transiently

phosphorylating eIF2α, temporarily halting synthesis of new proteins.

17

A central protein related to ER stress associated cell death is CAAT/enhancer binding

homologous protein (CHOP)(13). CHOP is located downstream of PERK and

upregulated during prolonged ER stress. CHOP can reduce expression of BCL-2 anti-

apoptotic proteins and has also been shown to upregulate death receptor-5 (DR5), both

of which factors promote a pro-apoptotic phenotype (14, 15). Furthermore, CHOP may

be involved in mediating other forms of cell death in response to ER stress (16).

Pyroptosis is a type of programmed cell death that shares features of apoptosis and

necrosis and is a typical response of cells to unresolvable inflammation. Cleavage of

caspase-1 is a key feature defining pyroptosis (17). CHOP is thought to be involved in

caspase-1 cleavage, resulting in cell death by pyroptotis. Treatment of primary mouse

hepatocytes with tunicaymcin resulted in caspase-1 cleavage. However, knockdown of

Chop using siRNA ameliorated this effect (18). Finally, ER stress may also promote cell

death by increasing intracellular ROS and Ca2+ release into the cytosol and

mitochondria (11).

The UPR is highly responsive to nutritional status. Therefore it is logical that

dysregulated energy metabolism would disrupt this pathway, particularly in the

adipocyte. ER stress was first linked with obesity by Ozcan et al. in 2004 (10). Ob/ob

mice and mice fed high fat diets both showed increased PERK phosphorylation, JNK

activation, and GRP78 protein expression in adipose tissue. Several factors may

contribute to obesity-induced ER stress. In obesity, adipocytes face hypoxia and

increased concentrations of free fatty acids, both of which factors further contribute to

ER stress. Indeed, in-vitro studies have shown that the saturated fatty acid (SFA),

palmitate activates the UPR (19, 20). The mechanism by which palmitate induces ER

18

stress is not well understood. However, one hypothesis points to accumulation of SFA

in the ER membrane, which may interfere with fluidity by replacing phosphatidylcholine

residues (21). Increased UPR activation causes changes in inflammatory signaling to

immune cells. All three UPR pathways have been shown to upregulate nuclear factor

kappa-light-chain-enhancer of activated B cells (NF-κB) and c-Jun N-terminal kinase

(JNK) (22). Both of these pathways are pro-inflammatory and may inhibit tyrosine

phosphorylation of insulin receptor substrate-1 (IRS-1), leading to insulin resistance.

Inflammation and insulin resistance are two downstream consequences of ER stress

important to the adipocyte that will be discussed below.

Chronic UPR activation may directly cause insulin resistance. In 2001, Harding et al.

showed that ER stress in Perk -/- mice, was marked with a compensatory increase in

phosphorylation of IRE1. Perk -/- mice experienced heightened type-2 diabetes disease

severity and increased apoptosis of pancreatic β-cells (23). Furthermore, UPR

activation in adipose tissue of mice interferes with IRS-1 signaling by IRE1 dependent

JNK activation (10). This observation suggests that obesity associated ER stress may

have direct consequences on insulin sensitivity and link obesity with type-2 diabetes.

Prolonged ER stress may also contribute to adipocyte cell death, which is implicated in

inflammation and metabolic disease. When a cell is not able to cope with ER stress, cell

death is favored over adaptation. Cinti et al. showed macrophage infiltration in adipose

tissue was 90% localized to adipocytes showing morphological features of necrosis

(24). On the contrary, adipocyte apoptosis has also been shown to cause increased

macrophage infiltration. (25). Inactivation of the pro-apoptotic protein BH3 interacting-

domain death agonist (Bid) reduced macrophage infiltration and TNF-α concentrations

19

in adipose tissue of obese mice. Furthermore, insulin resistance was higher in wild-type

mice compared to their Bid-/- littermates. These data suggest multiple cell death

pathways may be activated in adipocytes during obesity-induced ER stress. However, it

was later verified by ultrasound imaging that adipocytes undergo pyroptosis in obesity-

induced ER stress, a cell death pathway which shares features of apoptosis and

necrosis (16). Therefore, future research should critically consider the mechanism

behind cell death in adipocytes. In summary, adipocyte cell death promotes

inflammation in WAT and further increases insulin resistance in humans and animal

models. Therefore, targeting cell death in the adipocyte may have implications in

resolving metabolic dysregulation.

Adiponectin

Adiponectin is recognized as an anti-inflammatory adipokine, or adipo-cytokine secreted

by adipocytes. It was discovered in 1995 by four independent labs (26-29). Since its

discovery, adiponectin has been studied due to its inverse correlation with obesity, type-

2 diabetes, and MetS. Obese and diabetic subjects have been shown to have lower

circulating concentrations of adiponectin (30). This association has garnered interest in

adiponectin as a target for prevention or treatment of metabolic diseases including

obesity and type-2 diabetes. Interestingly, adiponectin concentrations are shown to be

higher in women than men and are also higher in centenarians and their offspring (31).

The presence of higher levels of adiponectin in centenarians has harbored questions as

to whether adiponectin may also contribute to longevity.

Disulfide bonding is crucial in the assembly of higher order complexes of adiponectin

(32). The HMW form, which is an octadecamer consisting of eighteen adiponectin

monomers, has been shown to behave differently than the other forms and may be

20

most relevant to metabolic health. The liver and skeletal muscle are key tissues where

adiponectin exerts its insulin sensitizing effects. Adiponectin exerts insulin sensitizing

properties through the adenosine monophosphate kinase (AMPK) and peroxisome

proliferator-activated receptor alpha (PPARα) pathways by binding to its

transmembrane protein receptors AdipoR1 and AdipoR2 (33, 34). AdipoR1 shows high

affinity for globular adiponectin while AdipoR2 shows high affinity for the HMW isoform

(35).

There is some evidence that ER stress alters assembly and secretion of adiponectin in

adipocytes. 3T3-L1 adipocytes subjected to hypoxic conditions, similar to what is seen

in obese adipose tissue, have been shown to have increased GRP78 mRNA

expression, indicating ER stress (36). Importantly, adiponectin mRNA expression was

reduced in this cell culture model. Other in-vitro studies have also observed

relationships between ER stress and adiponectin concentrations. Liu et al. observed

increased ER stress in 3T3-L1 cells treated with thapsigargin along with decreased

adiponectin concentrations (37). Another study using human adipose stem cells showed

that ER stress induced by palmitate decreased secretion of the HMW form of

adiponectin specifically into the cell culture medium (19). Total adiponectin was also

decreased in cell lysates. These experiments show that ER stress results in decreased

adiponectin concentrations and secretion into the extracellular environment.

Glutathione

Glutathione is a tripeptide consisting of glutamate, cysteine, and glycine,

covalently bonded in that respective order. Glutathione has spurred much interest over

the past 40 years because it is a powerful intracellular antioxidant and plays an

important role in maintaining cellular redox status (38). GSH exerts antioxidant activity

21

by reacting with intracellular reactive oxygen species (ROS) and reactive nitrogen

species (RNS), subsequently converting them to more benign forms at the cost of its

own oxidation to glutathione disulfide (GSSG). Oxidized glutathione may be recycled by

enzymatic activity of glutathione reductase (GR) and NADPH as a corresponding

source of reducing equivalents. GSH is also involved in reduction of hydrogen peroxide

and other various lipid peroxides by acting as a substrate for the enzyme glutathione

peroxidase. Besides its antioxidant activity, glutathione is an important storage form of

sulfur and cysteine. Glutathione also assists in the removal of xenobiotics. In the

intracellular environment, glutathione exists primarily in the reduced form, but in the

extracellular environment, oxidized glutathione is the predominant form. The ratio of

GSH : GSSG also varies by cellular compartment (39, 40). For example in the cytosol

and mitochondria, GSH may represent over 98% of the total glutathione pool. This may

reflect the role of GSH in ameliorating oxidative stress in these compartments,

especially the mitochondria. In the endoplasmic reticulum (ER), as much as 50% of total

glutathione has been reported to be as GSSG (41). This is essential as the ER requires

a slightly oxidizing environment to ensue correct protein folding. In many cases of

chronic disease, the intracellular GSH : GSSG ratio is lower than normal and is an

indicator of oxidative stress. However, the total amount of intracellular glutathione may

be more telling of a cell’s potential to deal with oxidative stress due to the high efficiency

of GR. Therefore, boosting intracellular glutathione concentrations may be an effective

means of reducing the damage caused by ROS in many cell and tissue types.

Glutathione is present in dietary sources, but poorly available. It is found in animal

sources such as beef and poultry, but quickly degraded by proteases in the stomach

22

and poorly absorbed by cells. Consuming foods rich in the amino acids cysteine and

glycine, or foods known to increase GSH biosynthesis, such as alliums and cruciferous

vegetables may be the optimal way to increase GSH through dietary means. In-vivo

studies often show GSH to be poorly absorbed. However, not all studies show this.

Kovaks-Nolan et al. found GSH to undergo transport across the epithelium in humans

(42). However, glutathione was increased only in liver and red blood cells, not in

plasma. Another ex-vivo study showed exogenous GSH was absorbed into isolated

kidney cells treated with the glutathione synthetase inhibitor, buthionine sulfoxomine.

These cells did not show signs of GSH depletion, implying that exogenous GSH was

indeed absorbed.(43). These data suggests that GSH is able to be transported across

membranes in these cell types. However, Future studies are needed to understand the

conditions which allows optimal cellular GSH uptake and determine the differences in

GSH transport between cell types.

Recently, supplemental forms of GSH with increased bioavailability have recently

been developed as dietary supplements for human use. GSH in this form has been

shown to be highly bioavailable. A clinical trial showed that 1000mg GSH / day

significantly increased glutathione concentrations in PBMC after 1, 3, and 6 months of

supplementation compared to a placebo (44). The maximum increase in lymphocyte

GSH was approximately 30%. However, whether GSH was increased in other tissues,

such as the adipose tissue was not measured and should be a subject of future studies.

Glutathione and ER Stress

Reducing cell death in adipose tissue is a potential target in alleviating adipose

tissue inflammation and insulin resistance. ER stress has been shown to be implicated

in adipocyte cell death and CHOP is an important transcription factor in this process

23

(45). Furthermore, ER stress is also known to deplete intracellular glutathione

concentrations due to increased protein folding demand, ROS production, and initiation

of cell death during severe ER stress (46, 47).

The PERK pathway of the UPR is highly sensitive to misfolded proteins in the ER

lumen as well as oxidative stress. Therefore, bolstering intracellular GSH concentrations

may protect against PERK-eIF2α -ATF4-CHOP activation by preventing the

accumulation of misfolded proteins and ameliorating oxidative stress.

Although glutathione contributes to the maintenance of the redox state inside of

the ER lumen, it is not well understood how modulating intracellular glutathione

concentrations affects the UPR. Giordano et al. recently showed that treating HepG2

cells with glutathione ethyl ester showed no decrease in GRP78 or CHOP mRNA

expression (48). However, a study performed in mice showed that treatment with the

GSH precursor, n-acetyl-cysteine (NAC) reduced oxidative stress and ER stress after

liver ischemia reperfusion (49). ER stress severity was determined by GRP78, AFT4,

and CHOP protein expression. Interestingly, GSH concentrations were lower in the mice

who did not receive NAC treatment. The above studies are insightful, but do not clearly

show whether increased GSH concentrations may independently reduce ER stress or

modulate the UPR. More research is needed to elucidate how GSH may alter UPR

activation and contribute to determining cell fate during ER stress.

GSH may also have protective effects indirectly related to the UPR. For example, GSH

may directly reduce non-native disulfide bonds (aka misfolded proteins) which

accumulate during ER stress (41). GSH may also reduce oxidized protein disulfide

isomerases (PDI), which catalyze the formation of disulfide bonds in newly assembled

24

proteins. Together, these processes show that GSH supports rearrangement of disulfide

bonds, which is crucial for correct protein assembly (50, 51). Therefore, bolstering

intracellular GSH concentrations may ameliorate ER stress by assisting in protein

folding. ERp44 and ERo-1α are key proteins located in the ER that regulate protein

folding. Erp44 is a member of the PDI family and binds to proteins, retaining them in the

ER until they become correctly folded. Ero-1α works oppositely of ERp44 by binding to it

and releasing any previously bound proteins for secretion from the cell. ERo-1α can

also facilitate disulfide bonding in proteins and is thought to be rate limiting factor in this

process. ERp44 and ERo-1α together form a system known as thiol-mediated protein

retention, which is crucial for proper assembly of proteins requiring significant post-

translational modifications (52). ERo-1α mRNA expression is upregulated in ER stress

by the PERK and ATF6 pathways (53). Increased ERO-1α activity may interfere with

thiol-mediated protein retention, which could cause premature release of proteins from

the ER (54). Indeed, previous work in human adipose stem cells seems to support this.

In response to palmitate-induced ER stress, these cells showed lower secretion of

HMW adiponectin in the cell culture medium (19). Additionally, ERo-1α mRNA

expression was upregulated.

In summary, GSH is able to reduce PDI proteins including ERp44, which could

influence disulfide rearrangement. GSH also regulates protein folding by

counterbalancing ERo-1α activity, possibly preventing secretion of immature proteins.

Therefore, it is tempting to speculate that bolstering intracellular concentrations of GSH

may antagonize ERo-1α activity or prevent its upregulation. This could allow for the

complete assembly of HMW adiponectin to occur before it is secreted from the cell.

25

Specific Aims

Specific Aim I. Investigate the effect of augmenting total glutathione

concentrations on glutathione depletion during palmitate-induced ER stress in 3T3-L1

adipocytes. It is not known whether extracellular GSH is readily taken up by 3T3-L1

adipocytes. Therefore, I propose to incubate cells with extracellular GSH and measure

glutathione concentrations in the cell after 20 hours. Palmitate, in the free fatty acid form

will be used to induce ER stress in 3T3-L1 adipocytes for 24 hours. A time course

experiment will be conducted and intracellular glutathione concentrations will be

measured in cells pre-treated with GSH or vehicle.

Specific Aim II. Determine effect of GSH on UPR activation during palmitate-

induced ER stress. The role of intracellular GSH status in protecting against ER stress

is not fully understood. Furthermore, it is not known whether GSH may modulate the

UPR in response to ER Stress. Therefore, I propose to investigate the effect of

augmented intracellular glutathione concentrations on UPR activation in 3T3-L1 cells

during palmitate-induced ER stress. CHOP protein expression and splicing of XBP1 will

be measured to assess activation of the PERK and IRE1 arms of the UPR respectively.

Specific Aim III. Determine the effect of GSH on adiponectin secretion and Ero-

1α mRNA expression during palmitate-induced ER stress. Pre-treating 3T3-L1

adipocytes undergoing ER stress with GSH may improve secretion of HMW adiponectin

by reducing the negative consequences of ER stress. It is hypothesized that GSH

treatment will accomplish this by ameliorating oxidative stress and assisting in protein

folding. In addition to its antioxidant potential, GSH may catalyze disulfide

rearrangement in misfolded proteins. GSH also works antagonistically of Ero-1α, a

protein that has been shown to be involved in regulating adiponectin secretion. Several

26

antioxidant compounds including tocopherols, (-)-catechin from green tea polyphenols,

and hydroxycinnamic acid derivatives have previously been shown to increase

adiponectin concentrations in 3T3-L1 cells (55-57). However, the increases shown in

these studies may have resulted from increased adiponectin mRNA expression, rather

than post-translational events. Furthermore, HMW adiponectin was not measured, nor

was secretion of adiponectin into conditioned medium.

27

Figure 1-1. Thiol-mediated protein retention. Proteins such as adiponectin may form disulfide bonds with the ER chaperone ERp44. This allows retention of the target protein in the ER lumen, allowing for the required post-translational modifications to take place. Ero-1α acts antagonistically of ERp44 in facilitating thiol-mediated retention by binding to it and releasing the previously bound protein.

28

CHAPTER 2 MATERIALS AND METHODS

Cell Culture and Treatments

3T3-L1 cells were obtained from the American Type Culture Collection (ATCC®

CL173™) and subcultured in Dulbecco’s Modified Eagle Media (DMEM) containing 4.5

g/L glucose and 584 mg/L L-glutamine (Cellgro), supplemented with 1% Penicillin (100

U/ml) / Streptomycin (100 µg/ml) (Sigma), 10% calf serum, and incubated at 37°C in 5%

CO2. Once fibroblasts were 2 days post-confluent, differentiation into adipocytes was

initiated by switching to differentiation medium 1 (DM1.) This was Day 0. DM1 consists

of DMEM supplemented with 10% fetal bovine serum (FBS), 0.5 mM 3-Isobutyl-1-

methylxanthine (IBMX) (Sigma), 1 µM dexamethasone (DXM) (Sigma), and 1.5 µg/ml

insulin (Sigma). Cells were incubated in DM1 for 48 hours before being switched to a

post-differentiation medium consisting of DMEM supplemented with 10% FBS, and 1.5

µg/ml insulin. A stock solution of glutathione (50 mM) was prepared by dissolving GSH

(Sigma) in deionized water. The solution was then sterilized using a 0.2µ syringe filter

and stored at -80°C in 0.5 ml aliquots. For glutathione pre-treatments, mature

adipocytes (day 9) were treated with 1 mM GSH or equivalent volume of saline solution

for 20 hours. ER stress was induced by treating cells with 1 mM palmitate (Sigma.)

For ER stress experiments, cells were cultured in DMEM supplemented with 10% FBS,

1% Penicillin/Streptomycin, and 0.75% fatty acid-free bovine serum albumin (BSA) (58).

Palmitic acid was dissolved in 0.1M aqueous NaOH and incubated at 37°C for 45

minutes before being quickly dissolved in medium supplemented with 0.75% BSA at

37°C. The resulting medium was incubated overnight before being used the following

29

day. To induce ER stress, palmitate was added to a final concentration of 1 mM.

Medium containing 0.75% BSA served as a control for these experiments.

Fatty acid-free BSA (Sigma) was purchased or prepared by the method adapted from

Chen (59). Briefly, 5g BSA was dissolved in 50ml deionized H2O and pH was lowered to

3.0 using 0.1 M HCl. 2.5g activated charcoal (Sigma) was then added. The resulting

slurry was magnetically stirred at 4°C overnight before being transferred to multiple

microfuge tubes and centrifuged at 13,000 rpm for 20 minutes. The supernatant was

collected and pH was adjusted to 7.0 by addition of 0.1 M NaOH. The resulting solution

was then sterile filtered using a 0.2µ filter and degassed before being stored at 4°C.

Thapsigargin (Santa Cruz Biotechnology) was used as a positive control for ER stress

marker experiments. A 1 mM stock solution was created by dissolving thapsigargin in

DMSO and the final concentration of thapsigargin used in experiments was 1 µM.

Measurement of Total Glutathione

Total intracellular glutathione was measured using a commercial assay kit (Cayman

Chemical). Cells were washed with cold phosphate-buffered saline (PBS) before

addition of cold MES buffer. Cells were then scraped and transferred to a 1.5 ml

Eppendorf tube before being sonicated twice in ten second bursts. To cell lysates, an

equal volume of metaphosphoric acid (MPA) was added. After 5 minutes of incubation

with MPA, lysates were centrifuged for 4 minutes at 12,000 rpm to precipitate proteins.

Deproteinated cell lysates were stored at -80°C for future analysis.

Measurement of total and HMW adiponectin

Total and HMW adiponectin was measured in conditioned medium using a commercial

ELISA kit (Alpco Adiponectin (Mouse) Total, HMW ELISA.) This protocol was modified

from the method designed Harris et al (60) which adapted the original protocol to be

30

more suitable for measuring adiponectin in conditioned medium. To measure HMW

adiponectin, 50 µL of conditioned medium was incubated with 100 µL protease solution

before being neutralized by 100 µL sample pre-treatment buffer. This protease

specifically digests lower-order isoforms of adiponectin, isolating the HMW isoform for

analysis. The sample was then diluted 25 times before being assayed according to the

standard protocol. To measure total adiponectin, 50 µL of conditioned medium was

added to 200 µL sample pre-treatment buffer. The sample was then diluted 75 times

before being assayed according to the standard protocol.

Western Blot Analysis

Cells were washed with cold PBS before being scraped in 1xRIPA buffer supplemented

with protease inhibitors (Pierce) and phosphatase inhibitors (PhosSTOP, Sigma). The

cell lysate was then sonicated twice in ten second bursts. Cellular debris were pelleted

by centrifugation at 12,000 rpm for 20 minutes at 4°C. The Bradford method (Biorad)

was used to determine total protein concentrations. Cell lysates containing 40 µg protein

were dissolved in SDS running buffer (Thermo Fisher Scientific) and boiled at 70°C for

10 minutes before being loaded onto a 12% Bis-Tris gel for electrophoresis. Samples

were ran in duplicate against Molecular weight standards (Precision Plus, dual color,

Bio-Rad) and MagixMark XP Western Protein Standards (Invitrogen.) The gel was then

transferred onto a nitrocellulose membrane (Biorad) before being blocked for 1 hour in

blocking buffer consisting of TBST (tris-buffered saline, pH 7.4 and 0.01% Tween-20)

supplemented with 5% BSA or non-fat dry milk. The blocked membranes were washed

and incubated with primary antibodies overnight at 4°C. Membranes were probed as

follows: CHOP (1:1000) (Cell Signaling Technologies). Following incubation with

primary antibodies, membranes were subsequently probed with the correct secondary

31

antibody: anti-rabbit secondary antibody conjugated to horseradish peroxidase (1:2000)

(Cell Signaling Technologies). α-tubulin was used as a protein loading standard. The

primary antibody was directed against stripped membranes as follows: (1:5000) (Sigma)

before probing with the secondary antibody, goat anti-mouse secondary antibody

conjugated to horseradish peroxidase (1:2000) (Cell Signaling Technologies).

Membrane-bound antibodies were detected using an electrochemiluminescent detection

reagent (Thermo Fisher Scientific).

RNA isolation and RT-qPCR

Cells were lysed in cold RNAzol RT lysis buffer (Sigma) and stored at -80°C for future

analysis. Frozen cell lysates were thawed by placing on a dry heat block set at 37°C for

5 minutes. Lysates were then centrifuged at 12,000 rpm for 5 minutes and residual

lipids were removed. RNA isolation was then carried out by the manufacturer’s protocol

and checked for purity. cDNA was synthesized using a commercial high-capacity

reverse-transcription kit (Applied Biosystems.) RT-qPCR was performed using Power

SYBR Green PCR Master Mix (Applied Biosystems) and the CFX96 Real-Time PCR

system (Bio-Rad) according to the manufacturer’s instructions. The standard curve

method was used for quantitation of results. Standard curves featured the original

sample and three 10-fold serial dilutions of the original sample. mRNA concentrations

were standardized to the housekeeping gene RPL13a. Primer sequences are shown in

Table 2-1.

Oil Red O Staining

Mature 3T3-L1 adipocytes (Day 9) were stained with Oil Red O by the following method

(Derived from biolonza.) Cells were gently washed with cold PBS before a 2%

paraformaldehyde solution in PBS was added. Cells were incubated at room

32

temperature for 90 minutes. Cells were then washed with ddH2O before 1 ml of a

working solution of Oil Red O was added for 5 minutes. Cells were then washed again

with ddH2O before observed under a phase-contrast microscope at 100x magnification.

Photos were taken with a digital camera (Canon).

Statistical Analysis

Statistics were performed using SigmaPlot 11. Data are expressed as mean ± SD or

mean ± SE. Student’s T-test was used to determine whether glutathione treatment

significantly increased intracellular glutathione concentrations. A one-way ANOVA was

used to determine differences in gene expression, protein expression, and adiponectin

secretion between treatment groups. A two-way analysis of variance (ANOVA) was

used to determine differences in intracellular glutathione concentrations during ER

stress. Time and treatment group were factors and glutathione concentrations were the

quantity being compared. For post-hoc analysis, the Holm-Sidak method was used. A p-

value of <0.05 was considered significant for these experiments.

33

Table 2-1. Primer sequences used for RT-qPCR.

Gene Forward Primer (5’ 3’) Reverse Primer (5’ 3’)

XBP1s

XBP1u

ERo-1α

RPL13A

TGAGTCCGCAGCAGGT

GCTTGGGAATGGACACGCTG

CGATATACAGTCCCCCGATG

GCAAGTTCACAGAGGTCCTCAA

TGTCAGAGTCCATGGGAAGA

GCACATAGTCTGAGTGCTGCG

ACTTTTTCCTCGCCCAGAAG

GGCATGAGGCAAACAGTCTTTA

34

CHAPTER 3 RESULTS

The aim of this study was to investigate any protective effects of bolstering

glutathione concentrations in 3T3-L1 adipocytes during ER stress. 3T3-L1 adipocytes

were grown to maturity. The presence of lipid droplet accumulation was shown using Oil

Red O staining (Figure 3-1). An aqueous solution of glutathione (1 mM) was used as

pre-treatment before treatment with palmitate (1 mM) to induce ER stress. Following

these treatments, glutathione concentrations in the cell were measured. To investigate

the effect of increasing glutathione concentrations on UPR signaling, CHOP and XBP1s

were measured by western blotting and RT-qPCR respectively. Adiponectin secretion

was measured by ELISA and gene expression of the ER chaperone, ERO-1α was

measured using RT-qPCR.

Glutathione uptake into 3T3-L1 adipocytes and effect of ER stress on glutathione concentrations

Uptake of GSH into mature 3T3-L1 adipocytes was determined by incubating

cells with GSH (1 mM) or vehicle (saline) for 20 hours. Cells were washed with PBS

before being lysed in cold MES buffer. Intracellular glutathione was measured using a

commercial colorimetric assay. Glutathione concentrations were reported as nmoles

glutathione / mg cellular protein. Total protein was determined using the Bradford

method. To determine how palmitate-induced ER stress affects intracellular glutathione

concentrations, a time course experiment was performed. Cells were pre-treated with or

without GSH as described above. Fresh media was then added containing palmitate (1

mM) or vehicle (0.75% BSA) and cells were incubated for 6, 12, or 24 hours. Cells were

lysed and assayed for glutathione concentrations as described above. 20 hours

following incubation with GSH, cells showed a significant increase in glutathione

35

concentrations (approximately 60%), implying uptake of reduced glutathione into the cell

(Figure 3-2). During ER stress, glutathione concentrations decreased after 12, and 24

hours. GSH pre-treatment did not ameliorate this effect (Figure 3-3).

Effect of glutathione pre-treatment on UPR markers in 3T3-L1 adipocytes during ER stress

CHOP protein expression was measured to assess activation of the PERK

pathway of the UPR. 3T3-L1 adipocytes were treated with 1 mM palmitate or vehicle

(0.75% BSA) for 12 hours. Additionally, the effect of 20 hours pre-treatment with 1 mM

GSH was investigated. Cells were lysed in cold 1XRIPA buffer supplemented with

protease and phosphatase inhibitors. Total protein content was determined using the

Bradford method. 3T3-L1 adipocytes treated with thapsigargin for 12 hours were used

as a positive control. Densitometric analysis was performed on protein bands. 3T3-L1

cells treated with 1 mM palmitate showed an approximate 50% increase CHOP

induction at 12 hours (Figure 3-4). Interestingly, GSH pre-treatment completely

ameliorated this effect.

Activation of the IRE-1 pathway of the UPR results in cleavage of a 28 base pair

intron from XBP1 (XBP1u), resulting in the spliced variant of the gene, XBP1s. XBP1s

and XBP1u mRNA expression was measured to assess activation of the IRE1 pathway

of the UPR. 3T3-L1 adipocytes were treated with 1 mM palmitate or vehicle (0.75%

BSA) for 12 hours. Additionally, the effect of 20 hours pre-treatment with 1 mM GSH or

vehicle was observed. Total RNA was isolated using RNAzol RT lysis buffer. 1 µg RNA

was reverse transcribed using a commercial kit. RT-qPCR was performed and results

were quantified using the standard curve method. Data were normalized to the

housekeeping gene, RPL13a. Expression of XBP1s was approximately 6 fold higher in

36

cells treated with palmitate compared to controls (Figure 3-5, A). GSH pre-treatment

had no significant effect on XBP1s mRNA expression. No significant change in XBP1u

was observed in cells treated with palmitate or pre-treated with GSH (Figure 3-5, B).

Glutathione does not attenuate the decrease in HMW adiponectin secretion caused by treatment with palmitate

A study by Mondal et al. showed human adipose stem cells secrete less HMW

adiponectin under ER stress (19). To determine if ER stress has a similar effect on

HMW adiponectin secretion in 3T3-L1 adipocytes, adiponectin was measured in

conditioned medium after 24 hours of treatment with palmitate (1 mM.) The effect of 20

hours of GSH pre-treatment (1 mM) was also investigated. Adiponectin concentrations

were quantified using ELISA and standardized to total cellular protein to obtain the units

of ng adiponectin / mg cellular protein. Total protein was determined using the Bradford

method. Total and HMW adiponectin were both quantified.

Treatment with palmitate did not significantly decrease total adiponectin secretion

from 3T3-L1 adipocytes after 24 hours Figure 3-6, A. However, a significant decrease in

HMW adiponectin was observed (~60%) (Figure 3-6, B). GSH pre-treatment did not

ameliorate this effect. Surprisingly, GSH pretreatment also resulted in a small, but

significant decrease in total adiponectin secretion relative to non-palmitate treated

controls.

Glutathione pre-treatment lowers ERo-1α gene expression

ERo-1α is one of the primary oxidoreductases found in the ER and thought to be

the rate limiting enzyme in disulfide bond formation. Here, ERo-1α mRNA expression

was measured to determine if ER stress induced by palmitate upregulates ERo-1α gene

expression in 3T3-L1 cells and whether GSH pre-treatment has influences ERo-1α gene

37

expression. 3T3-L1 adipocytes were treated with 1 mM palmitate or vehicle (0.75%

BSA) for 12 hours. Additionally, the effect of 20 hours pre-treatment with 1 mM GSH or

vehicle was observed. Total RNA was isolated using RNAzol RT lysis buffer. 1 µg RNA

was reverse transcribed using a commercial kit (Applied Biosystems.) RT-qPCR was

performed and results were quantified using the standard curve method. Data were

normalized to the housekeeping gene, RPL13a. ERo-1α mRNA expression was not

significantly affected by palmitate treatment, indicating that this gene was not

upregulated in ER stress (Figure 3-7). However, GSH pre-treatment suppressed ERo-

1α gene expression by approximately 80%.

38

Figure 3-1. Oil Red O staining of 3T3-L1 adipocytes. Photos were taken Day 9 after differentiation using a phase contrast microscope (100x magnification) and a digital camera (Canon). Oil Red O dye selectively stains lipids a red color.

39

Treatment Group

Vehicle GSH

nm

ole

s G

luta

thio

ne /

mg p

rote

in

0

2

4

6

8

10

12

14

Figure 3-2. Glutathione uptake into 3T3-L1 adipocytes. Mature 3T3-L1 adipocytes were incubated with 1 mM GSH or vehicle (saline) for 20 hours. Cells were lysed in MES buffer and deproteinated using 5% MPA. The supernatant was analyzed for total glutathione concentrations. Data represent three independent experiments and are reported as mean ± SD analyzed by the Student’s T-test (P=0.026).

*

40

Time (hours)

6 12 24

nm

ole

s G

luta

thio

ne /

mg p

rote

in

0

1

2

3

4

5

6

Vehicle

Palmitate

Palmitate-GSH

Figure 3-3. Intracellular glutathione concentrations in 3T3-L1 adipocytes during ER

stress. Mature 3T3-L1 adipocytes were incubated with 1 mM GSH or vehicle (saline) for 20 hours. The media was then removed and cells were incubated with fresh media supplemented with palmitate (1 mM) or vehicle (0.75% BSA) for 6, 12, or 24 hours. Cells were lysed in MES buffer and deproteinated using 5% MPA. The supernatant was analyzed for total glutathione concentrations. Data represent three independent experiments and are reported as mean ± SD analyzed by two-way ANOVA. Different lowercase letters denote significant differences between treatment groups (P<0.05 vs. treatment).

a

b b b

b

a a

a

a

41

Figure 3-4. GSH pre-treatment prevents induction of CHOP during palmitate-induced ER stress. 3T3-L1 adipocytes were pre-treated with 1 mM GSH or vehicle for 20 hours prior to treatment with 1 mM palmitate or vehicle for 12 hours. CHOP protein expression in cell lysates was measured by western blotting and normalized to α-tubulin. Cells treated with thapsigargin were used as a positive control. Data represent densitometric analysis of relative densities of each protein band. Results are reported as mean ± SD of three independent experiments analyzed by ANOVA (P<0.001 for all significant differences).

Different lowercase letters denote significant differences between treatment groups.

Treatment Group

Vehicle Palmitate Palmitate-GSH

CH

OP

exp

ressio

n (

arb

itra

ry u

nits)

0.0

0.5

1.0

1.5

2.0

2.5

b

a

c

CHOP

α-tubulin

Veh Palm Palm-GSH (+) Thap

~27

kDa

~50

42

Treatment Group

Vehicle Palmitate Palmitate-GSH Thapsigargin

XB

P1

u m

RN

A e

xpre

ssio

n (fo

ld in

cre

ase

)

0.0

0.5

1.0

1.5

2.0

2.5

Treatment Group

Vehicle Palmitate Palmitate-GSH Thapsigargin

XB

P1s m

RN

A e

xpre

sssio

n (

fold

incre

ase)

0

2

4

6

8

10

12

Figure 3-5. GSH pre-treatment does not decrease XBP1s mRNA expression during

palmitate induced ER stress. 3T3-L1 adipocytes were treated with 1 mM palmitate for 12 hours. The effect of 20 hours pre-treatment with GSH was also investigated. RT-qPCR was performed to assess splicing of the XBP1 transcript. Data were normalized to RPL13A and reported as a fold increase from vehicle treated cells. Results were reported as mean ± SD of three independent experiments (P <0.01) (A). XBP1u mRNA was also measured.

No significant changes were shown in cells treated with palmitate or palmitate + GSH (B). Different lowercase letters denote significant differences between treatment groups.

b

a

a,b

A B

a

a

a

43

Treatment Group

Vehicle Palmitate Palmitate-GSH

ng A

dip

onectin /

mg p

rote

in

0

200

400

600

800

1000

1200

1400

Treatment Group

Vehicle Palmitate Palmitate-GSH

ng A

dip

onectin /m

g p

rote

in

0

100

200

300

400

500

600

Figure 3-6. Adiponectin secretion, Total and HMW. 3T3-L1 adipocytes were pre-treated

with 1 mM GSH or vehicle (saline) for 20 hours prior to treatment with 1 mM palmitate or vehicle (0.75% BSA) for 24 hours. Conditioned media was collected and centrifuged for 4 minutes at 12,000 rpm to pellet cell debris. Total (A) and HMW (B) adiponectin was quantitated using ELISA and standardized to total cellular protein. Results are reported as mean ± SD of three independent experiments analyzed using ANOVA. P-values are (P=0.029) and (P<0.001) for total and HMW adiponectin respectively.

Different lowercase letters denote significant differences between treatment groups.

a

a,b

b a

b

a

b

A B

44

Treatment Group

Vehicle Palmitate Palmitate - GSH Thapsigargin

Ero

-1m

RN

A e

xpre

ssio

n (

fold

change)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

Figure 3-7. GSH pre-treatment decreases ERo-1α mRNA expression. ERo-1α mRNA expression was measured using RT-qPCR. 3T3-L1 adipocytes were treated with 1 mM glutathione or vehicle (saline) before being treated with1 mM palmitate or vehicle (0.75% BSA) for 12 hours. Data were normalized to RPL13A and reported as a fold change from vehicle treated cells. Results were reported as mean ± SD of three independent experiments. (P = 0.015).

Different lowercase letters denote significant differences between treatment groups.

a

a

b

45

CHAPTER 4 DISCUSSION

Glutathione is one of the major endogenous antioxidants in the human body.

Many chronic diseases, including obesity and type-2 diabetes are associated with

oxidative stress, ER stress, glutathione depletion, and lower antioxidant capacity.

Recently, GSH supplements with higher bioavailability have been proven to increase

intracellular GSH in lymphocytes, erythrocytes, and buccal cells (44). Whether the same

effect would be seen in cells of peripheral tissues remains to be determined. The ability

of various cell types to uptake GSH from the extracellular environment would be one

important factor. Therefore, one of the aims of this study was to show that extracellular

GSH is able to influence intracellular glutathione concentrations in 3T3-L1 adipocytes. It

was also investigated whether higher concentrations of glutathione may confer

resistance to ER stress in this same cell line. Mature adipocytes were pre-treated with

or without GSH before being treated with the free fatty acid, palmitate. Palmitate is

known to induce both ER stress and oxidative stress and was used in this study to

mimic high concentrations of fatty acids that adipocytes may be exposed to during

obesity (61). In addition, ER stress has been shown to decrease HMW adiponectin

secretion; therefore, the effect of GSH on adiponectin secretion during ER stress was

also evaluated.

Dietary sources of glutathione are known to have poor bioavailability.

Furthermore, concentrations of glutathione in the extracellular environment are between

one and three orders of magnitude lower than that inside of the cell (62). This, in

combination with the hydrophilic nature of glutathione and lack of specific importers has

popularized the idea that glutathione uptake into cells is poor. Conversely, a small

46

number of studies have reported GSH uptake into cells (42, 43). These data support the

idea that 3T3-L1 adipocytes uptake GSH from the extracellular environment. Incubating

3T3-L1 adipocytes with 1 mM GSH for 20 hours resulted in an approximate 60%

increase in total glutathione concentrations. Numerous possible glutathione transporters

have been identified, many of which are non-specific (63). It is possible than non-

specific transporters such as the organic ion transporter family (OAT) may mediate GSH

uptake across the plasma membrane. The exact roles and mechanisms of these

transporters with respect to GSH are still being investigated. Alternatively, GSH may not

cross the plasma membrane intact. 3T3-L1 cells and many other cell types express

plasma membrane ƴ-glutamyl transpeptidase, which may cleave GSH, resulting in free

cysteine. Cysteine may then be taken up by the cell via amino acid transporters. An

increase in intracellular cysteine could also explain the increased glutathione

concentrations reported here.

ER stress is involved in the pathology of obesity and is associated with oxidative

stress and glutathione depletion. Glutathione is able to neutralize ROS and is thought to

contribute to proper folding of proteins by maintaining the pool of reduced PDI in the

ER. Although glutathione may contribute to proper protein folding, other studies have

questioned its importance. Tsunoda et al. showed that GSH was dispensable to many

protein folding features of the ER, but may still be important in folding large proteins with

several disulfide bonds (40). It was hypothesized that treatment with palmitate would

deplete glutathione concentrations in 3T3-L1 adipocytes and pre-treatment with GSH

would ameliorate this effect. Indeed, after 12 or 24 hours of palmitate treatment,

intracellular glutathione concentrations decreased by ~50%. However, GSH pre-

47

treatment did not ameliorate this effect. Interestingly, there was a trend towards lower

glutathione concentrations 6 hours following palmitate treatment in cells pre-treated with

GSH. The non-allosteric feedback inhibition of glutamate cysteine ligase (GCL) by

glutathione may explain this. These data are in line with previous studies showing that

saturated free fatty acids induce oxidative stress to cells by UPR signaling or other

pathways (64). These data also suggests that any protective effects of augmenting

glutathione concentrations during ER stress is likely to occur early during the onset of

stress or by a mechanism that does not rely only on free GSH acting as an antioxidant

or assisting in protein folding.

Although, pre-treating 3T3-L1 adipocytes with GSH did not prevent glutathione

depletion during palmitate-induced ER stress, GSH pre-treatment did show other

biological effects, such as significantly decreasing induction of CHOP, a downstream

target of the PERK-eIF2α-ATF4 signaling pathway associated with ER stress induced

cell death. The spliced variant of XBP1 (XBP1s) was also measured as a marker for

activation of the IRE1 pathway of the UPR and was upregulated in response to

palmitate. GSH pre-treatment did not significantly affect XBP1s mRNA expression.

XBP1s binds to ER stress response elements in its target genes and is involved in lipid

synthesis, endoplasmic reticulum associated protein degradation (ERAD) and initiation

of adipogenesis (65). Therefore, XBP1s is thought to promote cellular adaptation to ER

stress. XBP1s overexpression in murine embryonic fibroblasts conferred resistance to

ER stress and insulin resistance. Furthermore, obese XBP1+/- mice showed insulin

resistance and increased PERK phosphorylation compared to WT mice (10). Seeing

that GSH pre-treatment completely ameliorated CHOP expression, but did not affect

48

XBP1s, it is tempting to speculate that increased intracellular GSH concentrations may

modulate UPR signaling in response to ER stress, possibly conferring stress resistance

and promoting adaptation over cell death.

Adipocyte cell death has been shown to be associated with adipose tissue

inflammation and insulin resistance during obesity. It has been shown that adipocytes

undergoing cell death in obese adipose tissue show morphological features of

pyroptosis, a programmed form of cell death resulting in inflammation (16). Mice lacking

CHOP seem to be protected against pyroptotic cell death (66). Therefore, CHOP

induction may be crucial in adipocyte pyroptosis. The fact that GSH strongly prevented

CHOP induction by palmitate treatment points to a possible role of GSH in reducing

adipocyte cell death during obesity. The mechanism by which GSH prevents CHOP

induction is not known. However, CHOP is more highly induced in mice lacking

glutathione S-transferase Pi (GSTP), a protein catalyzing S-glutathionylation of proteins,

compared to WT mice during ER stress. This implies that protein S-glutathionylation of

proteins upstream of CHOP may regulate its expression. (67). Protein S-

glutathionylation has been shown to occur when cells are facing oxidative stress and

may influence protein function (67, 68). The binding of GSH to cysteine residues on

proteins occurs more readily when intracellular glutathione concentrations are high and

the redox environment is mildly oxidizing in order to facilitate disulfide bonding.

Conversely, protein de-glutathionylation is favored under reducing conditions and can

be mediated by redox proteins including thioredoxins and glutaredoxins.

It was recently reported that S-glutathionylation of key ER stress proteins can

alter UPR signaling. Bone marrow-derived dendritic cells and murine embryonic

49

fibroblasts cells lacking GSTP showed increased mRNA and protein expression of

CHOP and IRE1 in response to treatment with the pharmacological ER stress inducers

thapsigargin or tunicamycin (67). Therefore, higher glutathione concentrations may be

ER protective by increasing S-glutathionylation of UPR proteins. However, further

studies are needed to confirm that excess glutathione concentrations directly increases

S-glutathionylation of proteins. Interestingly, GSH pre-treatment did not significantly

affect XBP1s gene expression even though IRE1 expression has been shown to be

regulated by S-glutathionylation. Therefore, the PERK pathway of UPR signaling may

be more susceptible to glutathione concentrations than IRE1.

Besides acting as a reservoir for energy storage, adipocytes partake a signaling

role by secreting adipokines such as leptin and adiponectin. Adiponectin is an anti-

inflammatory adipokine with insulin sensitizing properties and is inversely correlated

with BMI. ER stress is associated with decreased adiponectin secretion. Mondal et al.

showed that murine adipose stem cells secreted less adiponectin (total and HMW)

during ER stress (19). Furthermore, this decrease was associated with a small, but

significant increase in mRNA expression of the redox active protein ERo-1α. ERo-1α

may prevent folding of adiponectin into its HMW form by interfering with thiol mediated

protein retention and causing premature secretion of adiponectin from the cell (52).

Therefore, I aimed to determine whether GSH pre-treatment may increase HMW and

total adiponectin secretion during ER stress, perhaps by antagonizing ERo-1α activity.

GSH pre-treatment did not have any effect on HMW adiponectin secretion after 24

hours of incubation with palmitate in 3T3-L1 adipocytes. Interestingly, GSH pre-

treatment slightly decreased total adiponectin secretion relative to vehicle and cells

50

treated with palmitate alone. There was no significant difference between adiponectin

concentrations in conditioned media between palmitate and vehicle treated cells at 24

hours. Also, GSH pretreatment resulted in decreased ERo-1α mRNA expression

relative to both vehicle and palmitate treated cells. Therefore, it is possible that GSH

may regulate ERo-1α at the transcriptional level. I hypothesized that GSH may act

antagonistically of ERo-1α by maintaining a pool of reduced PDI in the ER. This could

allow for proper assembly of HMW adiponectin before the protein is secreted. In this

case, I expected that GSH would increase HMW adiponectin secretion from 3T3-L1

adipocytes during ER stress. It was also hypothesized that ERo-1α would be

upregulated during ER stress, as CHOP is known to upregulate ERo-1α mRNA

expression (69). However, I did not see this occurrence, perhaps because palmitate is a

mild ER stress inducer compared to pharmacological agents such as thapsigargin. The

observed suppression of ERo-1α mRNA expression by GSH may also explain why total

adiponectin secretion was lower in GSH pre-treated cells. ERo-1α is the rate limiting

enzyme in disulfide bond formation in the ER. Therefore, decreased ERo-1α expression

could actually prevent disulfide bonding and secretion of many proteins, including

adiponectin.

This study pointed out potential roles of GSH as a signaling molecule outside of

its normal roles as an antioxidant and in assisting with protein folding. Few studies have

investigated how increasing glutathione status in the cell affects ER stress related

outcomes. Furthermore, it was shown that exogenous GSH was able to increase

intracellular GSH, perhaps by directly crossing the plasma membrane. Although, these

data show that higher initial glutathione concentrations may not prevent its depletion by

51

palmitate, protein bound glutathione was not measured and may represent an additional

pool of intracellular glutathione. GSH pretreatment ameliorated CHOP induction in 3T3-

L1 adipocytes during ER stress. Increased S-glutathionylation of proteins is a plausible

mechanism. However, future studies should determine whether S-glutathionylation is

depended on glutathione concentrations, in addition to GSTP activity. Furthermore,

exactly which UPR proteins are glutathionylated also remains to be determined. GSH

has been shown bind to transcription factors c-jun and NF-kB, inhibiting their function

(70). It is also plausible that GSH could bind to the transcription factor ATF4, preventing

it from upregulating CHOP. This study showed that GSH pre-treatment did not increase

HMW adiponectin secretion from 3T3-L1 adipocytes during ER stress. The lack of effect

of GSH on HMW adiponectin secretion suggests that redox chaperones other than Ero-

1α may be more important in maintaining secretion of HMW adiponectin during ER

stress. Indeed, disulfide bond A oxidoreductase-like protein (DsbA-L) has been shown

to localize in the ER and prevent the decrease in HMW adiponectin secretion by

thapsigargin-induced ER stress in 3T3-L1 adipocytes (71, 72). Therefore, future studies

should investigate regulation of this chaperone during ER stress. A limitation of this

study is that intracellular adiponectin concentrations were not measured. Therefore, it

cannot be known whether the decrease in HMW adiponectin secretion was due to

impaired synthesis or secretion. Finally, GSH suppressed ERo-1α mRNA expression,

which is in line with previous studies showing that ERo-1α is upregulated by CHOP

during ER stress. Therefore, ERo-1α may also be regulated by S-glutathionylation of its

upstream proteins.

52

In summary, GSH may play a role in determining cell fate during ER stress by

tilting UPR signaling towards survival, rather than cell death. This could be favorable

during obesity and MetS, as adipocyte cell death is linked to inflammation and insulin

resistance. Therefore, bolstering intracellular glutathione concentrations in the adipocyte

may help prevent these comorbidities. Future animal studies could point out whether

highly bioavailable oral glutathione supplements may be effective in increasing

adipocyte glutathione concentrations. Glutathione may also be increased by hormetic

compounds in food that target the NRF2 pathway, such as curcumin and sulphoraphane

(73).

53

Figure 4-1. Hypothetical mechanism of action explaining how increased intracellular

glutathione alters UPR signaling. Increased intracellular glutathione in the presence of oxidative stress favors S-glutathionylation of proteins containing cysteine residues. ATF4 (mouse and human) contains multiple cysteine residues which may serve as targets for S-glutathionylation, perhaps inhibiting the DNA binding activity of the protein. Downstream effects include decreased CHOP and Ero-1α expression. Decreased availability of Ero-1α may prevent release of thiol-retained proteins from the ER, including adiponectin.

BRANDON EUDY © 2016

54

LIST OF REFERENCES

1. Eckel RH, Grundy SM, Zimmet PZ. The metabolic syndrome. Edtion ed. Lancet. England, 2005:1415-28.

2. Ford ES, Li C, Zhao G. Prevalence and correlates of metabolic syndrome based on a harmonious definition among adults in the US. J Diabetes 2010;2(3):180-93. doi: 10.1111/j.1753-0407.2010.00078.x.

3. Dunham-Snary KJ, Ballinger SW. Mitochondrial genetics and obesity: evolutionary adaptation and contemporary disease susceptibility. Free Radic Biol Med 2013;65:1229-37. doi: 10.1016/j.freeradbiomed.2013.09.007.

4. Shungin D, Winkler TW, Croteau-Chonka DC, et al. New genetic loci link adipose and insulin biology to body fat distribution. Edtion ed. Nature. England, 2015:187-96.

5. O'Rahilly S, Farooqi IS. The Genetics of Obesity in Humans. Edtion ed. In: De Groot LJ, Beck-Peccoz P, Chrousos G, et al., eds. Endotext. South Dartmouth MA: MDText.com, Inc., 2000.

6. Musso G, Gambino R, Cassader M. Obesity, diabetes, and gut microbiota: the hygiene hypothesis expanded? Edtion ed. Diabetes Care. United States, 2010:2277-84.

7. Kalliomaki M, Collado MC, Salminen S, Isolauri E. Early differences in fecal microbiota composition in children may predict overweight. Edtion ed. Am J Clin Nutr. United States, 2008:534-8.

8. Al-Hamodi Z, Al-Habori M, Al-Meeri A, Saif-Ali R. Association of adipokines, leptin/adiponectin ratio and C-reactive protein with obesity and type 2 diabetes mellitus. Edtion ed. Diabetol Metab Syndr. England, 2014:99.

9. Ozcan L, Tabas I. Role of endoplasmic reticulum stress in metabolic disease and other disorders. Annu Rev Med 2012;63:317-28. doi: 10.1146/annurev-med-043010-144749.

10. Ozcan U, Cao Q, Yilmaz E, et al. Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 2004;306(5695):457-61. doi: 10.1126/science.1103160.

11. Malhotra JD, Kaufman RJ. Endoplasmic reticulum stress and oxidative stress: a vicious cycle or a double-edged sword? Antioxid Redox Signal 2007;9(12):2277-93. doi: 10.1089/ars.2007.1782.

12. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 2001;107(7):881-91.

55

13. Oyadomari S, Mori M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ 2004;11(4):381-9. doi: 10.1038/sj.cdd.4401373.

14. McCullough KD, Martindale JL, Klotz LO, Aw TY, Holbrook NJ. Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol Cell Biol 2001;21(4):1249-59. doi: 10.1128/mcb.21.4.1249-1259.2001.

15. Yamaguchi H, Wang HG. CHOP is involved in endoplasmic reticulum stress-induced apoptosis by enhancing DR5 expression in human carcinoma cells. J Biol Chem 2004;279(44):45495-502. doi: 10.1074/jbc.M406933200.

16. Giordano A, Murano I, Mondini E, et al. Obese adipocytes show ultrastructural features of stressed cells and die of pyroptosis. J Lipid Res 2013;54(9):2423-36. doi: 10.1194/jlr.M038638.

17. Fink SL, Cookson BT. Apoptosis, pyroptosis, and necrosis: mechanistic description of dead and dying eukaryotic cells. Infect Immun 2005;73(4):1907-16. doi: 10.1128/iai.73.4.1907-1916.2005.

18. Lebeaupin C, Proics E, de Bieville CH, et al. ER stress induces NLRP3 inflammasome activation and hepatocyte death. Cell Death Dis 2015;6:e1879. doi: 10.1038/cddis.2015.248.

19. Mondal AK, Das SK, Varma V, et al. Effect of endoplasmic reticulum stress on inflammation and adiponectin regulation in human adipocytes. Metab Syndr Relat Disord 2012;10(4):297-306. doi: 10.1089/met.2012.0002.

20. Yin J, Wang Y, Gu L, Fan N, Ma Y, Peng Y. Palmitate induces endoplasmic reticulum stress and autophagy in mature adipocytes: implications for apoptosis and inflammation. Int J Mol Med 2015;35(4):932-40. doi: 10.3892/ijmm.2015.2085.

21. Leamy AK, Egnatchik RA, Young JD. Molecular mechanisms and the role of saturated fatty acids in the progression of non-alcoholic fatty liver disease. Prog Lipid Res 2013;52(1):165-74. doi: 10.1016/j.plipres.2012.10.004.

22. Hotamisligil GS. Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Edtion ed. Cell. United States: 2010 Elsevier Inc, 2010:900-17.

23. Harding HP, Zeng H, Zhang Y, et al. Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Edtion ed. Mol Cell. United States, 2001:1153-63.

24. Cinti S, Mitchell G, Barbatelli G, et al. Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. Edtion ed. J Lipid Res. United States, 2005:2347-55.

56

25. Alkhouri N, Gornicka A, Berk MP, et al. Adipocyte apoptosis, a link between obesity, insulin resistance, and hepatic steatosis. Edtion ed. J Biol Chem. United States, 2010:3428-38.

26. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF. A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 1995;270(45):26746-9.

27. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Edtion ed. Biochem Biophys Res Commun. United States, 1996:286-9.

28. Nakano Y, Tobe T, Choi-Miura NH, Mazda T, Tomita M. Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma. J Biochem 1996;120(4):803-12.

29. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 1996;271(18):10697-703.

30. Pires A, Martins P, Pereira AM, et al. Pro-inflammatory triggers in childhood obesity: correlation between leptin, adiponectin and high-sensitivity C-reactive protein in a group of obese Portuguese children. Rev Port Cardiol 2014;33(11):691-7. doi: 10.1016/j.repc.2014.04.004.

31. Atzmon G, Pollin TI, Crandall J, et al. Adiponectin levels and genotype: a potential regulator of life span in humans. Edtion ed. J Gerontol A Biol Sci Med Sci. United States, 2008:447-53.

32. Frizzell N, Rajesh M, Jepson MJ, et al. Succination of thiol groups in adipose tissue proteins in diabetes: succination inhibits polymerization and secretion of adiponectin. Edtion ed. J Biol Chem. United States, 2009:25772-81.

33. Caselli C. Role of adiponectin system in insulin resistance. Mol Genet Metab 2014;113(3):155-60. doi: 10.1016/j.ymgme.2014.09.003.

34. Yadav A, Kataria MA, Saini V. Role of leptin and adiponectin in insulin resistance. Clin Chim Acta 2013;417:80-4. doi: 10.1016/j.cca.2012.12.007.

35. Yamauchi T, Kamon J, Ito Y, et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Edtion ed. Nature. England, 2003:762-9.

36. Hosogai N, Fukuhara A, Oshima K, et al. Adipose tissue hypoxia in obesity and its impact on adipocytokine dysregulation. Diabetes 2007;56(4):901-11. doi: 10.2337/db06-0911.

57

37. Liu M, Xiang R, Wilk SA, et al. Fat-specific DsbA-L overexpression promotes adiponectin multimerization and protects mice from diet-induced obesity and insulin resistance. Edtion ed. Diabetes. United States, 2012:2776-86.

38. Christophersen BO. The inhibitory effect of reduced glutathione on the lipid peroxidation of the microsomal fraction and mitochondria. Biochem J 1968;106(2):515-22.

39. Montero D, Tachibana C, Rahr Winther J, Appenzeller-Herzog C. Intracellular glutathione pools are heterogeneously concentrated. Redox Biol 2013;1(1):508-13. doi: 10.1016/j.redox.2013.10.005.

40. Tsunoda S, Avezov E, Zyryanova A, et al. Intact protein folding in the glutathione-depleted endoplasmic reticulum implicates alternative protein thiol reductants. Elife 2014;3:e03421. doi: 10.7554/eLife.03421.

41. Chakravarthi S, Jessop CE, Bulleid NJ. The role of glutathione in disulphide bond formation and endoplasmic-reticulum-generated oxidative stress. EMBO Rep 2006;7(3):271-5. doi: 10.1038/sj.embor.7400645.

42. Kovacs-Nolan J, Rupa P, Matsui T, et al. In vitro and ex vivo uptake of glutathione (GSH) across the intestinal epithelium and fate of oral GSH after in vivo supplementation. J Agric Food Chem 2014;62(39):9499-506. doi: 10.1021/jf503257w.

43. Hagen TM, Aw TY, Jones DP. Glutathione uptake and protection against oxidative injury in isolated kidney cells. Kidney Int 1988;34(1):74-81.

44. Richie JP, Jr., Nichenametla S, Neidig W, et al. Randomized controlled trial of oral glutathione supplementation on body stores of glutathione. Eur J Nutr 2015;54(2):251-63. doi: 10.1007/s00394-014-0706-z.

45. Hotamisligil GS. Inflammation and endoplasmic reticulum stress in obesity and diabetes. Int J Obes (Lond) 2008;32 Suppl 7:S52-4. doi: 10.1038/ijo.2008.238.

46. Bhandary B, Marahatta A, Kim HR, Chae HJ. An involvement of oxidative stress in endoplasmic reticulum stress and its associated diseases. Edtion ed. Int J Mol Sci. Switzerland, 2012:434-56.

47. Higuchi Y. Glutathione depletion-induced chromosomal DNA fragmentation associated with apoptosis and necrosis. J Cell Mol Med 2004;8(4):455-64.

48. Giordano E, Davalos A, Nicod N, Visioli F. Hydroxytyrosol attenuates tunicamycin-induced endoplasmic reticulum stress in human hepatocarcinoma cells. Mol Nutr Food Res 2014;58(5):954-62. doi: 10.1002/mnfr.201300465.

58

49. Sun Y, Pu L-Y, Lu L, Wang X-H, Zhang F, Rao J-H. N-acetylcysteine attenuates reactive-oxygen-species-mediated endoplasmic reticulum stress during liver ischemia-reperfusion injury. World Journal of Gastroenterology : WJG 2014;20(41):15289-98. doi: 10.3748/wjg.v20.i41.15289.

50. Malhotra JD, Miao H, Zhang K, et al. Antioxidants reduce endoplasmic reticulum stress and improve protein secretion. Edtion ed. Proc Natl Acad Sci U S A. United States, 2008:18525-30.

51. Cuozzo JW, Kaiser CA. Competition between glutathione and protein thiols for disulphide-bond formation. Nat Cell Biol 1999;1(3):130-5. doi: 10.1038/11047.

52. Anelli T, Alessio M, Mezghrani A, et al. ERp44, a novel endoplasmic reticulum folding assistant of the thioredoxin family. Edtion ed. EMBO J. England, 2002:835-44.

53. White-Gilbertson S, Hua Y, Liu B. The role of endoplasmic reticulum stress in maintaining and targeting multiple myeloma: a double-edged sword of adaptation and apoptosis. Front Genet 2013;4:109. doi: 10.3389/fgene.2013.00109.

54. Wang ZV, Schraw TD, Kim JY, et al. Secretion of the adipocyte-specific secretory protein adiponectin critically depends on thiol-mediated protein retention. Edtion ed. Mol Cell Biol. United States, 2007:3716-31.

55. Landrier JF, Gouranton E, El Yazidi C, et al. Adiponectin expression is induced by vitamin E via a peroxisome proliferator-activated receptor gamma-dependent mechanism. Edtion ed. Endocrinology. United States, 2009:5318-25.

56. Ohara K, Uchida A, Nagasaka R, Ushio H, Ohshima T. The effects of hydroxycinnamic acid derivatives on adiponectin secretion. Edtion ed. Phytomedicine. Germany, 2009:130-7.

57. Cho SY, Park PJ, Shin HJ, et al. (-)-Catechin suppresses expression of Kruppel-like factor 7 and increases expression and secretion of adiponectin protein in 3T3-L1 cells. Edtion ed. Am J Physiol Endocrinol Metab. United States, 2007:E1166-72.

58. Oliveira AF, Cunha DA, Ladriere L, et al. In vitro use of free fatty acids bound to albumin: A comparison of protocols. Biotechniques 2015;58(5):228-33. doi: 10.2144/000114285.

59. Chen RF. Removal of fatty acids from serum albumin by charcoal treatment. J Biol Chem 1967;242(2):173-81.

59

60. Harris CA, Haas JT, Streeper RS, et al. DGAT enzymes are required for triacylglycerol synthesis and lipid droplets in adipocytes. Edtion ed. J Lipid Res. United States, 2011:657-67.

61. Boden G. Obesity and free fatty acids. Endocrinol Metab Clin North Am 2008;37(3):635-46, viii-ix. doi: 10.1016/j.ecl.2008.06.007.

62. Lushchak VI. Glutathione homeostasis and functions: potential targets for medical interventions. J Amino Acids 2012;2012:736837. doi: 10.1155/2012/736837.

63. Bachhawat AK, Thakur A, Kaur J, Zulkifli M. Glutathione transporters. Biochim Biophys Acta 2013;1830(5):3154-64. doi: 10.1016/j.bbagen.2012.11.018.

64. Guo W, Wong S, Xie W, Lei T, Luo Z. Palmitate modulates intracellular signaling, induces endoplasmic reticulum stress, and causes apoptosis in mouse 3T3-L1 and rat primary preadipocytes. Am J Physiol Endocrinol Metab 2007;293(2):E576-86. doi: 10.1152/ajpendo.00523.2006.

65. Sha H, He Y, Chen H, et al. The IRE1alpha-XBP1 pathway of the unfolded protein response is required for adipogenesis. Cell Metab 2009;9(6):556-64. doi: 10.1016/j.cmet.2009.04.009.

66. Endo M, Mori M, Akira S, Gotoh T. C/EBP homologous protein (CHOP) is crucial for the induction of caspase-11 and the pathogenesis of lipopolysaccharide-induced inflammation. J Immunol 2006;176(10):6245-53.

67. Ye Z, Zhang J, Ancrum T, Manevich Y, Townsend DM, Tew KD. S-Glutathionylation of Endoplasmic Reticulum Proteins Impacts Unfolded Protein Response Sensitivity. Antioxid Redox Signal 2016. doi: 10.1089/ars.2015.6486.

68. Ghezzi P, Romines B, Fratelli M, et al. Protein glutathionylation: coupling and uncoupling of glutathione to protein thiol groups in lymphocytes under oxidative stress and HIV infection. Mol Immunol 2002;38(10):773-80.

69. Li G, Mongillo M, Chin KT, et al. Role of ERO1-alpha-mediated stimulation of inositol 1,4,5-triphosphate receptor activity in endoplasmic reticulum stress-induced apoptosis. J Cell Biol 2009;186(6):783-92. doi: 10.1083/jcb.200904060.

70. Ghezzi P. Protein glutathionylation in health and disease. Biochim Biophys Acta 2013;1830(5):3165-72. doi: 10.1016/j.bbagen.2013.02.009.

71. Liu M, Chen H, Wei L, et al. ER localization is critical for DsbA-L to Suppress ER Stress and Adiponectin Down-Regulation in Adipocytes. J Biol Chem 2015. doi: 10.1074/jbc.M115.645416.

60

72. Liu M, Zhou L, Xu A, et al. A disulfide-bond A oxidoreductase-like protein (DsbA-L) regulates adiponectin multimerization. Edtion ed. Proc Natl Acad Sci U S A. United States, 2008:18302-7.

73. Bryan HK, Olayanju A, Goldring CE, Park BK. The Nrf2 cell defence pathway: Keap1-dependent and -independent mechanisms of regulation. Biochem Pharmacol 2013;85(6):705-17. doi: 10.1016/j.bcp.2012.11.016.

61

BIOGRAPHICAL SKETCH

Brandon Eudy was born in 1991 in New Bern, North Carolina. He attended North

Carolina State University from 2009-2013, where he graduated cum laude with a BS in

chemistry. During his undergraduate career, he developed an avid interest in the field of

nutrition, which motivated him to pursue his MS in the Department of Food Science and

Human Nutrition at the University of Florida. After graduating, Brandon will continue his

education by pursuing a PhD in nutritional sciences to prepare him for a career in

nutrition science research.