http://informahealthcare.com/rnfISSN: 0886-022X (print), 1525-6049 (electronic)

Ren Fail, Early Online: 1–9! 2014 Informa Healthcare USA, Inc. DOI: 10.3109/0886022X.2014.900404

LABORATORY STUDY

The effects of adenosine A2B receptor inhibition on VEGF and nitricoxide axis-mediated renal function in diabetic nephropathy

Leena Patel1 and Aswin Thaker2

1Department of Pharmacology, Ramanbhai Patel College of Pharmacy, Charotar University of Science and Technology, Anand, Gujarat, India and2Department of Pharmacology & Toxicology, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand, Gujarat,

India

Abstract

Diabetic nephropathy (DN) is the most common cause of end-stage renal disease worldwide.The pathophysiologic mechanisms of diabetic nephropathy are incompletely understoodbut include overproduction of various growth factors and cytokines. Upregulation ofvascular endothelial growth factor (VEGF) is a pathogenic event occurring in most forms ofpodocytopathy; however, the mechanisms that regulate this growth factor induction are notclearly identified. A2B receptors have been found to regulate VEGF expression under hypoxicenvironment in different tissues. One proposed hypothesis in mediating diabetic nephropathyis the modulation of VEGF-NO balance in renal tissue. We determined the role of adenosine A2B

receptor in mediating VEGF overproduction and nitrite in diabetic nephropathy. The renalcontent of A2B receptors and VEGF was increased after 8 weeks of diabetes induction. The renaland plasma nitrite levels were also reduced in these animals. In vivo administration of A2B

adenosine receptor antagonist (MRS1754) inhibited the renal over expression of VEGF andadverse renal function parameters. The antagonist administration also improved the kidneytissue nitrite levels. In conclusion, we demonstrated that VEGF induction via adenosinesignaling might be the critical event in regulating VEGF-NO axis in diabetic nephropathy.

Keywords

A2B Adenosine receptor, diabeticnephropathy, nitric oxide, streptozotocin,VEGF

History

Received 9 November 2013Revised 28 January 2014Accepted 19 February 2014Published online 28 March 2014

Introduction

Diabetic nephropathy (DN) is the most common cause of end-

stage renal disease. About one-third of the patients who

develop diabetes eventually suffer from DN. The costs of DN

are significantly higher than those from other diabetic

complications because the patients are subjected to hemodi-

alysis programs and renal transplant when failure occurs.

Thus, the burden of DN on public health is enormous.1 The

pathomechanisms leading to these changes are not yet clearly

understood and therefore, therapeutic approaches for relief

of this disease are scarce or do not permit a favorable

pharmacological intervention.

Vascular endothelial growth factor (VEGF-A) is one of the

critical mediators in DN. It is constitutively expressed in

podocytes, proximal tubular cells and medullary thick

ascending limb cells in the juxtamedullary region of the

normal kidney. Evidence is emerging that VEGF plays a

critical role in maintaining renal homeostasis.2,3 An alteration

in VEGF-A expression has been shown in a variety of renal

diseases. Altered (increased or decreased) expression of

VEGF leads to glomerular dysfunction and proteinuria.

Both circulating and local VEGF-A levels are high in diabetes

and the excessive VEGF-A has been shown to have a key role

in mediating glomerular hypertrophy, proteinuria and retin-

opathy.4–6 VEGF-A induced excessive angiogenesis has been

extensively found in retinopathy, the same has been also seen

in nephropathy.7 The precise mechanism is unclear for

contradictory status of VEGF-A in diabetic and non-diabetic

kidney disease. Hypoxia has been found to stimulate VEGF-A

expression. Adenosine is a critical mediator in physiological

adaptation to hypoxia and contribute to diseases as diverse as

inflammation and carcinogenesis.8 Once liberated in the

extracellular space, adenosine is either recycled or interacts

with cell surface adenosine receptors. Presently, four subtypes

of G protein-coupled receptors exist, designated A1, A2A, A2B

or A3. A2B receptors are the lower affinity receptors and they

have been found to induce angiogenesis.9

The role of adenosine receptors in cellular dysfunction

mediating progression of DN has been studied recently.

Ex vivo exposure of rat kidney glomeruli to adenosine leads to

an increase in VEGF-A content. Activation of A2B receptor

subtype augments expression, and releases VEGF-A beyond

basal levels in rat glomeruli.10 Uncoupling of VEGF-nitric

oxide (VEGF–NO) axis has been studied as the factor

mediating DN.11 Hypoxia has been found to play a critical

role in pathogenesis of DN.12 We thus hypothesize that

Address correspondence to Leena Patel, Department of Pharmacology,Ramanbhai Patel College of Pharmacy, Charotar University of Scienceand Technology, CHARUSAT Campus, Changa – 388 421, Ta. Petlad,Dist. Anand, Gujarat, India. Tel: +91- 9913523315; Fax: 02697-265021;E-mail: hetavi2009@gmail.com

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

hypoxic condition produced in hyperglycemic environment

of DN may change the expression of adenosine receptors

to angiogenic phenotype increasing levels of VEGF-A. The

accelerated state of VEGF-A together with reduced endothe-

lial NO bioavailability, in diabetic kidney; results in

uncoupling of the VEGF–NO axis. The event consequently

causes VEGF-A to produce diverse biologic effects that could

contribute to DN. Herein, we examined the effects of A2B

antagonist on VEGF–NO axis-mediated renal function in

mice model of DN.

Materials and methods

Chemicals and reagents

Streptozotocin and nitrate reductase were purchased from

Sigma Chemical Co., Milwaukee, WI. An enzyme linked

immunosorbent assay (ELISA) kit for the estimation of

VEGF-A was purchased from RayBiotech Inc., Norcross, GA.

MRS1754 were purchased from Abcam plc.UK. DAN (2,3-

diaminonaphthalene), sodium nitrite and nicotinamide aden-

ine dinucleotide phosphate (NADP) were purchased from

Himedia Laboratories, Mumbai, India. Kits for the estimation

of plasma creatinine and blood urea nitrogen (BUN) were

purchased from Crest Biosystem, Goa, India.

Animal model and experimental protocol

All animal experiments were conducted in accordance with

the guidelines of CPCSEA, India. Male C57BL/6 mice were a

kind gift from Zydus Research Centre, Ahmedabad (body

weight: 22 ± 2 g). Animals were maintained at a room

temperature in a light (12 h light/12 h dark)-controlled

environment with access to food and water ad libitum. One

week after the acclimatization animals were randomly

assigned to different treatment as depicted in Table 1.

Induction of diabetes

The low dose streptozotocin (STZ) protocol described by

Animal Models of Diabetic Complications Consortium

(AMDCC) was followed for induction of diabetes.13 In

brief, mice were fasted prior to injection for 4 h. A single

intraperitoneal STZ (50 mg/kg) injection was administered to

each mouse for 5 days consecutively (n¼ 12). Mice were

supplied with 10% sucrose water to avoid sudden hypogly-

cemia post-injection. A normal control group of mice were

injected with 400mL vehicle (sodium citrate buffer). Body

weight and blood glucose (SD CHECK� GOLD Blood

Glucose Meter, SD Biosensor, Korea) were monitored 1 week

after STZ injection and every week thereafter. Mice with

blood glucose levels of4300 mg/dL were considered diabetic.

Following 8 weeks of diabetes induction (n¼ 6), the mice

were treated with the antagonist of A2B adenosine receptor,

MRS1754 (1 mg/kg, i.p.) for two weeks. The animals in the

antagonist control group were administered MRS1754

(1 mg/mL) for two weeks (n¼ 6).

Collection of urine, blood and tissue samples

Mice were housed in metabolic cages for collection of 24 h

urine samples. Blood was drawn from retro orbital tract. The

setting up of cages and collecting samples were carried out

between 15:00 and 16:00 to avoid food derived creatinine

interference. At the end of the treatment all the animals were

sacrificed and whole kidneys were removed. The kidneys

were weighed and frozen in liquid nitrogen in RNA later� for

isolation of total RNA. The samples were stored at �80 �Cuntil used for biochemical analysis.

Renal function parameters

Plasma and urine creatinine (modified Jaffe’s kinetic method),

BUN (GLDH kinetic method) were measured by commer-

cially available kits following manufacturers’ instructions.

Urine albumin (Bromocresol green method using mouse

albumin as standard) was measured to calculate urinary

albumin excretion (UAE) from 24 h urine samples. Creatinine

clearance was calculated according to the U/P�V principle

for the matching plasma and urine samples.14

Quantitative VEGF-A determinations

Kidney tissues were washed with cold phosphate buffered

saline (PBS) and homogenized (10%w/v) in ice bath. The

homogenate was then centrifuged at 20,000 rpm at 4 �C. The

supernatant was stored at �80 �C till further analysis. VEGF-

A protein was measured in plasma and homogenate by ELISA

following the manufacturer’s protocols (RayBiotech Inc.,

Norcross, GA).

Quantitative NO determinations

As an indicator of nitric oxide bioavailability, nitrite and

nitrate were estimated in urine and kidney homogenate by

spectrofluorometric analysis. The method was adopted from

the literature and modified slightly.15 Briefly, 10 mL of nitrate

reductase (0.5 U/mL) was added to 100 mL of sample, after

4 h; 20 mL of DAN (0.05 mg/mL), 130 mL HCl (1.5 N) were

added. After 10 min, the reaction was stopped by 130 mL of

NaOH (2 N). The resultant solution was diluted to 2 mL

and the emission scan was recorded by a spectrofluorometer

(LS 55 Fluorescence spectrometer, Perkin Elmer) exciting at

360 nm and reading at 415 nm. Sodium nitrite was used as

reference standard.

Real time quantitative PCR for VEGF-A and A2B mRNA

RNeasy Mini Kit (Qiagen, Valencia, CA) was used for the

RNA extraction according to the manufacturer’s instructions.

Reverse transcription of total RNA to cDNA was performed

Table 1. Allocation of treatment to animals.

Groups Group I (n¼ 6) Group II (n¼ 6) Group III (n¼ 6) Group IV (n¼ 6)

Treatment Vehicle(Sodium citrate buffer)

Streptozotocin +Vehicle of MRS1754(for two weeks corresponding to group III)

Streptozotocin+ MRS1754 MRS1754

2 L. Patel and A. Thaker Ren Fail, Early Online: 1–9

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

with the Verso cDNA Synthesis Kit (Thermo Scientific,

ABgene and Surrey, UK) in a DNA Thermal cycler (Perkin-

Elmer Applied Biosystems, Foster City, CA) with random

hexamers as primers. The quality of DNA and total RNA was

checked by bioanalyzer (2100 Bioanalyzer Instrument,

Agilent Technologies, Santa Clara, CA). The real-time

PCR was performed (7500 Fast, Applied Biosystems, Grand

Island, NY) using the Quanti Tect SYBR Green PCR Kit

(Qiagen, Valencia, CA), with the cDNA synthesized above as

template in a reaction; following manufacturer‘s instructions.

Specific primers (Table 2) used for the mouse adenosine A2B

receptor (gene bank accession number GI:145966718) and

VEGF-A were adopted from the earlier literature.16,17 The

gene for glyceraldehyde 3-phosphate dehydrogenase

(GAPDH) was used as reference. Fold change in gene

expression was calculated for each gene. Melt curves were

performed upon completion of the cycles to ensure that the

non-specific products were absent.

Histochemistry and assessment of glomerulosclerosis

Kidney tissue was fixed in formalin, embedded in paraffin,

sectioned and stained with Masson trichrome reagent. One

hundred glomeruli were randomly selected for determination

of glomerulosclerosis. Glomeruli that exhibited adhesion of

the capillary tuft to Bowman’s capsule, capillary obliteration,

mesangial expansion or segmental tuft sclerosis were defined

as glomerulosclerotic. The extent of glomerular damage was

expressed as the percentage of glomeruli that exhibited

sclerosis. The degree of glomerulosclerosis was graded from

1 to 4 points according to the percentage of effected glomeruli

(1� 10%, 2� 10–20%, 3� 20–50%, and 4� 50%). Blind

analysis was done on all sections by one observer.

Statistical analysis

Data are presented as the mean ± standard error of mean

(SEM). Statistical analysis was performed using Systat13

(syatat Inc., San Jose, CA). For comparisons of continuous

variables, a test of normality was performed (Shapiro–Wilk

test) prior to assessing statistical significance using either a t-

test (parametric) or a Fligner-Wolfe test (nonparametric)

when comparing two groups. Association between the

expressions of both genes and, VEGF-A and NO levels,

were analyzed by Pearson’s correlation coefficient.

Results

General parameters

Following 10 weeks of diabetes induction, plasma glucose

concentration (Figure 1a), kidney hypertrophy index

(Figure 1b), and food intake (Figure 1c) were significantly

increased compared with non-diabetic control animals

(p50.05). Similarly a significant decrease in body weight

(p50.05, Figure 1d) was observed in animals treated with

streptozotocin. The treatment with A2B adenosine receptor

antagonist did not alter the increased levels of plasma

glucose, food intake and body weight significantly. The

treatment with antagonist significantly recovered kidney

hypertrophy index in diabetic animals (p50.05). However,

antagonist administration had no effect on all above param-

eters when administered to vehicle treated animals (MRS

control group).

Renal function parameters

Serum creatinine (Figure 2a), blood urea nitrogen (Figure 2b)

and urinary protein excretion (Figure 2d) were increased in

animals after 10 weeks of diabetes (p50.05). Similarly,

creatinine clearance was lower in diabetic animals compared

with non-diabetic control animals (Figure 2c, p50.05). Urine

albumin levels in control and control MRS animals were

below the detection limit of the method employed for

analysis. The treatment with A2B adenosine receptor antag-

onist recovered blood urea nitrogen, serum creatinine,

creatinine clearance and urinary protein excretion in diabetic

mice (p50.05). Moreover, no change in renal functions was

found in vehicle treated animals (MRS control group) after

two weeks of antagonist treatment.

Change in VEGF-A and A2B adenosine receptor geneexpression

To evaluate the impact of diabetes on expression level of

VEGF-A and A2B receptors in mice kidney, we examined

mRNA levels in kidneys of normal and STZ-induced diabetic

animals. The changes in mRNA level were evaluated based on

results from real-time PCR performed on cDNA transcribed

from RNA isolated from whole kidney. There was a

significant increase in the mRNA level of receptor in diabetic

kidney, 10 weeks after diabetes induction (Figure 3, p50.05).

In diabetic animals, the level of A2B receptor and VEGF-A

mRNA were raised 11- and 12–fold, respectively.

Administration of MRS1754 for two weeks blocked the

renal increase in VEGF-A expression. Additionally, when

antagonist was administered to vehicle treated animals (MRS

control group); a partial but not significant decrease in

VEGF-A expression was observed. The expression of A2B

receptor and VEGF-A genes was positively correlated

(Figure 3c, r¼ 0.575).

VEGF-A protein levels

VEGF-A protein measurement by ELISA supported results

obtained by gene expression study (p50.05, Figure 4b).

Comparison of VEGF-A protein level in kidneys of normal and

Table 2. Sequences of primer used in real time PCR.

Primers

Entity Sense sequence Antisense sequence

VEGF GTTCACTGTGAGCCTTGTTCAG GTCACATCTGCAAGTACGTTCGGAPDH TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGAA2B receptor TTGGCATTGGATTGACTC TATGAGCAGTGGAGGAAG

DOI: 10.3109/0886022X.2014.900404 Role of A2B receptor inhibition in diabetic nephropathy 3

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

Figure 2. Effect of A2B adenosine receptor antagonist (MRS1754) on the renal functions in control and diabetic animals. (a) Serum creatinine;(b) Blood urea nitrogen; (c) Creatinine clearance; (d) Urinary albumin excretion. Results shown are the means ( ± SEM). Notes: *p50.05; #p50.05versus Diabetes group; n¼ 6.

Figure 1. Effect of A2B adenosine receptor antagonist (MRS1754) on (a) Blood Glucose; (b) Kidney weight/body weight; (c) Food intake; (d) Bodyweight in control and diabetic animals. Notes: Data are means (±SEM). *p50.05 versus control group #p50.05 versus diabetes group; n¼ 6.

4 L. Patel and A. Thaker Ren Fail, Early Online: 1–9

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

diabetic mice indicated significantly increased level of this

mRNA in diabetic kidney. A two-week treatment with

MRS1754 blocked the increase in VEGF-A. However, antag-

onist administration had no effect on VEGF-A levels when

administered to vehicle treated animals (MRS control group).

Change in nitric oxide levels

STZ treatment significantly decreased urinary excretion of

nitrite (Figure 5a). Plasma availability (Figure 5c) and kidney

concentration (Figure 5b) of nitrite were also reduced when

compared with the control levels. The administration of

MRS1754 for two weeks blocked the renal decrease in nitrite

(p50.05).

Glomerulosclerosis

Figure 6(a–d) shows histochemical staining of representative

kidney sections from each group, and Figure 7 depicts the

quantification for glomerulosclerosis derived from the ana-

lysis of the kidney sections. Glomerulosclerosis was signifi-

cantly increased in diabetic mice, involving at least 20–50%

of glomeruli, p50.05 versus all other groups (Figure 6).

Treatment with MRS1754 prevented the increase in glomer-

ulosclerosis observed in diabetic mice. The images of the

characteristic features of DN can be viewed online in the

supplementary section of article.

Relative VEGF-A level

Figure 8(a) shows the negative correlation (r¼�0.581)

between VEGF-A and nitric oxide in diabetes in kidney

tissue homogenate. The relative concentration (VEGF/NO

ratio) of VEGF-A was found to evaluate the impact of A2B

inhibition on uncoupling state of VEGF–NO axis. The

relative level of VEGF-A was significantly increased after

10 weeks of diabetes induction (Figure 8b). The treatment

with MRS1754 improved the VEGF/NO ratio.

Discussion

The present study demonstrates that the A2B receptor has a

pathogenic effect in early glomerular dysfunctions observed

in STZ-induced diabetic mice and; it can be blocked by using

a selective antagonist in vivo. Eight weeks after induction

of diabetes in mice, marked albuminuria associated with a

reduction of renal function; and early histological changes of

diabetic nephropathy are established. Administration of A2B

receptor antagonist led to a marked reversal of albuminuria

along with a restoration of creatinine clearance and BUN.

Blood glucose and food intake were the same in control and

antagonist treated groups; thus, these factors are unlikely to

explain the difference in proteinuria observed. These alter-

ations mediated by A2B receptors correlate with an increased

Figure 3. Real-time RT-PCR analysis of (a) A2B adenosine receptors and (b) VEGF mRNA level in kidney. RNA was isolated reverse-transcribed tocDNA, as described. The cDNA was then subjected to real-time PCR using specific primers and expression levels calculated and normalized to aninternal control (GAPDH). (c) Correlation between expressions of both the genes (Pearson’s correlation). Notes: Data are means (±SEM). *p50.05versus control group; #p50.05 versus diabetes group. n¼ 5.

DOI: 10.3109/0886022X.2014.900404 Role of A2B receptor inhibition in diabetic nephropathy 5

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

expression of this receptor in mice diabetic kidney. Results

obtained are comparable to the earlier in-vivo and in-vitro

studies.18,19 The differential expression of adenosine receptor

was first described by Pawelczyk et al.20 The alteration turns

off the inhibition on VEGF-A release accompanied by an

increase in the production of this growth factor release in

diabetic state.

The mechanism by which A2B receptor antagonist mediate

protection in STZ-induced diabetic nephropathy is not known.

The pathomechanism leading to diabetic nephropathy

involves release of diverse growth factors, increased VEGF-

A being the most often involved. VEGF-A has been found to

act in autocrine manner to induce proteinuria caused by

podocytopathy. A2B receptors have been investigated for

attenuating kidney injury in diabetes directly through effects

on signaling pathways inducing VEGF-A. A2B receptor

antagonist was demonstrated to block the increased release

of TGF-b from diabetic glomeruli in vitro and the

myofibroblast transdifferentiation of mesangial cells

in vivo.21 In these studies, intervention of VEGF-A induction

was a remarkable event. Therefore, interception of both the

TGF-b and VEGF-A signaling via A2B receptors may give

new insights into drug discovery. We also correlate the

increase in low affinity A2B receptor with an increase in

VEGF-A expression.

Several studies have shown that the VEGF-A expression in

renal podocytes increased upon exposure to high glucose

concentration and it is intracellular mediated by PKC-alpha

and ERK1/2 signalling molecules.22 Our results also support

increased expression of VEGF-A in renal tissue in diabetic

state. The in vitro studies also showed reversal of increased

VEGF-A in the presence of MRS1754.10,23 In agreement with

this evidence, our study in vivo implies A2B receptors could

be a transducer of hyperglycemic conditions to mediate

VEGF-A increase in diabetic mielu.

A low renal VEGF-A was observed in many types of

experimental kidney diseases, and administration of VEGF-A

was found to be protective.24 A contradiction in terms occurs

in diabetes, wherein renal VEGF-A levels are high and a

detrimental effect of VEGF-A on kidney disease has been

shown.4,5 Normally, VEGF-A stimulates endothelial nitric

oxide release; thus, elevated NO and VEGF-A act in

coordination with each other as a trophic factor for vascular

endothelium. The surplus NO, derived from the endothelial

cell; acts as an inhibitory factor that prevents excess

endothelial cell proliferation, vascular smooth muscle cell

proliferation and macrophage infiltration. In diabetic state,

where NO bioavailability is reduced; high levels of VEGF-A

lead to excessive endothelial cell proliferation, stimulation of

macrophage chemotaxis and vascular smooth muscle cell

activation.25 Consistent with this, in our study, we could find

Figure 4. Effect of A2B adenosine receptor antagonist (MRS1754) on (a)plasma; (b) homogenate concentration of VEGF protein, measured byELISA in different experimental groups. Notes: Data are means(±SEM). *p50.05 versus control group; #p50.05 versus diabetesgroup, n¼ 6.

Figure 5. A2B adenosine receptor antagonist (MRS1754) on (a) kidneytissue (b) urine nitrite levels in control and diabetic mice. Notes: Dataare means (±SEM). *p50.05 versus control group; #p50.05 versusdiabetes group; n¼ 6.

6 L. Patel and A. Thaker Ren Fail, Early Online: 1–9

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

a reduced state of nitric oxide in plasma, urine and renal tissue

homogenate in diabetic mice. These events are consistent with

the postulate that oxidative stress promotes NO degradation in

the renal cortex during the early stage of diabetes melli-

tus.26,27 It is interesting to note that reversal in albuminuria is

greater in diabetic mice than the normal control mice treated

with antagonist alone; suggesting that the diabetic conditions

modulate expression of adenosine receptors toward angio-

genic phenotype; which are otherwise low-affinity receptors.

The elevated receptor expression induces renal VEGF-A level

(as indicated by positive correlation between the receptor and

VEGF-A) which would be added to hyperglycemia-induced

low NO availability, and becomes a critical event triggering

uncoupled state of VEGF-A–NO axis. In consistent with this

hypothesis, we could find reversal of VEGF-A–NO axis in

Figure 6. Masson trichrome staining of kidney tissue: (a) Control; (b) Diabetes; (c) Diabetes + MRS1754; (d) Control MRS1754. All images arerepresentative glomeruli at an original magnification of 400�.

Figure 8. Effect of A2B adenosine receptor antagonist (MRS1754) onrelative VEGF level in kidney tissue in different experimentalgroups. Notes: Data are means (±SEM). *p50.05 versus controlgroup; #p50.05 versus diabetes group; n¼ 6.

Figure 7. Glomerulosclerosis score in different experimentalgroups. Notes: Data are means (±SEM). *p50.05 versus controlgroup; #p50.05 versus diabetes group; n¼ 6.

DOI: 10.3109/0886022X.2014.900404 Role of A2B receptor inhibition in diabetic nephropathy 7

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

diabetic animals after 2 weeks of antagonist administration.

A2B antagonist may also directly modulate NO which is

indicated by increase in NO levels; 2 weeks after MRS1754

treatment.

The current literature evidence indicates Angiotensin II

(Ang II) as contributing factor to induce VEGF-A expression

in diabetic glomerular tissue. Intra-renal renin and angioten-

sinogen levels are increased in diabetic animals. High glucose

has been demonstrated to induce renin and Ang II production

in glomerular cells.28,29 A2BAR antagonist blocked the

progression of renal fibrosis generated in the ADA�/�animals; in mice infused with Ang II or subjected to unilateral

ureteral obstruction. These studies suggest a common patho-

genic pathway involving adenosine signaling in chronic

kidney disease.30 Recently, notch I signaling have also been

proved to increase VEGF-A and podocytopathy.31 Therefore,

it remained to be revealed if A2B receptors also interrelate

activation of the notch I signaling. Our major contribution

is to demonstrate that this pathogenic pathway occurs

early in the progression of the diabetic renal disease, and

supports the option of A2BAR as a pharmacological target

intervention in DN.

In patients with cancer treated with bevacizumab, a

humanized monoclonal anti-VEGF-A antibody, thrombotic

microangiopathy developed as a complication.32

Administration of A2B antagonist may inhibit pathological

change in VEGF, mediated by hypoxic diabetic environment

instead of the widespread non-specific inhibition which

might have resulted into adverse effects. The correlation

between the activities of these low-affinity receptors with

increased ligand availability have already been observed in

diabetic kidney in experimental animals.30 In accordance

with these findings, elevated adenosine levels in plasma of

clinically manifested DN patients were also found.33 Hence,

the measurement of adenosine levels in plasma and urine

or expression of these receptors in biopsy specimen could

represent a novel specific marker for early diagnosis or

patient at risk for development of DN. It has been described

that A2B receptor blockade reverses insulin resistance in

type II diabetes animal models and points toward another

therapeutic potential.34 A2B receptor blockers useful in

humans such as CVT-6883 are being developed in phase 1

trial,35 may be a novel alternative for the management of

DN patients.

Our studies do not exclude the possibility that A2B receptor

antagonist induce a favorable intraglomerular hemodynamic

effect to reduce proteinuria. It is possible that A2B receptor

antagonist mitigate proteinuria through direct effects by

blocking vasoactive inflammatory mediators. Additional

studies are necessary to address this issue.

In summary, our study demonstrates that administration

of selective A2B receptor antagonist attenuates renal dys-

function in DN. We believe that the renal tissue-protective

effect of A2B receptor antagonist is mediated primarily by

inhibiting induction of VEGF-A; thereby, preventing dis-

traction of VEGF–NO axis in diabetic kidney. We conclude

that A2B receptor antagonist represent a novel therapeutic

option for the treatment of diabetic kidney disease and for

potentially other diabetic complications; where VEGF-A is

the culprit.

Acknowledgments

The authors thank Dr. C. J. Joshi (Department of Animal

Biotechnology, Anand Agricultural University, Anand,

Gujarat, India) for providing facility to carry out gene

expression studies and ELISA experiments. They also thank

Ms. Pankti Desai (Department of Pharmaceutical Chemistry

and Analysis, Ramanbhai Patel College of Pharmacy) for

assistance in spectrofluorometric experiments. Authors are

also thankful to Dr D. J. Godasara (Department of Veterinary

Pathology, Anand Agricultural University, Anand, Gujarat,

India) for assistance in histopathological studies.

Declaration of interest

The authors state no conflict of interest.

References

1. Peter Rossing MDD. Diabetic nephropathy: worldwide epidemicand effects of current treatment on natural history. Curr DiabetesReports. 2006;6(6):479–483.

2. Futrakul N, Butthep P, Laohareungpanya N, Chaisuriya P,Ratanabanangkoon K. A defective angiogenesis in chronic kidneydisease. Renal Fail. 2008;30(2):215–217.

3. Schrijvers BF, Flyvbjerg A, De Vriese AS. The role of vascularendothelial growth factor (VEGF) in renal pathophysiology. KidneyInt. 2004;65(6):2003–2017.

4. Tsuchida K, Makita Z, Yamagishi S, et al. Suppression oftransforming growth factor beta and vascular endothelial growthfactor in diabetic nephropathy in rats by a novel advanced glycationend product inhibitor, OPB-9195. Diabetologia. 1999;42(5):579–588.

5. De Vriese AS, Tilton RG, Elger M, Stephan CC, Kriz W, LameireNH. Antibodies against vascular endothelial growth factor improveearly renal dysfunction in experimental diabetes. J Am Soc Nephrol.2001;12(5):993–1000.

6. Ho C, Hsu Y-C, Tseng C-C, Wang F-S, Lin CL, Wang JY.Simvastatin alleviates diabetes-induced VEGF-mediated nephro-pathy via the modulation of Ras signaling pathway. Renal Fail.2008;30(5):557–565.

7. Xu L, Kanasaki K, Kitada M, Koya D. Diabetic angiopathy andangiogenic defects. Fibrogen Tissue Repair. 2012;5:13. doi:10.1186/1755-1536-5-13.

8. Kong T, Westerman KA, Faigle M, Eltzschig HK, Colgan SP. HIF-dependent induction of adenosine A2B receptor in hypoxia. FASEBJ. 2006;20(13):2242–2250.

9. Feoktistov I, Goldstein AE, Ryzhov S, et al. Differential expressionof adenosine receptors in human endothelial cells role of A2Breceptors in angiogenic factor regulation. Circ Res. 2002;90(5):531–538.

10. Valladares D, Quezada C, Montecinos P, et al. Adenosine A2Breceptor mediates an increase on VEGF-A production in rat kidneyglomeruli. Biochem Biophys Res Commun. 2008;366(1):180–185.

11. Nakagawa T. Uncoupling of the VEGF-endothelial nitric oxide axisin diabetic nephropathy: an explanation for the paradoxical effectsof VEGF in renal disease. Am J Physiol-Renal Physiol. 2007;292(6):F1665–F1672.

12. Palm F, Nordquist L, Wilcox CS, Hansell P. Oxidative Stress andHypoxia in the Pathogenesis of Diabetic Nephropathy. Studies onRenal Disorders. Springer; 2011:559–586.

13. Wu KK, Huan Y. Streptozotocin-induced Diabetic Models in Miceand Rats. Current Protocols in Pharmacology. John Wiley andSons; 2008:5.47.1–5.47.14.

14. Eisner C, Faulhaber-Walter R, Wang Y, et al. Major contribution oftubular secretion to creatinine clearance in mice. Kidney Int. 2009;77(6):519–526.

15. Rao AM, Dogan A, Hatcher J, Dempsey R. Fluorometric assay ofnitrite and nitrate in brain tissue after traumatic brain injury andcerebral ischemia. Brain Res. 1998;793(1):265–270.

8 L. Patel and A. Thaker Ren Fail, Early Online: 1–9

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.

16. Kreckler LM, Wan TC, Ge Z-D, Auchampach JA. Adenosineinhibits tumor necrosis factor-a release from mouse peritonealmacrophages via A2A and A2B but not the A3 adenosine receptor.J Pharmacol Exp Therapeut. 2006;317(1):172–180.

17. Liu J, Jha P, Lyzogubov VV, Tytarenko RG, Bora NS, Bora PS.Relationship between complement membrane attack complex,chemokine (CC motif) ligand 2 (CCL2) and vascular endothelialgrowth factor in mouse model of laser-induced choroidalneovascularization. J Biol Chem. 2011;286(23):20991–21001.

18. Cardenas A, Toledo C, Oyarzun C, et al. Adenosine A2B receptor-mediated VEGF induction promotes diabetic glomerulopathy.Laboratory Invest. 2013;93:135–144.

19. Valladares D, Quezada C, Montecinos P, et al. Adenosine A2B

receptor mediates an increase on VEGF-A production in rat kidneyglomeruli. Biochem Biophys Res Commun. 2008;366(1):180–185.

20. Pawelczyk T, Grden M, Rzepko R, Sakowicz M, Szutowicz A.Region-specific alterations of adenosine receptors expression levelin kidney of diabetic rat. Am J Pathol. 2005;167(2):315–325.

21. Roa H, Gajardo C, Troncoso E, et al. Adenosine mediatestransforming growth factor-beta 1 release in kidney glomeruli ofdiabetic rats. FEBS Lett. 2009;583(19):3192–3198.

22. Hoshi S, Nomoto K-I, Kuromitsu J, Tomari S, Nagata M.High glucose induced VEGF expression via PKC and ERK inglomerular podocytes. Biochem Biophys Res Commun. 2002;290(1):177–184.

23. Karczewska J, Piwkowska A, Rogacka D, Stepinski J, Angielski S,Jankowski M. Purinergic modulation of glucose uptake intocultured rat podocytes: Effect of diabetic milieu. BiochemBiophys Res Commun. 2011;404(2):723–727.

24. Kang D-H, Kim Y-G, Andoh TF, et al. Post-cyclosporine-mediatedhypertension and nephropathy: amelioration by vascular endothe-lial growth factor. Am J Physiol-Renal Physiol. 2001;280(4):F727–F736.

25. Nakagawa T, Sato W, Sautin YY, et al. Uncoupling ofvascular endothelial growth factor with nitric oxide as a

mechanism for diabetic vasculopathy. J Am Soc Nephrol. 2006;17(3):736–745.

26. Baynes JW, Thorpe SR. Role of oxidative stress in diabeticcomplications: a new perspective on an old paradigm. Diabetes.1999;48(1):1–9.

27. Xia Z, Nagareddy PR, Guo Z, Zhang W, McNeill JH. AntioxidantN-acetylcysteine restores systemic nitric oxide availability andcorrects depressions in arterial blood pressure and heart rate indiabetic rats. Free Radical Res. 2006;40(2):175–184.

28. Singh R, Singh AK, Alavi N, Leehey DJ. Mechanism of increasedangiotensin II levels in glomerular mesangial cells cultured in highglucose. J Am Soc Nephrol. 2003;14(4):873–880.

29. Vidotti D, Casarini D, Cristovam P, Leite C, Schor N, Boim M.High glucose concentration stimulates intracellular renin activityand angiotensin II generation in rat mesangial cells. Am J Physiol-Renal Physiol. 2004;286(6):F1039–F1045.

30. Dai Y, Zhang W, Wen J, Zhang Y, Kellems RE, Xia Y. A2Badenosine receptor-mediated induction of IL-6 promotes CKD.J Am Soc Nephrol. 2011;22(5):890–901.

31. Lin C-L, Wang F-S, Hsu Y-C, et al. Modulation of notch-1signaling alleviates vascular endothelial growth factor-mediateddiabetic nephropathy. Diabetes. 2010;59(8):1915–1925.

32. Schraermeyer U, Julien S. Formation of immune complexes andthrombotic microangiopathy after intravitreal injection of bevaci-zumab in the primate eye. Graefes Arch Clin Exp Ophthalmol.2012;250(9):1303–1313.

33. Xia J-F, Liang Q-L, Hu P, Wang Y-M, Li P, Luo G-A. Correlationsof six related purine metabolites and diabetic nephropathyin Chinese type 2 diabetic patients. Clin Biochem. 2009;42(3):215–220.

34. Figler RA, Wang G, Srinivasan S, et al. Links between insulinresistance, adenosine A2B receptors, and inflammatory markers inmice and humans. Diabetes. 2011;60(2):669–679.

35. Kalla RV, Zablocki J. Progress in the discovery of selective, highaffinity A2B adenosine receptor antagonists as clinical candidates.Purinergic Signal. 2009;5(1):21–29.

Supplementary material available online

Supplementary Figures I–IV

DOI: 10.3109/0886022X.2014.900404 Role of A2B receptor inhibition in diabetic nephropathy 9

Ren

Fai

l Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Ond

okuz

May

is U

niv.

on

05/0

6/14

For

pers

onal

use

onl

y.