Proc. Natl. Acad. Sci. USAVol. 77, No. 6, pp. 3346-3350, June 1980Biochemistry

The Escherichia coli L-arabinose operon: Binding sites of theregulatory proteins and a mechanism of positive andnegative regulation

(DNase protection/cooperativity/araC protein/cyclic AMP receptor protein/RNA polymerase)

SHARON OGDEN, DENNIS HAGGERTY*, CAROL M. STONER, DAVID KOLODRUBETZ, AND ROBERT SCHLEIFDepartment of Biochemistry, Brandeis University, Waltham, Massachusetts 02254

Communicated by Charles Yanofsky, March 28, 1980

ABSTRACT The locations of DNA binding by the proteinsinvolved with positive and negative regulation of transcriptioninitiation of the L-arabinose operon in Escherichia coli havebeen determined by the DNase I protection method. Two cyclicAMP receptor protein sites were found, at positions -78 to -107and -121 to -146, an araCprotein-arabinose binding site wasfound at position -40 to -78, and an araC protein-fucosebinding site was found at position -106 to -144. These loca-tions, combined with in vivo data on induction of the two div-ergently oriented arabinose promoters, suggest the followingregulatory mechanism: induction of the araBAD operon occurswhen cyclic AMP receptor protein, araC protein, and RNApolymerase are all present and able to bind to DNA. Negativeregulation is accomplished by the repressing form of araCprotein binding to a site in the regulatory region such that itsimultaneously blocks access of cyclic AMP receptor proteinto two sites on the DNA, one site of which serves each of the twopromoters. Thus, from a single operator site, the negative reg-ulator represses the two outwardly oriented ara promoters. Thisregulatory mechanism explains the known positive and negativeregulatory properties of the ara promoters.

Studies on the L-arabinose operon of Escherichia coli have es-tablished the following important facts on regulation of thedivergently oriented ara promoters PC and PBAD (see Fig. 1).The activity of both promoters is stimulated by the cyclic AMP(cAMP) receptor protein (CRP) in the presence of cyclic AMP(1-4). The promoter PBAD is positively regulated by araCprotein in the presence of arabinose-i.e., the protein is re-quired for activity of the promoter (1, 2, 5). Under noninducingconditions, the araC protein instead acts negatively to repressboth the PC and PBAD promoters (1-3, 6). At least part of theDNA site necessary for repression of PBAD lies upstream fromall of the sites necessary for induction of PBAD, as shown by theexistence of deletions entering the ara regulatory region fromthe Pc side that abolish repression of PBAD without affectinginduction of PBAD (6, 7).The requisite components are now available for in vitro

studies of the mechanism of regulation of the ara operon. Theregulatory region DNA has been isolated, and its nucleotidesequence has been determined (8, 9) and found to contain el-ements similar to the RNA polymerase-binding sites seen inother E. coli promoters at about 10 and 35 bases before the startsites of transcription (8). The sequence also contains severalstretches that resemble the CRP-binding site in the gal operon(10). Also available are the proteins involved in the regulationof the ara operon: araC protein (11), CRP (12), and RNApolymerase (13).

In the work reported here, we have utilized the DNA se-

The publication costs of this article were defrayed in part by pagecharge payment. This article must therefore be hereby marked "ad-vertisement" in accordance with 18 U. S. C. §1734 solely to indicatethis fact.

3346

quence determination methodology of Maxam and Gilbert (14)with the DNase I protection method of Galas and Schmitz (15)to determine the DNA-binding sites of the araC protein andCRP. These studies, data from a physiological experiment, andconsideration of published data suggest the following mecha-nism for regulation of the operon: under induction conditions,CRP is able to bind to a DNA site to be called CRPBAD. Itspresence on the DNA stabilizes the binding of araC protein inits inducing conformation adjacent to CRP on a DNA sequence,araL. The presence of araC protein on the DNA then stimulatesthe binding of RNA polymerase to the DNA. This inductionscenario can be blocked by the presence of araC protein in arepressing conformation bound to a DNA site upstream from,but partly obscuring, the CRPBAD site. At the same time andfrom the same location, araC protein also partially repressesPc by blocking access of CRP to a second site, CRPC, locatedon the opposite side of araC from CRPBAD.

MATERIALS AND METHODSDNA fragments for sequence determination and protectionwere obtained from plasmid pMB9ara440 (8) by EcoRI en-donuclease digestion and polyethylene glycol precipitation (16).CRP was purified as described (12), and araC protein was pu-rified as described (11), with the substitution of a hydroxy-apatite column for the DEAE-Sephadex column. It was loadedin 0.014 M potassium phosphate buffer at pH 6.9, 10% (vol/vol)glycerol, 0.01 M L-arabinose, 1 mM EDTA, and 1 mM di-thiothreitol and eluted in the same buffer with the phosphateraised to 0.13 M.DNA fragments were 32P end-labeled by alkaline phospha-

tase treatment and T4 polynucleotide kinase as described byMaxam and Gilbert (14) and in protocols provided by theseauthors. Size standards for the DNAse-protected DNA frag-ments were G>A sequencing fragments in which the methyl-ation was performed either in the buffer described in the figurelegends or in the DNase I digestion buffer.DNase I protection was performed as described (15), with

the exceptions noted here and in the figure legends. DNase Idigestion buffer is 50 mM NaCI/20 mM Tris-HCI, pH 8.0/3mM MgCl2/0.1 mM dithioerythritol/0.2 mM cAMP. DNA wasincubated at 37°C for 10 min in DNase I digestion buffer, thenproteins were added and the incubation was continued 10 minto permit the proteins to bind. The temperature was shifted to20°C and DNase I was added to a final concentration of 0.13,ug/ml. After the addition of stop buffer, the DNA was preparedand separated by electrophoresis.The strain used in induction measurements of Pc was con-

Abbreviations: cAMP, cyclic AMP; CRP, cAMP receptor protein.* Present address: Industrial Products Group, Miles Laboratories, Inc.,P.O. Box 932, Elkhart, IN 40515

Dow

nloa

ded

by g

uest

on

Aug

ust 1

7, 2

021

Proc. Natl. Acad. Sci. USA 77 (1980) 3347

araCRegulatory region

PcaraB

PBADa~~~~

araA araD

i I I I I I-1~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

-140

I'

-120

-60

-100

-40 -20 1

-160

-80

TCACACTTTGCTATGCCATAGCATTTrATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTC7cTACTGTTTCTCCATACCCGTTTTTAGTGTGAAACGATACGGTATCGTAAAAATAGGTATTCTAATCGCCTAGGATGGACTGCGAAAAA TAGCGTTGAGAGATGACAAAGAGGTATrGGCAAAAA

FIG. 1. Structure of the L-arabinose operon, with origins and directions of transcription of the genes, nucleotide sequence, and positionnotation.

structed by mating the araB episome, F'74 (17), into a leu-cine-requiring derivative of the pc-f3-galactosidase fusion strainFC-17 (3). The resulting strain, F'C+B-A +D + /araC-lacZB +A +D -, grows on L-arabinose. In the measurements shown,cells were grown overnight in M1O medium (18) containingthiamine at 0.001%, glycerol at 0.2%, and Difco casamino acidsat 1%. The cells were diluted 1:1000 and grown to 1 X 108 cellsper ml, at which time the experiment began. At the indicatedtimes, 0.35-ml samples were taken into 0.5 ml of assay bufferat 00C containing 200 ,gg of chloramphenicol per ml, and the0-galactosidase was measured as described (18).

RESULTSLocation of the CRPC and CRPBAD Binding Sites. Binding

of a protein to a specific DNA sequence can block or enhancecleavage of the phosphate backbone by DNase I (15). The lo-cation of the sites with altered cleavage frequencies is thendetermined by electrophoresis of the DNase I digestion prod-ucts: cleavage positions are determined by parallel electro-phoresis of the same DNA that has been prepared in accordancewith the DNA sequence determination methods developed byMaxam and Gilbert. In such experiments with DNase I, we havelocated two CRP-binding regions: one between 20 and 50 basepairs from pc, position -121 to -146, and one from 78 to 107base pairs from PBAD, position -78 to -107 (Fig. 2 A and B).In one of the experiments shown (Fig. 2A), almost completeprotection of CRPBAD was achieved, and protection and en-hancement of cleavage sites in CRPC were only barely detect-able. In the other experiment shown (Fig. 2B), the original datashowed more complete protection of CRPBAD than CRPC, al-though the reproduced data show the differences less well.From these observations we conclude that the in vitro affinityof CRP protein is higher for CRPBAD than it is for CRPC.

Location of the araC Protein Induction and RepressionBinding Sites. By similar DNase I experiments, the araC pro-tein-binding sites have been located (Fig. 2 C and D). araC, inthe presence of arabinose, identifies a binding region frompositions -40 to -78, and a region less well protected from-106 to -144 (Fig. 2C). When the same DNase I experimentsare performed with araC protein in the presence of the anti-inducer D-fucose, the region -106 to -144 is protected, -andto a lesser extent the region -40 to -78 (Fig. 2D). Thus thesequence from -40 to -78 is identified as the araI site, and theregion from -106 to -144 is identified as the araO site in ac-cordance with the nomenclature of Englesberg (6).No evidence of other araC protein-binding sites, either

arabinose- or fucose-dependent, was seen in the region +45 to

-170. The presence of cAMP was irrelevant for C protein-binding in the absence of CRP, but necessary for CRP binding.At less than saturating concentrations of araC protein, thepresence of CRP-cAMP enhanced the apparent binding ofaraC protein in the presence of arabinose (data not shown).

Induction of the Pc Promoter. The binding sites determinedabove suggested the mechanism of positive and negative reg-ulation of PBAD to be discussed in the next section. Additionally,the partial overlapping of araO with both CRPBAD and CRPCsuggested that the repression complex of araC protein withDNA might repress both the PBAD and PC promoters; therefore,induction by arabinose might both induce PBAD and derepressPc. Several years ago Casadaban addressed this very questionafter noting that both ara promoters were in the same region(3). He constructed a pc-f3-galactosidase fusion strain to enableconvenient assay of Pc activity, but his measurements failedto reveal any arabinose-mediated activation of Pc. On the basisof the DNase I protection findings, we have reexamined thisquestion.Our initial experiments confirmed Casadaban's findings that

the steady-state expression of Pc in an araC +B +A +D + strainis nearly the same in the presence or absence of arabinose. Wetherefore explored the response of Pc immediately after theaddition of arabinose. Fig. 3 shows that Pc is indeed derepressedby the addition of arabinose. The initial activity of Pc, asdemonstrated by the slope of the curve for f3-galactosidase level,is about 5-fold higher than the activity just preceding the ad-dition of arabinose. At about 15 min after arabinose addition,by which time the ,B-galactosidase level has almost doubled, therate of Pc expression falls back to about its preinduction value.Subsequently (data not shown), Pc retains this preinductionvalue so that the level of f3-galactosidase per cell is diluted bycell growth back to its preinduction level.The expression of Pc appears to be strongly catabolite sen-

sitive. As shown in Fig. 3, adding glucose to the medium 30 minbefore adding arabinose drastically reduces the magnitude ofthe Pc derepression. Additionally, as shown, a high concen-tration of cAMP in the medium reverses the catabolite repres-sion caused by glucose.

DISCUSSIONIn Results we have presented data that locate the DNA-bindingsites of the proteins involved in the joint regulation of thearabinose operon promoters PC and PBAD. Determined werethe two binding sites of CRP protein, CRPC and CRPBAD, andthe binding sites araI and araO of araC protein in its inducingand repressing states. Additionally, DNase I protection exper-

a

Biochemistry: Ogden et al.

a

I I

1*GACCAAAGCCATGACAAAAACGCGTAACAAAAGTG7'CTATAA7'CACGGCAGAAAAG7'CCACATTGATTATT7'GCACGGCGC7GGTTTCGGTAC7'G'1717-1 TTGTTTTCACAGATATTAG7GCCG7CTTT7'CAGGTGTAACTAATAAACG7'GCCGC

Dow

nloa

ded

by g

uest

on

Aug

ust 1

7, 2

021

3348 Biochemistry: Ogden et al.

ca)

11o

C 000X >C

Xz~

-150-140

-130

-120

-100 ~~~~_CDf-%.... _6% f

-80 X

cU)0L-

00CL 0 CL <

0 0 0 Z 0

Q0 - -140

~~ .~~-j30

- -120

~~~~~~~~~-I~~~^

- zA* -lF

__Ol _ _- - 100_t- ,

46_okf JN-70

A B

U1)U)00

o OL. LOL Or0 +z

-80-

-70 -

ma

-60 _

-50_

-40 _

-30* ___

aw-

__od -.

"Nl -EA

-80-

__ _

DA

C

FIG. 2. Locations of CRPBAD, CRPc, araI, and araO by DNase I. Indicated are the regions containing bases with protected or enhancedcleavages. Arrows indicate the bases with cleavage enhanced by the presence of the protein. (A) Protection ofCRPBAD from DNase I digestion.Buffer was 10 mM Tris-HCl, pH 7.9/50 mM KCl/lO mM MgCl2/2.5 mM CaCl2/0.1 mM dithiothreitol/30% (vol/vol) glycerol/0.2 mM cAMP.DNA was labeled at the BamHI site at position -43. Lane 1 is G>A sequencing size control. For lanes 2-5 DNA was digested with DNase I at0.13 jg/ml. Lane 2 is DNase I digestion with no other protein added. Lanes 3-5 are DNase I digestion with CRP present at concentrations of6.5,32.5, and 65 gg/ml. (B) Protection ofCRPC from DNase I digestion. DNA was labeled at the BamHI site at position -43. Lanes 1-3 containedCRP, a different preparation than that used in part A, at 12 Ag/ml; DNA was digested with DNase I at 0.10, 0.12, and 0.2 ag/ml. Lane 4 containedno other added protein and its DNA was digested with DNase I at 0.13 ,g/ml. (C) Protection of araI from DNase I digestion. DNA was labeledat the EcoRI end at position +48. The G>A sizing lane is not shown because it was substantially fainter and required longer exposure. DNAwas digested with DNase I at 0.2 ,g/ml. Lane 1 is DNase I with no other added protein and lane 2 contained 2.5 ,l ofaraC protein and 100mML-arabinose. (D) Protection ofaraO from DNase I digestion. DNA was labeled at theBamHI site at position -43. Lane 1 is the G>A sizing standard.DNA was digested with DNase I at 0.1 jug/ml. Lane 2 contained no other added protein and lane 3 contained 2.5 jAl of araC protein and 100mMD-fucose.

iments performed with araC protein plus CRP indicate thatthe presence of the CRP-cAMP complex enhances the bindingof araC protein. Similarly, electron microscopy previously in-dicated that RNA polymerase detectably binds to PBAD onlywhen CRP and araC proteins are present (4). The microscopyalso showed that CRP-cAMP stimulated the binding of RNApolymerase to the Pc promoter about 3fold. This information,plus the observation contained in this paper that addition ofarabinose induces both PC and PBAD, suggests the mechanismsketched in Fig. 4: araC protein in the repressing state bindsto the araO sequence. In this poition araC blocks access of CRPto the CRPc and CRPBAD sites located on either side. Thus PBADremains fully off, but because RNA polymerase retains signif-icant "unaided" activity on the Pc promoter (3), a residual levelof araC protein synthesis remains. Upon the addition of arab-inose, araC protein leaves the araO site and permits the entryof CRP molecules to both CRP-binding sites. Such binding of

CRP to the CRPC sequence stimulates the activity of RNApolymerase on Pc. Similarly, the binding of CRP to the CRPBADDNA sequence leads to greater occupancy by araC protein inits inducing state to a site adjacent to the CRP on the araI se-

quence. In turn, the presence of araC protein increases occu-

pancy by RNA polymerase of the promoter DNA and hencestimulates transcription from PBAD-

This mechanism directly explains the facts enumerated inthe Introduction on regulation of PBAD and Pc: (i) positive andnegative control by araC of PBAD; (ii) the CRP requirement forinduction of PBAD; (iii) negative control on PBAD is exertedupstream from positive control; (iv) araC protein represses Pc;and (v) the synthesis of araC protein can be stimulated by CRP(3,4).The mechanism leads to the prediction that under certain

conditions the addition of arabinose to cells should derepressthe synthesis of araC protein. Furthermore, this derepression

c (a)Z u)4- 0

O UL.

-1 0> +oD Z 0

-150'

-140-

-130

-120 -

-110

-100

-90s

0

Proc. Nati. Acad. Sci. USA 77 (1980)

Iam =ft

Dow

nloa

ded

by g

uest

on

Aug

ust 1

7, 2

021

Proc. Natl. Acad. Sci. USA 77 (1980) 3349

0

.00

0 0

o

£prt 0 00

c 2 *<AA°'°00 ~ ~

0~~~~~~~~

. ,..

-10 0 10 20Time after arabinose addition, min

FIG. 3. Activity of the Pc promoter as assayed by fl-galactosidasein the pc-lacZ fusion strain F'C+B-A+D+pCp-1acZ A+B+D-. Timeis after the addition of arabinose to 0.2% to all cultures. Plotted are

cell density (-), fl-galactosidase level in the culture with onlyarabinose added (0-0), fl-galactosidase level in the culture withglucose added to 0.2% at -30 min (0-0), and f3-galactosidase levelin the culture with glucose added to 0.2% and cAMP added to 5mMat -30 min (^^).

should be cAMP dependent. Indeed, such derepression is ob-served, as shown in Fig. 3. Unexpectedly, the arabinose-inducedderepression of Pc ceases after about 15 min. A likely cause forthe shutoff appears to be catabolite repression generated by thecatabolism of arabinose. The experiment reported in Resultsshowed that CRP-cAMP possesses a substantially lower ap-parent affinity for CRPC than for CRPBAD. If this differenceis also expressed in vvo, then the metabolism of arabinose,which is known to impose partial catabolite repression (19, 20),could effectively catabolite repress Pc back to its araC-re-pressed activity while having little effect on PBAD. The exper-iments reported in Fig. 3 also showed that derepression of Pcis indeed highly responsive to catabolite repression and cAMP.Similar differential effects of cAMP on different operons in viwhave been observed previously (20, 21).The mechanism proposed explains a substantial body of

additional information that has accumulated on regulation ofthe arabinose operon. For example, it has been possible to isolateCRP-independent Ara+ mutants (22, 23). These mutants can

grow on arabinose in the absence of CRP, and it has been foundthat the mutations conferring this property lie in araC proteinitself. These can be most easily understood as alterations in thearaC protein such that it may bind to the araI site in the absenceof CRP-i.e., tighter-binding mutants.

Mutants have been isolated that express the arabinose operonin the absence of araC protein (24, 25). Amongst other possi-bilities, such mutations could create a new RNA polymerase

binding site adjacent to CRPBAD or convert the araC-bindingsite, I, to another CRP-binding site. From the relevant se-quences (8, 10) such results appear possible with one or two basechanges. Mutations affecting araC protein have also been ob-served that permit expression of the arabinose operon in theabsence of the normal inducer, arabinose (26, 27). Paradoxi-cally, these mutations, Cc, are not dominant to the wild-typearaC protein. That is, uninduced cells containing both proteinspossess basal levels of arabinose enzymes, whereas uninducedcc mutants possess levels characteristic of wild-type fully in-duced cells. The dominance of the repressing form of araCprotein has long been hard to rationalize; however, it can nowbe seen to be a natural consequence of the mechanism: occu-pancy of the repression site blocks induction.A number of questions relevant to the proposed mechanism

remain to be answered. Delineation of the RNA polymerase-binding sites on PC and PBAD by DNase protection has not yetbeen completed. We have not physically demonstrated thataraC protein bound to the araO site directly blocks the entryof CRP to its binding sites, although this seems probable in lightof the apparent overlapping binding regions. Also to be deter-mined in the future are the actual association and dissociationrates for all of the protein-DNA complexes. The relative valuesof these rates are necessary for determination of the mostprobable order of protein binding. No evidence has yet beenpresented that determines whether the cooperativity betweenthe proteins in DNA binding is a result of protein-protein in-teractions or whether it is mediated via the DNA. It is yet to beexplained how CRP can stimulate the activity of RNA poly-merase on the lac and gal promoters from different positionswith respect to the start of transcription (10, 28), and addi-tionally, on the ara operon, stimulate the binding of araCprotein. This apparent plasticity raises the question of whetherany protein bound to DNA in the correct position can stimulatethe DNA binding of another protein. It has not yet been shownthat the sole cause for the shutoff of Pc induction about 15 minafter arabinose addition is catabolite repression generated bymetabolism of arabinose.The protection experiments with araC protein showed in-

complete selectivity in binding to araI and araO. It is possible,then, that arabinose or fucose bound to the protein only slightlyalters its affinity for either of the sites. Alternatively, becausearaC protein is highly labile, it is possible that the purifiedprotein used in these experiments was damaged or sluggish inshifting between inducing and repressing states. The findingspresented here raise the possibility that if a cell possessed a greatexcess of araC protein, a substantial quantity of the proteinmight always remain in the repressing state. This could preventinduction of the operon. An excess of araC protein could alsohave a different effect. Experiments presented earlier showedthat araC protein is able to bind to the I site in the absence ofCRP. Thus an excess of araC protein might instead alleviatethe requirement for CRP in induction of PBAD-

Finally, we note that the failure of high-resolution electronmicroscopy to reveal the CRP-DNA complexes (29) may beattributed to their occurring at low frequency, staining inad-equately for definitive identification, or both. Also, the pro-tein-DNA complex observed in the earlier electron microscopework, which was thought to be a repression complex (29), ap-pears more likely to be RNA polymerase bound at Pc, as Waslater suggested (4). Still unavailable is an explanation for therole of araC protein in the formation of protein-DNA com-plexes.We have described a mechanism of gene regulation in which

induction occurs only when all of a set of proteins are presentand able to bind to a string of sites on DNA. That there exists

Biochemistry: Ogden et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

7, 2

021

Proc. Natl. Acad. Sci. USA 77 (1980)

RNAP

c IF- wRNAP

C

RNAP

.1-~~~~~~~~~~~~~

-200 -160

CindCRP CRP I

I I

RNAP

IqI IYII F

CindCRP

-1 20 -80

RNAP

-40

Repression

Just afterinduction

l BAD

Steady-stateinduction

E BAD

1

Base pairs

FIG. 4. Proposed mechanism of ara operon regulation. Represented is the binding status of the regulatory proteins before, immediatelyafter, and several minutes after induction by the addition of arabinose. The positions of the binding regions are to scale, but not the sizes of theproteins. Also depicted are the activities of the leftward pC and rightward PBAD promoters in the three conditions. RNAP, RNA polymerase;Crep and Cind, araC protein in repressing and inducing conformations.

a requirement for the complete set of proteins necessitates thatthe binding of the proteins to DNA be cooperative. Such aregulatory mechanism is versatile and easily accommodatessituations in which large numbers of inducers must all bepresent in order for a gene to be induced.

We gratefully acknowledge Allen Maxam for his advice on the se-quence determination procedures and Ann Favreau for technical as-sistance. This work was supported by U.S. Public Health Service Re-search Grant GM-18277 and Training Grant GM-212 from the Na-tional Institutes of Health.

1. Greenblatt, J. & Schleif, R. (1971) Nature (London) New Biol.233, 166-170.

2. Wilcox, G., Neuris, P., Bass, R. & Englesberg, E. (1974) J. Biol.Chem. 249,2946-2952.

3. Casadaban, M. (1976) J. Mol. Biol. 104,557-566.4. Hirsh, J. & Schleif, R. (1977) Cell 11, 545-550.5. Sheppard, D. & Englesberg, E. (1967) J. Mol. Biol. 25, 443-

454.6. Englesberg, E., Squires, C. & Meronk, F. (1969) Proc. Nati. Acad.

Sci. USA 62, 1100-1107.7. Schleif, R. & Lis, J. (1975) J. Mol. Blol. 95, 417-431.8. Smith, B. & Schleif, R. (1978) J. Blol. Chem. a53, 6931-6933.9. Greenfield, L., Boone, T. & Wilcox, G. (1978) Proc. Nati. Acad.

Sci. USA 75,4724-4728.10. Taniguchi, T., O'Neill, M. & de Crombrugghe, B. (1979) Proc.

Nati. Acad. Sci. USA 76,5090-5094.11. Steffen, D. & Schleif, R. (1977) Mol. Gen. Genet. 157, 333-

339.

12. Eilen, E., Pampeno, C. & Krakow, J. (1978) Biochemistry 17,2469-2473.

13. Burgess, R. & Jendrisak, J. (1975) Biochemistry 14, 4634-4638.

14. Maxam, A. & Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA 74,560-564.

15. Galas, D. & Schmitz, A. (1978) Nucleic Acids Res. 5, 3157-3170.

16. Lis, J. & Schleif, R. (1975) Nucleic Acids Res. 2, 383-389.17. Schleif, R. (1972) Proc. Natl. Acad. Sci. USA 69,3479-3484.18. Haggerty, D., Oeschger, M. & Schleif, R. (1978) J. Bacteriol. 135,

775-781.19. Katz, L. & Englesberg, E. (1971) J. Bacteriol. 107,34-52.20. Lis, J. & Schleif, R. (1973) J. Mol. Biol. 79, 149-162.21. Prisvant, M. & Lazdunski, C. (1975) Biochemistry 14, 1821-

1825.22. Heffernan, L., Bass, R. & Englesberg, E. (1976) J. Bacteriol. 126,

1119-1131.23. Heffernan, L. & Wilcox, G. (1976) J. Bacterlol. 126, 1132-

1135.24. Englesberg, E., Sheppard, D., Squires, C. & Meronk, F. (1969)

J. Mol. Biol. 43, 281-298.25. Gielow, L., Largen, M. & Englesberg, E. (1971) Genetics 69,

289-302.26. Englesberg, E., Irr, J. & Lee, N. (1965) J. Bacteriol. 90, 946-

956.27. Nathanson, N. & Schleif, R. (1975) J. Mol. Biol. 96, 185-199.28. Majors, J. (1977) Dissertation (Harvard Univ., Cambridge,

MA).29. Hirsh, J. & Schleif, R. (1976) Proc. Natl. Acad. Sci. USA 73,

1518-1522.

IA

3350 Biochemistry: Ogden et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

7, 2

021