the glycerol-3-phosphate acyltransferase gpat6 from tomato plays

1

Running title: Tomato fruit GPAT6 cuticle mutant 1

2

3

Corresponding author 4

Christophe ROTHAN 5

INRA, UMR 1332 Biologie du Fruit et Pathologie 6

71 Av Edouard Bourlaux 7

F-33140 Villenave d’Ornon 8

Tel: +33 5 57122532; Fax: +33 5 57122541 9

Email: [email protected] 10

11

Plant Physiology Preview. Published on April 19, 2016, as DOI:10.1104/pp.16.00409

Copyright 2016 by the American Society of Plant Biologists

www.plantphysiol.orgon February 1, 2018 - Published by Downloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

The glycerol-3-phosphate acyltransferase GPAT6 from tomato plays a central role in 12 fruit cutin biosynthesis 13

Johann Petit1*, Cécile Bres1*, Jean-Philippe Mauxion1, Fabienne Wong Jun Tai1, Laetitia B. B. 14

Martin2, Eric A. Fich2, Jérôme Joubès3,4, Jocelyn K. C. Rose2, Frédéric Domergue3,4, 15

Christophe Rothan1 § 16

17

1 UMR 1332 BFP, INRA, Université de Bordeaux, F-33140 Villenave d’Ornon, France 18

2 Plant Biology Section, School of Integrative Plant Science, Cornell University, Ithaca, NY 19

14853, USA 20

3 Laboratoire de Biogénèse Membranaire, Université de Bordeaux, UMR5200, F-33000 21

Bordeaux, France 22

4 Laboratoire de Biogénèse Membranaire, CNRS, UMR5200, F-33000 Bordeaux, France 23

24

25

* Both authors contributed equally to this work 26

§ To whom correspondence should be addressed. E-mail: 27

[email protected], Tel.: +33557122532; Fax: +33557122541 28

29

30



3

31

Abstract 32

The thick cuticle covering and embedding the epidermal cells of tomato (Solanum 33

lycopersicum) fruit acts not only as a protective barrier against pathogens and water loss but 34

also influences quality traits such as brightness and postharvest shelf-life. In a recent study, 35

we screened a mutant collection of the miniature tomato cultivar Micro-Tom and isolated 36

several glossy fruit mutants in which the abundance of cutin, the polyester component of the 37

cuticle, was strongly reduced. We employed a newly developed mapping-by-sequencing 38

strategy to identify the causal mutation underlying the cutin deficiency in a mutant thereafter 39

named gpat6-a. To this end, a backcross population (BC1F2) segregating for the glossy trait 40

was phenotyped. Individuals displaying either a wild-type or a glossy fruit trait were then 41

pooled into bulked populations and submitted to whole-genome sequencing prior to mutation 42

frequency analysis. This revealed that the causal point mutation in gpat6-a mutant introduces 43

a charged amino acid adjacent to the active site of a glycerol-3-phosphate acyltransferase 44

(GPAT6) enzyme. We further showed that this mutation completely abolished the glycerol-3-45

phosphate acyltransferase activity of the recombinant protein. The gpat6-a mutant showed 46

perturbed pollen formation but, unlike a gpat6 mutant of Arabidopsis thaliana, was not male 47

sterile. The most striking phenotype was observed in the mutant fruit, where cuticle 48

thickness, composition and properties were altered. RNA seq analysis highlighted the main 49

processes and pathways that were affected by the mutation at transcriptional level, which 50

included those associated with lipid, secondary metabolite and cell wall biosynthesis. 51

52

53

Key words: tomato, mapping-by-sequencing, fruit, cuticle, mutant, EMS, brightness, cutin, 54

cell-wall, GPAT6 55

56



4

INTRODUCTION 57

The cuticle, which serves as a barrier protecting aerial plant organs, is localized on the outer 58

face of primary cell walls of epidermal cells, although in some cases it can extend through 59

the apoplast of additional underlying cell layers. It is composed of cutin, a polyester of 60

glycerol, hydroxy and epoxy fatty acids, in addition to a range of waxes. In tomato (Solanum 61

lycopersicum), as in many species, the main cutin monomers are C16-based fatty acids (C16 62

dihydroxy fatty acids, C16 ωhydroxy fatty acids and C16 dicarboxylic acids) (Mintz-Oron et 63

al., 2008; Isaacson et al., 2009; Girard et al., 2012; Petit et al., 2014). Following their 64

synthesis in the plastids, long chain fatty acids are transported to the endoplasmic reticulum, 65

where they undergo a series of modifications, including activation to coenzyme A thioesters 66

by long-chain acyl-CoA synthetases (LACS), oxidation by cytochrome P450-dependent fatty 67

acid oxidases (CYP) and esterification to glycerol-based acceptor by glycerol-3-phosphate 68

acyltransferase (GPAT) enzymes to produce acyl-glycerols (Li-Beisson et al., 2013). In 69

Arabidopsis thaliana, the bifunctional acyltransferase and phosphatase activities of GPAT4 70

and GPAT6 mainly lead to the production of sn-2 monoacylglycerols (MAGs) (Yang et al., 71

2010). In addition, a recent study from Yang et al. (2012) provided evidence that acyl transfer 72

to glycerol, catalyzed by GPAT, takes place after oxidation of acyl chains. Following their 73

synthesis in the endoplasmic reticulum, cutin monomers are transported across the 74

plasmalemma and polysaccharide cell wall to the hydrophobic cuticle layer. The monomers 75

are then assembled into a network of linear and branched cutin polymers (Chatterjee et al., 76

2015; Philippe et al., 2016) by cutin synthases (Girard et al., 2012; Yeats et al., 2012b; Fich 77

et al., 2016). 78

The cutin matrix is a polyester of polyhydroxy fatty acids and fatty alcohols, with varying 79

amounts of phenolic compounds (ferulic, p-coumaric acid and cinnamic acid) depending on 80

the species. Cutin may be bound to cell wall polysaccharides; however, the nature of this 81

hypothetical linkage(s) and the coordination of the synthesis of both types of polymers during 82

organ growth are poorly understood (Heredia et al., 2015). The cutin matrix is filled with 83

intracuticular waxes and also covered with a thin layer of epicuticular waxes (Nawrath, 2006; 84

Buschhaus and Jetter, 2011). Collectively, the wax fraction is typically a complex mixture 85

composed of derivatives of very-long-chain fatty acids, mainly alkanes and alcohols, but it 86

may also include various secondary metabolites, such as the triterpenol compounds amyrins, 87

flavonoids and sterols (Bernard and Joubès, 2013). The synthesis of cuticle is tightly 88

coordinated with developmental processes, such as the formation of epidermal cells during 89

plant and fruit growth (Javelle et al., 2011; Lashbrooke et al., 2015). Environmental cues may 90

also affect cuticle formation, as is the case with drought stress triggering changes in the 91

cuticle via abscisic acid signaling (Kosma et al., 2009). The coordination of the various 92



5

biosynthetic pathways required to build the cuticle and to impart its specific properties occurs 93

at various levels (Hen-Avivi et al., 2014). For example, several transcription factors that 94

regulate cuticle formation have been identified. The first characterized example from A. 95

thaliana was WIN1/SHN1, a member of the AP2/ERF domain family (Broun et al., 2004; 96

Aharoni et al., 2004). Since then, many transcription factors, belonging to several families 97

(AP2/ERF, DREB/CBF, MYB, HD-Zip IV and WW domain proteins), have been identified in 98

various plant species, including those that regulate cuticle formation in fleshy fruits (Borisjuk 99

et al., 2014; Hen-Avivi et al., 2014). Further studies have revealed the identity of target genes 100

of these transcription factors, most of which are genes involved in fatty acid, phenylpropanoid 101

and flavonoid metabolism (Adato et al., 2009; Lashbrooke et al., 2015). 102

Like many fleshy fruits, tomato fruits are covered by a thick astomatous cuticle that fulfil 103

various functions, including preventing water loss and resisting pathogen infection. It also 104

influences commercially important characteristics of tomato fruit such as susceptibility to fruit 105

cracking, visual appearance and post-harvest shelf-life (Martin and Rose, 2014). Since the 106

tomato fruit cuticle is so thick and easy to isolate, it has emerged as a model for studying 107

cuticle formation and properties. In recent years, new insights into the regulation, synthesis, 108

assembly, structure and properties of the cuticle have been obtained using natural 109

(Nadakuduti et al., 2012) or artificially-induced genetic variability available in cultivated 110

tomato (Adato et al., 2009; Isaacson et al., 2009; Shi et al., 2013; Petit et al., 2014) and in 111

related wild species (Hovav et al., 2007; Yeats et al., 2012a). However, such studies have 112

also raised many new questions and many aspects of tomato fruit cuticle formation remain 113

poorly characterized. 114

To better understand fruit cuticle formation, we recently isolated several cuticle mutants 115

from an EMS-mutagenized mutant collection in the miniature cultivar Micro-Tom genetic 116

background, and further identified by map-based cloning a mutation in a cutin synthase gene 117

that is responsible for a glossy fruit phenotype (Petit et al., 2014). However, crossing the 118

mutant line with a genetically distant genotype, as required for map-based cloning, 119

introduces a large genetic diversity and consequently large phenotypic variability. Since 120

cuticle-related traits are under complex genetic control, the phenotypic analysis of 121

segregating populations used for mapping such traits can extremely challenging. However, 122

given the recent generation of a high quality reference tomato genome sequence (Tomato 123

Genome Consortium, 2012), the sequencing of Micro-Tom (Kobayashi et al., 2014), and 124

recent advances in deep sequencing technologies, other strategies based on whole genome 125

sequencing are now available. Such strategies, called here mapping-by-sequencing, as 126

described in a recent review (Schneeberger, 2014), have been successfully used in the 127

model species A. thaliana (Schneeberger et al., 2009) and rice (Abe et al., 2012), in which 128

they allowed the identification of the causal mutations underlying remarkable mutant traits. 129



6

The mapping-by-sequencing approach is based on the comparative analysis of the 130

distribution along the genome of single nucleotide polymorphism (SNP) frequencies in 131

segregating plant bulked populations displaying either the mutant trait or the wild-type (WT) 132

trait. The mutant and WT parental lines are first crossed in order to generate a segregating 133

population and since both parents share the same genetic background, with the exception of 134

the EMS-induced polymorphisms, this approach facilitates the study of complex mutant traits. 135

Here we demonstrate that the large genetic and phenotypic diversity generated by ethyl 136

methanesulfonate (EMS) mutagenesis of tomato can be assessed through the mapping-by-137

sequencing approach to rapidly identify the causal mutation underlying a specific phenotypic 138

trait. Using this strategy, we established that a point mutation in a glycerol-3-phosphate 139

acyltransferase gene (SlGPAT6) is responsible for a previously identified glossy mutation 140

that affects fruit brightness (Petit et al., 2014). Assays using WT and mutant recombinant 141

SlGPAT6 proteins produced in yeast, together with various chemically synthesized oxidized 142

C16 fatty acyl-CoAs demonstrated that GPAT activity is abolished in the ΔSlGPAT6 variant. 143

Functional characterization of the mutant further showed that the deficiency in SlGPAT6 144

activity affects pollen viability, as was reported to be the case in an analogous study of A. 145

thaliana (Li et al., 2012), but has no effect on fruit set. The most striking phenotype was 146

observed in the mutant fruit, where cuticle thickness, composition and properties were 147

altered. Remarkably, mutation of this single structural gene, upstream in the cutin 148

biosynthetic pathway, resulted in major changes in exocarp gene expression associated with 149

not only lipid biosynthesis, but also other cuticle-related pathways (phenolics and flavonoids) 150

and those related to cell wall synthesis and modelling. 151

152 153



7

RESULTS 154

Identification of the causal mutation underlying a fruit brightness mutant via mapping-155

by-sequencing 156

In a previous study, we isolated from an EMS-mutagenized tomato mutant population (Micro-157

Tom cultivar) a set of fruit brightness mutants (named glossy mutants) with abnormal fruit 158

cutin amounts/compositions (Petit et al., 2014). In the present study, we focused on one of 159

these glossy mutants (line P23F12), which exhibits enhanced fruit brightness and a reduced 160

cutin load. Genetic mapping of the mutant traits (cuticle permeability, fruit brightness) 161

highlighted a large genomic region (~ 60 cM) encompassing the centromeric region and 162

comprising 488 annotated genes (Petit et al., 2014). To facilitate identification of the mutated 163

gene we adopted a strategy involving whole genome sequencing of tomato bulked pools of 164

individuals from a segregating BC1F2 population; hereafter referred to as the mapping-by-165

sequencing approach (Schneeberger, 2014). A general overview of this approach is shown 166

in Supplemental Figure S1. Briefly, once a recessive mutation controlling a phenotypic trait 167

has been identified in a tomato mutant population (e.g. a glossy fruit trait), the mutant line is 168

crossed with the WT (non-mutagenized) parental line in order to produce a BC1F2 population, 169

which segregates for both the mutant trait (25% of the plants display the mutant phenotype 170

and 75% of the plants display the WT phenotype) and the mutant alleles. Plants from the 171

BC1F2 population showing either phenotype are then pooled to constitute bulks that are 172

submitted to whole genome sequencing. Sequencing reads are mapped onto the reference 173

tomato genome (Tomato Genome Consortium, 2012), allelic variants are detected and their 174

frequency in both bulks are analyzed in order to detect the causal mutation. In the mutant 175

bulk, because all BC1F2 individuals exhibiting the mutant phenotype are homozygous for the 176

mutation, the allelic frequency (AF) of the causal mutation should in principal be 1.0. 177

Frequencies of other allelic variants will be either 0.5<AF<1.0 for mutations in linkage 178

disequilibrium with the causal mutation, or AF<0.5 for unrelated mutations. Importantly, the 179

mutant line does not need to undergo successive backcrosses to eliminate SNPs or 180

Insertions/Deletions (INDELS) unrelated to the trait that is being targeted. Indeed, the 181

mutagenesis-induced SNPs are later used as polymorphic markers to map the causal 182

mutation. It has been reported that a typical Micro-Tom EMS mutant plant typically carries 183

2,000 to 4,000 SNPs (Shirasawa et al., 2015). 184

We applied this strategy to identify the causal mutation in the P23F12 glossy mutant 185

line (Petit et al., 2014). As shown in Figure 1A, the homozygous glossy mutant line was 186

back-crossed (BC1) with the WT parental line genotype used for generating the EMS mutant 187

collection. The BC1F1 hybrid plant, which displayed a WT-like phenotype (dull/normal fruit) 188

because the glossy mutation is recessive, was then selfed. The resulting BC1F2 segregating 189

population (343 plants) was analyzed for the glossy-fruit phenotype. Two bulked pools of 190



8

191 plants displaying either glossy-fruit or WT-like fruit phenotypes were then created, each of 192

which had 80 individuals. Pooled genomic DNA from each bulk was then sequenced to a 193

tomato genome coverage depth of 29-37X, the trimmed sequences were mapped onto the 194

tomato reference genome (Supplemental Table S1) and EMS mutation variants were filtered 195

to exclude natural polymorphisms found in Micro-Tom (Kobayashi et al., 2014) compared to 196

the Heinz 1706 reference genome (Supplemental Table S2). Analysis of the allelic variant 197

frequencies in the two bulks led to the identification of chromosome 9 as the genome region 198

carrying the causal mutation, since it displayed high mutant allelic frequencies (AF>0.95) in 199

the glossy bulk and much lower frequencies (AF<0.4) in the WT-like bulk (Figure 1B and 200

Supplemental Table S3). Analysis of the putative effects of the mutations on protein 201

functionality highlighted three genes carrying mutations in exons (Table 1). One was a 202

synonymous mutation and the two others were missense mutations. Among these, one 203

affected an annotated AMP deaminase, while the second affected a predicted glycerol-3-204

phosphate acyltransferase (SlGPAT; Solyc09g014350) that was located in the expected 205

chromosomal region according to AF analysis. Given the established function of GPAT 206

proteins in lipid polyester biosynthesis (Li et al., 2007), we considered the latter to be the 207

most likely candidate. To unequivocally associate the gpat mutation with the glossy mutant 208

trait, and to exclude any other mutation, such as the mutation in AMP deaminase, we further 209

analyzed 6 recombinant plants selected from the BC1F2 progeny. To this end, we used the 210

EMS-induced SNPs surrounding the GPAT gene (Figure 1C) as genetic markers. This 211

analysis clearly indicated that a single G613A nucleotide transition in the first exon leading to 212



9

a G163R non-synonymous mutation was responsible for the glossy fruit phenotype (Figure 213

1D). 214

215

The glossy mutation affects a functional homolog of GPAT6, whose activity is 216

abolished in the ΔSlGPAT6 mutated variant. 217

Phylogenetic analysis of tomato and A. thaliana GPAT protein sequences indicated that the 218

tomato GPAT protein encoded by the Solyc09g014350 gene is homologous to A. thaliana 219

AtGPAT4, AtGPAT6 and AtGPAT8 (Figure 2), with the closest homolog being AtGPAT6. 220

Accordingly, the SlGPAT6 glossy mutant (P23F12 line) is hereafter referred to as gpat6-a. 221

We further investigated the effect of mutation position and its possible consequences on 222

SlGPAT6 activity. As shown in Figure 3A, the G163R mutation is predicted to result in an 223

amino acid substitution at position 163 in motif III, one of the two motifs (with motif I) that is 224

known to be required for phosphatase activity. Specifically, the G163R mutation thus 225

introduces an additional charged amino acid with a long side chain (arginine R163) adjacent 226

to the lysine K176 required for phosphatase activity of A. thaliana AtGPAT4 and AtGPAT6 227

(Yang et al., 2010). A structural model of SlGPAT6, based on the Methanococcus jannaschii 228

phosphoserine phosphatase (MJ-PSP) template and restricted to the N-terminal 17- 207 229

amino acid region, was generated in silico (Figure 3B). Analysis of the predicted structure 230

revealed that the G to R amino acid substitution at position 163 is close to the cluster of 231

residues that are essential for the catalytic activity and Mg++ binding of GPAT6 (Yang et al., 232

2010). We inferred from this observation that the G163R mutation in gpat6-a might confer a 233

loss of SlGPAT6 mediated glycerol-3-phosphate acyltransferase activity. 234

To test this hypothesis, cDNAs encoding the SlGPAT6 WT protein and the mutated 235

variant ΔSlGPAT6 carrying the G163R mutation were expressed in a yeast (S. cerevisiae) 236

gat1Δ mutant strain in which expression of the major glycerol-3-phosphate acyltransferase, 237

GAT1 has been knocked out (Athenstaedt et al., 1999). Microsomes containing recombinant 238

SlGPAT6 and ΔSlGPAT6 proteins were then prepared from the transformed gat1Δ mutant 239

yeast lines, as well as from a line transformed with an empty vector as a control. The 240

principal putative substrate of SlGPAT6 is 9(10),16-dihydroxyhexadecanoic acid (C16:0 241

diOH), the major cutin monomer present in tomato fruit cuticles (Mintz-Oron et al., 2008; Petit 242

et al., 2014). Since this substrate is not commercially available, it was prepared from tomato 243

cuticle extracts using a method adapted from Kawaguchi et al. (1981). Fatty acid methyl 244

esters were first obtained by depolymerisation of cutin derived from fresh tomato fruit peel. 245

The C16:0 diOH methyl ester was then purified using thin-layer chromatography (TLC), 246

saponified and esterified to Coenzyme A (CoA). The same activation procedure was 247

conducted with commercially available hexadecanoic acid (C16:0), 16-hydroxyhexadecanoic 248



10

249



11

acid (C16:0 ωOH) and hexadecane-1,16-dioic acid (C16:0 DCA). These activated acyl-CoAs 250

were used as substrates in enzymatic assays of recombinant wild-type and variant SlGPAT 251

microsomes, measuring incorporation of 14C, derived from [14C]G3P, into the acyl-glycerol 252

groups. 253

Microsomes from the gat1Δgat2Δ double knockout yeast strain rescued by GAT1 over-254

expression and supplied with hexadecanoic acid-CoA produced lysophosphatidic acid (LPA), 255

phosphatidic acid (PA), monoacylglycerol (MAG), diacylglycerol (DAG) and lower amounts of 256

triacylglycerol (TAG) (Supplemental Figure S2A). The single knockout mutant gat1Δ 257

transformed with the empty vector control and supplied with C16:0-CoA synthesized PA but 258

also low amounts of LPA, MAG, DAG, and TAG (Supplemental Figure S2B). These results 259

indicate that the weak activity of the second yeast glycerol-3 acyltransferase, GAT2, present 260

in the gat1Δ yeast mutant, is sufficient for the production of low amounts of MAG. 261



12

Microsomes prepared from yeast gat1Δ mutant expressing tomato SlGPAT6 were also able 262

to synthesize LPA, PA, MAG, DAG and TAG (Supplemental Figure S2C). However, MAG 263

accumulation was much higher than that observed in microsomes from the empty vector 264

control line (Supplemental Figure S2B), demonstrating that the WT SlGPAT6 has the dual 265

acyltransferase and phosphatase activity expected from a GPAT enzyme involved in cutin 266

monomer biosynthesis (Yang et al., 2010; Yang et al., 2012). 267

We next assessed SlGPAT6 substrate specificity and the effect of the Gly(163)Arg 268

mutation on its activity. SlGPAT6 was observed to use not only C16:0-CoA as a substrate to 269

produce MAG, but also C16:0 ωOH-CoA, C16:0 DCA-CoA and C16:0 diOH-CoA (Figure 4A). 270

This is noteworthy because C16:0 diOH is the most abundant cutin monomer in tomato fruit 271

and yet GPAT activity has to date not been demonstrated with this natural substrate. This 272

activity was absent in the ΔSlGPAT6 variant, regardless of the substrate used (Figure 4A and 273

4B), indicating that the G163R mutation confers a loss of SlGPAT6 enzyme function. 274

275

The fruit cuticle of the gpat6-a mutant has reduced levels of C16 cutin monomers 276

In order to investigate how the loss of SlGPAT6 activity affects cuticle composition, we 277

analyzed the wax and cutin constituents of cuticles from red ripe (RR) stage fruits (~45 days 278

post-anthesis, or DPA). No differences were observed in total wax load between WT and 279

gpat6-a fruits, but differences in wax composition were apparent (Table II), such as 280

increased or decreased levels of several minor C25 to C30 alkanes in the gpat6-a mutant. 281

Since both even- and odd-numbered alkanes displayed similar trends, these variations were 282

likely independent of the alkane biosynthetic pathways. The most striking wax compositional 283

change in the gpat6-a mutant was a ~5-fold increase in δ− and α-amyrin levels, and to a 284

lesser extent in β-amyrin levels. In contrast to waxes, the total cutin load in gpat6-a was 285

reduced by almost 3-fold, from 315 to 111 µg/cm2 (Table III). This corresponded to a ~3-fold 286

drop in the amount of 9(10),16-dihydroxyhexadecanoic acid. In addition, differences in the 287

levels of several other major C16 cutin monomers were observed, including C16:0 DCA and 288

C16:0 DCA 9(10) OH (~3 to 4-fold reduction in gpat6-a), and the C16:0 ωOH and C16:0 ωOH 289

10 oxo (up to a 10-fold reduction in gpat6-a). 290

291

The gpat6-a mutant has abnormal fruit cuticle thickness and properties 292

According to digital expression data for SlGPAT6 (Solyc09g014350), available from the BAR 293

database (http://bar.utoronto.ca/efp_tomato/cgi-bin/efpWeb.cgi), the gene is preferentially 294

expressed in reproductive organs, and more specifically in the unopened flower and the 295

young developing tomato fruit (Supplemental Figure S3). The A. thaliana homolog AtGPAT6 296

is also preferentially expressed in the inflorescences and its loss of expression causes 297



13

reduced fertility (Li-Beisson et al., 2009; Li et al., 2012). Consistent with these findings, the 298

whole plant and leaf phenotype from the tomato gpat6-a mutant showed no differences 299

compared with WT (Figure 5A and Figure 5B). In contrast to A. thaliana AtGPAT6 knockout 300

(KO) plants (Li-Beisson et al., 2009), no abnormal flowers displaying organ fusion were 301



14

observed in gpat6-a; however, stamen elongation was also reduced in the tomato gpat6-a 302

mutant (Figure 5C). Examination of the anthers revealed that the pollen sacs of gpat6-a had 303

fewer pollen grains than those of the mutant (Figure 5E and Figure 5H). In addition, most 304

mutant pollen grains were small, shrunken and had an abnormal shape (Figure 5F and 305



15

Figure 5I) and pollen viability was reduced by ~4-fold in the mutant (Figure 5G and Figure 306

5J). However, the reduced fertility in the gpat6-a mutant had no consequences on fruit size 307

or number of seeds per fruit (Supplemental Figure S4). 308

SlGPAT6 expression is highest in young fruit (3-fold more than in flowers), and more 309

specifically in the outer fruit epidermis (Matas et al., 2011). Accordingly, the most striking 310

effect of the gpat6-a mutation was observed on fruit cuticle. Mutant fruits with enhanced 311

brightness displayed increased permeability to toluidine blue stain (Figure 6A and Figure 6B) 312

and altered epidermal cell shape (Figure 6C and Figure 6D). In addition, the thickness of the 313

cuticle covering the fruit epidermal cells was substantially reduced (Figure 6C and Figure 314

6D), as was the width of the anticlinal cutinized cell wall between adjacent epidermal cells 315

(Figure 6E and Figure 6F). Taken together, these results indicated profound alterations in 316

cuticle load and structure. 317

318

Genes that are expressed at lower or higher levels in gpat6-a fruit exocarp compared 319

with WT are associated with a wide range of regulatory and biosynthesis pathways 320

Since the gpat6-a mutation affects not only the levels of cutin monomers in the cuticle but 321

also the formation and accumulation of cuticle compounds synthesized through distantly 322

related (alkanes), or unrelated (amyrins, coumaric acid) pathways, as well as cell wall 323

morphology, we further investigated gene expression changes in the fruit exocarp from WT 324

and gpat6-a lines. Fruits at 20 DPA were selected because this stage of fruit development 325

corresponds to the maximum rate of cuticle formation in Micro-Tom (Petit et al., 2014) and to 326

the peak of SlGAPT6 expression in the fruit (Supplemental Figure S3). Transcripts 327

expressed in the fruit skin, which is comprised of epidermal cells and underlying cutinized 328

collenchyma cells (Figure 6C), were subjected to high-throughput RNA sequencing analysis 329

(RNAseq) using Illumina technology. Among the ~23 000 genes detected, 567 were found to 330

be differentially expressed between WT and gpat6-a fruit exocarp using a two-fold cut-off on 331

fold change in transcript abundance (ratio of 1 and -1 on a log2 scale) and a p-value <0.05 332

(Supplemental Table S4). Of these, 368 genes and 199 genes were expressed at higher or 333

lower levels, respectively, in gpat6-a than in WT. For the 376 genes belonging to MapMan 334

Gene Ontology classes (Urbanczyk-Wochniak et al., 2006), significant differences were 335

observed not only for genes involved in lipid metabolism, as would be expected, but also for 336

genes belonging to the ‘transport’, ‘hormone metabolism’, and ‘stress response’ categories 337

(Supplemental Figure S5). The largest category comprised ‘transcription factors’, which 338

contained almost 28% of the differentially-expressed genes. An analysis of the metabolism-339

related functional categories using MapMan revealed differential expression of genes in 340

categories related to cuticle formation, including lipid metabolism and specialized metabolism 341

(terpenes, flavonoids and phenylpropanoids), but also in categories related to cell wall 342



16

formation and modification. Relatively few differences in genes associated with central 343

metabolism were observed (Figure 7). 344

Notably, all the cuticle associated genes identified, which collectively are involved in 345

various steps in cutin biosynthesis and assembly and in wax biosynthesis, were expressed at 346



17

significantly lower levels (p-values ≤0.0003) in the gpat6-a mutant than in WT. Examples 347

included genes encoding enzymes known to be required for the production of the MAG cutin 348

precursors in A. thaliana or tomato (Li-Beisson et al., 2013; Shi et al., 2013): a long-chain 349

acyl CoA synthetase (LACS2, Solyc01g109180) putatively required for the activation to 350

coenzyme A thioesters (Schnurr et al., 2004); three cytochrome P450-dependent fatty acid 351

oxidases (CYP) belonging to protein families required for either in-chain hydroxylation of fatty 352

acids (CYP77A1 or CYP77A2, Solyc11g007540 and Solyc05g055400; Li-Beisson et al., 353

2009) or for terminal chain hydroxylation (CYP86A69, Solyc08g081220; Shi et al., 2013); and 354

two glycerol-3-phosphate acyltransferases (GPAT4 and GPAT6, Solyc01g094700 and 355

Solyc09g014350; Yang et al., 2010; Figure 2) (Table IV). One gene encoded a nonspecific 356

lipid transfer protein, examples of which have been suggested to be involved in the transport 357

of cuticle components across the apoplast to the cuticle, although this has yet to be 358



18

conclusively demonstrated (Yeats and Rose, 2008). An additional differentially expressed 359

cutin-related gene was predicted to encode an omega-hydroxypalmitate O-feruloyl 360

transferase (Solyc11g008630), which belongs to the BAHD family of acyl-CoA-dependent 361

acyl-transferases, some of which being implicated in cutin biosynthesis (Rautengarten et al., 362

2012). Finally, 11 GDSL-lipase genes expressed at various stages of fruit development 363

(Tomato Genome Consortium, 2012 and Tomato eFP browser, 364

http://bar.utoronto.ca/efp_tomato/cgi-bin/efpWeb.cgi), were expressed at lower levels in gpat6-365

a. These genes are homologous to the cutin synthase gene (CUS1, Solyc11g006250) 366

encoding the enzyme that catalyzes the extracellular polymerization of cutin (Girard et al., 367

2012; Yeats et al., 2012b). 368

We also observed that the expression of several wax-associated genes involved in 369

very-long-chain-fatty acid (VLCFA) synthesis and modification was reduced in the gpat6-a 370

mutant relative to WT (Table IV). These included three genes (KCS3, Solyc11g072990; 371

KCS10/FDH, Solyc08g067260; and KCS6/CER6, Solyc02g085870) encoding β-ketoacyl-372

CoA synthase enzymes that catalyze the first step in the multi-enzymatic fatty acid elongase 373

complex generating very long chains (VLCs) C20-C36 acyl-CoAs. Similarly, the expression 374

of CER26L (Solyc09g092270), which likely controls the chain-length specificities of wax 375

cuticle components (Bernard and Joubès, 2013), was also reduced in gpat6-a, as was the 376

expression of genes encoding enzymes catalyzing successive steps in the alkane 377

biosynthesis pathway (Table IV). CER3 likely catalyzes the conversion of VLC acyl-CoAs to 378

intermediate VLC aldehydes, CER1 (Solyc12g087980) and CER3 (Solyc07g006300) 379

catalyze their conversion to VLC alkanes, while MAH1 (CYP96A15, Solyc10g080840) is a 380

midchain alkane hydroxylase responsible for the generation of secondary alcohols and 381

ketones derivatives from alkanes (Bourdenx et al., 2011; Bernard et al., 2012; Bernard and 382

Joubès, 2013). 383

The RNA-seq data also suggested that the phenylpropanoid and flavonoid biosynthetic 384

pathways were altered in gpat6-a (Table IV). In the phenylpropanoid core pathway, two 385

phenylalanine ammonia-lyase (PAL, Solyc03g042560 and Solyc09g007910) genes were 386

expressed at higher levels in gpat6-a, while a 4-coumarate CoA ligase (4CL, 387

Solyc03g097030) catalyzing the formation of p-coumaroyl-CoA used as precursor for 388

flavonoids and phenolic compounds was expressed at lower levels. In the flavonoid 389

biosynthetic pathway, transcripts levels of a chalcone synthase (CHS, Solyc09g091510) 390

were higher in gpat6-a, whereas those of a flavonoid 3’-hydroxylase (F3’H, Solyc08g079280) 391

were lower. Two additional genes that were expressed at lower levels in gpat6-a encode an 392

enzyme involved in the formation of cinnamyl alcohols (CAD, Solyc01g107590) and a 393

CYP72A (Solyc07g062500) protein. A member of the CYP72A family was recently shown to 394

catalyze the C-30 oxidation of β-amyrin (Seki et al., 2011). 395



19

In addition to the cuticle-associated lipid pathways, the most striking gene expression 396

changes were related to cell wall pathways. For example, a gene encoding cellulose 397

synthase (CESA, Solyc07g043390), the catalytic moiety required for the synthesis of 398

cellulose microfibrils, was expressed at higher levels in the gpat6-a mutant. Conversely, the 399

expression of a COBRA-like gene (SlCOBL1, Solyc02g089120), which encodes a 400

glycosylphosphatidylinositol (GPI) anchored protein regulating epidermal cell wall thickness 401

and cellulose formation in tomato fruit (Cao et al., 2012; Niu et al., 2015), was lower in gpat6-402

a. We also detected the altered expression of genes related to pectins and hemicelluloses, 403

the matrix polysaccharides of the primary cell wall. A gene encoding a cellulose-synthase-404

like (CSL, Solyc04g077470) gene, a member of a glycosyltransferase family involved in the 405

synthesis of matrix polysaccharides such as xyloglucan (Cosgrove, 2005), was expressed at 406

higher level in gpat6-a. In contrast, the expression levels of four xyloglucan 407

endotransglucosylase/hydrolase (XTH) genes (Solyc02g091920, Solyc01g081060, 408

Solyc07g009380, Solyc09g092520) were substantially lower. XTH enzymes are involved in 409

cell wall assembly and restructuring, and are involved in cell expansion and the integration of 410

newly synthesized xyloglucans in the cell wall (Rose et al., 2002; Cosgrove, 2005; Park and 411

Cosgrove, 2015). Genes encoding a pectin methylesterase (PME, Solyc05g047590) and a 412

pectin methylesterase inhibitor (PMEI, Solyc03g083770) were expressed at lower or higher 413

levels, respectively, in gpat6-a. These proteins have opposite roles and their interplay likely 414

controls the esterification status of pectins, which in turn is thought to influence the 415

mechanical properties of cell wall (Reca et al., 2012; Müller et al., 2013). Two genes 416

encoding β-galactosidases (Solyc01g110000 and Solyc03g121540), were expressed at 417

lower levels in the mutant, and these too may play roles in the modification of cell wall 418

polysaccharides (Smith and Gross, 2000). Other differentially expressed genes included two 419

expansin genes (Solyc06g076220 and Solyc04g081870), important modulators of cell wall 420

extensibility (Park and Cosgrove, 2015), which were either expressed at higher or lower 421

levels in gpat6-a in the mutant, and two genes encoding fasciclin-like arabinogalactan 422

proteins (FLAs, Solyc07g053530 and Solyc07g053540), which also showed opposite 423

patterns of relative transcript abundance in the mutant and WT. The functions of FLAs are 424

not well understood, although many are GPI-anchored to the plasma membrane, and play 425

key roles in plant development, including cell-wall architecture and composition (MacMillan et 426

al., 2010; Johnson et al., 2011; Seifert et al., 2014). 427

Not surprisingly, given the large transcriptional changes induced by the GPAT6 428

mutation deficiency, 53 transcription factors (TFs), belonging to AP2/EREBP (8), bHLH (3), 429

C2/C2(Zn) (11), C2H2 zinc finger (4), MADS Box (4) , MYB (6) and other TF categories (17), 430

were expressed at higher (18) or lower (35) levels in gpat6-a (Supplemental Table S5). To 431

our knowledge most of these have not previously been associated with the fruit 432



20

epidermis/cuticle; however, several are known to regulate early fruit development, including 433

the MADS box gene TAGL11 (Mejia et al., 2011), or fruit ripening, such as the MADS box 434

gene RIPENING INHIBITOR (RIN, Solyc05g012020; Vrebalov et al., 2002; Kosma et al., 435

2010), as well as several of the ERF ethylene-responsive transcription factors (Liu et al., 436

2016). The differentially expressed TFs included those with a possible link to the circadian 437

clock, with two genes (Solyc01g095030 and Solyc10g084370) encoding MYB-related TFs of 438

the REVEILLE family (Farina and Mas, 2011), one of which was expressed at lower levels in 439

gpat6-a, and six genes encoding CONSTANS-like TFs (Valverde et al., 2011), one of which 440

(Solyc12g005660) was expressed at much lower levels. Despite the large number of 441

differentially-expressed TFs identified, the group did not include TFs that have been reported 442

to regulate cuticle formation in tomato or other species (Shi et al., 2013; Borisjuk et al., 2014; 443

Hen-Avivi et al., 2014), other than a MIXTA-like MYB transcription factor (Oshima et al., 444

2013), whose role in tomato has recently been described (Lashbrooke et al., 2015). We 445

observed that expression of SlMIXTA-like (Solyc02g088190) was lower in the gpat6-a mutant 446

than in WT (Supplemental Table S5). Moreover, ten cutin and wax related genes that were 447

differentially expressed between the WT and the gpat6-a mutant (Table IV) were previously 448

identified as SlMIXTA-like targets (Lashbrooke et al., 2015). 449

450

451



21

DISCUSSION 452

Tomato represents an excellent model for studying cuticle formation in fleshy fruits as well as 453

more broadly in plant taxa (Hen-Avivi et al., 2014; Martin and Rose, 2014; Fich et al., 2016). 454

Studies of tomato cuticles span many different fields, ranging from the analysis of cuticle 455

composition and architecture (Mintz-Oron et al., 2008; Buda et al., 2009; Yeats et al., 2012a; 456

Philippe et al., 2016; Segado et al., 2016), biosynthetic pathways, assembly and regulation 457

(Shi et al., 2013; Lashbrooke et al., 2015), interaction with other metabolic pathways and 458

developmental processes (Kosma et al., 2010; Gimenez et al., 2015), mechanical properties 459

(Schreiber, 2010; España et al., 2014), as well as the significance of the cuticle for 460

agronomically important traits such as fruit glossiness, postharvest shelf-life, fruit cracking 461

and resistance to pathogens (Isaacson et al., 2009; Shi et al., 2013; Buxdorf et al., 2014; 462

Petit et al., 2014). Considerable progresses have been made through reverse genetics 463

approaches, where the function of a candidate gene previously identified is studied in planta 464

in tomato (Girard et al., 2012). As a complement to reverse genetic approaches, forward 465

genetic strategies can be a highly effective means of gene discovery. In such cases, 466

phenotypic changes in the fruit cuticle can lead to identification of the underlying gene, as 467

was the case with several of the eceriferum A. thaliana mutants (Negruk et al., 1996). In 468

tomato, these strategies enabled the discovery of new cuticle-associated genes and 469

functions, including genes involved in cutin synthesis and polymerization (Yeats et al., 470

2012b; Shi et al., 2013; Petit et al., 2014), and in cuticle regulation (Adato et al., 2009; 471

Isaacson et al., 2009; Ballester et al., 2010; Nadakuduti et al., 2012). The diversity in cuticle 472

traits is high in cultivated tomato accessions and in wild related species (Hovav et al., 2007; 473

Yeats et al., 2012a) as well as in artificially-produced mutant collections (Isaacson et al., 474

2009; Kimbara et al., 2013; Shi et al., 2013; Petit et al., 2014; Philippe et al., 2016). 475

Harnessing such genetic and phenotypic diversity will doubtless lead to many new insights 476

into cuticle formation and regulation in tomato and other plant species. 477

478

Mapping-by-sequencing reveals a gpat6-a causal mutation underlying a glossy fruit 479

mutant 480

All the strategies used to identify natural polymorphism or causal mutations responsible for a 481

cuticle phenotypes in tomato to date have been based on genetic mapping of the 482

polymorphism and subsequent map-based cloning of the underlying gene (Isaacson et al., 483

2009; Yeats et al., 2012b; Kimbara et al., 2013; Shi et al., 2013; Petit et al., 2014). Despite a 484

high quality tomato reference genome sequence and the development of associated 485

genomic tools (Shirasawa et al., 2010; Sim et al., 2012; Tomato Genome Consortium, 2012; 486

Kobayashi et al., 2014), this remains a time consuming and laborious task. An attractive 487



22

alternative strategy is mapping-by-sequencing (Schneeberger, 2014), which is based on a 488

combination of Bulk Segregant Analysis (BSA) of a BC1F2 segregating population and of 489

whole genome sequencing followed by SNP frequency analysis to identify the causal 490

mutation. Mapping-by-sequencing has been applied successfully to the model species A. 491

thaliana (Schneeberger et al., 2009) and rice (Abe et al., 2012). Since the approach involves 492

a simple cross between the mutant and the parental (non-mutagenized) lines, it is well 493

adapted to the study of traits that are highly sensitive to genetic context and/or to 494

environmental conditions, such as the structure and composition of the tomato fruit cuticle. 495

The analysis of a cuticle mutant is therefore not restricted to the most severe cuticle 496

alterations, opening the way for the discovery of new cuticle-associated genes and functions. 497

The use of the miniature cultivar Micro-Tom has an obvious advantage since it requires far 498

less space for growing populations than for normal sized genotypes. As an example, the 499

culture of the 343 plant BC1F2 population used in this study required as few as 5 square 500

meters. Furthermore, the mapping-by-sequencing method described uses simple and widely 501

distributed bioinformatics tools and can be applied to any publicly available tomato mutant 502

collection (Menda et al., 2004; Saito et al., 2011; Just et al., 2013). 503

504

SlGPAT6 plays a key role in cutin biosynthesis during early tomato fruit development 505

MAGs, which form cutin building blocks, are synthesized through the action of long chain 506

acyl-CoA synthetases (LACS), cytochrome P450s enzymes (CYPs) and acyltransferases 507

(GPATs). The monomers are then exported to the apoplast and polymerized on the outer 508

face of the walls of epidermal cells to form cutin polyesters. In tomato, cutin polymerization 509

was shown to be catalyzed by a member of the GDSL lipase family, called SlCUS1 for S. 510

lycopersicum cutin synthase 1 (Girard et al., 2012; Yeats et al., 2012b; Philippe et al., 2016). 511

The following order of the reactions has been recently suggested for MAG synthesis: the ω-512

hydroxylation of fatty acids catalyzed by members of the CYP86A family is followed by in-513

chain hydroxylation carried out by members of the CYP77A family, after which the GPAT 514

catalyze the transfer to glycerol backbone (Li-Beisson et al., 2009; Yang et al., 2012; Li-515

Beisson et al., 2013). LACS must precede GPAT to provide the acyl-CoA substrates (Yang 516

et al., 2012; Li-Beisson et al., 2013). 517

A mutation in a tomato CYP gene, SlCYP86A69, which is regulated by the SlSHN3 518

transcription factor, has been reported to cause major alterations in the structure of the fruit 519

skin, including a substantial reduction in cuticle thickness (Shi et al., 2013). In a recent study, 520

Lashbrooke et al. (2015) demonstrated that another CYP gene, SlCYP77A1, a SlMIXTA-521

regulated gene whose expression is reduced in the gpat6-a mutant (Table IV), is responsible 522

for the synthesis of the midchain hydroxylated 9(10),16-dihydroxyhexadecanoic acid. In this 523

current study, we purified C16:0 diOH from tomato peel extracts and used this natural 524



23

substrate in a yeast system, previously used for assaying GPAT activity (Yang et al., 2010; 525

Yang et al., 2012; Dittrich-Domergue et al., 2014), to demonstrate that recombinant SlGPAT6 526

synthesizes MAG (Figure 4). It has previously been shown that the A. thaliana GPAT 527

enzymes involved in cutin synthesis are AtGPAT4, AtGPAT6 and AtGPAT8 (Yang et al., 528

2010; Yang et al., 2012). They possess dual sn2-acyltransferase and phosphatase activity, 529

thus producing predominantly sn2-MAGs (Yang et al., 2010; Yang et al., 2012). AtGPAT6 is 530

essential for the accumulation of cutin in flowers (Li-Beisson et al., 2009). The enzyme has a 531

higher affinity for C16 and C18 acyl-CoA substrates, the C16:0 diOH being the dominant 532

monomer in flower cutin (Li-Beisson et al., 2009). Mutation of a key amino acid residue in the 533

phosphatase domain (K178L) of AtGPAT6 abolishes its MAG synthesis activity, due to the 534

loss of phosphatase activity, but keeps the LPA synthesis activity (Yang et al., 2010). We 535

observed that both LPA and MAG did not accumulate when tomato ΔGPAT6 activity was 536

assayed (Figure 4), suggesting that the G163R mutation, which occurs adjacent to the 537

SlGPAT6 phosphatase domain, impairs both phosphatase and/or acyltransferase activities. 538

As a consequence, the fruit cutin abundance and composition was substantially altered in the 539

gpat6-a mutant, particularly with regards to levels of C16:0 diOH, in agreement with studies 540

of the floral organs of the A. thaliana gpat6-1 and gpat6-2 mutants (Li-Beisson et al., 2009; 541

Fabre et al., 2016). 542

AtGPAT6 is preferentially expressed in inflorescences, where it plays diverse roles in 543

the formation of the pollen exine and coat, in tapetum development and in stamen elongation 544

(Li-Beisson et al., 2009; Li et al., 2012). Accordingly, suppression of AtGPAT6 expression 545

results in reduced fertility (Li-Beisson et al., 2009; Li et al., 2012). While SlGPAT6 is also 546

highly expressed in inflorescence, mostly in unopened flowers, its expression is much higher 547

(3-fold) in young growing fruit. The development of tomato flowers, anthers and pollen was 548

clearly altered in the gpat6-a mutant, although this had no effect on fruit set and size 549

(Supplemental Figure S4). The most striking phenotype was in the composition and amount 550

of fruit cutin, as well as cuticle properties (glossiness and permeability to toluidine blue). 551

Another GPAT (SlGPAT4, Figure 2), the A. thaliana ortholog of which was shown to be 552

involved in cutin biosynthesis (Yang et al., 2010), has a similar pattern of expression in the 553

fruit, albeit weaker than SlGPAT6 in the fruit but stronger in the flower 554

(http://bar.utoronto.ca/efp_tomato/cgi-bin/efpWeb.cgi). We propose that SlGPAT6 developed a 555

specialized function in the fruit to accommodate the rapid production of polymeric cutin 556

during the early stages of fruit development (Petit et al., 2014), while SlGPAT4 likely has an 557

equivalent function in flowers. 558

559

Loss of SlGPAT6 function leads to altered expression of genes involved in cuticle and 560

cell wall formation and remodeling 561



24

Comparative RNA-seq profiling of the exocarp of gpat6-a and WT expanding fruit revealed 562

expression differences in several gene categories, including not only genes involved in cutin 563

or wax biosynthesis, but also secondary metabolism and cell wall synthesis and modification. 564

Since SlGPAT6 is necessary for the formation of MAG cutin monomers, it is conceivable that 565

a feed-back regulation due to MAG shortage and to the accumulation of MAG precursors in 566

the epidermal cells may affect the expression of genes involved in cutin synthesis, as well as 567

in VLCFA synthesis, which shares common precursors with cutin (Li-Beisson et al., 2013). 568

This effect would explain the large reduction in the accumulation of several cutin 569

components, as well as the lesser changes in the composition of VLCFAs. The fruit-570

expressed SlGPAT4 might be expected to compensate for the loss of SlGPAT6 activity, but 571

we observed that SlGPAT4 transcript levels were more than 2-fold lower in the gpat6-a 572

mutant than in the WT (Table IV). These observations raise the question of why a mutation in 573

a single structural gene triggers such profound alterations in exocarp transcriptome, and the 574

mechanism by which this is mediated. 575

In recent years, considerable progress has been made in elucidating the factors that 576

influence cuticle formation (Borisjuk et al., 2014), including advances resulting from the study 577

of fleshy fruits (Hen-Avivi et al., 2014; Martin and Rose, 2014). Several families of 578

transcription factors have been proposed as regulators of cuticle biosynthesis, as well as 579

epidermal cell differentiation and patterning. The first such example was the SHN gene 580

family (Aharoni et al., 2004; Broun et al., 2004), whose members control wax and cutin 581

accumulation in various plant species, including A. thaliana and tomato, and that target 582

genes involved in their synthesis (Aharoni et al., 2004; Shi et al., 2011; Shi et al., 2013). 583

Interestingly, SHN genes have been shown to control epidermal cell elongation and 584

patterning in A. thaliana flowers (Shi et al., 2011). Moreover, when expressed in rice, the 585

AtSHN2 gene was shown to regulate cell wall and lignin biosynthesis, possibly by targeting 586

NAC and MYB TFs (Ambavaram et al., 2011). Taken together, these results indicate that 587

SHN TFs may coordinate cuticle and cell wall biosynthesis in growing organs. In tomato fruit, 588

members of various TF families have been shown to play prominent roles in tomato cuticle 589

formation and its coordination with: (i) flavonoid biosynthesis, including the CD2 HD-Zip IV 590

transcription factor (Isaacson et al., 2009; Nadakuduti et al., 2012) and the MYB12 591

transcription factor (Adato et al., 2009; Ballester et al., 2010); and (ii) fruit ripening including 592

the FUL1, FUL2 and TAGL1 MADS box TFs (Bemer et al., 2012; Shima et al., 2013; 593

Giménez et al., 2015). Accordingly, changes in the expression of genes encoding SHN and 594

other known TFs might be expected in the gpat6-a mutant, but we did not observe such 595

changes. However, genes in other TF families that were expressed at higher or lower levels 596

in the gpat6-a mutant than in WT may fulfill related roles. These include the MADS box 597

protein RIN, a regulator of fruit ripening that forms DNA binding complexes with FUL1, FUL2 598



25

and TAGL1 (Fujisawa et al., 2014) and links cuticle formation to fruit development (Kosma et 599

al., 2010). Additionally, the MYB SlMIXTA-like gene, which is expressed at lower levels in 600

gpat6-a, was recently shown to play a major role in the control of cuticle formation and of 601

epidermal patterning in tomato fruit (Lashbrooke et al., 2015). Strikingly, among the 17 602

cuticle-related genes whose expression was reduced in SlMIXTA-RNAi lines, 10 were also 603

expressed at lower levels in the gpat6-a mutant. This suggests that SlMIXTA-like plays a role 604

in the formation of fruit epidermis in response to the cutin-deficiency induced by the SlGPAT6 605

mutation. 606

During tomato fruit growth, cells in the exocarp maintain a high mitotic activity (Joubès 607

et al., 1999) to accommodate the rapid enlargement of the fruit (Lemaire-Chamley et al., 608

2005). This is accompanied by a massive increase in the deposition of cutin in the epidermal 609

cell wall (Mintz-Oron et al., 2008; Isaacson et al., 2009) in order to seal the fruit surface. 610

Cuticle properties also undergo profound changes during the cell expansion phase and are 611

affected by cuticle composition, such as the accumulation of flavonoids (Espana et al., 2014). 612

In addition to the cuticle, the cell wall plays a critical role in the differentiation and maturation 613

of the fruit epidermis, and the cutin:polysaccharide ratio has been suggested to modulate the 614

cuticle viscoelastic deformation necessary for fruit enlargement (Bargel and Neinhuis, 2005; 615

Segado et al., 2016). The changes that we observed in the exocarp transcriptome of gpat6-a, 616

were associated with cuticle, phenylpropanoid, flavonoid and cell wall biosynthesis and 617

modification (Table IV), which is consistent with remodeling of fruit epidermal cell walls and 618

the overlying cuticle. Such changes may compensate for the cutin-deficiency and allow fruit 619

growth to proceed. The question remains as to how the inactivation of a single structural 620

protein with no known transcriptional regulatory role triggers such a cascade of responses 621

and suggests a mechanism for sensing of cutin-deficiency or cuticle biophysical properties. 622

This hypothesis may be addressed through future studies of other genotypes, such as single 623

or double mutants affected in various steps of cutin biosynthesis and assembly. 624

625 MATERIALS AND METHODS 626

Plant materials 627

The tomato (Solanum lycopersicum) glossy mutant line P23F12 was isolated from an EMS 628

(ethyl methanesulfonate) mutant tomato collection generated in the miniature Micro-Tom 629

cultivar at INRA Bordeaux (France), as previously described (Just et al., 2013; Petit et al., 630

2014). Plant culture conditions were as described in Rothan et al. (2016). To generate the 631

mapping-by-sequencing population, the P23F12 line was first crossed with the wild-type 632

(WT) parental line. A single BC1F1 hybrid was then selfed and the resulting BC1F2 seeds 633

were collected and sown. The 343 plants from the BC1F2 population segregating for the 634

glossy mutant trait were grown in a greenhouse under the conditions indicated in an area of 635



26

5 m2. Fruit brightness was measured at the mature green (MG) stage as described in Petit et 636

al. (2014). Fruits were photographed under standardized conditions using a Walimex 637

photographic light box (Walser GmbH, Burgheim, Germany). 638

639

Mapping-by-Sequencing 640

A mapping BC1F2 population of 343 plants was created by crossing the P23F12 Micro-Tom 641

glossy mutant line with a WT Micro-Tom parental line. Two bulks were then constituted by 642

pooling 80 plants displaying either a glossy fruit phenotype (glossy bulk) or 80 with a 643

dull/moderately glossy phenotype (WT-like bulk). To this end, 5 leaf disks (5 mm diameter 644

each) were collected from each BC1F2 plant (~600 mg fresh weight) and pooled into the 645

glossy bulk and in the WT-like bulk. The same amount of plant material was also collected 646

from the WT-parental line. Genomic DNA was extracted from each bulk and the parental line 647

using a cetyl-trimethyl-ammonium bromide (CTAB) method as described in Petit et al., 2014. 648

DNA was suspended in 200 µl of distilled water and quantified by fluorometric measurement 649

with a Quant-it™ dsDNA assay kit (Invitrogen, Waltham, Massachusetts, USA). Illumina 650

paired-end shotgun indexed libraries were prepared using the TruSeq DNA PCRF-Free LT 651

Sample Preparation Kit, according to the manufacturer’s instructions (Illumina Inc., San 652

Diego, California, USA). The libraries were validated using an Agilent High Sensitivity DNA 653

chip (Agilent Technologies, Santa Clara, California, USA), and sequenced using an Illumina 654

HiSeq 2000 at the INRA-EPGV facility, operating in a 100 bp paired-end run mode. Raw 655

fastq files were mapped to the tomato reference genome sequence S. lycopersicum build 656

release SL2.50 657

(ftp://ftp.solgenomics.net/tomato_genome/wgs/assembly/build_2.50/S_lycopersicum_chromosome658

s.2.50.fa.gz) using BWA version 0.7.12 (Li and Durbin, 2009; http://bio-bwa.sourceforge.net/). 659

Variant calling (SNPs and INDELs) was performed using SAMtools version 1.2 (Li et al., 660

2009; http://htslib.org). As the tomato reference genome (Heinz 1706 cultivar) used to map 661

the reads is distinct from that of the Micro-Tom cultivar, the variants identified would include 662

both Heinz 1706 /Micro-Tom natural polymorphisms, in addition to EMS mutations. In this 663

context, additional sequencing to a minimum depth of 20X of the Micro-Tom line was 664

performed to take into account and further remove the Heinz 1706 /Micro-Tom natural 665

polymorphism. 666

The output file included various quality parameters relevant to sequencing and mapping 667

that were subsequently used to filter the variants. The Micro-Tom line output file (.vcf) 668

included all variants (SNPs + INDELs) corresponding to natural polymorphisms between 669

Micro-Tom and Heinz 1706. The two .vcf output files obtained from the glossy and WT-like 670

bulks included variants (SNPs + INDELs) corresponding to natural polymorphisms between 671

Micro-Tom and Heinz 1706 and also to EMS mutations. The VCF files were annotated using 672



27

SnpEff version 4.1 (http://snpeff.sourceforge.net/SnpEff.html; Cingolani et al., 2012) using 673

ITAG2.40 gene models 674

ftp://ftp.solgenomics.net/genomes/Solanum_lycopersicum/annotation/ITAG2.4_release/ITAG2.4_ge675

ne_models.gff3). SNP allelic frequencies between glossy and WT-like bulks and Micro-Tom 676

parental line were compared using a custom Python script version 2.6.5. 677

(https://www.python.org). 678

Once the putative causal mutation was detected using the mapping-by-sequencing 679

procedure, the EMS-induced SNPs flanking the putative mutation were used as markers for 680

genotyping the BC1F2 individuals using a KASP assay (Smith and Maughan, 2015). Specific 681

primer design was performed using batchprimer3 software (Smith and Maughan, 2015; 682

http://probes.pw.usda.gov/batchprimer) and genotyping was done using KASP procedures 683

(LGC Genomics, Teddington, UK). 684

685

SlGPAT6 Phylogenetic analysis and in silico modeling 686

A. thaliana and S. lycopersicum databases (TAIR, https://www.arabidopsis.org; and SGN, 687

http://solgenomics.net, respectively) were searched for glycerol-3-phosphate acyltransferase 688

amino acid sequences using Molecular Evolutionary Genetic Analysis (MEGA) version 6.0 689

(Tamura et al., 2013). Neighbor-joining (NJ) tree was then constructed using MEGA 6.0 with 690

default parameters settings. 691

SlGPAT6 modeling was performed using Rasmol version 2.7.1 (Raswin Molecular 692

Graphics, Sayle and Milner-White, 1995) with the crystal structure of Methanocaldococcus 693

jannaschii phosphoserine phosphatase complex (Protein Data Bank [http://www.rcsb.org], 694

entry 1L7P) as a template. 695

696

Expression of recombinant WT and mutant SlGPAT6 proteins 697

To construct the GPAT6 expression vectors, the cDNA corresponding to the SlGPAT6 WT 698

protein (GPAT6) and the mutated form (ΔGPAT6), with codon optimization for yeast 699

expression as previously described (Dittrich-Domergue et al., 2014), were synthesized and 700

then cloned into the plasmid pDONR221 using the “Gene Synthesis & Express Cloning 701

Service” (Life Technologies, Carlsbad, California, USA). The forward primer was 1-22 attB1-702

Express [ACTTTGTACAAAAAAGCAGGCT] and the reverse primer was 1,546-1,566 attB2-703

Express [ACCCAGCTTTCTTGTACAAAG]. The fragments were then introduced into the 704

Gateway destination vector pVT102-U-GW containing a uracil selection cassette (Domergue 705

et al., 2010), through an LR recombination reaction, following the manufacturer’s instructions 706

(Thermo Fisher Scientific, Waltham, Massachusetts, USA). 707



28

The recombinant plasmids and the control vector were then introduced into a 708

glycerol-3-phosphate acyltransferase GAT1-deficient Saccharomyces cerevisiae yeast strain 709

gat1Δ (Dittrich-Domergue et al., 2014). Transformation with the empty vector (pVT102-U-710

GW) and the recombinant plasmids was performed using a polyethylene glycol/lithium 711

acetate protocol (Dittrich-Domergue et al., 2014). Selection of positive clones was made on 712

minimal medium agar plates lacking uracil, as described in Ausubel et al. (1995). 713

714

Synthesis of acyl-CoAs substrates and in vitro assays of GPAT6 activity 715

Samples of 16-hydroxyhexadecanoic acid (98%) and hexadecane-1,16-dioic acid (>98%) 716

were purchased from Sigma-Aldrich France (Saint-Quentin-Fallavier, France), and 9(10),16-717

dihydroxyhexadecanoic acid was purified from about 5 g of Red Ripe M82 tomato peel, using 718

a protocol adapted from Kawaguchi et al. (1981). After 3h of transmethylation in 5% H2SO4/ 719

MetOH at 85°C, fatty acid methyl esters were separated by a preparative-TLC (HPTLC Silica 720

Gel 60 plate (Merck, Darmstadt, Germany), diethyl ether / hexane / methanol 40:10:1 [v/v/v]) 721

and eluted from the silica with methanol / H20 / MTBE 1:1:2 (v/v/v). The purified fatty acid 722

methyl ester was saponified using potassium hydroxide 11N during 1h at 80°C. Acyl-CoAs 723

substrates were then synthesized from the corresponding fatty acids and purified as 724

described previously (Yang et al., 2010). 725

Yeast microsomes were prepared as described in Yang et al. (2010) and enzyme 726

activities were assayed as described by Dittrich-Domergue et al. (2014), except that the 727

incubation step was carried out for 10 min at 30 °C in 100 µL containing 40 µg of proteins. 728

After lipid extraction, the organic phase was analyzed by TLC using HPTLC Silica Gel 60 729

plates and chloroform / methanol / water / acetic acid (65:25:3.8:0.2 [v/v/v/v]) as a solvent. 730

Radiolabeled products were identified by co-migration with standards, and samples were 731

quantified by autoradiography using a Typhoon FLA9500 Molecular Imager (GE Healthcare, 732

Little Chalfont, United Kingdom), operating in 50 µm resolution mode. 733

734

Pollen morphology and viability 735

Pollen was collected from 20 flowers at anthesis stage and fresh samples were stained on a 736

glass slide with fluorescein diacetate (FDA), as described in Mandaokar and Browse (2009). 737

Replicates were collected under similar climatic conditions (time of pollen collection, humidity 738

and temperature). Microscopic observations were performed under visible light and at λ =495 739

nm, with a Zeiss Axioplan microscope (Carl Zeiss AG, Oberkochen, Germany). 740

741

Permeability Measurement of fruit cuticle 742

For measurements of cuticle permeability to stain, we used a protocol adapted from Tanaka 743

et al. (2004). MG stage fruits collected from WT and gpat6-a mutant plants were placed in 744



29

0.1% toluidine blue solution for 16h. Staining of the fruit surface was then visually scored and 745

photographs were taken. 746

747

Light Microscopy Analysis of Fruit Cuticle 748

For cuticle thickness measurements, fruit exocarp (including the cuticle) was obtained from 749

two independent RR stage fruits from WT and gpat6-a plants. Samples were fixed and 750

embedded in OCT medium as described in Buda et al. (2009). For each fruit, 12 µm 751

cryosections were produced using a Microm HM560 cryostat (Thermo Fisher Scientific, 752

Waltham, Massachusetts, USA) with C-type blade. Oil Red O (Alfa Aesar, Ward Hill, 753

Massachusetts, USA) stock solution (saturated solution in isopropyl alcohol) was diluted 3:2 754

with distilled water, mixed well, equilibrated at room temperature for 30 min and filtered with 755

a 0.45 µm pore size filter. The stain was added to the slides for 30 min in a petri dish 756

containing water to maintain a humid atmosphere. The slides were then exposed to an 757

alcohol series of 50%, 30%, 22%, 15%, and 8% isopropyl alcohol and the slides were finally 758

mounted in 8% isopropyl alcohol with a cover slip. The width of the cuticle layer was 759

determined by measuring the thickness of the cutinized anticlinal cell wall between two 760

adjacent epidermal cells, as previously described (Petit et al., 2014). Mean cuticle thickness 761

was assessed from 20 measurements each of 31 sections. 762

763

Cutin and Wax Analysis 764

Cuticular waxes were extracted by fruit immersion for 30 sec in 6 mL of chloroform 765

containing 6 µg of docosane as an internal standard and subsequently analyzed as 766

previously described (Petit et al., 2014). For the cutin monomer analysis, two 1 cm diameter 767

discs were isolated from a RR fruit epidermal peel, carefully scratched with a scalpel blade to 768

remove exocarp cells and incubated for 30 min in isopropanol at 85°C. The cutin was then 769

delipidated, depolymerized and analyzed as previously described (Petit et al., 2014). 770

771

RNAseq analysis 772

Twelve 1 cm diameter discs of epidermal peels were isolated from six 20 DPA fruits collected 773

from three independent WT and gpat6-a mutant plants and carefully scratched with a scalpel 774

blade, as above. Two disks per fruit were collected in distinct pools and three pools were 775

made in order to obtain three biological replicates. RNA was extracted using Trizol reagent 776

(Invitrogen, Carlsbad, California, USA). Samples were ground in liquid nitrogen and stored at 777

-80°C until RNA extraction, as previously described (Mounet et al., 2009). Total RNA integrity 778

and concentration were assessed using an Agilent 2100 Bioanalyzer with RNA Nano Chip 779

(Agilent Technologies, Santa Clara, California, USA). Total RNA samples were converted to 780

cDNA libraries using a TruSeq RNA Sample Preparation Kit (Illumina Inc., San Diego, 781



30

California, USA) according to the manufacturer’s instructions. The final library size 782

distribution was determined using a Fragment Analyzer (Advanced Analytical Technologies, 783

Ankeny, Iowa, USA). The insert size was comprised between 200 and 420 base pairs (bp) 784

and the average insert size of the library was 274 bp. Three libraries were multiplexed, 785

pooled and sequenced on a quarter lane of a HiSeq2500 (Illumina Inc., San Diego, 786

California, USA), operating in 125 bp paired-end read mode. 787

Bioinformatic analysis was performed using the TUXEDO analysis pipeline (Trapnell et 788

al., 2012). Filtered RNA-seq reads were aligned to the tomato reference genome sequence 789

S. lycopersicum build release SL2.50 using TopHat2 (v 2.0.13) (Kim et al., 2013). The 790

resulting TopHat alignments were then fed into Cufflinks (v 2.2.1) to assemble the 791

transcripts. Annotated transcripts were obtained using ITAG2.40 gene models. Transcript 792

abundances estimates were measured in fragment per kilobase million (FPKM). Cuffdiff and 793

CummerRbund were used to determine differential gene expression profiles (Trapnell et al., 794

2012). 795

796

ACKNOWLEDGMENTS 797

The authors gratefully acknowledge the helpful comments of Frédéric Delmas regarding 798

pollen analysis, Isabelle Atienza for taking care of the plants in the greenhouse, Christel 799

Baudet, from the Magendie Neurocentre, for the cryostat training, Jonathan Couillet and 800

Ouerdia Hatem for the cytological analysis and Weili Yang and John Ohlrogge for their 801

advice concerning acyl-CoA synthesis. RNA sequencing was performed in the Biotechnology 802

Resource Center of Cornell University’s Institute of Biotechnology (Ithaca, New-York, USA), 803

lipid analyses were performed in the Metabolome facility of Bordeaux and fruit cytology 804

analysis was performed at the Bordeaux Imaging Center member of the national 805

infrastructure France BioImaging. This work was supported by CEA-IG/CNG, who performed 806

QC of DNA and Illumina sequencing and the authors thank Marie Christine Le Paslier, 807

Dominique Brunel and their staff. We are grateful to Sarah Maman, the Genotoul 808

bioinformatics platform Toulouse Midi-Pyrenees and Sigenae group for providing help and/or 809

computing and/or storage resources thanks to Galaxy instance. This project was funded by 810

INRA AIP Bioressources, ERA-NET Plant Genomics “TomQML” and ANR Bioadapt (ANR-811

13-BSV7-0012) “Adaptom” project. JKCR was supported by grants from the US Department 812

of Agriculture Cooperative State Research, Education and Extension Service (2015-06803) 813

and the US National Science Foundation (Plant Genome Research Program; IOS-1339287). 814

815



31

Tables 816

Table I. Annotation of the high scoring causal mutations identified on chromosome 9 for the 817

glossy fruit mutant. Filtered EMS mutations were annotated using snpEff version 4.1 818

(Cingolani et al., 2012) from build release SL2.50 available on the SGN website 819

(http://solgenomics.net). Two EMS missense mutations (mutations at positions 5,902,976 820

and 6,873,436 on chromosome 9) located in exonic regions may affect protein function. An 821

additional mutation at position 35,265,019 causes a synonymous amino acid change in an 822

exonic region. 823

EMS Position Mutation Read

depth

Gene position

Mutation type

Tomato gene id Gene annotation

5,902,976 C to T 28 exonic missense

(G to R)

Solyc09g014350 Glycerol-3-phosphate acyltransferase 6

6,873,436 C to T 21 exonic missense

(S to F)

Solyc09g014770 AMP deaminase

35,265,019 G to A 21 exonic synonymous (L to L)

Solyc09g050010 Retrotransposon gag protein

824

825



32

Table II. Wax composition of the fruit cuticles from wild-type (WT) and gpat6-a mutant plants. 826

Mean values (µg per square centimeter x 10) of each compound are given with SD (n=3). 827

The percentage of total wax load is indicated for individual compounds. Unidentified 828

compounds are not included in the table. A letter indicates significant difference from WT 829

composition (t test, b: P<0.05, a: P<0.01). 830

831

832



33

Table III. Cutin composition of the cuticle from fruits of wild-type (WT) and gpat6-a mutant 833

plants 834

Mean values (µg per square centimeter) of each compound are given with SD (n=3). The 835

percentage of total cutin load is indicated for individual compounds. Unidentified compounds 836

are not included in the table. A letter indicates significant difference from wild-type 837

composition (t test, b: P<0.05, a: P<0.01). 838

839

840



34

Table IV. Genes differentially expressed between the exocarp of gpat6-a mutant and WT 841

fruit. Genes were assigned 842

manually to functional 843

categories. 844

845

846



35

847

FIGURE LEGENDS 848

849

Figure 1. Mapping-by-sequencing identification of the gpat6-a mutation responsible for the 850

glossy-fruit phenotype. 851

A. WT parental line was crossed with the glossy mutant. The BC1F2 progeny (343 plants) 852

was screened for glossy fruits (~25% of the plants) and normal/dull fruits (~75% of the 853

plants) to constitute the WT-like and the glossy bulks (80 individuals each). B. Variant calling 854

frequency analysis after sequencing the WT-like and glossy bulks. Variations in SNP 855

frequencies along the 12 tomato chromosomes are shown using a 20 EMS mutations sliding 856

window for the WT-like bulk (red line) and the glossy bulk (blue line). C. Progeny testing of 857

BC1F2 recombinant plants. Vertical bars indicate the nucleotide position of SNP markers. The 858

numbers between markers indicate the number of recombinant plants. The red and blue lines 859

represent WT-like and glossy homozygous chromosomal segments, respectively. The 2 860

haplotypes per individual are represented. d=dull, n=normal, g=glossy phenotypes. D. A 861

single nucleotide transition G613A in Solyc09g14350 first exon sequence led to a non-862

synonymous mutation G163R. 863

864

Figure 2. Neighbour joining phylogenetic tree of the amino acid sequences of glycerol-3-865

phosphate acyltransferase (GPAT) identified from Arabidopsis thaliana and Solanum 866

lycopersicum (Molecular Evolutionary Genetic Analysis version 6.0 (Tamura et al., 2013)). 867

The black box surrounds the tomato SlGPAT6 gene (Solyc09g14350). 868

869

Figure 3. Mutation position in the ΔSlGPAT6 protein. 870

A. Protein sequence alignment of A. thaliana AtGPAT6, S. lycopersicum ΔSlGPAT6 variant 871

and Methanococcus jannaschii phosphoserine phosphatase (Mj-PSP). Black boxes show 872

residues required for PSP activity in motif I and motif III, according to Yang et al. (2010). The 873

G163R mutation is indicated as underlined bold red text. B. In silico ΔGPAT6 modeling 874

based on Protein Data Bank structure 1L7P, restricted to the 17 to 207 amino acid positions. 875

Critical residues from motifs I and III are indicated in green for D /K amino acids and in blue 876

for other amino acids from canonical motifs. The position of the mutation is indicated in red. 877

878

Figure 4. SlGPAT6 in vitro assays in yeast, in the presence of [14C]G3P. 879

The substrates are Coenzyme A activated hexadecanoic acid (C16:0-CoA), 16-OH 880

hexadecanoic acid (C16:0 ωOH-CoA), hexadecane-1,16 dioic acid (C16:0 DCA-CoA) and 881

9(10), 16 diOH hexadecanoic acid (C16:0 diOH-CoA). The GPAT6 and ΔGPAT6 expressing 882



36

yeast strains were grown for 24 h at 30 °C. After preparation of microsomes and activated 883

substrates, enzyme activities were assayed three times using independent microsome and 884

substrate preparations. Reactions were stopped by adding HClO4, lipids were extracted and 885

the organic phase was analyzed by (A) thin-layer chromatography. (B) Monoacylglycerol 886

signals were quantified using ImageQuant™ TL (GE Healthcare Life Sciences). The activity 887

of the wild-type SlGPAT6 was arbitrarily set at 100. Values are means ± SD of three 888

independent experiments. Asterisks indicate significant differences from the wild-type value (t 889

test, P<0.01). PA, phosphatidic acid; LPA, lysophosphatidic acid; MAG, monoacylglycerol; 890

DAG, diacylglycerol; TAG, triacylglycerol. 891

892

Figure 5. Morphological comparison of wild-type WT and gpat6-a plants, flowers and pollen. 893

A. Appearance of the plants 6 weeks after sowing. B. Morphology of the fourth leaf. C. 894

Morphology of the detached anther cone. D. Measurements of the length (measure 1, m1) 895

and thickness (m2) of the anther cone. Mean values (in millimeters) of 20 measures are 896

given with SD. Asterisk indicates significant difference from WT fruit (t test, P<0.01). E, H: 897

Macroscopic observation of dissected anthers of WT (E) and gpat6-a flowers (H). F-I: 898

Microscopic observations under visible light (F, I) and at λ =495 nm (G, J) of the WT (F, G) 899

and gpat6-a pollen (I, J), stained with fluorescein diacetate 2%. The pollen viability is 900

determined by the numeration of fluorescent spots, reported to the total number of pollen 901

grains in the acquisition field. Mean values of 10 fields are given in percentage with SD. 902

Asterisks indicate significant differences from WT fruit (t test, P<0.01). 903

904

Figure 6. Cuticle phenotype of wild-type (WT) and gpat6-a fruits. 905

A. Macroscopic observations of brightness of mature green stage fruits. B. Macroscopic 906

observations of cuticle permeability to 0.5% toluidine blue. C,D. Microscopic observations of 907

8 µm cryosections of cuticles from WT (C) and gpat6-a (D) breaker stage fruits after Oil Red 908

O staining. Mean values (µm) of 40 measurements of 3 different sections are given with SD, 909

in two different positions, on the top of the epidermal cell (measure 1, m1) and between 910

epidermal cells (m2). Asterisks indicates significant differences from WT fruit (t test, P<0.01). 911

E,F. Microscopic observations of freshly peeled outer epidermal tissue from WT (E) and 912

gpat6-a (F) red ripe stage fruits. The width of the cutinized cell wall was measured between 913

the two yellow arrowheads (m3). Mean values (µm) of 620 measures (20 measurements of 914

31 sections) are given with SD. Asterisks indicate significant differences from WT fruit (t test, 915

P<0.01). 916

917

Figure 7. MapMan based general overview of genes differentially expressed between wild-918

type (WT) and gpat6-a mutant fruit. 919



37

Log2 ratio of the mutant to the WT for individual genes was plotted onto boxes. Red boxes 920

indicate genes expressed at significantly higher levels in the WT compared to gpat6-a 921

mutant. Blue boxes indicate genes expressed at significantly higher levels in the gpat6-a 922

mutant compared to the WT. OPP, oxidative pentose phosphate; TCA, tricarboxylic acid 923

cycle; CHO, carbohydrate metabolism. 924

925

SUPPLEMENTAL DATA 926

Supplementary data can be found at Plant Physiology online. 927

928

Supplemental Table 1: Illumina sequencing of BC1F2 bulked individuals with glossy fruit or a 929

WT-like fruit. 930

Supplemental Table 2: Number of SNPs in the glossy and the WT-like bulks. 931

Supplemental Table 3: Identification of the putative causal mutations associated with the 932

glossy fruit phenotype based on allelic frequency analysis in the glossy and WT-like bulks. 933

Supplemental Table 4: Genes detected before the differential analysis 934

Supplemental Table 5: Transcription factors showing differential expression in gpat6-a 935

mutant. 936

937

Supplemental Figure S1. Mapping-by-sequencing strategy for the identification of mutations 938

underlying fruit cuticle phenotypic changes in Micro-Tom EMS mutants. 939

The homozygous mutant line carrying a recessive mutation is first back-crossed (BC1) with 940

the WT parental line used for generating the EMS mutant collection. The BC1F1 hybrid plant 941

displaying a WT-like phenotype is self-crossed. The resulting BC1F2 population segregating 942

for the mutant trait is phenotyped and two bulks (80 plants each) are then constituted by 943

pooling plants displaying either the WT or the mutant phenotype. Each bulk is then 944

sequenced using Next Generation Sequencing (Illumina) to a depth of 20 to 40X coverage of 945

the tomato genome. Trimmed sequences are mapped onto the tomato reference genome 946

and EMS mutation variants are filtered. Comparison of the allelic mutation frequencies in the 947

two bulks then allows the identification of the causal mutation, which shows very high 948

frequency in the mutant-like bulk (~100% of mutant allele) and lower than average frequency 949

in the WT-like bulk (~33% of mutant allele). 950

Supplemental Figure S2. Simplified representation of acylglycerol metabolism in a S. 951

cerevisiae double knockout CMY228 gat1Δgat2Δ strain rescued by GAT1 (A), in S. 952

cerevisiae knockout strain gat1Δ transformed with the pVT102U empty vector (B) and S. 953

cerevisiae knockout strain gat1Δ transformed with pVT102U carrying the tomato GPAT6 (C). 954

On the right of each representation, a thin layer chromatography (TLC) illustrates typical 955



38

products detected after an enzyme assay with radioactive G3P. Schematically, the thickness 956

of the arrows illustrates the amount of products. The enzymes are GAT, glycerol-3-957

acyltransferase; GPAT, glycerol-3-phosphate acyltransferase; LPAP, lysophosphatidic acid 958

phosphatase; LPAAT, lysophosphatidic acid acyltransferase; PAP, phosphatidic acid 959

phosphatase; MAGAT, monoacylglycerol acyltransferase; DAGAT, diacylglycerol 960

acyltransferase. 961

962

Supplemental Figure S3. The S. lycopersicum cv Heinz SlGPAT6 gene expression in 963

flower, fruit, leaves and root. Normalized expression of SlGPAT6 gene in unopened and 964

opened flowers, young fruits (1 cm, 2 cm and 3 cm diameter), mature green (MG) stage fruit, 965

breaker stage fruit, breaker + 10 days fruit, leaves and roots. Data were collected from the 966

Toronto University public database BAR using the Tomato eFP Browser 967

(http://bar.utoronto.ca/efp_tomato/cgi-bin/efpWeb.cgi). diam: diameter, D: days. 968

969

Supplemental Figure S4. Comparison of fruits (RR stage) and seeds from WT and gpat6-a 970

mutant. Fruit diameter was measured in the equatorial zone of the fruit (n=10 fruits, mean 971

value ± SD). Only fruits with diameter between 20 and 25 mm were considered. The number 972

of seeds per fruit is shown (n=10 fruits, mean value ± SD). Seed weight was determined by 973

measuring the weight of ten seeds (n=10 fruits, mean value ± SD). 974

975

Supplemental Figure S5. Functional categories of genes differentially expressed between 976

Micro-Tom Wild-type and gpat6-a mutant. Only genes with MapMan Ontology annotation and 977

significant difference in expression (P<0.05) were considered. 978

979



Parsed CitationsAbe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Mitsuoka C, Tamiru M, Innan H, Cano L, Kamoun S,Terauchi R (2012) Genome sequencing reveals agronomically important loci in rice using MutMap. Nature Biotechnol 30: 174-178

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Adato A, Mandel T, Mintz-Oron S, Venger I, Levy D, Yativ M, Domínguez E, Wang Z, De Vos RC, Jetter R, Schreiber L, Heredia A,Rogachev I, Aharoni A (2009) Fruit-surface flavonoid accumulation in tomato is controlled by a SlMYB12-regulated transcriptionalnetwork. PLoS Genet 5: e1000777


Aharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 domain transcription factorsactivates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. PlantCell 16: 2463-2480


Ambavaram MM, Krishnan A, Trijatmiko KR, Pereira A (2011) Coordinated activation of cellulose and repression of ligninbiosynthesis pathways in rice. Plant Physiol 155: 916-931


Athenstaedt K, Weys S, Paltauf F, Daum G (1999) Redundant systems of phosphatidic acid biosynthesis via acylation of glycerol-3-phosphate or dihydroxyacetone phosphate in the yeast Saccharomyces cerevisiae. J Bacteriol. 181(5):1458-63


Ausubel FM, Katagiri F, Mindrinos M, Glazebrook J (1995) Use of Arabidopsis thaliana defense-related mutants to dissect the plantresponse to pathogens. Proc Natl Acad Sci USA 92: 4189-4196


Ballester AR, Molthoff J, de Vos R, Hekkert B, Orzaez D, Fernández-Moreno JP, Tripodi P, Grandillo S, Martin C, Heldens J,Ykema M, Granell A, Bovy A (2010) Biochemical and molecular analysis of pink tomatoes: deregulated expression of the geneencoding transcription factor SlMYB12 leads to pink tomato fruit color. Plant Physiol 152: 71-84


Bargel H, Neinhuis C (2005) Tomato (Lycopersicon esculentum Mill.) fruit growth and ripening as related to the biomechanicalproperties of fruit skin and isolated cuticle. J Exp Bot 56: 1049-1060


Bemer M, Karlova R, Ballester AR, Tikunov YM, Bovy AG, Wolters-Arts M, Rossetto PeB, Angenent GC, de Maagd RA (2012) Thetomato FRUITFULL homologs TDR4/FUL1 and MBP7/FUL2 regulate ethylene-independent aspects of fruit ripening. Plant Cell 24:4437-4451


Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire R, Joubès J (2012) Reconstitutionof plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of avery-long-chain alkane synthesis complex. Plant Cell 24: 3106-3118


Bernard A, Joubès J (2013) Arabidopsis cuticular waxes: advances in synthesis, export and regulation. Prog Lipid Res 52: 110-129Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Borisjuk N, Hrmova M, Lopato S (2014) Transcriptional regulation of cuticle biosynthesis. Biotechnol Adv 32: 526-540Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bourdenx B, Bernard A, Domergue F, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, Lessire R, Joubès J(2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature Biotechnol%5BTitle%5D%29 AND 30%5BVolume%5D AND 174%5BPagination%5D AND Abe A%2C Kosugi S%2C Yoshida K%2C Natsume S%2C Takagi H%2C Kanzaki H%2C Matsumura H%2C Mitsuoka C%2C Tamiru M%2C Innan H%2C Cano L%2C Kamoun S%2C Terauchi R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, Matsumura H, Mitsuoka C, Tamiru M, Innan H, Cano L, Kamoun S, Terauchi R (2012) Genome sequencing reveals agronomically important loci in rice using MutMap. Nature Biotechnol 30: 174-178

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Abe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome sequencing reveals agronomically important loci in rice using MutMap&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome sequencing reveals agronomically important loci in rice using MutMap&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Abe&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Fruit%2Dsurface flavonoid accumulation in tomato is controlled by a SlMYB12%2Dregulated transcriptional network%2E%5BTitle%5D%29 AND Adato A%2C Mandel T%2C Mintz%2DOron S%2C Venger I%2C Levy D%2C Yativ M%2C Dom�nguez E%2C Wang Z%2C De Vos RC%2C Jetter R%2C Schreiber L%2C Heredia A%2C Rogachev I%2C Aharoni A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Adato A, Mandel T, Mintz-Oron S, Venger I, Levy D, Yativ M, Dom�nguez E, Wang Z, De Vos RC, Jetter R, Schreiber L, Heredia A, Rogachev I, Aharoni A (2009) Fruit-surface flavonoid accumulation in tomato is controlled by a SlMYB12-regulated transcriptional network. PLoS Genet 5: e1000777

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Adato&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fruit-surface flavonoid accumulation in tomato is controlled by a SlMYB12-regulated transcriptional network.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fruit-surface flavonoid accumulation in tomato is controlled by a SlMYB12-regulated transcriptional network.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Adato&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 16%5BVolume%5D AND 2463%5BPagination%5D AND Aharoni A%2C Dixit S%2C Jetter R%2C Thoenes E%2C van Arkel G%2C Pereira A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Aharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Aharoni&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Aharoni&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 155%5BVolume%5D AND 916%5BPagination%5D AND Ambavaram MM%2C Krishnan A%2C Trijatmiko KR%2C Pereira A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ambavaram MM, Krishnan A, Trijatmiko KR, Pereira A (2011) Coordinated activation of cellulose and repression of lignin biosynthesis pathways in rice. Plant Physiol 155: 916-931

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ambavaram&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Coordinated activation of cellulose and repression of lignin biosynthesis pathways in rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Coordinated activation of cellulose and repression of lignin biosynthesis pathways in rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ambavaram&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Bacteriol%5BTitle%5D%29 AND 181%5BVolume%5D AND 1458%5BPagination%5D AND Athenstaedt K%2C Weys S%2C Paltauf F%2C Daum G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Athenstaedt K, Weys S, Paltauf F, Daum G (1999) Redundant systems of phosphatidic acid biosynthesis via acylation of glycerol-3-phosphate or dihydroxyacetone phosphate in the yeast Saccharomyces cerevisiae. J Bacteriol. 181(5):1458-63

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Athenstaedt&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Redundant systems of phosphatidic acid biosynthesis via acylation of glycerol-3-phosphate or dihydroxyacetone phosphate in the yeast Saccharomyces cerevisiae&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Redundant systems of phosphatidic acid biosynthesis via acylation of glycerol-3-phosphate or dihydroxyacetone phosphate in the yeast Saccharomyces cerevisiae&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Athenstaedt&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 92%5BVolume%5D AND 4189%5BPagination%5D AND Ausubel FM%2C Katagiri F%2C Mindrinos M%2C Glazebrook J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ausubel FM, Katagiri F, Mindrinos M, Glazebrook J (1995) Use of Arabidopsis thaliana defense-related mutants to dissect the plant response to pathogens. Proc Natl Acad Sci USA 92: 4189-4196

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ausubel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Use of Arabidopsis thaliana defense-related mutants to dissect the plant response to pathogens&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Use of Arabidopsis thaliana defense-related mutants to dissect the plant response to pathogens&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ausubel&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 152%5BVolume%5D AND 71%5BPagination%5D AND Ballester AR%2C Molthoff J%2C de Vos R%2C Hekkert B%2C Orzaez D%2C Fern�ndez%2DMoreno JP%2C Tripodi P%2C Grandillo S%2C Martin C%2C Heldens J%2C Ykema M%2C Granell A%2C Bovy A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ballester AR, Molthoff J, de Vos R, Hekkert B, Orzaez D, Fern�ndez-Moreno JP, Tripodi P, Grandillo S, Martin C, Heldens J, Ykema M, Granell A, Bovy A (2010) Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit color. Plant Physiol 152: 71-84

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ballester&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit color&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit color&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ballester&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28 fruit growth and ripening as related to the biomechanical properties of fruit skin and isolated cuticle%2E J Exp Bot%5BTitle%5D%29 AND 56%5BVolume%5D AND 1049%5BPagination%5D AND Bargel H%2C Neinhuis C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bargel H, Neinhuis C (2005) Tomato (Lycopersicon esculentum Mill.) fruit growth and ripening as related to the biomechanical properties of fruit skin and isolated cuticle. J Exp Bot 56: 1049-1060

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bargel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tomato (Lycopersicon esculentum Mill&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tomato (Lycopersicon esculentum Mill&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bargel&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 24%5BVolume%5D AND 4437%5BPagination%5D AND Bemer M%2C Karlova R%2C Ballester AR%2C Tikunov YM%2C Bovy AG%2C Wolters%2DArts M%2C Rossetto PeB%2C Angenent GC%2C de Maagd RA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bemer M, Karlova R, Ballester AR, Tikunov YM, Bovy AG, Wolters-Arts M, Rossetto PeB, Angenent GC, de Maagd RA (2012) The tomato FRUITFULL homologs TDR4/FUL1 and MBP7/FUL2 regulate ethylene-independent aspects of fruit ripening. Plant Cell 24: 4437-4451

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bemer&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato FRUITFULL homologs TDR4/FUL1 and MBP7/FUL2 regulate ethylene-independent aspects of fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato FRUITFULL homologs TDR4/FUL1 and MBP7/FUL2 regulate ethylene-independent aspects of fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bemer&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 24%5BVolume%5D AND 3106%5BPagination%5D AND Bernard A%2C Domergue F%2C Pascal S%2C Jetter R%2C Renne C%2C Faure JD%2C Haslam RP%2C Napier JA%2C Lessire R%2C Joub�s J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire R, Joub�s J (2012) Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell 24: 3106-3118

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bernard&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bernard&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Prog Lipid Res%5BTitle%5D%29 AND 52%5BVolume%5D AND 110%5BPagination%5D AND Bernard A%2C Joub�s J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bernard A, Joub�s J (2013) Arabidopsis cuticular waxes: advances in synthesis, export and regulation. Prog Lipid Res 52: 110-129

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bernard&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis cuticular waxes: advances in synthesis, export and regulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis cuticular waxes: advances in synthesis, export and regulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bernard&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Biotechnol Adv%5BTitle%5D%29 AND 32%5BVolume%5D AND 526%5BPagination%5D AND Borisjuk N%2C Hrmova M%2C Lopato S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Borisjuk N, Hrmova M, Lopato S (2014) Transcriptional regulation of cuticle biosynthesis. Biotechnol Adv 32: 526-540

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Borisjuk&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional regulation of cuticle biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional regulation of cuticle biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Borisjuk&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1


response to biotic and abiotic stresses. Plant Physiol 156: 29-45Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Broun P, Poindexter P, Osborne E, Jiang CZ, Riechmann JL (2004) WIN1, a transcriptional activator of epidermal wax accumulationin Arabidopsis. Proc Natl Acad Sci USA 101: 4706-4711


Buda GJ, Isaacson T, Matas AJ, Paolillo DJ, Rose JKC (2009) Three-dimensional imaging of plant cuticle architecture usingconfocal scanning laser microscopy. Plant J 60: 378-385


Buschhaus C, Jetter R (2011) Composition differences between epicuticular and intracuticular wax substructures: how do plantsseal their epidermal surfaces? J Exp Bot 62: 841-853


Buxdorf K, Rubinsky G, Barda O, Burdman S, Aharoni A, Levy M (2014) The transcription factor SlSHINE3 modulates defenseresponses in tomato plants. Plant Mol Biol 84: 37-47


Cao Y, Tang X, Giovannoni J, Xiao F, Liu Y (2012) Functional characterization of a tomato COBRA-like gene functioning in fruitdevelopment and ripening. BMC Plant Biol 12: 211


Chatterjee S, Matas AJ, Isaacson T, Kehlet C, Rose JK, Stark RE (2016) Solid-State (13)C NMR delineates the architectural designof biopolymers in native and genetically altered tomato fruit cuticles. Biomacromolecules 17: 215-224


Cingolani P, Platts A, Wang lL, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM (2012) A program for annotating andpredicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118;iso-2; iso-3. Fly (Austin) 6: 80-92


Consortium TG (2012) The tomato genome sequence provides insights into fleshy fruit evolution. Nature 485: 635-641Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cosgrove DJ (2005) Growth of the plant cell wall. Nat Rev Mol Cell Biol 6: 850-861Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Dittrich-Domergue F, Joubès J, Moreau P, Lessire R, Stymne S, Domergue F (2014) The bifunctional protein TtFARAT fromTetrahymena thermophila catalyzes the formation of both precursors required to initiate ether lipid biosynthesis. J Biol Chem 289:21984-21994


Domergue F, Vishwanath SJ, Joubès J, Ono J, Lee JA, Bourdon M, Alhattab R, Lowe C, Pascal S, Lessire R, Rowland O (2010)Three Arabidopsis fatty acyl-coenzyme A reductases, FAR1, FAR4, and FAR5, generate primary fatty alcohols associated withsuberin deposition. Plant Physiol 153: 1539-1554


Domínguez E, Cuartero J, Heredia A (2011) An overview on plant cuticle biomechanics. Plant Sci 181: 77-84Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Domínguez E, Heredia-Guerrero JA, Heredia A (2015) Plant cutin genesis: unanswered questions. Trends Plant Sci 20: 551-558Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon February 1, 2018 - Published by Downloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 156%5BVolume%5D AND 29%5BPagination%5D AND Bourdenx B%2C Bernard A%2C Domergue F%2C Pascal S%2C L�ger A%2C Roby D%2C Pervent M%2C Vile D%2C Haslam RP%2C Napier JA%2C Lessire R%2C Joub�s J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bourdenx B, Bernard A, Domergue F, Pascal S, L�ger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, Lessire R, Joub�s J (2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant Physiol 156: 29-45

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bourdenx&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bourdenx&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28WIN%5BTitle%5D%29 AND 1%5BVolume%5D AND a transcriptional activator of epidermal wax accumulation in Arabidopsis%2E Proc Natl Acad Sci USA 101%3A 4706%5BPagination%5D AND Broun P%2C Poindexter P%2C Osborne E%2C Jiang CZ%2C Riechmann JL%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Broun P, Poindexter P, Osborne E, Jiang CZ, Riechmann JL (2004) WIN1, a transcriptional activator of epidermal wax accumulation in Arabidopsis. Proc Natl Acad Sci USA 101: 4706-4711

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Broun&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Broun&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 60%5BVolume%5D AND 378%5BPagination%5D AND Buda GJ%2C Isaacson T%2C Matas AJ%2C Paolillo DJ%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Buda GJ, Isaacson T, Matas AJ, Paolillo DJ, Rose JKC (2009) Three-dimensional imaging of plant cuticle architecture using confocal scanning laser microscopy. Plant J 60: 378-385

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Buda&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Three-dimensional imaging of plant cuticle architecture using confocal scanning laser microscopy&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Three-dimensional imaging of plant cuticle architecture using confocal scanning laser microscopy&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Buda&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Exp Bot%5BTitle%5D%29 AND 62%5BVolume%5D AND 841%5BPagination%5D AND Buschhaus C%2C Jetter R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Buschhaus C, Jetter R (2011) Composition differences between epicuticular and intracuticular wax substructures: how do plants seal their epidermal surfaces? J Exp Bot 62: 841-853

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Buschhaus&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Composition differences between epicuticular and intracuticular wax substructures: how do plants seal their epidermal surfaces&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Composition differences between epicuticular and intracuticular wax substructures: how do plants seal their epidermal surfaces&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Buschhaus&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Mol Biol%5BTitle%5D%29 AND 84%5BVolume%5D AND 37%5BPagination%5D AND Buxdorf K%2C Rubinsky G%2C Barda O%2C Burdman S%2C Aharoni A%2C Levy M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Buxdorf K, Rubinsky G, Barda O, Burdman S, Aharoni A, Levy M (2014) The transcription factor SlSHINE3 modulates defense responses in tomato plants. Plant Mol Biol 84: 37-47

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Buxdorf&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The transcription factor SlSHINE3 modulates defense responses in tomato plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The transcription factor SlSHINE3 modulates defense responses in tomato plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Buxdorf&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Functional characterization of a tomato COBRA%2Dlike gene functioning in fruit development and ripening%2E%5BTitle%5D%29 AND Cao Y%2C Tang X%2C Giovannoni J%2C Xiao F%2C Liu Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cao Y, Tang X, Giovannoni J, Xiao F, Liu Y (2012) Functional characterization of a tomato COBRA-like gene functioning in fruit development and ripening. BMC Plant Biol 12: 211

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Functional characterization of a tomato COBRA-like gene functioning in fruit development and ripening.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Functional characterization of a tomato COBRA-like gene functioning in fruit development and ripening.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cao&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Biomacromolecules%5BTitle%5D%29 AND 17%5BVolume%5D AND 215%5BPagination%5D AND Chatterjee S%2C Matas AJ%2C Isaacson T%2C Kehlet C%2C Rose JK%2C Stark RE%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chatterjee S, Matas AJ, Isaacson T, Kehlet C, Rose JK, Stark RE (2016) Solid-State (13)C NMR delineates the architectural design of biopolymers in native and genetically altered tomato fruit cuticles. Biomacromolecules 17: 215-224

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chatterjee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Solid-State (13)C NMR delineates the architectural design of biopolymers in native and genetically altered tomato fruit cuticles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Solid-State (13)C NMR delineates the architectural design of biopolymers in native and genetically altered tomato fruit cuticles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chatterjee&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Fly Austin%5BTitle%5D%29 AND 6%5BVolume%5D AND 80%5BPagination%5D AND Cingolani P%2C Platts A%2C Wang lL%2C Coon M%2C Nguyen T%2C Wang L%2C Land SJ%2C Lu X%2C Ruden DM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cingolani P, Platts A, Wang lL, Coon M, Nguyen T, Wang L, Land SJ, Lu X, Ruden DM (2012) A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin) 6: 80-92

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cingolani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cingolani&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 485%5BVolume%5D AND 635%5BPagination%5D AND Consortium TG%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Consortium TG (2012) The tomato genome sequence provides insights into fleshy fruit evolution. Nature 485: 635-641

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Consortium&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato genome sequence provides insights into fleshy fruit evolution&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato genome sequence provides insights into fleshy fruit evolution&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Consortium&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat Rev Mol Cell Biol%5BTitle%5D%29 AND 6%5BVolume%5D AND 850%5BPagination%5D AND Cosgrove DJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cosgrove DJ (2005) Growth of the plant cell wall. Nat Rev Mol Cell Biol 6: 850-861

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cosgrove&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Growth of the plant cell wall&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Growth of the plant cell wall&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cosgrove&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Biol Chem%5BTitle%5D%29 AND 289%5BVolume%5D AND 21984%5BPagination%5D AND Dittrich%2DDomergue F%2C Joub�s J%2C Moreau P%2C Lessire R%2C Stymne S%2C Domergue F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Dittrich-Domergue F, Joub�s J, Moreau P, Lessire R, Stymne S, Domergue F (2014) The bifunctional protein TtFARAT from Tetrahymena thermophila catalyzes the formation of both precursors required to initiate ether lipid biosynthesis. J Biol Chem 289: 21984-21994

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dittrich-Domergue&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The bifunctional protein TtFARAT from Tetrahymena thermophila catalyzes the formation of both precursors required to initiate ether lipid biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The bifunctional protein TtFARAT from Tetrahymena thermophila catalyzes the formation of both precursors required to initiate ether lipid biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dittrich-Domergue&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Three%5BTitle%5D%29 AND 1%5BVolume%5D AND FAR4%2C and FAR5%2C generate primary fatty alcohols associated with suberin deposition%2E Plant Physiol 153%3A 1539%5BPagination%5D AND Domergue F%2C Vishwanath SJ%2C Joub�s J%2C Ono J%2C Lee JA%2C Bourdon M%2C Alhattab R%2C Lowe C%2C Pascal S%2C Lessire R%2C Rowland O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Domergue F, Vishwanath SJ, Joub�s J, Ono J, Lee JA, Bourdon M, Alhattab R, Lowe C, Pascal S, Lessire R, Rowland O (2010) Three Arabidopsis fatty acyl-coenzyme A reductases, FAR1, FAR4, and FAR5, generate primary fatty alcohols associated with suberin deposition. Plant Physiol 153: 1539-1554

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Domergue&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Domergue&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Sci%5BTitle%5D%29 AND 181%5BVolume%5D AND 77%5BPagination%5D AND Dom�nguez E%2C Cuartero J%2C Heredia A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Dom�nguez E, Cuartero J, Heredia A (2011) An overview on plant cuticle biomechanics. Plant Sci 181: 77-84

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dom�nguez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=An overview on plant cuticle biomechanics&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=An overview on plant cuticle biomechanics&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dom�nguez&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 20%5BVolume%5D AND 551%5BPagination%5D AND Dom�nguez E%2C Heredia%2DGuerrero JA%2C Heredia A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Dom�nguez E, Heredia-Guerrero JA, Heredia A (2015) Plant cutin genesis: unanswered questions. Trends Plant Sci 20: 551-558

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dom�nguez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant cutin genesis: unanswered questions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant cutin genesis: unanswered questions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dom�nguez&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1


España L, Heredia-Guerrero JA, Segado P, Benítez JJ, Heredia A, Domínguez E (2014) Biomechanical properties of the tomato(Solanum lycopersicum) fruit cuticle during development are modulated by changes in the relative amounts of its components.New Phytol 202: 790-802


Fabre G, Garroum I, Mazurek S, Daraspe J, Mucciolo A, Sankar M, Humbel BM, Nawrath C (2016) The ABCG transporterPEC1/ABCG32 is required for the formation of the developing leaf cuticle in Arabidopsis. New Phytol 209: 192-201


Farinas B, Mas P (2011) Histone acetylation and the circadian clock: a role for the MYB transcription factor RVE8/LCL5. PlantSignal Behav 6: 541-543


Fich EA, Segerson NA, Rose JKC (2016) The plant polyester cutin: biosynthesis, structure, and biological roles. Annu Rev PlantBiol DOI: 10.1146/annurev-arplant-043015-111929


Fujisawa M, Shima Y, Nakagawa H, Kitagawa M, Kimbara J, Nakano T, Kasumi T, Ito Y (2014) Transcriptional regulation of fruitripening by tomato FRUITFULL homologs and associated MADS box proteins. Plant Cell 26: 89-101


Giménez E, Dominguez E, Pineda B, Heredia A, Moreno V, Lozano R, Angosto T (2015) Transcriptional activity of the MADS boxARLEQUIN/TOMATO AGAMOUS-LIKE1 gene is required for cuticle development of tomato fruit. Plant Physiol 168: 1036-1048


Girard A-L, Mounet F, Lemaire-Chamley M, Gaillard C, Elmorjani K, Vivancos J, Runavot J-L, Quemener B, Petit J, Germain V,Rothan C, Marion D, Bakan B (2012) Tomato GDSL1 is required for cutin deposition in the fruit cuticle. Plant Cell 24: 3119-3134


Hen-Avivi S, Lashbrooke J, Costa F, Aharoni A (2014) Scratching the surface: genetic regulation of cuticle assembly in fleshy fruit.J Exp Bot 65: 4653-4664


Heredia A, Dominguez E, Segado P (2015) Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanumlycopersicum L.) during development. Plant Physiol 170: 935-946


Hovav R, Chehanovsky N, Moy M, Jetter R, Schaffer AA (2007) The identification of a gene (Cwp1), silenced during Solanumevolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit. Plant J 52: 627-639


Isaacson T, Kosma DK, Matas AJ, Buda GJ, He Y, Yu B, Pravitasari A, Batteas JD, Stark RE, Jenks MA, Rose JKC (2009) Cutindeficiency in the tomato fruit cuticle consistently affects resistance to microbial infection and biomechanical properties, but nottranspirational water loss. Plant J 60: 363-377


Javelle M, Vernoud V, Rogowsky PM, Ingram GC (2011) Epidermis: the formation and functions of a fundamental plant tissue. NewPhytol 189: 17-39


Johnson KL, Kibble NA, Bacic A, Schultz CJ (2011) A fasciclin-like arabinogalactan-protein (FLA) mutant of Arabidopsis thaliana,fla1, shows defects in shoot regeneration. PLoS One 6: e25154



http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 202%5BVolume%5D AND 790%5BPagination%5D AND Espa�a L%2C Heredia%2DGuerrero JA%2C Segado P%2C Ben�tez JJ%2C Heredia A%2C Dom�nguez E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Espa�a L, Heredia-Guerrero JA, Segado P, Ben�tez JJ, Heredia A, Dom�nguez E (2014) Biomechanical properties of the tomato (Solanum lycopersicum) fruit cuticle during development are modulated by changes in the relative amounts of its components. New Phytol 202: 790-802

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Espa�a&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Biomechanical properties of the tomato (Solanum lycopersicum) fruit cuticle during development are modulated by changes in the relative amounts of its components&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Biomechanical properties of the tomato (Solanum lycopersicum) fruit cuticle during development are modulated by changes in the relative amounts of its components&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Espa�a&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 209%5BVolume%5D AND 192%5BPagination%5D AND Fabre G%2C Garroum I%2C Mazurek S%2C Daraspe J%2C Mucciolo A%2C Sankar M%2C Humbel BM%2C Nawrath C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fabre G, Garroum I, Mazurek S, Daraspe J, Mucciolo A, Sankar M, Humbel BM, Nawrath C (2016) The ABCG transporter PEC1/ABCG32 is required for the formation of the developing leaf cuticle in Arabidopsis. New Phytol 209: 192-201

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fabre&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The ABCG transporter PEC1/ABCG32 is required for the formation of the developing leaf cuticle in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The ABCG transporter PEC1/ABCG32 is required for the formation of the developing leaf cuticle in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fabre&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Signal Behav%5BTitle%5D%29 AND 6%5BVolume%5D AND 541%5BPagination%5D AND Farinas B%2C Mas P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Farinas B, Mas P (2011) Histone acetylation and the circadian clock: a role for the MYB transcription factor RVE8/LCL5. Plant Signal Behav 6: 541-543

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Farinas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Histone acetylation and the circadian clock: a role for the MYB transcription factor RVE8/LCL5&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Histone acetylation and the circadian clock: a role for the MYB transcription factor RVE8/LCL5&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Farinas&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The plant polyester cutin%3A biosynthesis%2C structure%2C and biological roles%2E Annu Rev Plant Biol DOI%5BTitle%5D%29 AND 10%5BVolume%5D AND 043015%5BPagination%5D AND Fich EA%2C Segerson NA%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fich EA, Segerson NA, Rose JKC (2016) The plant polyester cutin: biosynthesis, structure, and biological roles. Annu Rev Plant Biol DOI: 10.1146/annurev-arplant-043015-111929

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fich&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fich&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 26%5BVolume%5D AND 89%5BPagination%5D AND Fujisawa M%2C Shima Y%2C Nakagawa H%2C Kitagawa M%2C Kimbara J%2C Nakano T%2C Kasumi T%2C Ito Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fujisawa M, Shima Y, Nakagawa H, Kitagawa M, Kimbara J, Nakano T, Kasumi T, Ito Y (2014) Transcriptional regulation of fruit ripening by tomato FRUITFULL homologs and associated MADS box proteins. Plant Cell 26: 89-101

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujisawa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional regulation of fruit ripening by tomato FRUITFULL homologs and associated MADS box proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional regulation of fruit ripening by tomato FRUITFULL homologs and associated MADS box proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujisawa&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 168%5BVolume%5D AND 1036%5BPagination%5D AND Gim�nez E%2C Dominguez E%2C Pineda B%2C Heredia A%2C Moreno V%2C Lozano R%2C Angosto T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gim�nez E, Dominguez E, Pineda B, Heredia A, Moreno V, Lozano R, Angosto T (2015) Transcriptional activity of the MADS box ARLEQUIN/TOMATO AGAMOUS-LIKE1 gene is required for cuticle development of tomato fruit. Plant Physiol 168: 1036-1048

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gim�nez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional activity of the MADS box ARLEQUIN/TOMATO AGAMOUS-LIKE1 gene is required for cuticle development of tomato fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional activity of the MADS box ARLEQUIN/TOMATO AGAMOUS-LIKE1 gene is required for cuticle development of tomato fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gim�nez&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 24%5BVolume%5D AND 3119%5BPagination%5D AND Girard A%2DL%2C Mounet F%2C Lemaire%2DChamley M%2C Gaillard C%2C Elmorjani K%2C Vivancos J%2C Runavot J%2DL%2C Quemener B%2C Petit J%2C Germain V%2C Rothan C%2C Marion D%2C Bakan B%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Girard A-L, Mounet F, Lemaire-Chamley M, Gaillard C, Elmorjani K, Vivancos J, Runavot J-L, Quemener B, Petit J, Germain V, Rothan C, Marion D, Bakan B (2012) Tomato GDSL1 is required for cutin deposition in the fruit cuticle. Plant Cell 24: 3119-3134

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Girard&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tomato GDSL1 is required for cutin deposition in the fruit cuticle&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tomato GDSL1 is required for cutin deposition in the fruit cuticle&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Girard&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Exp Bot%5BTitle%5D%29 AND 65%5BVolume%5D AND 4653%5BPagination%5D AND Hen%2DAvivi S%2C Lashbrooke J%2C Costa F%2C Aharoni A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hen-Avivi S, Lashbrooke J, Costa F, Aharoni A (2014) Scratching the surface: genetic regulation of cuticle assembly in fleshy fruit. J Exp Bot 65: 4653-4664

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hen-Avivi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Scratching the surface: genetic regulation of cuticle assembly in fleshy fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Scratching the surface: genetic regulation of cuticle assembly in fleshy fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hen-Avivi&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28 during development%2E Plant Physiol%5BTitle%5D%29 AND 170%5BVolume%5D AND 935%5BPagination%5D AND Heredia A%2C Dominguez E%2C Segado P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Heredia A, Dominguez E, Segado P (2015) Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanum lycopersicum L.) during development. Plant Physiol 170: 935-946

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Heredia&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanum lycopersicum L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanum lycopersicum L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Heredia&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 52%5BVolume%5D AND 627%5BPagination%5D AND Hovav R%2C Chehanovsky N%2C Moy M%2C Jetter R%2C Schaffer AA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hovav R, Chehanovsky N, Moy M, Jetter R, Schaffer AA (2007) The identification of a gene (Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit. Plant J 52: 627-639

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hovav&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The identification of a gene (Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The identification of a gene (Cwp1), silenced during Solanum evolution, which causes cuticle microfissuring and dehydration when expressed in tomato fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hovav&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 60%5BVolume%5D AND 363%5BPagination%5D AND Isaacson T%2C Kosma DK%2C Matas AJ%2C Buda GJ%2C He Y%2C Yu B%2C Pravitasari A%2C Batteas JD%2C Stark RE%2C Jenks MA%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Isaacson T, Kosma DK, Matas AJ, Buda GJ, He Y, Yu B, Pravitasari A, Batteas JD, Stark RE, Jenks MA, Rose JKC (2009) Cutin deficiency in the tomato fruit cuticle consistently affects resistance to microbial infection and biomechanical properties, but not transpirational water loss. Plant J 60: 363-377

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Isaacson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cutin deficiency in the tomato fruit cuticle consistently affects resistance to microbial infection and biomechanical properties, but not transpirational water loss&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cutin deficiency in the tomato fruit cuticle consistently affects resistance to microbial infection and biomechanical properties, but not transpirational water loss&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Isaacson&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 189%5BVolume%5D AND 17%5BPagination%5D AND Javelle M%2C Vernoud V%2C Rogowsky PM%2C Ingram GC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Javelle M, Vernoud V, Rogowsky PM, Ingram GC (2011) Epidermis: the formation and functions of a fundamental plant tissue. New Phytol 189: 17-39

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Javelle&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Epidermis: the formation and functions of a fundamental plant tissue&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Epidermis: the formation and functions of a fundamental plant tissue&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Javelle&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28A fasciclin%2Dlike arabinogalactan%2Dprotein FLA mutant of Arabidopsis thaliana%2C fla1%2C shows defects in shoot regeneration%2E%5BTitle%5D%29 AND Johnson KL%2C Kibble NA%2C Bacic A%2C Schultz CJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Johnson KL, Kibble NA, Bacic A, Schultz CJ (2011) A fasciclin-like arabinogalactan-protein (FLA) mutant of Arabidopsis thaliana, fla1, shows defects in shoot regeneration. PLoS One 6: e25154

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Johnson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A fasciclin-like arabinogalactan-protein (FLA) mutant of Arabidopsis thaliana, fla1, shows defects in shoot regeneration.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A fasciclin-like arabinogalactan-protein (FLA) mutant of Arabidopsis thaliana, fla1, shows defects in shoot regeneration.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Johnson&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1


Joubès J, Phan TH, Just D, Rothan C, Bergounioux C, Raymond P, Chevalier C (1999) Molecular and biochemical characterizationof the involvement of cyclin-dependent kinase A during the early development of tomato fruit. Plant Physiol 121: 857-869


Just D, Garcia V, Fernandez L, Bres C, Mauxion J-P, Petit J, Jorly J, Assali J, Bournonville C, Ferrand C, Baldet P, Lemaire-Chamley M, Mori K, Okabe Y, Ariizumi T, Asamizu E, Ezura H, Rothan C (2013) Micro-Tom mutants for functional analysis of targetgenes and discovery of new alleles in tomato. Plant Biotechnol 30: 225-231


Kawaguchi A, Yoshimura T, Okuda S (1981) A new method for the preparation of acyl-CoA thioesters. J Biochem 89: 337-339Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: accurate alignment of transcriptomes in thepresence of insertions, deletions and gene fusions. Genome Biol 14: R36


Kimbara J, Yoshida M, Ito H, Kitagawa M, Takada W, Hayashi K, Shibutani Y, Kusano M, Okazaki Y, Nakabayashi R, Mori T, Saito K,Ariizumi T, Ezura H (2013) Inhibition of CUTIN DEFICIENT 2 causes defects in cuticle function and structure and metabolitechanges in tomato fruit. Plant Cell Physiol 54: 1535-1548


Kobayashi M, Nagasaki H, Garcia V, Just D, Bres C, Mauxion JP, Le Paslier MC, Brunel D, Suda K, Minakuchi Y, Toyoda A, FujiyamaA, Toyoshima H, Suzuki T, Igarashi K, Rothan C, Kaminuma E, Nakamura Y, Yano K, Aoki K (2014) Genome-wide analysis ofintraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum). Plant Cell Physiol 55: 445-454


Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lue S, Joubès J, Jenks MA (2009) The impact of water deficiency on leaf cuticlelipids of Arabidopsis. Plant Physiol 151: 1918-1929


Kosma DK, Parsons EP, Isaacson T, Lü S, Rose JK, Jenks MA (2010) Fruit cuticle lipid composition during development in tomatoripening mutants. Physiol Plant 139: 107-117


Lashbrooke J, Adato A, Lotan O, Alkan N, Tsimbalist T, Rechav K, Fernandez-Moreno JP, Widemann E, Grausem B, Pinot F,Granell A, Costa F, Aharoni A (2015) The tomato MIXTA-like transcription factor coordinates fruit epidermis conical celldevelopment and cuticular lipid biosynthesis and assembly. Plant Physiol 169: 2553-2571


Lemaire-Chamley M, Petit J, Garcia V, Just D, Baldet P, Germain V, Fagard M, Mouassite M, Cheniclet C, Rothan C (2005) Changesin transcriptional profiles are associated with early fruit tissue specialization in tomato. Plant Physiol 139: 750-769


Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25: 1754-1760Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Subgroup GPDP (2009) The sequencealignment/map format and SAMtools. Bioinformatics 25: 2078-2079


Li XC, Zhu J, Yang J, Zhang GR, Xing WF, Zhang S, Yang ZN (2012) Glycerol-3-phosphate acyltransferase 6 (GPAT6) is important fortapetum development in Arabidopsis and plays multiple roles in plant fertility. Mol Plant 5: 131-142



http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 121%5BVolume%5D AND 857%5BPagination%5D AND Joub�s J%2C Phan TH%2C Just D%2C Rothan C%2C Bergounioux C%2C Raymond P%2C Chevalier C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Joub�s J, Phan TH, Just D, Rothan C, Bergounioux C, Raymond P, Chevalier C (1999) Molecular and biochemical characterization of the involvement of cyclin-dependent kinase A during the early development of tomato fruit. Plant Physiol 121: 857-869

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Joub�s&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and biochemical characterization of the involvement of cyclin-dependent kinase A during the early development of tomato fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and biochemical characterization of the involvement of cyclin-dependent kinase A during the early development of tomato fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Joub�s&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Biotechnol%5BTitle%5D%29 AND 30%5BVolume%5D AND 225%5BPagination%5D AND Just D%2C Garcia V%2C Fernandez L%2C Bres C%2C Mauxion J%2DP%2C Petit J%2C Jorly J%2C Assali J%2C Bournonville C%2C Ferrand C%2C Baldet P%2C Lemaire%2DChamley M%2C Mori K%2C Okabe Y%2C Ariizumi T%2C Asamizu E%2C Ezura H%2C Rothan C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Just D, Garcia V, Fernandez L, Bres C, Mauxion J-P, Petit J, Jorly J, Assali J, Bournonville C, Ferrand C, Baldet P, Lemaire-Chamley M, Mori K, Okabe Y, Ariizumi T, Asamizu E, Ezura H, Rothan C (2013) Micro-Tom mutants for functional analysis of target genes and discovery of new alleles in tomato. Plant Biotechnol 30: 225-231

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Just&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Micro-Tom mutants for functional analysis of target genes and discovery of new alleles in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Micro-Tom mutants for functional analysis of target genes and discovery of new alleles in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Just&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Biochem%5BTitle%5D%29 AND 89%5BVolume%5D AND 337%5BPagination%5D AND Kawaguchi A%2C Yoshimura T%2C Okuda S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kawaguchi A, Yoshimura T, Okuda S (1981) A new method for the preparation of acyl-CoA thioesters. J Biochem 89: 337-339

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kawaguchi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A new method for the preparation of acyl-CoA thioesters&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A new method for the preparation of acyl-CoA thioesters&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kawaguchi&as_ylo=1981&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28TopHat2%3A accurate alignment of transcriptomes in the presence of insertions%2C deletions and gene fusions%2E%5BTitle%5D%29 AND Kim D%2C Pertea G%2C Trapnell C%2C Pimentel H%2C Kelley R%2C Salzberg SL%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14: R36

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 54%5BVolume%5D AND 1535%5BPagination%5D AND Kimbara J%2C Yoshida M%2C Ito H%2C Kitagawa M%2C Takada W%2C Hayashi K%2C Shibutani Y%2C Kusano M%2C Okazaki Y%2C Nakabayashi R%2C Mori T%2C Saito K%2C Ariizumi T%2C Ezura H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kimbara J, Yoshida M, Ito H, Kitagawa M, Takada W, Hayashi K, Shibutani Y, Kusano M, Okazaki Y, Nakabayashi R, Mori T, Saito K, Ariizumi T, Ezura H (2013) Inhibition of CUTIN DEFICIENT 2 causes defects in cuticle function and structure and metabolite changes in tomato fruit. Plant Cell Physiol 54: 1535-1548

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kimbara&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Inhibition of CUTIN DEFICIENT 2 causes defects in cuticle function and structure and metabolite changes in tomato fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Inhibition of CUTIN DEFICIENT 2 causes defects in cuticle function and structure and metabolite changes in tomato fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kimbara&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 55%5BVolume%5D AND 445%5BPagination%5D AND Kobayashi M%2C Nagasaki H%2C Garcia V%2C Just D%2C Bres C%2C Mauxion JP%2C Le Paslier MC%2C Brunel D%2C Suda K%2C Minakuchi Y%2C Toyoda A%2C Fujiyama A%2C Toyoshima H%2C Suzuki T%2C Igarashi K%2C Rothan C%2C Kaminuma E%2C Nakamura Y%2C Yano K%2C Aoki K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kobayashi M, Nagasaki H, Garcia V, Just D, Bres C, Mauxion JP, Le Paslier MC, Brunel D, Suda K, Minakuchi Y, Toyoda A, Fujiyama A, Toyoshima H, Suzuki T, Igarashi K, Rothan C, Kaminuma E, Nakamura Y, Yano K, Aoki K (2014) Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum). Plant Cell Physiol 55: 445-454

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kobayashi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kobayashi&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 151%5BVolume%5D AND 1918%5BPagination%5D AND Kosma DK%2C Bourdenx B%2C Bernard A%2C Parsons EP%2C Lue S%2C Joub�s J%2C Jenks MA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kosma DK, Bourdenx B, Bernard A, Parsons EP, Lue S, Joub�s J, Jenks MA (2009) The impact of water deficiency on leaf cuticle lipids of Arabidopsis. Plant Physiol 151: 1918-1929

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kosma&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The impact of water deficiency on leaf cuticle lipids of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The impact of water deficiency on leaf cuticle lipids of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kosma&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Physiol Plant%5BTitle%5D%29 AND 139%5BVolume%5D AND 107%5BPagination%5D AND Kosma DK%2C Parsons EP%2C Isaacson T%2C L� S%2C Rose JK%2C Jenks MA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kosma DK, Parsons EP, Isaacson T, L� S, Rose JK, Jenks MA (2010) Fruit cuticle lipid composition during development in tomato ripening mutants. Physiol Plant 139: 107-117

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kosma&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fruit cuticle lipid composition during development in tomato ripening mutants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fruit cuticle lipid composition during development in tomato ripening mutants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kosma&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 169%5BVolume%5D AND 2553%5BPagination%5D AND Lashbrooke J%2C Adato A%2C Lotan O%2C Alkan N%2C Tsimbalist T%2C Rechav K%2C Fernandez%2DMoreno JP%2C Widemann E%2C Grausem B%2C Pinot F%2C Granell A%2C Costa F%2C Aharoni A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lashbrooke J, Adato A, Lotan O, Alkan N, Tsimbalist T, Rechav K, Fernandez-Moreno JP, Widemann E, Grausem B, Pinot F, Granell A, Costa F, Aharoni A (2015) The tomato MIXTA-like transcription factor coordinates fruit epidermis conical cell development and cuticular lipid biosynthesis and assembly. Plant Physiol 169: 2553-2571

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lashbrooke&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato MIXTA-like transcription factor coordinates fruit epidermis conical cell development and cuticular lipid biosynthesis and assembly&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato MIXTA-like transcription factor coordinates fruit epidermis conical cell development and cuticular lipid biosynthesis and assembly&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lashbrooke&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 139%5BVolume%5D AND 750%5BPagination%5D AND Lemaire%2DChamley M%2C Petit J%2C Garcia V%2C Just D%2C Baldet P%2C Germain V%2C Fagard M%2C Mouassite M%2C Cheniclet C%2C Rothan C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lemaire-Chamley M, Petit J, Garcia V, Just D, Baldet P, Germain V, Fagard M, Mouassite M, Cheniclet C, Rothan C (2005) Changes in transcriptional profiles are associated with early fruit tissue specialization in tomato. Plant Physiol 139: 750-769

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lemaire-Chamley&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Changes in transcriptional profiles are associated with early fruit tissue specialization in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Changes in transcriptional profiles are associated with early fruit tissue specialization in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lemaire-Chamley&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Bioinformatics%5BTitle%5D%29 AND 25%5BVolume%5D AND 1754%5BPagination%5D AND Li H%2C Durbin R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25: 1754-1760

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fast and accurate short read alignment with Burrows-Wheeler transform&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fast and accurate short read alignment with Burrows-Wheeler transform&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Bioinformatics%5BTitle%5D%29 AND 25%5BVolume%5D AND 2078%5BPagination%5D AND Li H%2C Handsaker B%2C Wysoker A%2C Fennell T%2C Ruan J%2C Homer N%2C Marth G%2C Abecasis G%2C Durbin R%2C Subgroup GPDP%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Subgroup GPDP (2009) The sequence alignment/map format and SAMtools. Bioinformatics 25: 2078-2079


http://scholar.google.com/scholar?as_q=The sequence alignment/map format and SAMtools&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The sequence alignment/map format and SAMtools&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol Plant%5BTitle%5D%29 AND 5%5BVolume%5D AND 131%5BPagination%5D AND Li XC%2C Zhu J%2C Yang J%2C Zhang GR%2C Xing WF%2C Zhang S%2C Yang ZN%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li XC, Zhu J, Yang J, Zhang GR, Xing WF, Zhang S, Yang ZN (2012) Glycerol-3-phosphate acyltransferase 6 (GPAT6) is important for tapetum development in Arabidopsis and plays multiple roles in plant fertility. Mol Plant 5: 131-142


http://scholar.google.com/scholar?as_q=Glycerol-3-phosphate acyltransferase 6 (GPAT6) is important for tapetum development in Arabidopsis and plays multiple roles in plant fertility&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Glycerol-3-phosphate acyltransferase 6 (GPAT6) is important for tapetum development in Arabidopsis and plays multiple roles in plant fertility&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


Li Y, Beisson F, Koo AJ, Molina I, Pollard M, Ohlrogge J (2007) Identification of acyltransferases required for cutin biosynthesisand production of cutin with suberin-like monomers. Proc Natl Acad Sci USA 104: 18339-18344


Li-Beisson Y, Pollard M, Sauveplane V, Pinot F, Ohlrogge J, Beisson F (2009) Nanoridges that characterize the surfacemorphology of flowers require the synthesis of cutin polyester. Proc Natl Acad Sci USA 106: 22008-22013


Li-Beisson Y, Shorrosh B, Beisson F, Andersson MX, Arondel V, Bates PD, Baud S, Bird D, Debono A, Durrett TP, Franke RB,Graham IA, Katayama K, Kelly AA, Larson T, Markham JE, Miquel M, Molina I, Nishida I, Rowland O, Samuels L, Schmid KM, Wada H,Welti R, Xu C, Zallot R, Ohlrogge J (2013) Acyl-lipid metabolism. Arabidopsis Book 11: e0161


Liu M, Lima Gomes B, Mila I, Purgatto E, Peres LE, Frasse P, Maza E, Zouine M, Roustan JP, Bouzayen M, Pirrello J (2016)Comprehensive profiling of Ethylene Response Factors expression identifies ripening-associated ERF genes and their link to keyregulators of fruit ripening in tomato (Solanum lycopersicum). Plant Physiol in press


MacMillan CP, Mansfield SD, Stachurski ZH, Evans R, Southerton SG (2010) Fasciclin-like arabinogalactan proteins: specializationfor stem biomechanics and cell wall architecture in Arabidopsis and Eucalyptus. Plant J 62: 689-703


Mandaokar A, Browse J (2009) MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation inArabidopsis. Plant Physiol 149: 851-862


Martin LB, Rose JKC (2014) There's more than one way to skin a fruit: formation and functions of fruit cuticles. J Exp Bot 65: 4639-4651


Matas AJ, Yeats TH, Buda GJ, Zheng Y, Chatterjee S, Tohge T, Ponnala L, Adato A, Aharoni A, Stark R, Fernie AR, Fei Z,Giovannoni JJ, Rose JKC (2011) Tissue- and cell-type specific transcriptome profiling of expanding tomato fruit provides insightsinto metabolic and regulatory specialization and cuticle formation. Plant Cell 23: 3893-3910


Meissner R, Jacobson Y, Melamed S, Levyatuv S, Shalev G, Ashri A, Elkind Y, Levy A (1997) A new model system for tomatogenetics. Plant J 12: 1465-1472


Mejía N, Soto B, Guerrero M, Casanueva X, Houel C, Miccono MeL, Ramos R, Le Cunff L, Boursiquot JM, Hinrichsen P, Adam-Blondon AF (2011) Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness ingrapevine. BMC Plant Biol 11: 57


Menda N, Semel Y, Peled D, Eshed Y, Zamir D (2004) In silico screening of a saturated mutation library of tomato. Plant J 38: 861-872


Mintz-Oron S, Mandel T, Rogachev I, Feldberg L, Lotan O, Yativ M, Wang Z, Jetter R, Venger I, Adato A, Aharoni A (2008) Geneexpression and metabolism in tomato fruit surface tissues. Plant Physiol 147: 823-851


Mounet F, Moing A, Garcia V, Petit J, Maucourt M, Deborde C, Bernillon S, Le Gall G, Colquhoun I, Defernez M, Giraudel J-L, RolinD, Rothan C, Lemaire-Chamley M (2009) Gene and metabolite regulatory network analysis of early developing fruit tissueshighlights new candidate genes for the control of tomato fruit composition and development. Plant Physiol 149: 1505-1528

Pubmed: Author and Title www.plantphysiol.orgon February 1, 2018 - Published by Downloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 104%5BVolume%5D AND 18339%5BPagination%5D AND Li Y%2C Beisson F%2C Koo AJ%2C Molina I%2C Pollard M%2C Ohlrogge J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li Y, Beisson F, Koo AJ, Molina I, Pollard M, Ohlrogge J (2007) Identification of acyltransferases required for cutin biosynthesis and production of cutin with suberin-like monomers. Proc Natl Acad Sci USA 104: 18339-18344


http://scholar.google.com/scholar?as_q=Identification of acyltransferases required for cutin biosynthesis and production of cutin with suberin-like monomers&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of acyltransferases required for cutin biosynthesis and production of cutin with suberin-like monomers&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 106%5BVolume%5D AND 22008%5BPagination%5D AND Li%2DBeisson Y%2C Pollard M%2C Sauveplane V%2C Pinot F%2C Ohlrogge J%2C Beisson F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li-Beisson Y, Pollard M, Sauveplane V, Pinot F, Ohlrogge J, Beisson F (2009) Nanoridges that characterize the surface morphology of flowers require the synthesis of cutin polyester. Proc Natl Acad Sci USA 106: 22008-22013

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li-Beisson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nanoridges that characterize the surface morphology of flowers require the synthesis of cutin polyester&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nanoridges that characterize the surface morphology of flowers require the synthesis of cutin polyester&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li-Beisson&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Acyl%2Dlipid metabolism%2E%5BTitle%5D%29 AND Li%2DBeisson Y%2C Shorrosh B%2C Beisson F%2C Andersson MX%2C Arondel V%2C Bates PD%2C Baud S%2C Bird D%2C Debono A%2C Durrett TP%2C Franke RB%2C Graham IA%2C Katayama K%2C Kelly AA%2C Larson T%2C Markham JE%2C Miquel M%2C Molina I%2C Nishida I%2C Rowland O%2C Samuels L%2C Schmid KM%2C Wada H%2C Welti R%2C Xu C%2C Zallot R%2C Ohlrogge J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li-Beisson Y, Shorrosh B, Beisson F, Andersson MX, Arondel V, Bates PD, Baud S, Bird D, Debono A, Durrett TP, Franke RB, Graham IA, Katayama K, Kelly AA, Larson T, Markham JE, Miquel M, Molina I, Nishida I, Rowland O, Samuels L, Schmid KM, Wada H, Welti R, Xu C, Zallot R, Ohlrogge J (2013) Acyl-lipid metabolism. Arabidopsis Book 11: e0161

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li-Beisson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Acyl-lipid metabolism.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Acyl-lipid metabolism.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li-Beisson&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Comprehensive profiling of Ethylene Response Factors expression identifies ripening%2Dassociated ERF genes and their link to key regulators of fruit ripening in tomato Solanum lycopersicum%2E%5BTitle%5D%29 AND Liu M%2C Lima Gomes B%2C Mila I%2C Purgatto E%2C Peres LE%2C Frasse P%2C Maza E%2C Zouine M%2C Roustan JP%2C Bouzayen M%2C Pirrello J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Liu M, Lima Gomes B, Mila I, Purgatto E, Peres LE, Frasse P, Maza E, Zouine M, Roustan JP, Bouzayen M, Pirrello J (2016) Comprehensive profiling of Ethylene Response Factors expression identifies ripening-associated ERF genes and their link to key regulators of fruit ripening in tomato (Solanum lycopersicum). Plant Physiol in press

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive profiling of Ethylene Response Factors expression identifies ripening-associated ERF genes and their link to key regulators of fruit ripening in tomato (Solanum lycopersicum).&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive profiling of Ethylene Response Factors expression identifies ripening-associated ERF genes and their link to key regulators of fruit ripening in tomato (Solanum lycopersicum).&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 62%5BVolume%5D AND 689%5BPagination%5D AND MacMillan CP%2C Mansfield SD%2C Stachurski ZH%2C Evans R%2C Southerton SG%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=MacMillan CP, Mansfield SD, Stachurski ZH, Evans R, Southerton SG (2010) Fasciclin-like arabinogalactan proteins: specialization for stem biomechanics and cell wall architecture in Arabidopsis and Eucalyptus. Plant J 62: 689-703

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=MacMillan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fasciclin-like arabinogalactan proteins: specialization for stem biomechanics and cell wall architecture in Arabidopsis and Eucalyptus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fasciclin-like arabinogalactan proteins: specialization for stem biomechanics and cell wall architecture in Arabidopsis and Eucalyptus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=MacMillan&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 149%5BVolume%5D AND 851%5BPagination%5D AND Mandaokar A%2C Browse J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mandaokar A, Browse J (2009) MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation in Arabidopsis. Plant Physiol 149: 851-862

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mandaokar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mandaokar&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Exp Bot%5BTitle%5D%29 AND 65%5BVolume%5D AND 4639%5BPagination%5D AND Martin LB%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Martin LB, Rose JKC (2014) There's more than one way to skin a fruit: formation and functions of fruit cuticles. J Exp Bot 65: 4639-4651

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Martin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=There's more than one way to skin a fruit: formation and functions of fruit cuticles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=There's more than one way to skin a fruit: formation and functions of fruit cuticles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Martin&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 23%5BVolume%5D AND 3893%5BPagination%5D AND Matas AJ%2C Yeats TH%2C Buda GJ%2C Zheng Y%2C Chatterjee S%2C Tohge T%2C Ponnala L%2C Adato A%2C Aharoni A%2C Stark R%2C Fernie AR%2C Fei Z%2C Giovannoni JJ%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Matas AJ, Yeats TH, Buda GJ, Zheng Y, Chatterjee S, Tohge T, Ponnala L, Adato A, Aharoni A, Stark R, Fernie AR, Fei Z, Giovannoni JJ, Rose JKC (2011) Tissue- and cell-type specific transcriptome profiling of expanding tomato fruit provides insights into metabolic and regulatory specialization and cuticle formation. Plant Cell 23: 3893-3910

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Matas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tissue- and cell-type specific transcriptome profiling of expanding tomato fruit provides insights into metabolic and regulatory specialization and cuticle formation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tissue- and cell-type specific transcriptome profiling of expanding tomato fruit provides insights into metabolic and regulatory specialization and cuticle formation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Matas&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 12%5BVolume%5D AND 1465%5BPagination%5D AND Meissner R%2C Jacobson Y%2C Melamed S%2C Levyatuv S%2C Shalev G%2C Ashri A%2C Elkind Y%2C Levy A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Meissner R, Jacobson Y, Melamed S, Levyatuv S, Shalev G, Ashri A, Elkind Y, Levy A (1997) A new model system for tomato genetics. Plant J 12: 1465-1472

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Meissner&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A new model system for tomato genetics&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A new model system for tomato genetics&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Meissner&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Molecular%2C genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine%2E%5BTitle%5D%29 AND Mej�a N%2C Soto B%2C Guerrero M%2C Casanueva X%2C Houel C%2C Miccono MeL%2C Ramos R%2C Le Cunff L%2C Boursiquot JM%2C Hinrichsen P%2C Adam%2DBlondon AF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mej�a N, Soto B, Guerrero M, Casanueva X, Houel C, Miccono MeL, Ramos R, Le Cunff L, Boursiquot JM, Hinrichsen P, Adam-Blondon AF (2011) Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine. BMC Plant Biol 11: 57

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mej�a&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mej�a&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 38%5BVolume%5D AND 861%5BPagination%5D AND Menda N%2C Semel Y%2C Peled D%2C Eshed Y%2C Zamir D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Menda N, Semel Y, Peled D, Eshed Y, Zamir D (2004) In silico screening of a saturated mutation library of tomato. Plant J 38: 861-872

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Menda&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=In silico screening of a saturated mutation library of tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=In silico screening of a saturated mutation library of tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Menda&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 147%5BVolume%5D AND 823%5BPagination%5D AND Mintz%2DOron S%2C Mandel T%2C Rogachev I%2C Feldberg L%2C Lotan O%2C Yativ M%2C Wang Z%2C Jetter R%2C Venger I%2C Adato A%2C Aharoni A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mintz-Oron S, Mandel T, Rogachev I, Feldberg L, Lotan O, Yativ M, Wang Z, Jetter R, Venger I, Adato A, Aharoni A (2008) Gene expression and metabolism in tomato fruit surface tissues. Plant Physiol 147: 823-851

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mintz-Oron&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gene expression and metabolism in tomato fruit surface tissues&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gene expression and metabolism in tomato fruit surface tissues&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mintz-Oron&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 149%5BVolume%5D AND 1505%5BPagination%5D AND Mounet F%2C Moing A%2C Garcia V%2C Petit J%2C Maucourt M%2C Deborde C%2C Bernillon S%2C Le Gall G%2C Colquhoun I%2C Defernez M%2C Giraudel J%2DL%2C Rolin D%2C Rothan C%2C Lemaire%2DChamley M%5BAuthor%5D&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Müller K, Levesque-Tremblay G, Fernandes A, Wormit A, Bartels S, Usadel B, Kermode A (2013) Overexpression of a pectinmethylesterase inhibitor in Arabidopsis thaliana leads to altered growth morphology of the stem and defective organ separation.Plant Signal Behav 8: e26464


Nadakuduti SS, Pollard M, Kosma DK, Allen C, Ohlrogge JB, Barry CS (2012) Pleiotropic phenotypes of the sticky peel mutantprovide new insight into the role of CUTIN DEFICIENT2 in epidermal cell function in tomato. Plant Physiol 159: 945-960


Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281-287Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Negruk V, Yang P, Subramanian M, McNevin JP, Lemieux B (1996) Molecular cloning and characterization of the CER2 gene ofArabidopsis thaliana. Plant J 9: 137-145


Niu E, Shang X, Cheng C, Bao J, Zeng Y, Cai C, Du X, Guo W (2015) Comprehensive analysis of the COBRA-like (COBL) genefamily in Gossypium identifies two COBLs potentially associated with fiber quality. PLoS One 10: e0145725


Oshima Y, Mitsuda N (2013) The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetativeorgans. Plant Signal Behav 8: e26826


Park YB, Cosgrove DJ (2015) Xyloglucan and its interactions with other components of the growing cell wall. Plant Cell Physiol 56:180-194


Petit J, Bres C, Just D, Garcia V, Mauxion J-P, Marion D, Bakan B, Joubès J, Domergue F, Rothan C (2014) Analyses of tomato fruitbrightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new hypomorphic allele of GDSL lipase. PlantPhysiol 164: 888-906


Philippe G, Gaillard C, Petit J, Geneix N, Dalgalarrondo M, Bres C, Mauxion JP, Franke R, Rothan C, Schreiber L, Marion D, BakanB (2015) Ester-crosslink profiling of the cutin polymer of Wild-Type and cutin synthase tomato (Solanum lycopersicum L.) mutantshighlights different mechanisms of polymerization. Plant Physiol 170: 807-820


Rautengarten C, Ebert B, Ouellet M, Nafisi M, Baidoo EE, Benke P, Stranne M, Mukhopadhyay A, Keasling JD, Sakuragi Y, SchellerHV (2012) Arabidopsis deficient in cutin ferulate encodes a transferase required for feruloylation of ?-hydroxy fatty acids in cutinpolyester. Plant Physiol 158: 654-665


Reca IB, Lionetti V, Camardella L, D'Avino R, Giardina T, Cervone F, Bellincampi D (2012) A functional pectin methylesteraseinhibitor protein (SolyPMEI) is expressed during tomato fruit ripening and interacts with PME-1. Plant Mol Biol 79: 429-442


Rose JKC, Braam J, Fry SC, Nishitani K (2002) The XTH family of enzymes involved in xyloglucan endotransglucosylation andendohydrolysis: current perspectives and a new unifying nomenclature. Plant Cell Physiol 43: 1421-1435


Rothan C, Just D, Fernandez L, Atienza I, Ballias P, Lemaire-Chamley M (2016) Culture of the tomato Micro-Tom cultivar ingreenhouse. Methods Mol Biol 1363: 57-64


http://search.crossref.org/?page=1&rows=2&q=Mounet F, Moing A, Garcia V, Petit J, Maucourt M, Deborde C, Bernillon S, Le Gall G, Colquhoun I, Defernez M, Giraudel J-L, Rolin D, Rothan C, Lemaire-Chamley M (2009) Gene and metabolite regulatory network analysis of early developing fruit tissues highlights new candidate genes for the control of tomato fruit composition and development. Plant Physiol 149: 1505-1528

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mounet&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gene and metabolite regulatory network analysis of early developing fruit tissues highlights new candidate genes for the control of tomato fruit composition and development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gene and metabolite regulatory network analysis of early developing fruit tissues highlights new candidate genes for the control of tomato fruit composition and development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mounet&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Overexpression of a pectin methylesterase inhibitor in Arabidopsis thaliana leads to altered growth morphology of the stem and defective organ separation%2E%5BTitle%5D%29 AND M�ller K%2C Levesque%2DTremblay G%2C Fernandes A%2C Wormit A%2C Bartels S%2C Usadel B%2C Kermode A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=M�ller K, Levesque-Tremblay G, Fernandes A, Wormit A, Bartels S, Usadel B, Kermode A (2013) Overexpression of a pectin methylesterase inhibitor in Arabidopsis thaliana leads to altered growth morphology of the stem and defective organ separation. Plant Signal Behav 8: e26464

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=M�ller&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of a pectin methylesterase inhibitor in Arabidopsis thaliana leads to altered growth morphology of the stem and defective organ separation.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of a pectin methylesterase inhibitor in Arabidopsis thaliana leads to altered growth morphology of the stem and defective organ separation.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=M�ller&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 159%5BVolume%5D AND 945%5BPagination%5D AND Nadakuduti SS%2C Pollard M%2C Kosma DK%2C Allen C%2C Ohlrogge JB%2C Barry CS%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nadakuduti SS, Pollard M, Kosma DK, Allen C, Ohlrogge JB, Barry CS (2012) Pleiotropic phenotypes of the sticky peel mutant provide new insight into the role of CUTIN DEFICIENT2 in epidermal cell function in tomato. Plant Physiol 159: 945-960

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nadakuduti&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pleiotropic phenotypes of the sticky peel mutant provide new insight into the role of CUTIN DEFICIENT2 in epidermal cell function in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pleiotropic phenotypes of the sticky peel mutant provide new insight into the role of CUTIN DEFICIENT2 in epidermal cell function in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nadakuduti&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr Opin Plant Biol%5BTitle%5D%29 AND 9%5BVolume%5D AND 281%5BPagination%5D AND Nawrath C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281-287

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nawrath&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Unraveling the complex network of cuticular structure and function&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Unraveling the complex network of cuticular structure and function&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nawrath&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 9%5BVolume%5D AND 137%5BPagination%5D AND Negruk V%2C Yang P%2C Subramanian M%2C McNevin JP%2C Lemieux B%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Negruk V, Yang P, Subramanian M, McNevin JP, Lemieux B (1996) Molecular cloning and characterization of the CER2 gene of Arabidopsis thaliana. Plant J 9: 137-145

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Negruk&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular cloning and characterization of the CER2 gene of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular cloning and characterization of the CER2 gene of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Negruk&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Comprehensive analysis of the COBRA%2Dlike COBL gene family in Gossypium identifies two COBLs potentially associated with fiber quality%2E%5BTitle%5D%29 AND Niu E%2C Shang X%2C Cheng C%2C Bao J%2C Zeng Y%2C Cai C%2C Du X%2C Guo W%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Niu E, Shang X, Cheng C, Bao J, Zeng Y, Cai C, Du X, Guo W (2015) Comprehensive analysis of the COBRA-like (COBL) gene family in Gossypium identifies two COBLs potentially associated with fiber quality. PLoS One 10: e0145725

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Niu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive analysis of the COBRA-like (COBL) gene family in Gossypium identifies two COBLs potentially associated with fiber quality.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive analysis of the COBRA-like (COBL) gene family in Gossypium identifies two COBLs potentially associated with fiber quality.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Niu&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The MIXTA%2Dlike transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs%2E%5BTitle%5D%29 AND Oshima Y%2C Mitsuda N%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Oshima Y, Mitsuda N (2013) The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs. Plant Signal Behav 8: e26826

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Oshima&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The MIXTA-like transcription factor MYB16 is a major regulator of cuticle formation in vegetative organs.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Oshima&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 56%5BVolume%5D AND 180%5BPagination%5D AND Park YB%2C Cosgrove DJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park YB, Cosgrove DJ (2015) Xyloglucan and its interactions with other components of the growing cell wall. Plant Cell Physiol 56: 180-194

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Xyloglucan and its interactions with other components of the growing cell wall&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Xyloglucan and its interactions with other components of the growing cell wall&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 164%5BVolume%5D AND 888%5BPagination%5D AND Petit J%2C Bres C%2C Just D%2C Garcia V%2C Mauxion J%2DP%2C Marion D%2C Bakan B%2C Joub�s J%2C Domergue F%2C Rothan C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Petit J, Bres C, Just D, Garcia V, Mauxion J-P, Marion D, Bakan B, Joub�s J, Domergue F, Rothan C (2014) Analyses of tomato fruit brightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new hypomorphic allele of GDSL lipase. Plant Physiol 164: 888-906

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Petit&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Analyses of tomato fruit brightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new hypomorphic allele of GDSL lipase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Analyses of tomato fruit brightness mutants uncover both cutin-deficient and cutin-abundant mutants and a new hypomorphic allele of GDSL lipase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Petit&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28 mutants highlights different mechanisms of polymerization%2E Plant Physiol%5BTitle%5D%29 AND 170%5BVolume%5D AND 807%5BPagination%5D AND Philippe G%2C Gaillard C%2C Petit J%2C Geneix N%2C Dalgalarrondo M%2C Bres C%2C Mauxion JP%2C Franke R%2C Rothan C%2C Schreiber L%2C Marion D%2C Bakan B%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Philippe G, Gaillard C, Petit J, Geneix N, Dalgalarrondo M, Bres C, Mauxion JP, Franke R, Rothan C, Schreiber L, Marion D, Bakan B (2015) Ester-crosslink profiling of the cutin polymer of Wild-Type and cutin synthase tomato (Solanum lycopersicum L.) mutants highlights different mechanisms of polymerization. Plant Physiol 170: 807-820

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Philippe&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ester-crosslink profiling of the cutin polymer of Wild-Type and cutin synthase tomato (Solanum lycopersicum L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ester-crosslink profiling of the cutin polymer of Wild-Type and cutin synthase tomato (Solanum lycopersicum L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Philippe&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28hydroxy fatty acids in cutin polyester%2E Plant Physiol%5BTitle%5D%29 AND 158%5BVolume%5D AND 654%5BPagination%5D AND Rautengarten C%2C Ebert B%2C Ouellet M%2C Nafisi M%2C Baidoo EE%2C Benke P%2C Stranne M%2C Mukhopadhyay A%2C Keasling JD%2C Sakuragi Y%2C Scheller HV%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rautengarten C, Ebert B, Ouellet M, Nafisi M, Baidoo EE, Benke P, Stranne M, Mukhopadhyay A, Keasling JD, Sakuragi Y, Scheller HV (2012) Arabidopsis deficient in cutin ferulate encodes a transferase required for feruloylation of ?-hydroxy fatty acids in cutin polyester. Plant Physiol 158: 654-665

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rautengarten&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis deficient in cutin ferulate encodes a transferase required for feruloylation of&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis deficient in cutin ferulate encodes a transferase required for feruloylation of&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rautengarten&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Mol Biol%5BTitle%5D%29 AND 79%5BVolume%5D AND 429%5BPagination%5D AND Reca IB%2C Lionetti V%2C Camardella L%2C D%27Avino R%2C Giardina T%2C Cervone F%2C Bellincampi D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Reca IB, Lionetti V, Camardella L, D'Avino R, Giardina T, Cervone F, Bellincampi D (2012) A functional pectin methylesterase inhibitor protein (SolyPMEI) is expressed during tomato fruit ripening and interacts with PME-1. Plant Mol Biol 79: 429-442

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Reca&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A functional pectin methylesterase inhibitor protein (SolyPMEI) is expressed during tomato fruit ripening and interacts with PME-1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A functional pectin methylesterase inhibitor protein (SolyPMEI) is expressed during tomato fruit ripening and interacts with PME-1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Reca&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 43%5BVolume%5D AND 1421%5BPagination%5D AND Rose JKC%2C Braam J%2C Fry SC%2C Nishitani K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rose JKC, Braam J, Fry SC, Nishitani K (2002) The XTH family of enzymes involved in xyloglucan endotransglucosylation and endohydrolysis: current perspectives and a new unifying nomenclature. Plant Cell Physiol 43: 1421-1435

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rose&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The XTH family of enzymes involved in xyloglucan endotransglucosylation and endohydrolysis: current perspectives and a new unifying nomenclature&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The XTH family of enzymes involved in xyloglucan endotransglucosylation and endohydrolysis: current perspectives and a new unifying nomenclature&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rose&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1



Saito T, Ariizumi T, Okabe Y, Asamizu E, Hiwasa-Tanase K, Fukuda N, Mizoguchi T, Yamazaki Y, Aoki K, Ezura H (2011)TOMATOMA: a novel tomato mutant database distributing Micro-Tom mutant collections. Plant Cell Physiol 52: 283-296


Sayle RA, Milner-White EJ (1995) RASMOL: biomolecular graphics for all. Trends Biochem Sci 20: 374Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Schneeberger K (2014) Using next-generation sequencing to isolate mutant genes from forward genetic screens. Nat Rev Genet15: 662-676


Schneeberger K, Ossowski S, Lanz C, Juul T, Petersen AH, Nielsen KL, Jørgensen JE, Weigel D, Andersen SU (2009) SHOREmap:simultaneous mapping and mutation identification by deep sequencing. Nat Methods 6: 550-551


Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development inArabidopsis. Plant Cell 16: 629-642


Schreiber L (2010) Transport barriers made of cutin, suberin and associated waxes. Trends Plant Sci 15: 546-553Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Segado P, Domínguez E, Heredia A (2016) Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanumlycopersicum L.) during development. Plant Physiol 170: 935-946


Seifert GJ, Xue H, Acet T (2014) The Arabidopsis thaliana FASCICLIN LIKE ARABINOGALACTAN PROTEIN 4 gene actssynergistically with abscisic acid signalling to control root growth. Ann Bot 114: 1125-1133


Seki H, Sawai S, Ohyama K, Mizutani M, Ohnishi T, Sudo H, Fukushima EO, Akashi T, Aoki T, Saito K, Muranaka T (2011) Triterpenefunctional genomics in licorice for identification of CYP72A154 involved in the biosynthesis of glycyrrhizin. Plant Cell 23: 4112-4123


Shi JX, Adato A, Alkan N, He Y, Lashbrooke J, Matas AJ, Meir S, Malitsky S, Isaacson T, Prusky D, Leshkowitz D, Schreiber L,Granell AR, Widemann E, Grausem B, Pinot F, Rose JK, Rogachev I, Rothan C, Aharoni A (2013) The tomato SlSHINE3 transcriptionfactor regulates fruit cuticle formation and epidermal patterning. New Phytol 197: 468-480


Shi JX, Malitsky S, De Oliveira S, Branigan C, Franke RB, Schreiber L, Aharoni A (2011) SHINE transcription factors act redundantlyto pattern the archetypal surface of Arabidopsis flower organs. PLoS Genet 7: e1001388


Shima Y, Kitagawa M, Fujisawa M, Nakano T, Kato H, Kimbara J, Kasumi T, Ito Y (2013) Tomato FRUITFULL homologues act in fruitripening via forming MADS-box transcription factor complexes with RIN. Plant Mol Biol 82: 427-438


Shirasawa K, Hirakawa H, Nunome T, Tabata S, Isobe S (2016) Genome-wide survey of artificial mutations induced by ethylmethanesulfonate and gamma rays in tomato. Plant Biotechnol J 14: 51-60



http://www.ncbi.nlm.nih.gov/pubmed?term=%28Methods Mol Biol%5BTitle%5D%29 AND 1363%5BVolume%5D AND 57%5BPagination%5D AND Rothan C%2C Just D%2C Fernandez L%2C Atienza I%2C Ballias P%2C Lemaire%2DChamley M%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rothan C, Just D, Fernandez L, Atienza I, Ballias P, Lemaire-Chamley M (2016) Culture of the tomato Micro-Tom cultivar in greenhouse. Methods Mol Biol 1363: 57-64

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rothan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Culture of the tomato Micro-Tom cultivar in greenhouse&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Culture of the tomato Micro-Tom cultivar in greenhouse&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rothan&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 52%5BVolume%5D AND 283%5BPagination%5D AND Saito T%2C Ariizumi T%2C Okabe Y%2C Asamizu E%2C Hiwasa%2DTanase K%2C Fukuda N%2C Mizoguchi T%2C Yamazaki Y%2C Aoki K%2C Ezura H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Saito T, Ariizumi T, Okabe Y, Asamizu E, Hiwasa-Tanase K, Fukuda N, Mizoguchi T, Yamazaki Y, Aoki K, Ezura H (2011) TOMATOMA: a novel tomato mutant database distributing Micro-Tom mutant collections. Plant Cell Physiol 52: 283-296

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Saito&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TOMATOMA: a novel tomato mutant database distributing Micro-Tom mutant collections&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TOMATOMA: a novel tomato mutant database distributing Micro-Tom mutant collections&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Saito&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28RASMOL%3A biomolecular graphics for all%2E%5BTitle%5D%29 AND Sayle RA%2C Milner%2DWhite EJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sayle RA, Milner-White EJ (1995) RASMOL: biomolecular graphics for all. Trends Biochem Sci 20: 374

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sayle&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=RASMOL: biomolecular graphics for all.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=RASMOL: biomolecular graphics for all.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sayle&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat Rev Genet%5BTitle%5D%29 AND 15%5BVolume%5D AND 662%5BPagination%5D AND Schneeberger K%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schneeberger K (2014) Using next-generation sequencing to isolate mutant genes from forward genetic screens. Nat Rev Genet 15: 662-676

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schneeberger&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Using next-generation sequencing to isolate mutant genes from forward genetic screens&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Using next-generation sequencing to isolate mutant genes from forward genetic screens&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schneeberger&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat Methods%5BTitle%5D%29 AND 6%5BVolume%5D AND 550%5BPagination%5D AND Schneeberger K%2C Ossowski S%2C Lanz C%2C Juul T%2C Petersen AH%2C Nielsen KL%2C J�rgensen JE%2C Weigel D%2C Andersen SU%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schneeberger K, Ossowski S, Lanz C, Juul T, Petersen AH, Nielsen KL, J�rgensen JE, Weigel D, Andersen SU (2009) SHOREmap: simultaneous mapping and mutation identification by deep sequencing. Nat Methods 6: 550-551

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schneeberger&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SHOREmap: simultaneous mapping and mutation identification by deep sequencing&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SHOREmap: simultaneous mapping and mutation identification by deep sequencing&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schneeberger&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 16%5BVolume%5D AND 629%5BPagination%5D AND Schnurr J%2C Shockey J%2C Browse J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis. Plant Cell 16: 629-642

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schnurr&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schnurr&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Trends Plant Sci%5BTitle%5D%29 AND 15%5BVolume%5D AND 546%5BPagination%5D AND Schreiber L%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schreiber L (2010) Transport barriers made of cutin, suberin and associated waxes. Trends Plant Sci 15: 546-553

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schreiber&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transport barriers made of cutin, suberin and associated waxes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transport barriers made of cutin, suberin and associated waxes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schreiber&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28 during development%2E Plant Physiol%5BTitle%5D%29 AND 170%5BVolume%5D AND 935%5BPagination%5D AND Segado P%2C Dom�nguez E%2C Heredia A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Segado P, Dom�nguez E, Heredia A (2016) Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanum lycopersicum L.) during development. Plant Physiol 170: 935-946

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Segado&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanum lycopersicum L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ultrastructure of the epidermal cell wall and cuticle of tomato fruit (Solanum lycopersicum L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Segado&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann Bot%5BTitle%5D%29 AND 114%5BVolume%5D AND 1125%5BPagination%5D AND Seifert GJ%2C Xue H%2C Acet T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Seifert GJ, Xue H, Acet T (2014) The Arabidopsis thaliana FASCICLIN LIKE ARABINOGALACTAN PROTEIN 4 gene acts synergistically with abscisic acid signalling to control root growth. Ann Bot 114: 1125-1133

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Seifert&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis thaliana FASCICLIN LIKE ARABINOGALACTAN PROTEIN 4 gene acts synergistically with abscisic acid signalling to control root growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Arabidopsis thaliana FASCICLIN LIKE ARABINOGALACTAN PROTEIN 4 gene acts synergistically with abscisic acid signalling to control root growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seifert&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 23%5BVolume%5D AND 4112%5BPagination%5D AND Seki H%2C Sawai S%2C Ohyama K%2C Mizutani M%2C Ohnishi T%2C Sudo H%2C Fukushima EO%2C Akashi T%2C Aoki T%2C Saito K%2C Muranaka T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Seki H, Sawai S, Ohyama K, Mizutani M, Ohnishi T, Sudo H, Fukushima EO, Akashi T, Aoki T, Saito K, Muranaka T (2011) Triterpene functional genomics in licorice for identification of CYP72A154 involved in the biosynthesis of glycyrrhizin. Plant Cell 23: 4112-4123

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Seki&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Triterpene functional genomics in licorice for identification of CYP72A154 involved in the biosynthesis of glycyrrhizin&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Triterpene functional genomics in licorice for identification of CYP72A154 involved in the biosynthesis of glycyrrhizin&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seki&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 197%5BVolume%5D AND 468%5BPagination%5D AND Shi JX%2C Adato A%2C Alkan N%2C He Y%2C Lashbrooke J%2C Matas AJ%2C Meir S%2C Malitsky S%2C Isaacson T%2C Prusky D%2C Leshkowitz D%2C Schreiber L%2C Granell AR%2C Widemann E%2C Grausem B%2C Pinot F%2C Rose JK%2C Rogachev I%2C Rothan C%2C Aharoni A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shi JX, Adato A, Alkan N, He Y, Lashbrooke J, Matas AJ, Meir S, Malitsky S, Isaacson T, Prusky D, Leshkowitz D, Schreiber L, Granell AR, Widemann E, Grausem B, Pinot F, Rose JK, Rogachev I, Rothan C, Aharoni A (2013) The tomato SlSHINE3 transcription factor regulates fruit cuticle formation and epidermal patterning. New Phytol 197: 468-480

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato SlSHINE3 transcription factor regulates fruit cuticle formation and epidermal patterning&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The tomato SlSHINE3 transcription factor regulates fruit cuticle formation and epidermal patterning&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shi&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs%2E%5BTitle%5D%29 AND Shi JX%2C Malitsky S%2C De Oliveira S%2C Branigan C%2C Franke RB%2C Schreiber L%2C Aharoni A%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shi JX, Malitsky S, De Oliveira S, Branigan C, Franke RB, Schreiber L, Aharoni A (2011) SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs. PLoS Genet 7: e1001388

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SHINE transcription factors act redundantly to pattern the archetypal surface of Arabidopsis flower organs.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shi&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Mol Biol%5BTitle%5D%29 AND 82%5BVolume%5D AND 427%5BPagination%5D AND Shima Y%2C Kitagawa M%2C Fujisawa M%2C Nakano T%2C Kato H%2C Kimbara J%2C Kasumi T%2C Ito Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shima Y, Kitagawa M, Fujisawa M, Nakano T, Kato H, Kimbara J, Kasumi T, Ito Y (2013) Tomato FRUITFULL homologues act in fruit ripening via forming MADS-box transcription factor complexes with RIN. Plant Mol Biol 82: 427-438

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shima&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Tomato FRUITFULL homologues act in fruit ripening via forming MADS-box transcription factor complexes with RIN&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Tomato FRUITFULL homologues act in fruit ripening via forming MADS-box transcription factor complexes with RIN&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shima&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Biotechnol J%5BTitle%5D%29 AND 14%5BVolume%5D AND 51%5BPagination%5D AND Shirasawa K%2C Hirakawa H%2C Nunome T%2C Tabata S%2C Isobe S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shirasawa K, Hirakawa H, Nunome T, Tabata S, Isobe S (2016) Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato. Plant Biotechnol J 14: 51-60

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shirasawa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shirasawa&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1


Shirasawa K, Isobe S, Hirakawa H, Asamizu E, Fukuoka H, Just D, Rothan C, Sasamoto S, Fujishiro T, Kishida Y, Kohara M,Tsuruoka H, Wada T, Nakamura Y, Sato S, Tabata S (2010) SNP discovery and linkage map construction in cultivated tomato. DNARes 17: 381-391


Sim NL, Kumar P, Hu J, Henikoff S, Schneider G, Ng PC (2012) SIFT web server: predicting effects of amino acid substitutions onproteins. Nucleic Acids Res 40: W452-457


Smith DL, Gross KC (2000) A family of at least seven beta-galactosidase genes is expressed during tomato fruit development.Plant Physiol 123: 1173-1183


Smith SM, Maughan PJ (2015) SNP genotyping using KASPar assays. Methods Mol Biol 1245: 243-256Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. MolBiol Evol 30: 2725-2729


Tanaka T, Tanaka H, Machida C, Watanabe M, Machida Y (2004) A new method for rapid visualization of defects in leaf cuticlereveals five intrinsic patterns of surface defects in Arabidopsis. Plant J 37: 139-146


Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L (2012) Differential geneand transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562-578


Urbanczyk-Wochniak E, Usadel B, Thimm O, Nunes-Nesi A, Carrari F, Davy M, Bläsing O, Kowalczyk M, Weicht D, Polinceusz A,Meyer S, Stitt M, Fernie AR (2006) Conversion of MapMan to allow the analysis of transcript data from Solanaceous species:effects of genetic and environmental alterations in energy metabolism in the leaf. Plant Mol Biol 60: 773-792


Valverde F (2011) CONSTANS and the evolutionary origin of photoperiodic timing of flowering. J Exp Bot 62: 2453-2463Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W, Giovannoni J (2002) A MADS-box genenecessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science 296:343-346.


Yang W, Pollard M, Li-Beisson Y, Beisson F, Feig M, Ohlrogge J (2010) A distinct type of glycerol-3-phosphate acyltransferase withsn-2 preference and phosphatase activity producing 2-monoacylglycerol. Proc Natl Acad Sci USA 107: 12040-12045


Yang W, Simpson J, Li-Beisson Y, Beisson F, Pollard M, Ohlrogge J (2012) A land-plant-specific glycerol-3-phosphateacyltransferase family in Arabidopsis: substrate specificity, sn-2 preference, and evolution. Plant Physiol 160: 638-652


Yeats TH, Buda GJ, Wang Z, Chehanovsky N, Moyle LC, Jetter R, Schaffer AA, Rose JKC (2012a) The fruit cuticles of wild tomatospecies exhibit architectural and chemical diversity, providing a new model for studying the evolution of cuticle function. Plant J69: 655-666


Yeats TH, Martin LB, Viart HM, Isaacson T, He Y, Zhao L, Matas AJ, Buda GJ, Domozych DS, Clausen MH, Rose JKC (2012b) The www.plantphysiol.orgon February 1, 2018 - Published by Downloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28DNA Res%5BTitle%5D%29 AND 17%5BVolume%5D AND 381%5BPagination%5D AND Shirasawa K%2C Isobe S%2C Hirakawa H%2C Asamizu E%2C Fukuoka H%2C Just D%2C Rothan C%2C Sasamoto S%2C Fujishiro T%2C Kishida Y%2C Kohara M%2C Tsuruoka H%2C Wada T%2C Nakamura Y%2C Sato S%2C Tabata S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Shirasawa K, Isobe S, Hirakawa H, Asamizu E, Fukuoka H, Just D, Rothan C, Sasamoto S, Fujishiro T, Kishida Y, Kohara M, Tsuruoka H, Wada T, Nakamura Y, Sato S, Tabata S (2010) SNP discovery and linkage map construction in cultivated tomato. DNA Res 17: 381-391

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shirasawa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SNP discovery and linkage map construction in cultivated tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SNP discovery and linkage map construction in cultivated tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shirasawa&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nucleic Acids Res%5BTitle%5D%29 AND 40%5BVolume%5D AND W452%5BPagination%5D AND Sim NL%2C Kumar P%2C Hu J%2C Henikoff S%2C Schneider G%2C Ng PC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sim NL, Kumar P, Hu J, Henikoff S, Schneider G, Ng PC (2012) SIFT web server: predicting effects of amino acid substitutions on proteins. Nucleic Acids Res 40: W452-457

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SIFT web server: predicting effects of amino acid substitutions on proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SIFT web server: predicting effects of amino acid substitutions on proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sim&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 123%5BVolume%5D AND 1173%5BPagination%5D AND Smith DL%2C Gross KC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Smith DL, Gross KC (2000) A family of at least seven beta-galactosidase genes is expressed during tomato fruit development. Plant Physiol 123: 1173-1183

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Smith&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A family of at least seven beta-galactosidase genes is expressed during tomato fruit development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A family of at least seven beta-galactosidase genes is expressed during tomato fruit development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Smith&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Methods Mol Biol%5BTitle%5D%29 AND 1245%5BVolume%5D AND 243%5BPagination%5D AND Smith SM%2C Maughan PJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Smith SM, Maughan PJ (2015) SNP genotyping using KASPar assays. Methods Mol Biol 1245: 243-256

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Smith&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SNP genotyping using KASPar assays&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SNP genotyping using KASPar assays&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Smith&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28MEGA%5BTitle%5D%29 AND 6%5BVolume%5D AND Molecular Evolutionary Genetics Analysis version 6%2E0%2E Mol Biol Evol 30%3A 2725%5BPagination%5D AND Tamura K%2C Stecher G%2C Peterson D%2C Filipski A%2C Kumar S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30: 2725-2729

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tamura&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tamura&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 37%5BVolume%5D AND 139%5BPagination%5D AND Tanaka T%2C Tanaka H%2C Machida C%2C Watanabe M%2C Machida Y%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tanaka T, Tanaka H, Machida C, Watanabe M, Machida Y (2004) A new method for rapid visualization of defects in leaf cuticle reveals five intrinsic patterns of surface defects in Arabidopsis. Plant J 37: 139-146

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tanaka&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A new method for rapid visualization of defects in leaf cuticle reveals five intrinsic patterns of surface defects in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A new method for rapid visualization of defects in leaf cuticle reveals five intrinsic patterns of surface defects in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tanaka&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat Protoc%5BTitle%5D%29 AND 7%5BVolume%5D AND 562%5BPagination%5D AND Trapnell C%2C Roberts A%2C Goff L%2C Pertea G%2C Kim D%2C Kelley DR%2C Pimentel H%2C Salzberg SL%2C Rinn JL%2C Pachter L%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562-578

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Trapnell&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Trapnell&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Mol Biol%5BTitle%5D%29 AND 60%5BVolume%5D AND 773%5BPagination%5D AND Urbanczyk%2DWochniak E%2C Usadel B%2C Thimm O%2C Nunes%2DNesi A%2C Carrari F%2C Davy M%2C Bl�sing O%2C Kowalczyk M%2C Weicht D%2C Polinceusz A%2C Meyer S%2C Stitt M%2C Fernie AR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Urbanczyk-Wochniak E, Usadel B, Thimm O, Nunes-Nesi A, Carrari F, Davy M, Bl�sing O, Kowalczyk M, Weicht D, Polinceusz A, Meyer S, Stitt M, Fernie AR (2006) Conversion of MapMan to allow the analysis of transcript data from Solanaceous species: effects of genetic and environmental alterations in energy metabolism in the leaf. Plant Mol Biol 60: 773-792

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Urbanczyk-Wochniak&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Conversion of MapMan to allow the analysis of transcript data from Solanaceous species: effects of genetic and environmental alterations in energy metabolism in the leaf&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Conversion of MapMan to allow the analysis of transcript data from Solanaceous species: effects of genetic and environmental alterations in energy metabolism in the leaf&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Urbanczyk-Wochniak&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J Exp Bot%5BTitle%5D%29 AND 62%5BVolume%5D AND 2453%5BPagination%5D AND Valverde F%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Valverde F (2011) CONSTANS and the evolutionary origin of photoperiodic timing of flowering. J Exp Bot 62: 2453-2463

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Valverde&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=CONSTANS and the evolutionary origin of photoperiodic timing of flowering&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=CONSTANS and the evolutionary origin of photoperiodic timing of flowering&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Valverde&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 296%5BVolume%5D AND 343%5BPagination%5D AND Vrebalov J%2C Ruezinsky D%2C Padmanabhan V%2C White R%2C Medrano D%2C Drake R%2C Schuch W%2C Giovannoni J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W, Giovannoni J (2002) A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science 296:343-346.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vrebalov&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vrebalov&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc Natl Acad Sci USA%5BTitle%5D%29 AND 107%5BVolume%5D AND 12040%5BPagination%5D AND Yang W%2C Pollard M%2C Li%2DBeisson Y%2C Beisson F%2C Feig M%2C Ohlrogge J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang W, Pollard M, Li-Beisson Y, Beisson F, Feig M, Ohlrogge J (2010) A distinct type of glycerol-3-phosphate acyltransferase with sn-2 preference and phosphatase activity producing 2-monoacylglycerol. Proc Natl Acad Sci USA 107: 12040-12045

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A distinct type of glycerol-3-phosphate acyltransferase with sn-2 preference and phosphatase activity producing 2-monoacylglycerol&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A distinct type of glycerol-3-phosphate acyltransferase with sn-2 preference and phosphatase activity producing 2-monoacylglycerol&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 160%5BVolume%5D AND 638%5BPagination%5D AND Yang W%2C Simpson J%2C Li%2DBeisson Y%2C Beisson F%2C Pollard M%2C Ohlrogge J%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang W, Simpson J, Li-Beisson Y, Beisson F, Pollard M, Ohlrogge J (2012) A land-plant-specific glycerol-3-phosphate acyltransferase family in Arabidopsis: substrate specificity, sn-2 preference, and evolution. Plant Physiol 160: 638-652

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A land-plant-specific glycerol-3-phosphate acyltransferase family in Arabidopsis: substrate specificity, sn-2 preference, and evolution&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A land-plant-specific glycerol-3-phosphate acyltransferase family in Arabidopsis: substrate specificity, sn-2 preference, and evolution&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 69%5BVolume%5D AND 655%5BPagination%5D AND Yeats TH%2C Buda GJ%2C Wang Z%2C Chehanovsky N%2C Moyle LC%2C Jetter R%2C Schaffer AA%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yeats TH, Buda GJ, Wang Z, Chehanovsky N, Moyle LC, Jetter R, Schaffer AA, Rose JKC (2012a) The fruit cuticles of wild tomato species exhibit architectural and chemical diversity, providing a new model for studying the evolution of cuticle function. Plant J 69: 655-666

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yeats&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The fruit cuticles of wild tomato species exhibit architectural and chemical diversity, providing a new model for studying the evolution of cuticle function&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The fruit cuticles of wild tomato species exhibit architectural and chemical diversity, providing a new model for studying the evolution of cuticle function&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yeats&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1


identification of cutin synthase: formation of the plant polyester cutin. Nat Chem Biol 8: 609-611Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yeats TH, Rose JKC (2008) The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs). Protein Sci 17: 191-198


Yeats TH, Rose JKC (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat Chem Biol%5BTitle%5D%29 AND 8%5BVolume%5D AND 609%5BPagination%5D AND Yeats TH%2C Martin LB%2C Viart HM%2C Isaacson T%2C He Y%2C Zhao L%2C Matas AJ%2C Buda GJ%2C Domozych DS%2C Clausen MH%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yeats TH, Martin LB, Viart HM, Isaacson T, He Y, Zhao L, Matas AJ, Buda GJ, Domozych DS, Clausen MH, Rose JKC (2012b) The identification of cutin synthase: formation of the plant polyester cutin. Nat Chem Biol 8: 609-611


http://scholar.google.com/scholar?as_q=The identification of cutin synthase: formation of the plant polyester cutin&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The identification of cutin synthase: formation of the plant polyester cutin&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yeats&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Protein Sci%5BTitle%5D%29 AND 17%5BVolume%5D AND 191%5BPagination%5D AND Yeats TH%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yeats TH, Rose JKC (2008) The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs). Protein Sci 17: 191-198


http://scholar.google.com/scholar?as_q=The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs)&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The biochemistry and biology of extracellular plant lipid-transfer proteins (LTPs)&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yeats&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 163%5BVolume%5D AND 5%5BPagination%5D AND Yeats TH%2C Rose JKC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yeats TH, Rose JKC (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20


http://scholar.google.com/scholar?as_q=The formation and function of plant cuticles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The formation and function of plant cuticles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yeats&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1


the glycerol-3-phosphate acyltransferase gpat6 from tomato plays

Documents