the human chromosomes
DESCRIPTION
The Human Chromosomes. 1. Other Structural Variants. Inversion. Deletion. Copy number variant. Other mutations - recombination. Copy 1. Copy 2. Probability r i (~10^-8) for recombination in position i. child chromosome. The Vision of Personalized Medicine. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/1.jpg)
The Human Chromosomes
1
![Page 2: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/2.jpg)
Other Structural Variants
InversionDeletionCopy number variant
![Page 3: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/3.jpg)
Other mutations - recombination
Copy 1
Copy 2
child chromosome
Probability ri (~10^-8) for recombination in position i.
![Page 4: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/4.jpg)
The Vision of Personalized MedicineThe Vision of Personalized Medicine
Genetic and epigenetic variants + Genetic and epigenetic variants + measurable environmental/behavioral factors wouldmeasurable environmental/behavioral factors wouldbe used for a personalized treatment and diagnosisbe used for a personalized treatment and diagnosis
![Page 5: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/5.jpg)
Association StudiesAssociation Studies
![Page 6: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/6.jpg)
AGAGCAGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCGACATGATAGCCAGAGCCGTCGACATGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCGACATGATAGTCAGAGCAGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCGACATGATAGCCAGAGCAGTCGACAGGTATAGCCTACATGAGATCAACATGAGATCGGTAGAGCAGTGAGATCGACATGATAGCCAGAGCCGTCGACATGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCAACATGATAGCCAGAGCCGTCGACATGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGCCAGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGTCAGAGCAGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC
AGAGCAGTCGACATGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGCCAGAGCAGTCGACATGTATAGTCTACATGAGATCAACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCCAGAGCAGTCGACATGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCAACATGATAGCCAGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGTCAGAGCCGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCAACATGATAGCCAGAGCAGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCTGTAGAGCAGTGAGATCGACATGATAGCCAGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCCAGAGCCGTCGACAGGTATAGTCTACATGAGATCAACATGAGATCTGTAGAGCAGTGAGATCGACATGATAGTC
Cases:
Controls: Associated SNP
Where should we lookWhere should we look??SNP= Single Nucleotide PolymorphismUsually SNPs are bi-allelic
![Page 7: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/7.jpg)
High-throughput genotyping technologiesallow for the genotyping of millions of variants for thousands of individuals
Genome-Wide Association StudiesGenome-Wide Association Studies
![Page 8: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/8.jpg)
Two minute genetic primer
• Recombining DNA:– Chromosome we get from each parent is mixture of both their
copies– Every base pair can have different inheritance history
• Non-recombining DNA:– Mitochondrial (mtDNA) maternally inherited– Most Y chromosome (NRY) in men paternally inherited
Non-recombining DNA has unique inheritance history. In particular, there is a unique mtDNA family tree and a unique NRY family tree on which we all sit:
NRY-Adam lived about 60K years ago in AfricamtDNA-Eve lived about 150K years ago in Africa
Trees
Inheritance
![Page 9: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/9.jpg)
My background: Ashkenazi Jewish on all sides
My family name: Rosset, Western-European non-Jewish sounding
Question: which is my paternal heritage story?
Answer: I belong to Y-haplogroup J2, which is very common among Jews, very rare in Western Europe
Confirms family story, family name still a mystery
Example of conclusion: my story
![Page 10: The Human Chromosomes](https://reader036.vdocument.in/reader036/viewer/2022081512/5681341f550346895d9b0b92/html5/thumbnails/10.jpg)
Example of conclusion: Genghis Khan’s Y?Investigating populations throughout East and Central
Asia, investigators discovered 8% of men had VERY closely related Y chromosome
Suggests common ancestor within 1000 yearsObvious candidate: Genghis Khan and his male
progenyVerifying conclusion:
1. This lineage had greatest diversity in Mongolia (indicates origin)
2. Had higher prevalence among Hazara in Pakistan, who have oral tradition of being Genghis Khan’s descendents