the ikaros gene encodes a family of functionally diverse zinc

MOLECULAR AND CELLULAR BIOLOGY, Dec. 1994, p. 8292-83030270-7306/94/$04.00+0Copyright ( 1994, American Society for Microbiology

The Ikaros Gene Encodes a Family of Functionally DiverseZinc Finger DNA-Binding Proteins

ARPAD MOLNAR AND KATIA GEORGOPOULOS*

Cutaneous Biology Research Center, Harvard Medical School, Massachusetts General Hospital,Charlestown, Massachusetts 02129

Received 3 June 1994/Returned for modification 20 July 1994/Accepted 16 September 1994

We previously described the lymphocyte-restricted Ikaros gene encoding a zinc finger DNA-binding proteinas a potential regulator of lymphocyte commitment and differentiation. Here, we report the isolation of fouradditional Ikaros transcripts, products of alternate splicing that encode functionally diverse proteins. TheIkaros proteins contain unique combinations of zinc finger modules that dictate their overall sequence

specificity and affinity. The Ik-i and Ik-2 proteins can both bind, albeit with different affinities, to the same

recognition sequences present in a number of lymphocyte-specific regulatory elements. The Ik-3 and the Ik-4proteins interact only with a subset of these motifs. The Ik-1 and Ik-2 proteins can strongly stimulatetranscription, whereas Ik-3 and Ik-4 are weak activators. Significantly, the transcription activation potentialof the Ikaros proteins correlates with their subcellular localization. Upon ectopic expression of the Ikarosisoforms in nonlymphoid cells, Ik-i and Ik-2 localize to the nucleus, whereas Ik-3 and Ik-4 are predominantlyfound in the cytoplasm. The Ikaros isoforms are expressed differentially in lymphocytes: Ik-i and Ik-2 mRNAsare the predominating forms, and Ik-4 is present in significant amounts only in early T-cell progenitors,whereas Ik-3 and Ik-5 transcripts are expressed at relatively low levels throughout lymphocyte development.The ability of the Ikaros gene to generate functionally diverse proteins that may participate in distinctregulatory pathways substantiates its role as a master regulator during lymphocyte development.

Transcription factors expressed in hemopoietic stem cells,responsible for mediating the complex and selective changes ingene expression that take place in these cells, can determinetheir differentiation potential and ultimate cell fate. Studies ofthe transcriptional mechanisms that regulate gene expressionin T and B cells have identified several nuclear factors that maycontrol early B-cell and T-cell development (9). Some of thesetranscription factors are tissue restricted in the adult (21, 25,44-46), but very few (1, 18, 33, 47) are expressed appropriatelyin the developing hemolymphopoietic system in the mouseembryo. Furthermore, the ability of some of these nuclearfactors to bind DNA and activate transcription requires ex-

pression of other lymphocyte-specific accessory proteins (23,44, 45).

In search of a master regulator for T-cell development, we

recently reported the characterization of a novel zinc fingerDNA-binding protein, expressed in early lymphocytes andmature T cells, encoded by the Ikaros gene (18). This nuclearfactor can function as a transcriptional activator when ex-

pressed ectopically in nonlymphoid cells and in the absence ofother tissue-restricted accessory proteins. Expression of IkarosmRNA is restricted at sites of both adult and embryoniclymphopoiesis. Outside the hemopoietic system, Ikaros mRNAis expressed in a small area in the developing corpus striatum.Given the ability of the Ikaros gene to function as an indepen-dent transcriptional activator and its restricted expression inthe embryo and in the adult, we have postulated that this geneplays a critical role in the development of the lymphocytelineage(s) (18). We have recently shown by gene targeting inthe mouse germ line that the Ikaros gene is an essential factorfor the development of all lymphoid lineages (16).

* Corresponding author. Mailing address: Cutaneous Biology Re-search Center, Harvard Medical School, Massachusetts General Hos-pital, Building 149, 13th St., Charlestown, MA 02129.

As an extension of our previous studies, here we describefour novel Ikaros cDNAs, products of alternate splicing,encoding proteins with distinct zinc finger composition. TheIkaros mRNAs are expressed at different amounts in thehemopoietic liver, the developing thymus, and the brain. TheIkaros proteins bind DNA with overlapping but overall distinctsequence specificities and affinities as determined by bindingsite selection, gel retardation, and chemical footprinting as-

says. The ability of these proteins to stimulate transcriptionfrom high-affinity binding sites and their subcellular localiza-tion were investigated and were found to differ dramatically.Natural target sites for the Ikaros proteins were identified bysequence homology in the regulatory domains of a number oflymphocyte-restricted genes and viral long terminal repeats.The potential of the Ikaros gene to control transcription froma range of lymphocyte-specific regulatory sequences with func-tionally distinct protein isoforms underscores its role as a

mediator of lymphocyte development.

MATERIALS AND METHODS

Cloning of Ikaros cDNAs. A mature mouse T-cell-EL4cDNA library made in X ZAPII was screened at high strin-gency with a 300-bp DNA fragment containing part of exon 7from the previously described Ikaros cDNA (18). Positiveclones were excised and further characterized by dideoxysequencing.

Expression studies during development. Embryonic tissueswere obtained from embryos harvested from time pregnantmothers (E14, E16, D1, obtained from TACONIC), and totalRNA was prepared. Two to five micrograms of total RNAprepared from the thymus, liver, brain, and spleen at differentstages of embryonic development was used to make cDNA byusing random hexamers and Superscript II reverse tran-scriptase (Gibco BRL). cDNA pools prepared from differentembryonic tissues were amplified for 25 cycles with the primers

8292

Vol. 14, No. 12

FUNCTIONALLY DIVERSE IKAROS PROTEINS 8293

TABLE 1. Oligonucleotides used as probes in the DNA binding studies

Probe Sequence

IK-BS1....TCAG.'l ' l ....'GGGAATACCCTGTCAIK-BS2....TCAGCl'lIT... .GGGAATCTCCTGTCAIK-BS3....TCAGC-l-l-l.1'GGGAATTCCCTGTCAIK-BS4....TCAGC'FlT'l.. . .GGGAATGTATTCCCTGTCAIK-BS5....TCAGC'lTlYl...GAGAATACCCTGTCAIK-BS6....TCAGCl'hI... .GGGATTACCCTGTCAIK-BS7.....TCAGCITITGGGAAAAACCTGTCAIK-BS8......TCAGCGGGGGGGAATACCCTGTCABA.....G'.l...TCCATGACATCATGATGGGGGT

1/2 (GCC TGT CCC TGA GGA CCT GTC/TCT GAG GCATAG AGC TCT TAC) and 3/4 (AGT AAT GTT AAA GTAGAG ACT CAG/CAT AGG GCA TGT CTG ACA GGC A)and were amplified for 30 cycles with the actin primers A/B(GAC GAG GCG CAG AGC AAG AGA GG/CTC TITGAT GTC ACG CAC GAT TTC). Amplification parameterswere 95°C for 5 min, with Taq polymerase added at 80°C,followed by 25 to 30 amplification cycles; each cycle entailed94°C for 45 s, 63°C for 1 min, and 72°C for 1 min. Productswere separated by agarose gel electrophoresis, excised, cloned,and sequenced to verify their origin. The 650-bp band detected(shown by asterisks in Fig. 2A and B) is an artifact of Ik-1 andIk-2 or Ik-1 and Ik-3 coamplification representing Ik-1/Ik-2and Ik-1/Ik-3 hybrid molecules. These species appear at signif-icant amounts at the later amplification cycles when the ratioof primers to Ik-1, Ik-2, and Ik-3 DNAs is decreased (alsodetected upon coamplification of Ik-1, Ik-2, and Ik-3 fromplasmids containing the respective cDNAs). The identity of thebands described above was confirmed by cloning and sequenc-ing (unpublished results). It is noteworthy that the 650-bpspecies was never cloned as a novel cDNA.

Bacterial expression of the Ikaros proteins. Recombinantglutathione S-transferase (GST) expression vectors harboringthe five Ikaros isoforms (Ik-1 to Ik-5); the truncated Ik-1, -2,and -3 lacking exon 7; and, the protein domain encoded byexon 7 were transformed in Escherichia coli DH5ca (40).Overnight cultures were diluted 1:10, grown for 1 to 2 h at37°C, and then induced for 3 h at 25°C with 2 mM IPTG(isopropyl-,-D-thiogalactopyranoside). Bacterial lysates wereprepared in MTPBS (150 mM NaCl, 16 mM Na2HPO4, 4 mMNaH2PO4 [pH 7.3]) and were partially purified on glutathioneagarose beads (Sigma). Fusion proteins Ik-1, Ik-2, Ik-3, Ik-4,Ik-5, Ik-1 (C terminus), Ik-2 (C terminus), Ik-3 (C terminus),and the C-terminal peptide were either left on the beads forbinding site selections or were eluted with a buffer containing20 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesul-fonic acid [pH 7.65]), 0.5 M NaCl, 20 mM glutathione, 100 mMKCl, 0.2 mM EDTA, and 20% glycerol. All buffers weresupplemented with 0.5% Triton X-100, 10 mM P2-mercapto-ethanol, 0.3 mM phenylmethylsulfonyl fluoride, 10 mM NaPPj,5 mM NaF, and 20 ,uM ZnCl. The bacterial NF-KB p50 proteinwas purchased from Promega, Inc.

Nuclear extracts. Nuclear extracts were prepared from theT-cell line ELM after 5 h of induction with 5 ,ug of phytohem-agglutinin and 50 ng of phorbol myristate acetate per ml aspreviously described (17).

Binding site selections. A 65-bp single-stranded oligonucle-otide composed of 25 bp of defined sequence at the 5' and 3'ends and 15 bp of random sequence in the middle (rpp6;GGGAGAATTCAACTGCCATCTAGGCNNNNNNNNNNNNNNNACACCGAGTCCAGAAGGATCCTACG) was syn-thesized. An oligonucleotide complementary to the defined

sequence of rpp6 was used to generate a pool of double-stranded labeled oligonucleotides by using the large fragmentof the DNA polymerase I. In the first round of selections,500,000 cpm of the purified double-stranded oligonucleotideswas used in a binding reaction with 20 ,ul of wet beadscontaining approximately 2.5 ,ug of the GST-Ikaros fusionproteins. The binding reaction was performed for 20 min onice, and then the beads were washed three times with a 10-foldexcess of binding buffer. After the third wash, bound oligonu-cleotides were eluted and PCR amplified in the presence of[a-32P]dCTP/dCTP with 25-bp oligonucleotides complemen-tary to the 5' and 3' defined sequences of rpp6. DNA templateswere denatured at 95°C for 5 min, Taq polymerase was addedat 80°C, and 20 amplification cycles were performed; each cycleentailed 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s. A finalcycle was performed for 5 min at 94°C, 2 min at 60°C, and 8min at 72°C. The amplified products were gel purified, and500,000 cpm was used in the next round of selection. Thepercentage of oligonucleotides bound to the Ik-1 beads in-creased from 0.4% in the first round of selection to 38% in thefifth round and did not increase further in subsequent roundsof selection. The percentage of oligonucleotides bound to theIk-2-GST and Ik-3-GST beads increased from 0.7 and 0.4% inthe first round of selection to 28 and 20%, respectively, in thesixth round of selection and did not increase further. Theselected Ik-1, Ik-2, and Ik-3 oligonucleotides from the fifth andsixth rounds were PCR amplified as previously described, gelpurified, digested with BamHI and EcoRI, and cloned into thepGEM3Z vector. Recombinant vectors were sequenced withnormal and reverse primers.DNA binding assays. DNA binding assays were performed

as previously described (18). The oligonucleotides used asprobes are shown in Table 1.

Antibodies. Antibodies raised against the C- and N-terminalregions of the Ikaros proteins were purified on protein Acolumns. NF-KB p50 and p65 antibodies were purchased fromSanta Cruz Biotech, Inc. The pancornulin antibody was a giftfrom Mary-Anne Greco.

Methylation interference. Footprinting of the Ik-1-, Ik-2-,Ik-3-, and Ik-4-GST fusion proteins on the IK-BS2 oligonucle-otide by methylation interference was performed as previouslydescribed (17).

Scanning densitometry. The relative amounts of Ik-1, Ik-2,Ik-3, and Ik-4 protein-DNA complexes were estimated aftershort film exposures of the respective gels were measured on acomputing densitometer (Molecular Dynamics).

Transfections. The thymidine kinase-chloramphenicol acetyl-transferase (tkCAT) reporter gene was placed under thecontrol of four sense tandem copies of the binding sitesIK-BS1, IK-BS2, and IK-BS7. Reporter plasmids were cotrans-fected with the CDM8-Ikaros 1 to CDM8-Ikaros 4 recombi-nant expression vectors and the pxGH5 plasmid at ratios of

VOL. 14, 1994

8294 MOLNAR AND GEORGOPOULOS

7 Exl2 V Ex3MDVDEGQDMS QVSGKESPPV SDTPDEGDEP MPVPEDLSTT SGAQQNSKSD RGMASNVKVE TQSDEENGRA CEMNGEECAE DLRMLDASGE

KMNGSHRDQG SSALSGVGGI RLPNGKLACD ICGTVCIGPN RSAT GERPF E GASFTOKGNL TRHTKTHdSGE KPF

KCRRRDALTC; HL uSVGKP H&GYCGRSY KORSSLEEHK ERCHNYLESM GLPGMYPVIK EETNHNEMAE DLCKIGAERS LVLDRLASNV'VEx7

AKRKSSMPQK FLGDKCLSDM PYDSANYEKE DMMTSHVMDQ AINNAINYLG AESLRPLVQT PPGSSEVVPV ISSMYQLHKP PSDGPPRSNH

SAQDAVDNLL LLSKAKSVSS EREASPSNSC QDSTDTESNA EEQRSGLIYL TNHINPHARN GLALKEEQRA YEVLRAASEN SQDAFRVWST

SGEQLKVYIEE1CRMEZVY GCHGFRDPFE tNMCGYHSOD RYEFSSHITR GEHkYHLS

F1 CDICGIVCIGPNVLMVHKRSHF2 CNQCGASFTQKGNLLRHIKLHF3 CHLCNYACRRRDALTGHLRTH14 CGYCGRSYKQRSSLEEHKERCHF5 CEHCRVLFLDHVMYTIHMGCHF6 CNMCGYHSQDRYEFSSHITRGEH

F1 F2 F3 F1

Ikaros 1

F5 F6

_i0 \ >mIILFsIhZ1/2 B3 W X5 Z6 V

Ikaros 2 _6 -g

Ikaros 3

Ikaros 4

Ikaros 5

FIG. 1. Predicted amino acid sequence of the Ikaros 1 cDNA and diagrammatic representation of the five Ikaros isoforms. Arrowheads displaythe splicing junctions, and shaded boxes indicate the exon usage (E1/2 and E3 to E7) by the Ik-1 to Ik-5 isoforms. The six Cys-2-His-2 zinc fingermodules present in the Ikaros proteins are aligned, and the Cys-His residues are shown in boldface. The finger modules (F1, F2, F3, F4, F5, andF6) are also shown as perpendicular boxes relative to the encoding exons.

1:0.25:1. Transfections were performed in the NIH 3T3 fibro-blast cell line by the calcium phosphate method as previouslydescribed (17). Each transfection was performed in duplicateor triplicate, and the average of four experiments is shown.Cell lysates were corrected for protein concentration with amini-Bradford assay (Bio-Rad) before proteins were utilized inCAT assays.

Microinjection and immunofluorescence. Mouse fibroblastNIH 3T3 cells were grown on glass coverslips and were madequiescent by serum deprivation. The arrested cells were re-leased from starvation by serum addition and microinjectedwith the CDM8-Ikaros expression vectors described above.Cells were injected in a 3.5-cm-diameter petri dish with anautomated microinjection system (AIS; Zeiss [2]) at a pressureof between 80 and 170 hPa. The computer settings were asfollows: angle, 450; speed, 10; and time, 0.0 s. Plasmid DNAwas purified twice on a CsCl gradient and extracted twice withphenol and chloroform and injected at 50-, 100-, and 200-,ug/ml concentrations. At 7.5 h after restimulation, when 95%of the population was in G1, the cells were fixed with a cold(-20°C) solution of 50% methanol-50% acetone and pro-cessed for immunofluorescence (34).

Antibodies were diluted in Dulbecco's modified Eagle'smedium containing 10% fetal calf serum. Coverslips wereincubated with affinity-purified N-terminal Ikaros antibodydiluted to 1:20 for 1 h. Biotinylated goat anti-rabbit antibodydiluted to 1:50 (Jackson Laboratories) was used as secondaryantibody, followed by fluorescein isothiocyanate-conjugatedstreptavidin (Jackson Laboratories [diluted to 1:50]) staining.All reactions were carried out at room temperature in ahumidified chamber. Between each step, the cells were washedthree times with phosphate-buffered saline (PBS). The cellswere counterstained with bisbenzimide (Hoechst 33258) for 2min at 1 [Lg/ml in PBS. Coverslips were mounted in 95%

glycerol-5% PBS and visualized on a Zeiss Axiovert 100photomicroscope with a Plan-Neofluar 40X lens.

RESULTS

Exon compositions of Ikaros isoforms. Four novel cDNAs,products of differential splicing of Ikaros gene transcripts, wereisolated by using a 300-bp fragment from the 3' end of thepreviously characterized Ikaros Ik-2 cDNA (see reference 18and Materials and Methods). All of these Ikaros transcriptsshare exons 1/2 and 7, with the latter exon encoding the twoC-terminal zinc finger motifs (Fig. 1 and reference 16). How-ever, distinct combinations of exons 3 through 6 are found inthe five Ikaros isoforms, which encode the N-terminal zincfingers. The N- and the C-terminal zinc fingers of the Ikarosproteins display strong similarity to the Cys-2-His-2 zinc fingermotif (35). The only deviation from this zinc finger consensusis the substitution of a cysteine or a tyrosine residue present infingers F1, F3, F4, and F5 for a conserved phenylalanine (Fig.1). The Ik-I cDNA (Fig. 1) contains exons 1 through 7 andencodes the largest of the five proteins. The translated Ik-1protein is 57.5 kDa, with four Cys-2-His-2 zinc fingers at its Nterminus (Fl, F2, F3, and F4) and two at its C terminus (F5and F6). This protein shows the strongest similarity in organi-zation to the Drosophila melanogaster segmentation geneHunchback (42). The Ik-2 and Ik-3 proteins are 48 kDa in sizeand share two of their three N-terminal zinc fingers (F2 andF3). These shared finger motifs are also present in the43.5-kDa Ik-4 protein. The smallest of the five isoformsencodes the 42-kDa Ik-5 protein with only one zinc fingermodule at its N terminus (Fl). Finally, all of these isoformsshare the two zinc fingers at their C termini (F5 and F6).

Expression of Ikaros proteins during embryonic develop-ment. The pattern of expression of the Ikaros isoforms was

MOL. CELL. BIOL.


A. 1IK-1/IK-2A1K-4

Brain Liver Thymus Spleen:14E16V If V14 E16DI E14E16 DI Di -

IK-1 -_* _

IK-2 -_IK-4 _

IK-1* _Mo

IK-3 -_

IK-5 -_

Actin -_

B. IK.IJIK-311K-5

C. P-actin

D.

2 4

Ofigol/2 IK-1/IK-2/1K-4

Ofigo3/4 IK-IIIK-3/11IK-5

FIG. 2. Embryonic and postnatal expression of Ik-1 through Ik-5isoforms. (A) cDNA products from the Ik-1, Ik-2, and Ik-4 mRNAswere coamplified with primer set 1/2 as 720-, 457-, and 335-bp bands.(B) The Ik-1, Ik-3, and Ik-5 cDNAs were coamplified with primer set3/4 as 715-, 458-, and 293-bp bands. (C) To account for possible cDNAvariability in different samples, P-actin was also amplified by usingf3-actin primers A and B from the same pools of cDNAs. Arrowsindicate amplified cDNA products at different gestation times. The650-bp DNA detected (indicated by asterisks in panels A and B) is anartifact of Ik-1 and Ik-2 or Ik-1 and Ik-3 coamplification representingIk-1/Ik-2 and Ik-1/Ik-3 hybrid molecules (see Materials and Methods).(D) The positions of primers 1/2 and 3/4 used in PCR are shown in a

diagram of Ik-1 cDNA.

determined at sites of embryonic and postnatal lymphopoiesisand in the developing brain. Two sets of primers (1/2 and 3/4in Fig. 2D) flanking the junctions of the Ikaros exons 2/3 and6/7 were used to amplify the five cDNAs as distinctly sizedbands from embryonic and postnatal tissues (Fig. 2A and B). Athird set of primers complementary to the ,B-actin cDNA wasused to determine the amount of cDNA used in the reactionmixtures (Fig. 2C). Primers 1/2 amplified fragments 720, 457,and 335 bp in size, which correspond to the expected productsfrom the Ik-1, Ik-2, and Ik-4 cDNAs, respectively (Fig. 2A).The second set of primers, 3/4, amplified fragments 715, 458,and 293 bp in size that correlate with 1k-i, Ik-3, and Ik-5cDNAs, respectively (Fig. 2B). To estimate the relative expres-sion of the five isoforms in the various tissues during develop-ment, 25 amplification cycles, which give proportional repre-sentation of the Ikaros cDNA products, were performed (datanot shown).During embryonic development, the five Ikaros mRNAs

were differentially expressed at hemopoietic centers and in thebrain (Fig. 2). The Ik-1 and Ik-2 mRNAs were abundantlyexpressed in the early fetal liver, the maturing thymus, and thepostnatal spleen. In addition, PCR products corresponding tothe Ik-1, Ik-2, and Ik-4 cDNAs were readily amplified fromminimal amounts of total cDNA prepared from the earlythymus, suggesting that these three isoforms were present athigh levels in this center for T-cell development (Fig. 2A andC [compare expression of Ikaros cDNAs in the day 14 thymusrelative to that of the actin control]). However, the relativeamounts of Ik-4 mRNA compared with that of 1k-1 and Ik-2varied during development. The concentration of the Ik-4transcript, low relative to that of the Ik-1 and Ik-2 in the earlyfetal liver, became comparable to that of these isoforms at theend of mid-gestation (Fig. 2A and C [Ik-4 in liver E14-E16]).This equalization was due to a decrease in the expression of thelatter two mRNAs rather than an increase in the expression ofthe Ik-4 transcript. In the embryonic day 14 thymus, the Ik-4isoform was expressed at similar if not higher levels than theIk-1 and Ik-2 mRNAs, but its expression declined during latemid-gestation (Fig. 2A and C [Ik-4 in the E16-Dl thymus]).The pattern of expression of Ik-1, Ik-2, and Ik-4 mRNAsdetected in the day 16 embryonic thymus persisted past birth inthis organ, in contrast to liver expression, which was switchedoff in the neonate. Ik-1 and Ik-2 but not Ik-4 mRNAs werereadily detectable in the spleen of the neonate. Ik-3 mRNAwas also expressed during embryonic development, but at lowlevels relative to the Ik-1 and Ik-2 isoforms (Ik-3 in Fig. 2B).Finally, the Ik-5 transcript present at very low amounts in thedeveloping lymphocyte was readily seen after a higher numberof amplification cycles (Ik-5 in Fig. 2B and data not shown).The five Ikaros mRNAs were also expressed in the develop-

ing brain; Ik-1 was the most abundant, with Ik-2, Ik-4, Ik-3, andIk-5 isoforms following in decreasing levels. The decrease inIkaros gene expression in the brain from mid-gestation to day1 probably reflects its restriction to a discrete cellular compart-ment in this growing organ (Fig. 2A and B [brain E14-E16 andreference 18]). In the neonatal brain, only Ik-1, the mostabundant of the Ikaros isoforms, was readily detected (Fig. 2Aand B [brain D1]).These data substantiate our previous in situ hybridization

studies performed with an RNA probe derived from exon 7and shared by all Ikaros cDNAs (18). These studies documentexpression of the Ikaros isoforms on the whole population ofcells residing in these embryonic and newborn hemopoieticcenters at different stages in development. However, theirexpression may differ substantially among subpopulations ofstem cell progenitors and their differentiated progeny.

Binding site selections for the Ik-1, Ik-2, and Ik-3 isoforms.To determine whether the differential usage of zinc fingermodules by the five Ikaros proteins contributes to their DNAbinding specificity, we cloned high-affinity binding sites byusing a binding site selection assay (5, 37). Of the five Ikarosisoforms, the Ik-1, Ik-2, and Ik-3 proteins fused to GST wereeffectively selected for binding sites after five and six rounds ofselection, respectively. Oligomers selected by Ik-1, Ik-2, andIk-3 proteins as high-affinity binding sites were cloned, se-quenced, and aligned to the conserved core motif T-G-G-G-A-A. The positional frequencies determined for the core andflanking sequences selected by the Ikaros proteins are N-N-T-T-G-G-G-A-A-T-A/g-C-C for Ik-1, N-N-T-T-G-G-G-A-A/t-N-N-C for Ik-2, and T-N-C/t-T-G-G-G-A-A-T-A-C-C for Ik-3(Fig. 3). Note that bases selected with a frequency higher than60% are shown in boldface, bases with a frequency of between40 and 60% are shown as capital letters, and bases with a

VOL. 14, 1994

I


Ik.1

Ik-2

N N T T G G G A A T A/g C C

-3 -1 -2 1 2 3 4 5 6 7 8 9 10

G 7 0 71 22 24 240028 2 3

A 7 6 32 2 0 0 24 22311 3 3

T 5 9 11 15000 0 2 153 6 4

C 5 9 3 6 0 0 0 0 0 4 2 13 14

% N N 46 62 91 100 1001009162 46 54 58/33

N N T T

-3 -2 -1 1G 12 7 7 0

A 9 11 5 6

T 5 13 17 20

C 10 5 7 10

G G G A A/t N N C

2 3 4 5 6 78 930 36 36 0 1 6 9 5

6 0 0 36 18 10 12 9

0 0 0 0 12 13 7 4

0 0 0 0 5 7 8 18

% N N 47 55 83 100 100 100 50 N N 50/33

Ik-3 T N

-3 -2G 7 5

A 3 8

T 15 4

C 0 8

% 0 N

C/t T G G G A A T A C C-1 1 2 3 45 6 7 8 9 103 0 20 25 25 0 0 0 5 0 0

0 6 5 0 0 25 25 0 16 1 1

9 14 0 0 0 0 0 18 4 6 7

13 5 0 0 0 0 0 7 0 18 17

52 56 80 100 100 100 100 72 64 72 68/36

FIG. 3. Oligonucleotides selected by the Ik-1, Ik-2, and Ik-3 pro-

teins. Sequences of oligonucleotides interacting with the Ik-1, Ik-2, andIk-3 proteins are shown after five and six rounds of selection. Theputative recognition sequences for Ik-1, Ik-2, and Ik-3 are shown,together with positional frequencies calculated after alignment of 24,36, and 25 selected oligonucleotides, respectively. Within this consen-

sus motif, bases selected with a frequency higher than 60% are shownin boldface, those with a frequency between 40 and 60% are shown incapital letters, and those with a frequency of between 30 and 40% are

shown in lowercase letters. Positions with no base conservation are

shown as N.

frequency of between 30 and 40% are shown as lowercaseletters.

Because the Ikaros proteins can bind these potential recog-nition sites in a number of ways, we have performed selectionswith the isolated N- and C-terminal DNA binding domains toaddress this issue. GST fusions of proteins derived from theIk-1, Ik-2, and Ik-3 isoforms lacking the C-terminal partencoded by exon 7, as well as a GST fusion to this C-terminaldomain, were used independently in binding site selection. Thetruncated Ik-1 (containing F1, F2, F3, and F4), Ik-2 (contain-ing F2, F3, and F4), and Ik-3 (containing F1, F2, and F3)proteins after 4, 6, and 7 rounds of selection, respectively,bound to a significant amount of the selected pool of oligonu-cleotides (data not shown). Analysis of a limited number ofcloned oligonucleotides revealed a core consensus similar tothe one selected by their full-length counterparts (data notshown). In contrast to these truncated proteins, the C-terminaldomain (containing F5 and F6) present in all of the Ikarosproteins did not appear to bind to any significant proportion ofthe oligonucleotide pool and to select for any specific se-

quences (data not shown). We can therefore conclude that theN-terminal fingers of the Ikaros proteins are predominantlyinvolved in the selection of the core consensus sequencedescribed above.Of the oligonucleotides selected by the different Ikaros

proteins, a range of 44 to 56% contained a second relatedconsensus motif (data not shown). Such double-recognitionsequences were also selected by the truncated Ikaros proteins(which lack the C-terminal finger domain), suggesting theinteraction between their N-terminal finger domain and thesesequences. Therefore, interactions between the Ikaros proteins

and DNA may be influenced by the existence of additionalbinding sites present in close proximity.

Binding specificity of Ik-1, Ik-2, Ik-3, Ik-4, and Ik-5. Thebinding specificity of the five Ikaros proteins for the selectedcore motifs was tested in a gel retardation assay. A 24-bpoligonucleotide (IK-BS1; T-C-A-G-C-T-T-T-T-G-G-G-A-A-T-A-C-C-C-T-G-T-C-A) designed to accommodate the sequencerequirements of the three proteins used in the selection wastested in a gel retardation assay against equal amounts of thefive Ikaros isoforms produced in bacteria as GST fusions. TheIkaros proteins interacted with the IK-BS1 site differentially;Ik-1 was the strongest binder, while Ik-2 and Ik-3 bound to thissequence with relatively lower affinities (Fig. 4). (Note thatscanning densitometry determined that the relative amounts ofIk-2 and Ik-3 complexes on the IK-BS1 DNA were 3.4- and1.7-fold lower than that of the Ik-1 complex.) The Ik-4 and Ik-5proteins did not bind to this sequence. The presence of onlyone or two zinc fingers at the N-terminal finger domain ofthese proteins was not sufficient for a high-affinity interactionwith this binding site.

Given the number of potential double-recognition sitesselected by the Ikaros proteins, an oligonucleotide containingan inverted repeat of their core consensus was tested (GGGAAT in Fig. 4 [IK-BS4]). Four of the five Ikaros proteins,including Ik-4, were bound to this sequence with high affinity.In contrast to their widely distinct binding affinities for a singlerecognition sequence, these Ikaros isoforms appeared to inter-act similarly with this double-recognition site. Significantly, therelative abundance of the Ik-2 protein complex on the palin-dromic IK-BS4 sequence was 6.3-fold higher than that on theIK-BS1 single-recognition site, and its mobility was slower andindicative of a potential higher-order complex. In addition, theIk-4 protein, which did not bind to IK-BS1, bound to thepalindromic sequence with high affinity. This strongly suggestscooperative binding of Ik-4 and possibly of Ik-2 proteins onproximal binding sites. The relative binding affinities of Ik-1and Ik-3 were also enhanced but to a lesser extent (2.3- and3.5-fold, respectively).To determine whether the high-affinity binding of the Ik-2

and Ik-4 proteins on IK-BS4 was due to an increase in the localconcentration of binding sites or whether this was mediated byprotein-protein interactions, we decreased the spacing be-tween the two half-sites to allow only for single-site occupancy.The Ik-1, Ik-2, and Ik-3 proteins bound with similar affinities tothe single site in the IK-BS1 oligomer, as they did to theIK-BS3 oligonucleotide, which contains two inverted andpartially overlapping core motifs (Fig. 4 [IK-BS3]). The Ik-4protein did not bind to IK-BS3, strongly implicating coopera-tive binding on proximal and appropriately spaced bindingsites (Fig. 4 [IK-BS3]).The Ikaros heptanucleotide core motif displays strong se-

quence similarities with a subset of NF-KB sites {Table 2(NF-KB sites in the interleukin 2 receptor ot [IL-2Ra] pro-moter H2-K", and beta interferon promoters) (3, 6, 31)}. TheNF-KB recognition sequence is an imperfect palindrome with acertain degree of base pair variation in the middle of the motif.These sequences bind with high-affinity homo- and het-erodimeric complexes formed between members of the NF-KB/Rel family (29). The IK-BS2 oligonucleotide, which con-tains an Ikaros consensus sequence in the context of theIL2-Rot promoter NF-KB site, was tested for binding the Ikarosproteins. The Ik-1 and Ik-2 proteins bound to the IK-BS2 withaffinities similar to those shown for the selected IK-BS1oligonucleotide. However, binding of the Ik-3 isoform to thissite was greatly reduced, probably because of a nonconserva-tive base pair substitution at position 8 of its consensus motif

MOL. CELL. BIOL.


IK-BS1 IK-BS2

H XI.- ;H H H H R H H H H

IK-BS3 IK-BS4 IK-BS5r4 i ow Un E.4 1r H v in .i41 H n -

H s EaI EI4I1Ito md MC MX mMX A MAX M MMX Xa H H H H H C R H H H H e H H H H H

IK-BS6 IK-BS7RH H v H H Hm HR H H H H H H

H H H FS H C. H H~ H1 H Hu

IK-BSB OA

Hd M Ml M H M MI M M HEe H H H H 1, HHH H 0ol

I w IMoI

Ik-BS1 7CAGCT:TTGGGAATACCCTGTCA.-7CGAAAACCCTTATGCGACAGT

Ik-BS2 -CAGCT7TTGGGAATc tCC7GT-CAAGTCGAAAACCCTTAgaAGGcAGT

Ik-BS3 TCAGCTTTTGGGAATtCCCTG-TCA.AtGTCGAAAACCCTTAaGGGACAGT

Ik-BS4 CAGCTTTGGGAATgiattCCCTGTCAACT-CGAAAACCCTTAcat aaGGGACAGT

Ik-BS5 CCAGCTTTTGaGAATACCCTGTCAr.GTCGAAAACtCTTATGGGACAGT

Ik-BS6 TCAGCTTTTGGGAtTACCcCTG:-CAAGTCGAAAACCCTaATGG CAG

Ik-BS7 TCAGCTTTTGGGAAaaaCCG?-CAAGTCGAAAACCCTTt ttGGACAGT

Ik-BS8 TCAGCggggGGGAATACCC .talCs.AGTCGccccCCCTTATGGG:ARCAGT

bA ;GTTTCCATGACATCAGATJGGGGGTCAAAGGTACTGTAGTACTACCCCCA

FIG. 4. The five Ikaros proteins bind DNA with differential specificity. The DNA binding specificity of the Ikaros proteins (Ik-1 through Ik-5)was determined with oligonucleotides containing the selected recognition sequence and variations of a common recognition sequence (IK-BS1 toIK-BS8 and 5A [see Materials and Methods]). The sequences of the oligomers used in the gel retardation assays are shown. The core recognitionsequence on the positive strand and related motifs on the negative strand are shown in boldface. The fusion partner of the bacterially expressedIkaros proteins, GST, was run in parallel.

(Fig. 3 and 4 [IK-BS2]). Interestingly, the Ik-4 protein, whichbound only to the palindromic sequence in the IK-BS4 oligo-nucleotide, also bound to the IK-BS2 oligonucleotide. This isprobably due to the presence of a related consensus motif on

the bottom strand of this oligonucleotide which creates animperfect palindrome (Fig. 4 [IK-BS2, boldface sequence]). Ahigher-order binding complex was again observed between theIk-2 protein and the IK-BS2 oligonucleotide (Fig. 4 [IK-BS2]).The IK-BS5 oligonucleotide, with a base pair substitution

within the core consensus, was tested for its ability to interactwith the Ikaros proteins (Fig. 4 [IK-BS5]). A single-base-pairchange at position 3 of the consensus, which substituted anadenine for the conserved guanine, abrogated binding of theIkaros proteins, underscoring the importance of this conservedresidue. Substitution of a thymidine for an adenine at position6 (Fig. 4 [IK-BS6]) in the selected consensus prevented bindingof the Ik-3 and Ik-4 proteins and decreased the relative affinityof the Ik-1 isoform by two- to threefold. However, there was noeffect on the binding of the Ik-2 protein that selected for eitherbase at this position with similar frequency (Fig. 4 [IK-BS6]).Nonconservative substitutions at the 3' end of the Ik-1/-3decanucleotide consensus abolished Ik-3 and Ik-4 binding andreduced the affinity of the Ik-1 protein but did not significantlyaffect the Ik-2-DNA interactions (Fig. 4 [IK-BS7]). Neverthe-less, substitution of four guanines for the thymidines at the 5'end of the core consensus had a negative effect on the bindingof all Ikaros proteins (Fig. 4 [IK-BS8]).Of the Ikaros isoforms, only Ik-5 with a single N-terminal

zinc finger did not bind to any of the oligomers tested,including the ones that contained a double-recognition site.However, we had previously shown that the C-terminal finger

domain could bind to the BA element of the CD3-8 enhancerin a sequence-specific manner (Fig. 4 [8A] and reference 18).Consequently, we tested binding of the Ikaros isoforms to the8A motif. Two sequence-specific binding complexes wereformed with the Ik-1, Ik-2, and Ik-3 proteins that differedsubstantially in their relative abundance (Fig. 4 [8A]). Thespecificity of the Ikaros-8A complexes was confirmed in com-petition experiments (reference 18 and data not shown). Onlythe more swiftly migrating complex was detected with the Ik-4and Ik-5 proteins. Formation of this complex on the BAelement may involve the C-terminal finger domain present inall of the Ikaros proteins. The Ik-5 isoform in particular, withonly one finger at its N-terminal domain, may primarily utilizethese C-terminal fingers for sequence-specific DNA binding(35). However, these C-terminal zinc fingers were not able toselect for any sequence motif in the binding site selectionsdescribed previously. This may be due to low-affinity protein-DNA interactions, which do not stand up to the stringency ofthe selection assays, and may also reflect a complexity in theDNA binding site not accommodated by the size of the randomsequence in selecting oligonucleotides.

In conclusion, the DNA binding specificity and affinity of anIkaros protein with two or more fingers at its N-terminal partare primarily dictated by these N-terminal fingers.Chemical footprinting of 1k-1 to Ik-4 on their cognate sites.

The DNA binding specificity of the Ik-1 to Ik-4 proteins andtheir base pair contacts was further investigated with a chem-ical footprinting assay. The IK-BS2/IL-2Ra NF-KB oligonucle-otide (TCAGCTTTTGGI AATCMIGTCA) that binds allfour isoforms was used in a methylation interference assay(Fig. 5). On the positive strand, all four proteins gave similar

w W :W

VOL. 14, 1994

&a

0

.. A-


+ strand -strand

r-1 "'--TIt~ ~1 -

- _-___im __~ _

_ v,,-of

A --

A -_-

G;---

C;G; _0a

h e.* c;

Al

i 4 6, -

Ik-2 * *Ik-1/3/4 . .

-6-5-4-3-2 -1 2 3 4 5 6 7 9 11112

+ TCAGCTTT GGGAATCTCCTGTC- AGTCGAAAACCCTTAGAGGACAG

Ik-I 0 0

Ik-2 a

Ik-3Ik-4

FIG. 5. Distinct base contacts made by the Ikaros proteins on a

common recognition site. The IK-BS2 oligonucleotide containing theIL-2Rc/NF-KB site and involved in complex formation with four of theIkaros proteins (Fig. 4 [interactions of Ik-1 to Ik-4 with IK-BS2]) wasused to establish their base contacts. Methylated DNA was end labeledeither on the positive or the negative strand and was used in mobilityshift assays. Retarded protein-DNA complexes were excised, andDNA was isolated, cleaved with NaOH, and run on a 15% denaturingacrylamide gel. DNA migrating at the front was isolated and treated inparallel to establish the cleavage pattern of free methylated DNA (-).Arrows point to the bases whose methylation interferes with protein-DNA complex formation. The identity of the base pair is shown nextto the arrows. A summary of the base pair contacts made by proteinsIk-1 to Ik-4 on the IK-BS2 site is given at the bottom of the figure.Solid and open circles indicating full and partial interference, respec-tively.

footprints. Methylation of the three guanines at positions 2, 3,and 4 of the consensus interfered 100% with the binding of allfour proteins. The Ik-2 protein made an additional majorgroove contact with the adenine at position 5 and the guanineat position -5. Methylation of adenines at positions 5 and 6enhanced binding of Ik-3 and Ik-2, respectively (Fig. 5 [en-hancement of AS and A6 bands on the positive strand of theIk-3 and Ik-2 ladder]). However, on the negative strand, thefour proteins made dramatically different contacts. The mostextended footprint was that of Ik-4, which covered the purinesfrom positions 8 through 12, while the Ik-3 protein madecontact with bases at positions 7 through 10. The Ik-1 and Ik-2proteins made only one full contact with the guanine atposition 10, while Ik-1 also made partial contact with thepurines at positions 7 through 9 (Fig. 5).Of the three proteins used in the selections, Ik-3, with the

strictest consensus, made the most base pair contacts on thenegative strand. The overall footprint made by this proteinsuggests extensive interactions between fingers 1, 2, and 3 with8 of the 10 bases of its recognition site (Fig. 5 [Ik-3]). On the

same recognition site, the Ik-2 protein made only six basecontacts, suggesting limited interaction between finger 4 andDNA (Fig. 5 [Ik-2]). Surprisingly, the Ik-1 protein containingfingers 1, 2, 3, and 4 made fewer full-base-pair contacts thanthe Ik-3 protein with fingers 1, 2, and 3. This suggests that theadditional finger 4 present in Ik-1 may influence the ability ofthe other fingers, especially that of finger 1, to interact withDNA, perhaps by dictating a different overall protein confor-mation. Finally, the extensive and qualitatively distinct foot-print made by the Ik-4 protein supports the cooperativeoccupancy of close proximity recognition sites by this isoform.The methylation interference data clearly demonstrate that thefour Ikaros proteins make distinct base pair contacts and bindDNA differently.

Target sites for the Ikaros proteins in lymphoid-restrictedregulatory domains. Because we were interested in identifyingtarget genes amenable to transcriptional control by the Ikarosproteins, we searched for potential Ikaros binding sites in theenhancer and promoter regions of lymphocyte-restrictedgenes.The core motif G-G-G-A-A selected by the Ikaros proteins

was found frequently in the regulatory domains of the mem-bers of the T-cell receptor (TCR) antigen complex, i.e., theTCR-ot, -I, and -8 genes and the CD3-8, -£, and -y genes(Table 2 [sequence motifs in boldface]). These sequencesrepresent high-affinity binding sites as determined by gelretardation assays (data not shown). The multiplicity and oftenthe proximity of potential high-affinity binding sites in theregulatory domains of these genes were striking (Table 2).Some of these sites can bind all four proteins, while others caninteract only with the Ik-1 and Ik-2 isoforms (32a). High-affinity binding sites for the Ikaros proteins were also found inthe promoters of the costimulatory T-cell differentiation anti-gens CD4 and CD2, in the early pre-B-cell differentiationantigen mb-i (22), and also in the NF-KB motifs present in thepromoter of the IL2-Ra, in the PRDII element of the betainterferon gene (31), in the enhancer of the H-2Kb gene (3),and in the E-Ad promoter (30). Four of the Ikaros proteins canbind with high affinity to these NF-KB sites (Fig. 4 [IK-BS2]and unpublished results).

Sequences related to the Ikaros recognition motif (Table 2[underlined bases]) were also found in the regulatory domainsdescribed above as well as in the purine boxes of the IL-2 gene(11, 39), the promoter of the TDT gene (32, 39a), and in thehuman immunodeficiency virus long terminal repeat (14).However, single sites containing these related sequences donot bind the Ikaros proteins very well (data not shown).Nevertheless, when these sites are present in multiplicity andproximity in a given regulatory domain, they may be occupiedby the Ikaros proteins. This is clearly the case with the CD3-8Aelement, which is composed of two low-affinity binding sites. Inaddition, the topographical arrangement of high- and low-affinity Ikaros binding sites in a given regulatory domain maycontrol the overall affinity of this locus for the Ikaros proteins.Occupancy of these complex sites by the Ikaros proteins maydictate the sequential activation of their respective target genesduring lymphocyte development.

Transcriptional activity and subcellular localization of theIkaros proteins. The ability of the Ikaros proteins to activatetranscription from a promoter juxtaposed with tandem copiesof low- or high-affinity binding sites was tested in transientexpression assays. Reporter genes under the control of fourcopies of the IK-BS1, IK-BS2, or IK-BS7 sites were cotrans-fected with plasmids expressing each of the four Ikaros cDNAsin NIH 3T3 fibroblast cells. Expression of Ik-1 increased theactivity of the tkCAT gene under the control of the high-

MOL. CELL. BIOL.

a * *


Regulatory domain

TCR-a enhancer, m

TCR-1Enhancerhmhhmmmmmmh/m

Promoter, m

TCR-8 enhancerBE5/mBE3/m

TABLE 2. Ikaros binding sites in lymphocyte-specific regulatory domains

Region

TGGAGGGAAGTGGGAAACTYIT, TGGAAGTGGGAGGC, GAGGAGAAAGGTCTCCTAC

AACAGGGAAACAGTCAGGGAACAGGAAGGTGGGAAGTAAGGTAGGAAIGGGGAGGGGGAAGAAAGTGGGGAAATCTGGTCAGGGAAACAATGGGGGAAGGGGTGGAAGT'TTTGGGAACCAAAGGGGAACCCTGGAGGGAGAGGGGAAA, TFITGGGAATT, TGAGAGGAAGAGGAGA, CA.GGAATT

AAGiAAACCAAAACAGGGGAAGT'IGGAAACCT

CD3-8 enhancer, BA/h/m

CD3--yb promoter, m

CD3-e enhancer, m

CD4 promoter, m

CD2 promoter, m

IL-2 enhancerPuBpPuBd (NFAT-1)

GTTTCCATGACATCATGAATjGGAGT, G'llCCATGATGTCATGAATGGGG£I, TTrCI .GGGGATTG

GGAGGAACT, T'fTGGGATG, TTCTAGGAAGTAAGGGAAT'll, GTGGGAAGA,TAGGAATTCT, TAAGQGAAAGG, T'lCCAAGTGGGAATC

TGGGACACAGAlllCA, TGGGGAAGTGAAGGAGGGAGG, GAGGGGGATCTGGGGAAGTT

TTGGGAAGGAT

AAGGAACA

AAGAGGAAAAAGGAGGAAAA

CAAGGGAATmb-i promoter/EBF

TDT promoter/LYF TGGGAG

CAGGGGAATCTCCCTCTCCATNF-KB

IL-2Ra promoter, h

Beta interferon (PRDII)

Major histocompatibility complex class II, m

Human immunodeficiency virus longterminal repeat

GGGAAATCC

GGGGAATCCC

CAGGGAAGTA

CAAGGGAOMl'CGCTGGGGAC1TTCAGGGAGGCG

a Potential high-affinity binding sites for the Ikaros proteins present in the regulatory sequences of the genes of the TCR complex, other T-cell (CD2, CD4, LYF,IL-2) and B-cell (LYF, mb-1) differentiation antigens, and in the human immunodeficiency virus long terminal repeat and the promoters of beta interferon and classII major histocompatibility complex (whose gene expression is modulated in lymphocytes upon activation) are shown in boldface. Related sequences present in theregulatory domains are underlined. For more detail, see references 8, 11, 14, 15, 20, 22, 24, 32, 38, 39, and 43. m, mouse, h, human.

affinity binding sites IK-BS1 and IK-BS2 by 11- and 19-fold,respectively, but stimulated the activity of this reporter geneunder the control of the lower-affinity binding site IK-BS7 byonly 3.3-fold (Fig. 6). Expression of the Ik-2 protein increasedthe activity of the IK-BS2 reporter gene by 11-fold but onlystimulated the activity of the IK-BS1 and IK-BS7 reportergenes by 2- to 3-fold (Fig. 6). However, the affinity of Ik-2 forthe binding sites in the three reporter plasmids was similar. It

is noteworthy that a higher-order Ik-2 binding complex wasonly detected on the IK-BS2 oligonucleotide.

Binding site composition also appeared to play a role in theability of the Ik-1 isoform to activate transcription. Althoughthe Ik-1 protein can bind the IK-BS1 and IK-BS2 sites withsimilar affinities and can bind to the IK-BS7 site with only atwofold difference, its ability to stimulate transcription fromthese sites was markedly different. Expression of the Ik-1

VOL. 14, 1994


10-

0

eL

Expresdon vector CDM8/: Wk-i Ik-2 Ik-3 Ik-4

Reporter genes:

* 4X K43S1 TCAGCTrTGWGAATACOCTGTCA19 4X IK-BS2 .C............ CTtkCAT0 4X IK-BS7 .. ...............AAA. I

FIG. 6. Transcriptional stimulation by the Ikaros isoforms fromhigh- and low-affinity binding sites. The Ik-1 to Ik-4 proteins weretested for their ability to activate transcription from the high-affinitybinding sites IK-BS1 and IK-BS2 and from the lower-affinity bindingsite IK-BS7. Reporter genes carrying four sense copies of thesebinding sites in front of the tkCAT gene were cotransfected with theCDM8-Ikaros 1 to 4 CDM8-Ikaros 4 expression vectors and thepxGH5 plasmid as described in Materials and Methods. The resultspresented exhibited a variance of less than 20% in CAT activity. Thestimulation of CAT activity of the reporter genes (fold stimulation)upon cotransfection with the CDM8-Ikaros recombinant vectors (Ik-1to Ik-4) relative to their CAT activity upon cotransfection with theCDM8 vector alone is shown.

isoform stimulated the activity of the IK-BS2 reporter to alevel sixfold higher than that of the IK-BS7 reporter. Tran-scriptional stimulation of these reporter constructs by the Ik-3and Ik-4 proteins was markedly lower. Expression of eitherIk-3 or Ik-4 stimulated transcription only by two- to threefold,even from constructs containing high-affinity binding sites forthese isoforms (Fig. 6 [IK-BS1 for Ik-3 and IK-BS2 for Ik-4]and unpublished results). This effect was not due to differencesin protein stability or expression in these assays, becausesimilar numbers of transfected cells with comparable levels ofimmunoreactive material were detected upon immunohisto-chemical analysis of transfected fibroblasts (data not shown).

After an initial observation that cells transfected with Ik-3and Ik-4 isoforms displayed predominantly cytoplasmic local-ization, we microinjected synchronized mouse fibroblast cellswith plasmids expressing the four Ikaros cDNAs. This tech-nique permitted the analysis of more cells and furthermoreallowed us to vary the concentration of the injected DNA inorder to determine whether this effect was due to proteinoverexpression. Independently from the DNA concentrationinjected into the nuclei of the cells, the Ik-1 and Ik-2 proteinswere predominantly detected in the nucleus (Fig. 7A to D),while Ik-3 and Ik4 were found in the cytoplasm (Fig. 7E to H).The nuclear versus cytoplasmic localization of the Ikarosisoforms correlated well with their ability to activate transcrip-tion from their cognate sequences. Amino acid sequencesencoded by exon 5, present in the Ik-1 and Ik-2 isoforms andabsent in Ik-3 and Ik-4, may provide the appropriate signalsrequired for the transportation of these proteins into thenucleus (13).

FIG. 7. Subcellular localization of Ikaros isoforms. CDM8-Ik-1 toCDM8-Ik-4 recombinant expression vectors were microinjected intosynchronized mouse fibroblast cells at a 100-pLg/ml concentration. Theexpressed proteins were detected by an antibody raised to the Ik-2N-terminal domain. Ik-1 and Ik-2 were detected primarily in thenucleus (A to D). Ik-3 and Ik-4 were primarily found in the cytoplasm(E to H). No staining was apparent among cells injected with theCDM8 expression vector (I and J). Cells were counterstained withHoechst 33258 to visualize the nucleus (A, C, E, G, and I).

Nuclear complexes forming over Ikaros recognition sites aremainly composed of Ikaros proteins. The composition of T-cellnuclear complexes formed over the recognition sites selectedby the Ikaros proteins was examined. The IK-BS4 oligonucle-otide, a high-affinity binding site for four of the Ikaros proteinisoforms, was tested with nuclear extracts made from the T-cellline EL4 (Fig. 8). Two sequence-specific nuclear complexeswere formed as determined by competition with 100-foldmolar excess of the IK-BS4 and IK-BS5 oligonucleotides (Fig.8 [C1 and C2], lanes 1 to 5). Both complexes were supershifted

MOL. CELL. BIOL.


Competitor Antibodies:IOOX 200X

,I - I,

-~ -T-

- 5: 5= 5 IKC IKNI pS5) p65 pC

CAI -f-

C2..

nuclear complexes (Fig. 8, lanes 13 and 14). We can thereforeconclude that the majority of the T-cell nuclear complexesforming over high-affinity Ikaros binding sites are composed of

p51 IKC IKN proteins that belong to the Ikaros family.

'S

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Protein Extract: EL4 p5O~~~~ -o- 10

FIG. 8. Composition of T-cell nuclear complexes forming over a

palindromic Ikaros binding site. Nuclear extract (2 ,ug) prepared fromthe T-cell line EL4 upon phytohemagglutinin-phorbol myristate ace-

tate stimulation was used in a mobility shift assay with 100,000 cpm ofthe end-labeled IK-BS4 oligonucleotide together with 1 ,ug of dI-dC.The sequence-specific binding of the two complexes formed over thissite was established upon competition with 100- and 200-fold excess ofcold IK-BS4 and IK-BS5 oligonucleotides. Purified antibodies raisedto the C and N termini of the Ikaros proteins (IKC and IKN,respectively) were preincubated for 15 min at room temperature withthe nuclear extracts as indicated (C-terminal antibody, lanes 6, 7, and8; N-terminal antibody, lanes 9, 10, and 11 [0.5, 1, and 1 pl, respec-tively]). Antibodies to the p50 and p65 members of the NF-KB complexand to an unrelated skin-specific protein (pC) were tested in parallel (1,ul, lanes 12 to 14). Binding of the NF-KB member p50 on IK-BS4 was

tested in parallel (lane 15), and the identity of the complex was

confirmed by supershifting with a p50 antibody (0.5 pl, lane 16). TheIkaros antibodies showed no interaction with the p50 homodimericcomplex (0.5 pul, lanes 17 and 18). Ab, antibody.

by two different antisera raised against the C- and the N-terminal domains of the Ikaros protein, respectively (Fig. 8,lanes 6 to 11 and data not shown). The majority of the IK-BS4binding complexes were supershifted by these antibodies (Fig.8, lanes 6, 7, 9, and 10), but some binding activity remained.Distinct nuclear factors with mobility properties similar tothose of the Ikaros proteins may be responsible for thisresidual binding. The supershifted complexes were not formedin the absence of the ELA nuclear proteins, supporting a

specific interaction between antibodies and protein-DNA com-plexes (Fig. 8, lanes 8 and 11). These Ikaros antibodies did notinteract with other proteins that can also bind with high affinityto this site (e.g., the p5O homodimer member of the NF-KBcomplex [Fig. 8, lanes 17 and 18, and reference 29]). Inaddition, antibodies raised against the p5O protein supershiftedthe p5O homodimers but had no effect on the IK-BS4 nuclearcomplexes (Fig. 8, lanes 12 and 16). Similarly, antibodies raisedagainst the other member of the NF-KB complex, the p65protein, or against an unrelated protein had no effect on these

DISCUSSION

Alternate splicing of Ikaros transcripts generates at least fivemRNAs that encode proteins with overlapping but distinctDNA binding specificity and affinity. The DNA binding spec-ificities of the Ikaros proteins are dictated primarily by thedifferential usage of exons encoding the N-terminal zinc fin-gers. The presence of three of the four N-terminal zinc fingersis necessary for binding of the Ikaros proteins to sequencescontaining the pentanucleotide core motif G-G-G-A-A. TheIk-1, Ik-2, and Ik-3 proteins, but not the Ik-4 or Ik-5 proteins,will bind to single recognition sites containing the G-G-G-A-Acore motif.

Because the Ikaros proteins belong to the Cys-2-His-2 zincfinger family of DNA-binding proteins, one can attempt topredict how these N-terminal zinc fingers determine sequencespecificity. The Cys-2-His-2 zinc finger proteins make base paircontacts by aligning their finger modules along the majorgroove of their recognition site in an antiparallel fashion (35),and in a protein with multiple zinc fingers, each module iscapable of from zero to a maximum of five base contacts (36).The Ik-1 and Ik-3 proteins, with four (Fl, F2, F3, and F4) andthree (Fl, F2, and F3) N-terminal fingers, respectively, bothselected the 10-bp consensus T-G-G-G-A-A-T-A-C-C. Ik-3,with one finger less (F4), made more DNA contacts anddisplayed a stricter DNA specificity relative to Ik-1 (T-N-C/t-T-G-G-G-A-A-T-A-C-C for Ik-3 versus N-N-T-T-G-G-G-A-A-T-A/g-C-C for Ik-1 [Fig. 3 and 5]). However, Ik-1 bound to thisrecognition site with higher affinity (Fig. 4 [IK-BS1]). Thissuggests that finger 4, which was expected to make the most 5'base pair contacts, is not directly involved in DNA binding.Nevertheless, this finger module may dictate the specificity andaffinity of the N-terminal DNA binding domain by affecting itsprotein conformation. The Ik-2 protein, with three N-terminalfingers (F2, F3, and F4), selected the 6-bp motif T-G-G-G-A-A/t, which is contained within the consensus sequence selectedby the Ik-1 and Ik-3 isoforms. However, the Ik-4 isoform, withthe same two N-terminal fingers (F2 and F3) as Ik-2 butlacking finger 4, did not bind to single-recognition sites andinteracted only with appropriately spaced double-recognitionsequences in a cooperative fashion. The N-terminal zinc fingerdomain of the Ikaros proteins and its role in dictating theirDNA binding specificities and affinities are reminiscent of asimilar domain in the Evi-1 gene. The Evi-1 protein is com-posed of seven N-terminal and three C-terminal zinc fingersand is involved in regulating differentiation in the myeloidlineage (27). The first three zinc finger motifs in this protein donot bind DNA, but they determine the overall DNA bindingspecificity of the N-terminal domain (10). The differentialusage of zinc fingers by the Ikaros proteins is also reminiscentof the Drosophila chorion transcription factor CF2, which, byalternate splicing, encodes proteins with distinct combinationsof Cys-2-His-2 zinc finger motifs. These zinc finger-containingproteins, in a fashion similar to that of the Ikaros isoforms,display overlapping but overall distinct DNA binding specific-ities (19, 26).The Ikaros isoforms differ in their level of expression in both

immature and mature lymphocytes but also exhibit distincttranscriptional activation and nuclear localization potentials.The Ik-1 and Ik-2 isoforms, localized primarily to the nucleus,are strong transcriptional activators and are abundantly ex-

VOL. 14, 1994


pressed throughout lymphocyte ontogeny. In contrast, Ik-3 andIk-4 are expressed at significantly lower amounts relative to theIk-1 and Ik-2 isoforms during most stages of lymphocytedevelopment. Only in the early embryonic thymus (E14) and inthe late mid-gestation hemopoietic liver (E16) is Ik-4 ex-pressed at mRNA levels similar to those of the Ik-1 and Ik-2isoforms. The Ik-3 and Ik-4 proteins when transiently ex-pressed in non-lymphoid cells exhibit a weak activity in stim-ulating transcription, which correlates with their predomi-nantly cytoplasmic location in these cells. The potentiallydistinct subcellular compartmentalization of Ikaros isoformssuggests their participation in distinct regulatory pathwaysmanifested in the nucleus and in the cytoplasm of the devel-oping lymphocyte. Posttranslational modifications of Ik-3 andIk-4 or their interaction with other proteins in lymphocytesmay regulate cytoplasmic retention versus their entry into thenucleus, where they may also participate in transcriptionreactions.A number of binding sites for the Ikaros proteins were

identified by sequence homology, in the enhancers of theTCR-8, -I, and -(x and the CD3-6, -£, and --y genes, in thehuman immunodeficiency virus long terminal repeat, the IL-2-Ra promoter, and a variety of other lymphocyte-restrictedgenes. Single and composite binding sites for the Ikarosproteins were found in the TCR-cx, -I, and -8 enhancers, andoccupancy of these sites by the Ikaros proteins may underlietheir temporal activation during T-cell development. A num-ber of well-described NF-KB binding sites present in thepromoter and enhancers of genes whose expression is modu-lated during lymphocyte differentiation and activation alsorepresent composite high-affinity binding sites for the Ik-1,Ik-2, and Ik-4 isoforms. In some cell types, such as in theterminally differentiated immunoglobulin-secreting plasmacell, in which Ikaros isoforms are expressed at minimalamounts (reference 18 and unpublished results), members ofthe NF-KB/Rel family probably play a primary role in theactivity of the NF-KB sites (3, 4, 7, 12, 28, 30, 41). However, inearly B lymphocytes and in the activated T cell, functionallydiverse Ikaros isoforms present in abundance may be involvedin the transcriptional control of some of the NF-KB sites.Within the nucleus of a differentiating T cell or an early B cell,the Ikaros isoforms may compete for binding with the nonac-tivating members of the NF-KB complex (P502 [7, 12]) as wellas with the NF-KB complex in the activated T cell. Understand-ing the interaction between Ikaros proteins and other factorsand their subcellular localization in the resting and activated Tcell may help us determine their role in the activity of NF-KBsites.The differential expression of the Ikaros isoforms during

T-cell ontogeny, their overlapping but also unique bindingspecificities, and their diverse transcriptional and nuclearlocalization potentials support their participation in distinctregulatory pathways during lymphocyte ontogeny. Synergisticinteractions and/or competition between members of theIkaros family and other transcription factors in these cells onqualitatively similar and distinct target sites may underlie thecomplex changes in gene expression manifested during lym-phocyte differentiation and activation.

ACKNOWLEDGMENTSWe thank Bruce Derfler and Ning-Yen Yao for technical support at

the initial phases of this project, Susan Winandy for initial immuno-histochemical analysis of transfected cells, Anne M. Theodoras andMichele Pagano for technical advice on microinjection procedures,and the Department of Molecular Genetics, MGH Cancer Center, foruse of their microinjection apparatus. We thank Michael Bigby, Bruce

Morgan, Bob Burgeson, Paul Goetinek, and Susan Winandy forcritically evaluating the manuscript.

This work was supported by a grant from the National Institutes ofHealth (R01AI33062) to K.G. and by CBRC support funds providedby the Shiseido Company. K.G. is a recipient of a Scholar award fromthe Leukemia Society of America.

REFERENCES1. Adams, B., P. Dorfler, A. Aguzzi, Z. Kozmik, P. Urbanek, I.

Maurer-Fogy, and M. Busslinger. 1992. Pax-5 encodes the tran-scription factor BSAP and is expressed in B-lymphocytes, thedeveloping CNS and adult testis. Genes Dev. 6:1589-1607.

2. Ansorge, W., and R. Pepperkok. 1988. Performance of an auto-mated system for capillary microinjection into living cells. J.Biochem. Biophys. Methods 16:283-292.

3. Baldwin, A. S., Jr., and P. A. Sharp. 1987. Binding of a nuclearfactor to a regulatory sequence in the promoter of the mouse H-K'class I major histocompatibility gene. Mol. Cell. Biol. 7:305-313.

4. Ballard, D. W., W. H. Walker, S. Doerre, P. Sista, J. A. Molitor,E. P. Dixon, N. J. Peffer, M. Hannink, and W. C. Greene. 1990.The v-rel oncogene encodes a KB enhancer binding protein thatinhibits NF-KB function. Cell 63:803-814.

5. Blackwood, E. M., and R. N. Eisenman. 1991. Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-bindingcomplex with Myc. Science 251:1211-1217.

6. Bohnlein, E., J. W. Lowenthal, M. Siekevitz, D. W. Ballard, B. R.Franza, and W. C. Greene. 1988. The same inducible nuclearproteins regulate mitogen activation of both the interleukin-2receptor-alpha gene and type 1 HIV. Cell 53:827-836.

7. Bours, V., G. Franzoso, V. Azarenko, S. Park, T. Kanno, K. Brown,and U. Siebenlist. 1993. The oncoprotein Bc1-3 directly transacti-vates through KB motifs via association and DNA-binding pSOBhomodimers. Cell 72:729-739.

8. Clevers, H. C., N. Lonberg, S. Dunlap, E. Lacey, and C. Terhorst.1989. An enhancer located in a CpG-island 3' to the TCR/CD3-epsilon gene confers T lymphocyte-specificity to its promoter.EMBO J. 8:2527-2535.

9. Clevers, H. C., M. A. Oosterwegel, and K. Georgopoulos. 1993.Transcription factors in early T-cell development. Immunol. To-day 14:591-596. (Review.)

10. Delwel, R., T. Funabiki, B. L. Kreider, K. Morishita, and J. N.Ihle. 1993. Four of the seven zinc fingers of the Evi-] myeloid-transforming gene are required for sequence-specific binding toGA(C/T)AAGA(T/C)AAGATAA. Mol. Cell. Biol. 13:4291-4300.

11. Durand, D. B., J.-P. Shaw, M. R. Bush, R. E. Replogle, R. Belagaje,and G. R. Crabtree. 1988. Characterization of antigen receptorresponse elements within the interleukin-2 enhancer. Mol. Cell.Biol. 8:1715-1724.

12. Franzoso, G., V. Bours, V. Azarenko, S. Park, M. Tomita-Yamagu-chi, T. Kanno, K. Brown, and U. Siebenlist. 1993. The oncoproteinBcl-3 can facilitate NF-KB-mediated transactivation by removinginhibiting p50 homodimers from select KB sites. EMBO J. 12:3893-3901.

13. Gashler, A. L., S. Swaminathan, and V. P. Sukhatme. 1993. Anovel repression module, an extensive activation domain, and abipartite nuclear localization signal defined in the immediate-earlytranscription factor Egr-1. Mol. Cell. Biol. 13:4556-4571.

14. Gaynor, R. 1991. Cellular factors involved in regulating HIV geneexpression, p. 107-134. In William A. Haseltine and FlossieWong-Staal (ed.), Genetic structure and regulation of HIV. RavenPress, Ltd., New York.

15. Georgopoulos, K., E. Bier, A. Maxam, and C. Terhorst. 1988. A Tcell-specific enhancer is located in a DNase I-hypersensitive areaat the 3' end of the CD3-delta gene. EMBO J. 7:2401-2408.

16. Georgopoulos, K., M. Bigby, J.-H. Wang, A. Molnar, P. Wu, S.Winandy, and A. Sharpe. 1994. Early arrest in lymphocyte differ-entiation in Ikaros mutant mice. Cell. 19:143-156.

17. Georgopoulos, K., D. Galson, and C. Terhorst. 1990. Tissuespecific nuclear factors mediate expression of the CD3d geneduring T cell development. EMBO J. 9:109-115.

18. Georgopoulos, K., D. D. Moore, and B. Derfler. 1992. Ikaros anearly T cell restricted transcription factor: a putative mediator forT cell commitment. Science 258:808-812.

MOL. CELL. BIOL.


19. Gogos, J. A., T. Hsu, J. Bolton, and F. C. Kafatos. 1992. Sequencediscrimination by alternatively spliced isoforms of a DNA bindingzinc finger domain. Science 257:1951-1955.

20. Gottschalk, L. R., and J. M. Leiden. 1990. Identification andfunctional characterization of the human T-cell receptor P genetranscriptional enhancer: common nuclear proteins interact withthe transcriptional regulatory elements of the T-cell receptor (xand 1B genes. Mol. Cell. Biol. 10:5486-5495.

21. Hagman, J., and R. Grosschedl. 1993. Cloning and functionalcharacterization of early B-cell factor, a regulator of lymphocyte-specific gene expression. Genes Dev. 7:760-773.

22. Hagman, J., A. Travis, and R. Grosschedl. 1991. A novel lineage-specific nuclear factor regulates mb-i gene transcription at theearly stages of B cell differentiation. EMBO J. 10:3409-3417.

23. Ho, I.-C., N. K. Bhat, L. R. Gottschalk, T. Lindsten, C. B.Thompson, T. S. Papas, and J. M. Leiden. 1990. Sequence-specificbinding of human Ets-1 to the T cell receptor gene enhancer.Science 250:814-818.

24. Ho, I.-C., and J. M. Leiden. 1990. Regulation of the human T-cellreceptor at gene enhancer: multiple ubiquitous and T-cell-specificnuclear proteins interact with four hypomethylated enhancerelements. Mol. Cell. Biol. 10:4720-4727.

25. Ho, I.-C., P. Vorhees, N. Marin, B. K. Oakley, S.-F. Tsai, S. H.Orkin, and J. M. Leiden. 1991. Human GATA-3: a lineage-restricted transcription factor that regulates the expression of theT cell receptor ax gene. EMBO J. 10:1187-1192.

26. Hsu, T., J. A. Gogos, S. A. Kirsh, and F. C. Kafatos. 1992. Multiplezinc finger forms resulting from developmentally regulated alter-native splicing of a transcription factor gene. Science 257:1946-1950.

27. Kreider, B. L., S. H. Orkin, and J. N. Ihle. 1993. Loss oferythropoietin responsiveness in erythroid progenitors due toexpression of the Evi-1 myeloid-transforming gene. Proc. Natl.Acad. Sci. USA 90:6454-6458.

28. Kuang, A. A., K. D. Novak, S.-M. Kang, K. Bruhn, and M. J.Lenardo. 1993. Interaction between NF-KB- and serum responsefactor-binding elements activates an interleukin-2 receptorcx-chain enhancer specifically in T lymphocytes. Mol. Cell. Biol.13:2536-2545.

29. Kunsch, C., S. M. Ruben, and C. A. Rosen. 1992. Selection ofoptimal KB/Rel DNA-binding motifs: interaction of both subunitsof NF-KB with DNA is required for transcriptional activation.Mol. Cell. Biol. 12:4412-4421.

30. Lenardo, M. J., and D. Baltimore. 1989. NF-KB: a pleiotropicmediator of inducible and tissue-specific gene control. Cell 58:227-229. (Minireview).

31. Lenardo, M. J., C.-M. Fan, T. Maniatis, and D. Baltimore. 1989.The involvement of NF-KB in 13-interferon gene regulation revealsits role as widely inducible mediator of signal transduction. Cell57:287-294.

32. Lo, K., N. R. Landau, and S. T. Smale. 1991. LyF-1, a transcrip-tional regulator that interacts with a novel class of promoters forlymphocyte-specific genes. Mol. Cell. Biol. 11:5229-5243.

32a.Molnar, A., and K. Georgopoulos. Unpublished results.33. Oosterwegel, M., M. van de Wetering, J. Timmerman, A. Kruis-

beek, 0. Destree, F. Meijlink, and H. Clevers. 1993. Differentialexpression of the HMG box factors TCF-1 and LEF-1 duringmurine embryogenesis. Development 118:439-448.

34. Pagano, M., A. M. Theodoras, S. W. Tam, and G. Draetta. 1994.Cyclin D1-mediated inhibition of repair and replicative DNAsystesis in human fibroblast synthesis. Genes Dev. 8:1627-1639.

35. Pavletich, N. P., and C. 0. Pabo. 1991. Zinc finger-DNA recogni-tion: crystal structure of a Zif268-DNA complex at 2.1A. Science252:809-818.

36. Pavietich, N. P., and C. 0. Pabo. 1993. Crystal structure of afive-finger GLI DNA complex: new perspectives on zinc fingers.Science 261:1701-1707.

37. Pollock, R., and R. Treisman. 1990. A sensitive method for thedetermination of protein-DNA binding specificities. Nucleic AcidsRes. 18:6197-6204.

38. Redondo, J. M., S. Hata, C. Brocklehurst, and M. S. Krangel.1990. A T cell specific transcriptional enhancer within the humanT cell receptor d locus. Science 247:1225.

39. Serfling, E., R. Barthelmas, I. Pfeuffer, B. Schenk, S. Zarius, R.Swoboda, F. Mercurio, and M. Karin. 1989. Ubiquitous andlymphocyte-specific factors are involved in the induction of themouse interleukin 2 gene in T lymphocytes. EMBO J. 8:465-473.

39a.Smale, S. T. Personal communication.40. Smith, B. D., and K. S. Johnson. 1988. Single-step purification of

polypeptides expressed in Eschenichia coli as fusions with glutha-tione S-transferase. Gene 67:31-40.

41. Sun, S.-C., P. A. Ganchi, D. W. Ballard, and W. C. Greene. 1993.NF-KB controls expression of inhibitor IkBat: evidence for aninducible autoregulatory pathway. Science 259:1912-1915.

42. Tautz, D., R. Lehmann, H. Schnurch, R Schuh, E. Seifert, A.Kienlin, K. Jones, and H. Jackie. 1987. Finger protein of novelstructure encoded by hunchback, a second member of the gapclass Drosophila segmentation genes. Nature (London) 327:383-389.

43. Thompson, C. B., C.-Y. Wang, I.-C. Ho, P. R. Bohjanen, B.Petryniak, C. H. June, S. Miesfeldt, L. Zhang, G. J. Nabel, B.Karpinski, and J. M. Leiden. 1992. cis-acting sequences requiredfor inducible interleukin-2 enhancer function bind a novel Ets-related protein, Elf-1. Mol. Cell. Biol. 12:1043-1053.

44. Travis, A., A. Amsterdam, C. Belanger, and R. Grosschedl. 1991.LEF-1, a gene encoding a lymphoid-specific protein with an HMGdomain, regulates T-cell receptor alpha enhancer function. GenesDev. 5:880-894.

45. van de Wetering, M., M. Oosterwegel, D. Dooijes, and H. Clevers.1991. Identification and cloning of TCF-1, a T lymphocyte-specifictranscription factor containing a sequence-specific HMG box.EMBO J. 10:123-132.

46. Waterman, M. L., W. H. Fisher, and K. A. Jones. 1991. Athymus-specific member of the HMG protein family regulates thehuman T cell receptor C alpha enhancer. Genes Dev. 15:656-669.

47. Xu, Y., M. Baldassare, P. Fisher, G. Rathbun, E. Oltz, G. D.Yancopoulos, T. M. Jessell, and F. Alt. 1993. LH-2: a novelLIM/homeodomain gene expressed in developing lymphocytesand neural cells. Proc. Natl. Acad. Sci. USA 90:227-231.

VOL. 14, 1994

the ikaros gene encodes a family of functionally diverse zinc

Documents