the j b c © 1999 by the american society for biochemistry ... · tively spliced regions (3,...

Association with the SRC Family Tyrosyl Kinase LYN Triggersa Conformational Change in the Catalytic Region of HumancAMP-specific Phosphodiesterase HSPDE4A4BCONSEQUENCES FOR ROLIPRAM INHIBITION*

(Received for publication, March 18, 1998, and in revised form, February 4, 1999)

Ian McPhee‡, Stephen J. Yarwood‡, Grant Scotland§, Elaine Huston, Matthew B. Beard,Annette H. Ross, Emma S. Houslay, and Miles D. Houslay¶

From the Division of Biochemistry & Molecular Biology, IBLS, Davidson Building, University of Glasgow,Glasgow G12 8QQ, Scotland, United Kingdom

The cAMP-specific phosphodiesterase (PDE) HSPDE4A4B(pde46) selectively bound SH3 domains of SRC fam-ily tyrosyl kinases. Such an interaction profoundlychanged the inhibition of PDE4 activity caused by thePDE4-selective inhibitor rolipram and mimicked the en-hanced rolipram inhibition seen for particulate, com-pared with cytosolic pde46 expressed in COS7 cells. Par-ticulate pde46 co-localized with LYN kinase in COS7cells. The unique N-terminal and LR2 regions of pde46contained the sites for SH3 binding. Altered rolipraminhibition was triggered by SH3 domain interactionwith the LR2 region. Purified LYN SH3 and humanPDE4A LR2 could be co-immunoprecipitated, indicatinga direct interaction. Protein kinase A-phosphorylatedpde46 remained able to bind LYN SH3. pde46 was foundto be associated with SRC kinase in the cytosol of COS1cells, leading to aberrant kinetics of rolipram inhibition.It is suggested that pde46 may be associated with SRCfamily tyrosyl kinases in intact cells and that the ensu-ing SH3 domain interaction with the LR2 region ofpde46 alters the conformation of the PDE catalytic unit,as detected by altered rolipram inhibition. Interactionbetween pde46 and SRC family tyrosyl kinases high-lights a potentially novel regulatory system and point ofsignaling system cross-talk.

Although it has long been appreciated that cAMP plays apivotal role in controlling a wide range of cellular processes, thecomplexity of the signaling system responsible for the genera-tion, detection, and degradation of this second messenger hasonly recently become apparent. Thus nine forms of adenylylcyclase able to generate cAMP, and around 30 forms of cyclicnucleotide phosphodiesterase (PDE)1 isoenzymes able to de-

grade cAMP, have been identified together with multiple formsof protein kinase A (PKA) and a large family of PKA-anchoringproteins (1–7). A number of these species have been shown toexhibit specific intracellular distributions. For example, thelocalization of particular adenylyl cyclase isoenzymes to dis-tinct regions of the plasma membrane in polar cells (8), thetargeting of PDE4 isoenzymes via their N-terminal alterna-tively spliced regions (3, 9–14), and the binding of PKA isoen-zymes to anchor proteins have all been noted (1, 4). Thesearrangements demonstrate a propensity to organize the com-ponents of the cAMP signal transduction system within definedregions of the three-dimensional matrix of the cell interior.This, undoubtedly, provides the molecular basis of the compart-mentalization of cAMP signaling that has been noted in anumber of different cell types (1, 2, 4). That specific adenylylcyclase and PDE isoenzymes can be regulated through theaction of a variety of intracellular signaling systems suggeststhat cAMP signaling may be regulated in distinct fashions indifferent cells (2).

The cAMP-specific phosphodiesterase, PDE4 enzyme familyis encoded by four genes which each produce a series of isoen-zymes through alternative mRNA splicing (3, 6, 7). Selectiveinhibitors of these enzymes are currently being developed asanti-inflammatory agents that appear likely to be of potentialtherapeutic use in a variety of disease states including asthma,rheumatoid arthritis, and AIDS (15–18). Each PDE4 isoen-zyme has a unique N-terminal region which, in the case of theso-called “long” isoenzyme, are connected to the catalytic do-main by two regions that provide unique signatures of thisenzyme family. These are the Upstream Conserved Regions,UCR1 and UCR2 (19). One feature that distinguishes isoen-zymes of each PDE4 class is the nature of their two LinkerRegions (3) namely LR1, which connects UCR1 to UCR2, andLR2, which connects UCR2 to the catalytic domain (3).

There is a growing realization that proteins involved in in-tracellular signaling systems can be recruited and organizedwithin distinct intracellular domains (4). SH3 domains, whichare found in various families of proteins including adapter andcytoskeletal proteins and signal transducing proteins such asSRC family tyrosyl kinases, can serve such a function (20, 21).

* This work was supported by a grant from the Medical ResearchCouncil (United Kingdom) and also by equipment grants from theWellcome Trust. The costs of publication of this article were defrayed inpart by the payment of page charges. This article must therefore behereby marked “advertisement” in accordance with 18 U.S.C. Section1734 solely to indicate this fact.

We dedicate this work to Grant Scotland, Ph.D., who died tragicallyin a climbing accident in Glencoe, Scotland, on September 20, 1998.

‡ Both authors contributed equally to this study.§ Deceased.¶ To whom correspondence and reprint requested should be ad-

dressed. Tel.: 44-141-330-5903; Fax: 44-141-330-4365; E-mail:[email protected].

1 The abbreviations used are: PDE, cyclic nucleotide phosphodiester-ase; PDE4, cAMP-specific family 4 PDE; UCR, upstream conservedregion; LR, linker region; pde46, a human PDE4 isoenzyme knownformally as HSPDE4A4B; h6.1, an N-terminally truncated form of

pde46 known formally as HSPDE4A4C (GenBankTM accession numberU18087) and also as clone h-PDE1 (HSPDE4A4A; M37744); rpde6, rathomologue of pde46 and known formally as RNPDE4A5 (GenBankTM

accession number L27057); rpde39, rat PDE4A isoenzyme (RNPDE4A8;L36467); rolipram, 4-{3-(cyclopentoxyl)-4-methoxyphenyl}-2-pyrroli-done; RP73401, [N-(3,5-dichloropyrid-4-yl)-3-cyclopentyloxy-4-methoxy-benzamide]; mAb, monoclonal antibody; SB207499 (Ariflo), [c-4-cyano-4-(3-cyclopentyloxy-4-methoxyphenyl)-r-1-cyclohexanecarboxylic acid];PKA, protein kinase A; VSV, vesicular stomatitis virus.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 17, Issue of April 23, pp. 11796–11810, 1999© 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org11796

by guest on July 14, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

They are distinct, self-folding, globular units of ;60 residuesthat confer protein-protein interaction by binding proline-richregions on acceptor proteins. Interactions involving SH3 do-mains allow the assembly of functionally active complexes thatserve to control conformational switches in a number of keyregulatory pathways (20).

We have shown (12) that the N-terminal region of the longhuman PDE4A isoenzyme pde46 appears to be responsible, atleast in part, for its intracellular targeting in COS7 cells.Such membrane association was accompanied (12) by a pro-found increase in the sensitivity of the particulate form ofthis enzyme to inhibition by the archetypal PDE4-selectiveinhibitor rolipram. Additionally, this interaction resulted ina striking change in the kinetics of enzyme inhibition byrolipram, implying that particulate association had triggereda conformational change in this enzyme. Here we identify adistinct proline- and arginine-rich stretch of sequence locatedwithin the LR2 region of pde46 which confers SH3 domainbinding and triggers a conformational change in the catalyticunit of this enzyme.

EXPERIMENTAL PROCEDURES

Materials—Restriction enzymes, Dulbecco’s modified Eagle’s me-dium, and fetal calf serum were from Life Technologies, Inc. (Paisley,UK). Tris, Hepes, DEAE-dextran (Mr 500,000), cytochalasin B, benza-midine hydrochloride, phenylmethylsulfonyl fluoride, aprotinin, pep-statin A, antipain, EDTA, EGTA, cAMP, cGMP, Dowex 1-X8–400 (chlo-ride form, 200–400 mesh), 3-isobutyl 1-methylxanthine, snake venom(Ophiophagus hannah), phosphate-buffered saline, isopropylthio-b-D-galactoside, ampicillin, glutathione, goat anti-rabbit IgG, FITC-conju-gated goat anti-mouse and FITC-conjugated anti-rabbit IgG, and bovinebrain calmodulin were from Sigma (Poole, UK). Nuserum was fromCollaborative Biomedical Products (UK). Dulbecco’s modified Eagle’smedium was from Life Technologies Inc. (Paisley, Scotland). [3H]cAMPand [3H]cGMP were from Amersham Pharmacia Biotech (UK). Leupep-tin was from Peptide Research Foundation (Scientific Marketing Asso-ciates, London, UK). Dithiothreitol, Triton X-100, and lysozyme werefrom Boehringer Mannheim (Lewes, UK). Triethanolamine was fromBDH (Glasgow, UK). Glycerol was from Fisons (Leicestershire, UK).Bradford reagent was from Bio-Rad (Hertfordshire, UK). Dimethylsulfoxide was from Koch-Light Ltd. (Haverhill, UK). Rolipram was akind gift from Schering Aktiengesellschaft, Berlin, Germany. RP73401was a kind gift from Dr. J. Souness, Rhone-Poulenc-Rorer, Dagenham,UK. SB207499 was a kind gift from Dr. Ted Torphy, SKB, Philadelphia.mAbs specific for both LYN and SRC were from Transduction Labora-tories (Lexington, KY). A polyclonal antibody specific for LYN was fromSanta Cruz Biotechnology. Alexa 594-conjugated goat anti-mouse IgGwas from Molecular Probes.

Construction of Da-h6.1 and Db-h6.1 Mutants—The Da and Db re-gions deleted here in the N-terminally truncated PDE4A form h6.1 (22)are shown schematically in Fig. 1. Both constructs were made usingPCR-based site-directed mutagenesis involving two rounds of PCR dur-ing which the 59 region of h6.1 (22) containing the deletion was synthe-sized. Plasmid pSVsport-h6.1 (12, 22, 23) was used as a template duringthe first round of PCR. The primer sequences employed were as follows:ESH1, AGCAGGGATCCACCATGTGCCCGTTCCCAG; ESH2a, GTGT-GGTACTTGCTGTTTTTCTCGTTCC; ESH2b, GGGCGGGGGCGGTT-GCTGTTTTTCTCGTTCC; ESH3a, GAAAAACAGCAAGTACCACACT-TACAGC; ESH3b, GAAAAACAGCAACCGCCCCCGCCCCCTG; andESH4, TGGTGATTCTCGAGCACCGAC. PCR was first done usingprimer ESH1 with either primer ESH2a or ESH2b and primer ESH4with either primer ESH3a or ESH3b. Fragments were then electro-phoresed on a 1.5% agarose gel and excised. In a second PCR, inaddition to primers ESH1 and ESH4, a small piece of gel (approximate-ly 2 mm3) containing the PCR product of primers ESH1 1 ESH2a wasmixed with a piece of gel containing the PCR product of primers ESH3a1 ESH4 in order to generate the Da-h6.1 construct. In a similar fashion,the PCR product of primers ESH1 1 ESH2b was mixed with PCRproduct of ESH4 1 ESH3b to make the Db-h6.1 construct. During thesecond PCR, after denaturation at 94 °C for 1 min, the annealingtemperature was dropped to 42 °C for 1 min to allow the complementaryends of the first round PCR products to anneal so that a hybrid productcontaining the desired deletion was created upon raising the tempera-ture to 72 °C for 1.5 min. This product was then subjected to a further

PCR using primers ESH1 and ESH4. After purification on an agarosegel the mutated 59 regions were then inserted into to pSVsport-h6.1using XhoI (in h6.1 sequence) and BamHI (in the pSVsport multiplecloning site and in primer ESH1 sequence) restriction sites, replacingthe unmodified region. The sequences of the resultant constructs werethen confirmed.

Generation of the Db-pde46 Mutant—The deletion Db (Fig. 1), encom-passing amino acids 313–320 inclusive, of HSPDE4A4B (pde46) (19)was generated by site-directed mutagenesis using the QuickChangeyMutagenesis system (Stratagene Ltd., Cambridge, UK) according to themanufacturer’s instructions. This employed the plasmid pSV.SPORT-h46 (12) together with the complementary oligonucleotide primers GSd-b1, 59-CGAGAAAAACAGCAACCGCCCCCG-39 (sense) and GSdb2, 59-CGGGGGCGGTTGCTGTTTTTCTCG-39 (antisense) in a PCR reaction.Upon completion, the reaction mix was treated with the restrictionenzyme DpnI, and digested samples were transformed into competentEscherichia coli strain XL1-Blue. This generated the plasmid pSV.h-PDE46-Db. Confirmation of the mutation was obtained by sequencing ofminiprep DNA.

Generation of a GST Fusion Protein of a VSV Epitope-tagged Form ofthe Human LR2 Region—PCR was used to generate the LR2 region (3)(Fig. 1) of pde46 with a C-terminal VSV epitope tag using the syntheticoligonucleotide primers GS-h46-LR2 59-GCGGGATCCATGCCATCAC-CCACG-39 (sense) and GS-h46-LR2 59-TGCTCTAGATTACTTTCCCA-GCCTGTTCATCTCTATATCGGTGTACTGTAAGTGTGGTAC-39 (an-tisense) and pde46 as template DNA. The PCR fragment generated wastreated with BamHI and XbaI, and the digested fragment was purifiedbefore ligation into the BamHI/XbaI sites of the plasmid pcDNA3, yield-ing the plasmid pcDNA-LR2-VSV. This was used as a template for PCRwith the following oligonucleotide primers: h46 pGEX 59, 59-CGCGGA-TCCCATCACCCACG-39, and h46 pGEX 39, 59-CGGCTCGAGTTACTT-TCCCAGCC-39. The resultant PCR fragment was digested with BamHIand XhoI; the fragment was gel-purified and ligated into BamHI, XhoIcut pGEX-5X-1 (Amersham Pharmacia Biotech) to form an in-framefusion with the GST gene. The resultant plasmid was designated pGEX-LR2-VSV. Sequences of all constructs were confirmed.

Preparation and Generation of SH3 Domain Fusion Proteins—GSTfusion proteins of the various SH3 domains employed in this study weregenerated as described previously by us (24) with the exception of thoseof c-Abl (kind gift from Dr. D. Baltimore, MIT, Cambridge, MA) andc-Crk (kind gift from Dr. S. Fischer, INSERM, Paris, France). Theprocedures used to grow transformed E. coli and then to induce, isolate,and purify various GST fusion proteins were done as described in detailby us before (24).

Pull-down Assays with GST Fusion Proteins—This was performedusing a modification of a procedure described previously by us (24).Volumes of slurry containing 400 mg of fusion protein immobilized onglutathione-agarose were pelleted, and the supernatants were dis-carded. Within each assay, volumes taken were equalized with washedbeads. The pellets were resuspended in 100 mg of crude cytosol of COS7cells transiently transfected to express the PDE4A form, diluted to afinal volume of 200 ml in KHEM buffer (50 mM KCl, 50 mM HEPES-KOH, pH 7.2, l0 mM EGTA, 1.92 mM MgCl2) containing 1 mM dithio-threitol and protease inhibitor mixture. The immobilized fusion proteinand cytosol were incubated together for 10-min “end-over-end” at 4 °C.The beads were then collected by centrifugation for 5 s at high speed ina benchtop centrifuge, and the supernatant was retained as the un-bound fraction. The beads were held on ice and washed three times with400 ml of KHEM containing 1 mM dithiothreitol and protease inhibitormixture over a 15-min period. These washes were pooled along with theunbound fraction and aliquots taken for PDE assay and Western blot-ting. Bound PDE was eluted from the beads by incubating three timesin 100 ml of elution buffer (10 mM glutathione, 50 mM Tris-HCl, pH 8.0),for 10 min at 4 °C. The eluted fractions were pooled and aliquots takenfor PDE assay and Western blotting.

Binding of PDE4 Species to SH3 Fusion Proteins Prior to KineticAnalyses—COS7 cells were transfected with either native or the indi-cated mutant forms of pde46 and h6.1. They were lysed in KHEMbuffer, and the high speed supernatant fraction was divided into 100-mlaliquots, each of which contained typically 180–200 mg of protein. Inthese experiments each 100-ml aliquot of the COS7 cell high speedsupernatant fraction was incubated with 200 mg of the indicated SH3domain-GST fusion protein that had been purified from bacterial ex-tracts and immobilized on glutathione-agarose. The immobilized fusionprotein and indicated PDE form were incubated end-over-end at 4 °Cfor 10 min. The beads were washed 3 times in KHEM buffer over a15-min period and eluted by 33 100-ml washes in ice-cold elution buffer(see above). The eluted fractions were then pooled and taken for imme-

cAMP Phosphodiesterase SH3 Domain Interactions 11797


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

diate analysis of PDE activity. In some instances an additional 200 mgof SH3 domain GST fusion protein was added to the eluted fraction.Over the time of the PDE assay .95% of each of the PDE formsremained bound to the SH3 (LYN/FYN/SRC) fusion proteins. No bind-ing occurred to GST alone, and GST addition to PDE assays did notelicit any change in rolipram inhibition of the PDEs analyzed herein.

Transfection and Subcellular Fractionation of COS7 Cells—Cellswere grown and transfected as described before by us in some detail(12). Disruption of COS7 cells was done as described previously by us insome detail (9, 12). This procedure routinely yielded (14, 25) a P1 pellet(1,000 3 gav for 5 min) and P2 pellet (60 min at 100,000 3 gav) as wellas a high speed supernatant (sn). The homogenization procedure wascomplete in that there was no detectable latent lactate dehydrogenaseactivity present in either of the pellet fractions, indicating the absenceof cytosolic proteins and .98% disruption. The high speed supernatant,P1 and P2 fractions, contained 34 6 3, 25 6 2, and 41 6 2% of the totalprotein, respectively (means 6 S.D.; n 5 8 experiments).

SDS-PAGE and Western Blotting—Samples of cellular fractions(2–50 mg of protein) were boiled for 5 min after being resuspended inLaemmli (26) buffer and were separated on 10% acrylamide gels. Gelswere routinely run at 40 mA/gel for 4–5 h with cooling. TransfectedPDE was detected by Western blotting with human PDE4A-specificantisera (12) following transfer to nitrocellulose. Immunoreactivebands were identified by using anti-rabbit peroxidase-linked IgG andthe Amersham Pharmacia Biotech ECL detection system as describedbefore by us (12).

Immunoprecipitation of Fusion Proteins—The GST fusion proteinGST-LR2-VSV (25 mg) was diluted to 500 ml in immunoprecipitationbuffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.02%Triton X-100) containing an equal amount of GST or LYN-SH3 GSTfusion protein. Fusion protein mixtures were incubated for 1 h at 4 °Cwith anti-VSV antiserum (1:50 v/v) or mouse IgG (1:50 v/v) after whichprotein A-agarose beads (1:50 v/v) were added. After incubation for anadditional hour, immune complexes were pelleted by centrifugation at14,000 3 gav and washed three times in immunoprecipitation buffer.Following washing, immunoprecipitates were subjected to SDS-PAGEand Western blotting with anti-GST antiserum (1:5,000 v/v). Labeledbands were identified by using anti-rabbit peroxidase-linked IgG (1:10,000 v/v) and visualized with the Amersham Pharmacia Biotech ECLprotocol.

Co-immunoprecipitation of pde46 with LYN—COS7 and COS1 cellswere transfected with 10 mg of plasmid pcDNA3 containing a cDNA offull-length pde46 by the DEAE-Dextran transfection method. Seventytwo hours post-transfection cells were harvested in RIPA buffer (55 mM

Tris-HCl, pH 7.4, 132 mM NaCl, 22 mM sodium fluoride, 11 mM sodiumpyrophosphate, 1.1 mM EDTA, 5.5 mM EGTA) and then lysed with 8strokes of a 261⁄2-gauge needle attached to a disposable syringe. Unbro-ken cells were removed by centrifugation at 1,000 3 gav for 5 min. Theresulting supernatant was centrifuged at 100,000 3 gav for 45 min at4 °C to yield a high speed supernatant fraction (S2) and a high speedpellet fraction (P2). 500 mg of S2 was mixed with 30 ml of pre-equili-brated protein A-agarose and incubated for 30 min at 4 °C. Beads wereremoved by centrifugation at 2,000 3 gav for 5 min, and the clearedlysates were incubated with 4 mg/ml anti-LYN antisera in the presenceof protein A-agarose beads for 3 h at 4 °C. Beads were collected bycentrifugation (2,000 3 gav for 5 min) and washed three times with lysisbuffer. 0.2 mg (protein) of the high speed (P2) pellet fraction was treatedwith 500 ml of lysis buffer containing 0.5% Nonidet P-40. They werethen incubated for 30 min at 4 °C and then centrifuged at 100,000 3 gav

for 45 min at 4 °C. The resulting supernatant was mixed with 30 ml ofpre-equilibrated protein A-agarose and incubated for 30 min at 4 °C.Beads were removed by centrifugation at 2,000 3 gav for 5 min, and thecleared supernatant was incubated with 4 mg/ml anti-LYN antiserum inthe presence of protein A-agarose beads for 3 h at 4 °C. Beads werecollected by centrifugation (2,000 3gav for 5 min) and washed threetimes with lysis buffer. Co-immunoprecipitation of pde46 with LYN wasanalyzed by immunoblotting with anti-human PDE4A antiserum (12)and a LYN mAb.

LYN SH3 Binding to Protein Kinase A-phosphorylated pde46—Thecytosolic fraction of pde46 from transfected COS7 cells, containing 8pmol/min/ml enzyme, and the equivalent amount of cytosol (50 mg) frommock-transfected cells were each made up to 200 ml in PKA assay buffer(0.2 mM ATP, 0.1 mM [32P]ATP, 10 mM MgCl2, 30 mM b-mercaptoetha-nol, 10% glycerol, 100 mM Tris-HCl, pH 7.5) and incubated in thepresence of 2 units of PKA for 30 min at room temperature. The samplewas then divided into two equal aliquots, one of which was incubated inthe presence of a LYN SH3-GST (100 mg) fusion protein, and the otherwas incubated in the presence of GST (100 mg) alone. After a 30-min

incubation on ice, 50 ml of glutathione beads were added to each aliquotand incubated end-over-end for 30 min at 4 °C. The beads were thenwashed 3 times in 0.5 ml of phosphate-buffered saline containing pro-tease inhibitors to remove any unbound proteins before being washed 3times (5 s centrifugation at 10,000 3 gav) in 100 ml of elution buffer (5mM glutathione, 50 mM Tris-HCl, pH 8) to release the GST, the LYNSH3-GST fusion protein, and any proteins that may have bound tothem. The eluates were then incubated for 30 min on ice with anantiserum specific for the unique C terminus of human PDE4A (12).Antibody-antigen complexes were then precipitated using protein Abeads and washed 3 times in 0.5 ml of phosphate-buffered saline. Theresultant pellets were boiled in Laemmli sample buffer (26) and appliedto the lanes of an 8% polyacrylamide gel. After running the gel, theproteins were transferred to nitro-cellulose, and radioactive bands weredetected using x-ray film and PhosphorImager plates.

Binding of h6.1 to P1 Pellet Fraction and Competition with GST-LR2-VSV—Using procedures described by us before (27, 28) h6.1 was syn-thesized in vitro using the coupled, single tube STP3 T7 transcription/translation system (Novagen) according to the manufacturer’sinstructions. Briefly, 1 mg/reaction of pSVsport-h6.1 DNA template wasadded to STP3 Transcription Mix (10 ml total reaction volume) andincubated at 30 °C for 15 min. Following the transcription step, 30 ml ofSTP3 Translation Mix and 40 mCi of [35S]methionine was added to thereaction tube. The reaction volume was made to 50 ml with nuclease-free water, and then the tube was incubated at 30 °C for 60 min. Thiswas used in binding experiments as described before by us (27, 28).Here, 5 ml of in vitro synthesized h6.1 was incubated for 10 min at 4 °Cwith 10 mg of P1 pellet fraction, and the indicated amount of eitherGST-LR2-VSV fusion protein or GST (control) in a total volume of 500ml of binding buffer (55 mM Tris-HCl, pH 7.4, 132 mM NaCl, 22 mM

sodium fluoride, 11 mM sodium pyrophosphate, 1.1 mM EDTA, 5.5 mM

EGTA) containing protease inhibitor mixture. Pellets were then col-lected by centrifugation (2,000 3 gav, 5 min, 4 °C), washed 3 times withbinding buffer, subjected to SDS-PAGE, and Western-blotted. Radioac-tive bands were identified by PhosphorImager analysis.

Immunofluorescence Analyses—48 h after transfection cells weretransferred onto coverslips (18 3 18 mm) at about 40% confluency. Theywere grown for a further 24 h and then fixed for 30 min in 4% paraform-aldehyde in Tris-buffered saline (TBS). Cells were permeabilized with 3changes of 0.2% Triton in TBS for 15 min, and, following four 5-minblocking incubations with 20% goat serum and 4% bovine serum albu-min, were labeled for 2 h with polyclonal antibodies raised againstspecific peptide sequences of the C-terminal region of PDE 4A4B (12) orRNPDE4A5 (10, 11). Alternatively a monoclonal anti-PDE4A antibody,also raised against the C-terminal region of PDE4A4B, was used. La-beling was detected using a tetramethyl rhodamine isothiocyanate-conjugated goat anti-rabbit IgG or Alexa 594-conjugated goat anti-mouse IgG for 1 h. Co-staining of cells was achieved using a monoclonalmouse anti-LYN antibody at a dilution of 1:100 and a polyclonal anti-body raised to a specific peptide sequence of the Gs a subunit of GTP-binding protein. Localization of proteins was visualized using FITC-conjugated goat anti-mouse or anti-rabbit IgG. All incubations wereperformed at room temperature. Cells were visualized using a laser-scanning confocal microscope using an Axiovert 100 microscope with aX63/1.4NA plan apochromat lens, as described previously (12).

PDE Assay—cAMP PDE activity was assessed at 30 °C by a modifi-cation of the two-step procedure of Thompson and Appleman (29) asdescribed previously by us (30). Initial rates were taken from lineartime courses of activity. Mock transfections, with vector only, as de-scribed before (12, 13), did not alter the endogenous COS cell PDEactivity. As a routine we subtracted the residual COS cell PDE activi-ties done in parallel experiments from those activities found in PDE-transfected cells. Protein was measured by the method of Bradford (31)using bovine serum albumin as a standard. Dose-effect inhibitor anal-yses were done with 1 mM cAMP as a substrate. Racemic rolipram wasdissolved in 100% Me2SO as a 10 mM stock and diluted in 20 mM

Tris-HCl, pH 7.4, 10 mM MgCl2 buffer for dilution in the assay. ResidualMe2SO did not affect PDE activity over the ranges used here. Inhibitorstudies were analyzed using KaleidaGraph (Synergy Software, Read-ing, PA). To define Km values, data from PDE assays were done over arange of cAMP substrate concentrations and then analyzed by fitting tothe hyperbolic form of the Michaelis-Menten equation using an itera-tive least squares procedure (Ultrafit; with Marquardt algorithm, ro-bust fit, experimental errors supplied; Biosoft, Cambridge, UK) (12, 25).

cAMP Phosphodiesterase SH3 Domain Interactions11798


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

RESULTS AND DISCUSSION

Through alternative mRNA splicing each of the four PDE4genes generates a number of isoenzymes that have uniqueN-terminal regions (3, 6, 7, 19, 32). Such splicing, however,occurs at two distinct splice junctions that generate so-called“short” and “long” PDE4 isoenzymes. The long forms are char-acterized by the presence of two regions that provide a uniquesignature for members of the PDE4 multigene family (19),namely the so-called UCR1 and UCR2 regions (Fig. 1). Theseare located between the unique N-terminal region of eachisoenzyme and their catalytic unit. The region that connectsUCR1 and UCR2 has been called (3) linker region 1 (LR1) andthat region which connects UCR2 to the catalytic region hasbeen called linker region 2 (LR2). These linker regions varydramatically in sequence between the different PDE4 families,with the most profound differences seen for the LR2 region (3).In contrast to the long PDE4 isoenzymes, however, the shortisoenzymes lack a UCR1 region.

Interactions between SH3 domains and putative target pro-teins have been investigated in a number of laboratories byusing specific SH3 domains expressed as in-frame fusion pro-teins with GST (20, 21). We have used such an approach todemonstrate (24) that the long rat PDE4A isoenzyme, rpde6,can interact with the SH3 domains from a variety of proteins,showing an apparent preference for interaction with the SH3domains of SRC family tyrosyl kinases. This interaction wasmediated exclusively by the extreme N-terminal alternativelyspliced region of 112 residues, as both a different long rat PDE4isoenzyme (rpde39) and an engineered rat PDE4A species(Met26-RD1), which lacks all N-terminal sequence up fromUCR2, failed to bind to the SH3 domains of SRC family tyrosylkinases. Within the N-terminal alternatively spliced region ofrpde6 are three motifs of the form that might be predicted tointeract with SH3 domain-containing proteins, including thoseof SRC family tyrosyl kinases. These consist of a “core” PXXPmotif together with a closely associated arginine residue, yield-ing a motif of the general form either PXXPXXR or RXXPXXP.Three similar motifs are found (Fig. 1) in the N-terminal region

of pde46, the human homologue of rpde6. We show here (TableI and Fig. 2) that pde46 was able to bind to GST fusion proteinsexpressing the SH3 domains of the tyrosyl kinases LYN andSRC. There is an apparent specificity in this interaction. Rel-ative to the binding of pde46 to SRC SH3 (set at unity) bothLYN SH3 (4.9 6 0.5 times as effective) and FYN SH3 (4.4 6 0.3times) bound more effectively, whereas ABL SH3 bound simi-larly (0.7 6 0.2 times), and CRK SH3 (0.05 6 0.03 times) andLCK SH3 (0.04 6 0.02 times) showed little if any interaction(data are means 6 S.D. for n 5 3 separate experiments; anal-yses done by Western blotting of pull-down assays as in Fig. 2;100 mg of COS cell lysate used plus 23 200 mg of fusion proteinsas described in detail under “Experimental Procedures”.

Previously, we have shown (24) that an N-terminal trun-cated rodent PDE4A form called Met26-RD1, was unable tobind to the SH3 domain of SRC. In marked contrast to this,however, we noted in this study that a cognate human PDE4AN-terminal truncate, exemplified by the form h6.1 (Fig. 1), wasstill able to bind to the SH3 domains of LYN and SRC (Table Iand Fig. 2). The PDE4A homologues, pde46 (human) and rpde6(rat), are extremely similar proteins, particularly regardingtheir alternatively spliced N-terminal regions and core cata-lytic unit. However, there are certain differences in their pri-mary structure (3, 19) which appear to be highly localized. Themost obvious differences relate to insertions in pde46 foundboth toward its C terminus and within its LR2 region (3).Indeed, the sequence of the exon 8-encoded LR2 region appearsto be hypervariable not only between the various PDE4 fami-lies but also between cognate PDE4A isoenzymes from differ-ent mammals (3, 32). This latter point is clearly evident uponcomparison of the sequence of the LR2 region from human andrat PDE4A species (Fig. 1 and Ref. 32). Inspection of this regionshows that the human, but not the rat, LR2 region (Fig. 1) ischaracterized by the presence of an RXXPXXP motif containedwithin a highly proline- and arginine-rich stretch of sequence.As such, the human PDE4A LR2 region is of a form that mightbe expected to be able to interact with SH3 domains. Thisdifference between the rat and human LR2 regions (51) might

FIG. 1. Domain structure of PDE4A. This schematic shows the putative domain structure of pde46 (HSPDE4A4B) (19) and the N-terminaltruncated species h6.1 (22). Identified features are the unique N-terminal alternatively spliced region of pde46 and which contains three putativeSH3 binding motifs starting at Pro3, Pro37, and Pro61; the upstream conserved regions UCR1 and UCR2 which are unique to PDE4 family membersand start at Ser140 and Gln228, respectively; the linker region LR1, which connects UCR1 and UCR2 and starts at Phe195; linker region LR2 whichstarts at Met305 and connects UCR2 to the putative catalytic unit which starts at Met332; two other putative SH3 binding regions, at Pro684 andPro819, found toward the C-terminal region of the protein which start at Glu701. h6.1 has 9 non-native amino acids at its N terminus. The form ofthe Da and Db mutants, which have deletions within the LR2 region, is shown together with a comparison of the sequences of the human and ratLR2 regions so as to indicate the absence of the PRPRP region in the rat LR2 and the differences in the human PPPPP region with that seen. Aputative SH3 binding motif of the form RXXPXXP can be identified in the human, but not the rat, LR2 region as R315PRPSQP.



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

then offer an explanation as to why the human truncate, h6.1(Fig. 2), but not the rat truncate Met26-D1 (24), was able to bindto SH3 domains of SRC and LYN. In order to evaluate this, wemade two h6.1 mutants. In Da-h6.1 the entire proline- andarginine-rich region found within human PDE4A-LR2 was de-leted (Fig. 1). In the Db-deletion mutant a stretch of sequencefound uniquely within the human, but not the rat, PDE4A LR2region was removed (Fig. 1). This region contained the“PRPRP” repeat sequence whose deletion served also to destroythe RXXPXXP motif found within human LR2. Expressed tran-siently in COS7 cells, both of these deletion mutants werefound as active species exhibiting Km values for cAMP of 2.7 60.4 and 2.3 6 0.5 mM for the Da-h6.1 and Db-h6.1 mutants,respectively (mean 6 S.D.; n 5 3). Their activities were inhib-ited by the PDE4-selective inhibitor rolipram in a dose-depend-ent fashion, with IC50 values that were similarly both to eachother and to h6.1 (Table II). However, neither of these deletionmutants was able to bind to the SH3 domains of either LYN(Fig. 2) or SRC (data not shown), and each was found exclu-sively in the high speed supernatant (cytosol) fraction of thesecells (Table III). In addition to the putative SH3 binding motifsfound in the extreme N-terminal region of pde46 and within theLR2 region, two other possible SH3 binding motifs are evidenttoward the C terminus of the protein (Fig. 1). However, webelieve it unlikely that these are capable of interacting with theSH3 domains of LYN, FYN, and SRC because similar motifsare evident in the rodent PDE4A isoenzyme, rpde39, and theN-terminal PDE4A truncate, Met26-RD1, both of which failedto interact with SH3 domains (24). Consistent with this, weshow here (Fig. 2) that both the human Da-h6.1 and Db-h6.1mutants, each of which exhibits the C-terminal PXXPXXRmotifs (Fig. 1), failed to bind to SH3 domains. We thus proposethat the sites of interaction of SRC family tyrosyl kinase SH3domains with PDE4A species are limited to the N-terminalalternatively spliced regions found in common in the humanand rat homologues, pde46 and rpde6, together with an addi-tional site found uniquely in the LR2 region of the humanPDE4A isoenzyme, pde46.

In order to define whether the LR2 region of human PDE4Awould indeed interact with an SRC family tyrosyl kinase SH3domain, we generated a VSV epitope-tagged version of LR2 asa GST fusion protein. This species migrated as a single, 33-kDa

species on SDS-PAGE (Fig. 3A; track h) when detected using apolyclonal antibody specific for GST (12). The GST fusion pro-tein of LYN SH3 was similarly detected and migrated as asingle, 36-kDa species on SDS-PAGE (Fig. 3A, track i). Using amAb specific for VSV we were able to immunoprecipitate theVSV epitope-tagged LR2-GST fusion protein (Fig. 3A, track c)but not the GST fusion protein of LYN SH3 (Fig. 3A, track e).However, after mixing these two chimeras together, we werethen able to co-immunoprecipitate them both, indicated by thedoublet evident on SDS-PAGE (Fig. 3A, track g), using theVSV-specific mAb but not by using a nonspecific mAb (Fig. 3A,track f). Indeed, a nonspecific mAb was ineffective in causingimmunoprecipitation of either chimera added alone or in com-bination (Fig. 3, tracks b, d, and f). These experiments demon-strate that the proline- and arginine-rich LR2 region that willbe found within all human PDE4A isoenzymes (32) can indeedinteract with the LYN SH3 domain. Indeed, as purified LYNSH3-GST and LR2-VSV-GST proteins were used in this study,this indicates that SH3 domain interaction with the humanPDE4A LR2 region was direct and did not involve any inter-mediary protein or any post-translational modification.

We have previously maintained that h6.1 (12, 22), like therodent N-terminal truncate Met26-RD1 (9, 10), was an entirelycytosolic species. However, in those studies we only analyzedthe high speed (P2) pellet and the supernatant fraction. Giventhe ability of h6.1 to interact with SH3 domains, we havere-investigated the intracellular localization of these two spe-cies in this study. This analysis (Table III) served to confirmthat h6.1 was located in the cytosol and not in the P2 fraction.However, we were also able to show (Table III) that ;23% ofthe total h6.1 immunoreactivity was associated with the P1particulate fraction. In marked contrast to this the rat trun-cate, Met26-RD1 was exclusively located within the high speedsupernatant fraction (Table III). This difference in associationof h6.1 and Met26-RD1 with the P1 particulate fraction mayexplain the previously reported differences in intracellular dis-tribution of these two species inferred from immunofluores-cence analyses done using laser scanning confocal microscopy(10, 12). In these studies the immunofluorescence of Met26-RD1was evenly spread throughout the cell, indicative of a solelycytosolic distribution (9), whereas h6.1 showed a nonuniformdistribution through the cell interior, with an increased label-ing associated with the perinuclear cytoskeleton (12). Thiswould be consistent with the association of h6.1 with a nuclear/cytoskeletal P1 subcellular fraction in addition to the highspeed supernatant/cytosol fraction. In order to determine ifassociation of h6.1 with the P1 pellet fraction was attributableto its proline- and arginine-rich LR2 region, we analyzed (TableIII) the intracellular distribution of the LR2 region deletionmutants, Da-h6.1 and Db-h6.1 (Fig. 1). Such mutants were, likeMet26-RD1, found exclusively in the high speed supernatant(cytosol) fraction (Table III). This suggests that the associationof h6.1 found with the P1 particulate fraction involves aninteraction between its LR2 region and an SH3 domain-con-taining protein. Consistent with this we were able to demon-strate (Fig. 3B) that the VSV-LR2-GST fusion protein was ableto prevent in vitro synthesized h6.1 from binding to a P1 pelletisolated from untransfected COS7 cells. As a control we wereable to demonstrate that GST was ineffective in this regard(Fig. 3B). This provides further support to the notion that h6.1associates with the P1 pellet fraction through an interactioninvolving its LR2 domain.

Although an interaction involving the proline- and arginine-rich sequences in LR2 may account for the association of h6.1with the P1 fraction, it cannot fully account for the associationof full-length pde46 with the P1 fraction. For the Db-pde46

TABLE IAssociation of pde46 and h6.1 with GST fusion proteins of

SH3 domainsPull-down assays were performed, as described under “Experimental

Procedures,” to determine the association of full-length (pde46) andN-terminally truncated (h6.1) human PDE4A forms with the SH3 do-mains of LYN and SRC expressed as GST fusion proteins. The associ-ation of PDE4A species was detected either by assaying PDE activity (1mM cAMP as substrate) or by immunoblotting with a PDE4A-specificantiserum raised against a C-terminal peptide. Binding is expressed asa percentage of the total activity/immunoreactivity present in the incu-bation mixture prior to pull down of the GST fusion proteins on gluta-thione-agarose. Native GST was used as a control. pde46 immunoreac-tivity was quantified as described in detail before by us (12) where aseries of dilutions of pde46-transfected COS-7 cell extracts (5–100 mg ofprotein), as well as bound and unbound fractions, were analyzed byWestern blotting with densitometric determinations done over linearranges. In these experiments 200 mg protein of COS-7 cell lysate wasused together with 23 200 mg of the various GST fusion proteins asdescribed under “Experimental Procedures.” These data show means 6S.D. of three separate experiments.

PDE46 bound SH3 h6.1 bound SH3

Activity Blot Activity Blot

% %

LYN SH3 93 6 7 88 6 6 22 6 3 28 6 6SRC SH3 23 6 5 28 6 7 13 6 2 11 6 3GST 2 6 3 0 6 2 1 6 2 2 6 3



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

mutant, whose LR2 domain has been modified to ablate bind-ing to SH3 domains, was still found associated, albeit at areduced level, with the P1 fraction (Table III). Similarly, therodent PDE4A isoenzyme, rpde6, which lacks the proline- andarginine-rich insert seen in the human LR2 region, was alsofound associated with the P1 fraction (Table III). These datasuggest that the N-terminal portion of these long PDE4A isoen-zymes is also involved in the targeting of these isoenzymes tocomponents found within the P1 fraction.

Immunoblotting COS7 cells (Fig. 4A) with a mAb specific forthe SRC family tyrosyl kinase, LYN, identified two immunore-active components of 56 6 1 and 53 6 2 kDa. These reflect thesizes of the two known splice variants of LYN (33). Subcellularfractionation studies showed that this kinase was locatedwithin both the P1 and P2 particulate fractions of COS7 cellsand was not found expressed in the cytosol (Fig. 4A). We havepreviously shown (12) that particulate pde46 could not be sol-ubilized using either high salt concentrations or the non-ionicdetergent Triton X-100, indicating that it is likely to be asso-ciated with the cytoskeleton. Similarly, under identical condi-tions of either high [NaCl] or with Triton X-100 or a combina-tion of both, we were unable to release LYN from particulatefractions (Fig. 4B). This suggests that pde46 and LYN mayboth be similarly associated with the particulate fractions.However, using an RIPA/Nonidet P-40 extraction method,which other investigators (see e.g. Ref. 34) have used to extractSRC family tyrosyl kinases from cells and determine associatedproteins through immunoprecipitation, then we were able toachieve the solubilization of both pde46 and LYN. This allowedus to demonstrate that solubilized pde46 and LYN could beco-immunoprecipitated using an anti-LYN antiserum (Fig. 5A),whereas a nonspecific antiserum was ineffective (Fig. 5A). Thepde46 that was co-immunoprecipitated with LYN was catalyt-

ically active. As noted for pde46 bound to LYN SH3 (see below),the activity of LYN-bound pde46 was similar (96 6 12%;mean 6 S.D.; n 5 3) to that of pde46 found in the cytosol oftransfected COS7 cells (100%; 1 mM cAMP as substrate). Theamount of pde46 that could be co-immunoprecipitated withLYN was variable, being in the range of 32–54% (n 5 3). This,undoubtedly, reflects the fact that complexes are likely to bedisrupted by varying extents during the lysis, extraction, andimmunoprecipitation procedures. Nevertheless, this procedureclearly identified an interaction occurring between these twoproteins. In contrast to this, however, we were unable to co-immunoprecipitate LYN and pde46 from the high speed super-natant (cytosol fraction) of COS7 cells (Fig. 5A, left-handpanel).

In order to address further the possibility that pde46 andLYN interact in intact COS7 cells, we utilized a confocal scan-ning microscopy approach. Immunofluorescence analyses ofCOS7 cells was done (Fig. 5B) using an antiserum specific forpde46 (rhodamine; red) and mAb specific for LYN (fluorescein;green). We noted (Fig. 5B) that pde46 immunofluorescence wasevident both at discrete cortical regions of the cell peripheryand also in a filamentous network surrounding the nucleusthat reflects the major cytoskeletal arrangement in these cells(12). The distribution of LYN immunofluorescence (Fig. 5B)was remarkably similar to that of pde46 and, indeed, overlay ofthe images yielded an essentially uniform “yellow” image, sug-gesting that both LYN and pde46 were highly co-localized inCOS7 cells. In contrast to analyses with pde46, it is clear thatthe distribution of the short rat PDE4A isoenzyme, RD1, inthese cells was entirely different from that of LYN and could beclearly distinguished (Fig. 5B). In addition the plasma mem-brane-located guanine nucleotide regulatory protein, Gsa, wasshown to have a punctate location at the cell plasma membrane

FIG. 2. Binding of pde46 and h6.1 to a LYN SH3 GST fusion protein. Panels A–C show immunoblots of HSPDE4A species analyzed usingan HSPDE4A-specific antisera. Data are typical of “pull-down” experiments done on three separate occasions and performed as described under“Experimental Procedures” using 500 mg protein of cell extracts and 20 mg protein of the various fusion proteins. Panel A shows the pellet (tracksa and c) and supernatant (tracks b and d) fractions for an experiment to assess the association of PDE46 with either GST itself (tracks a and b)or LYN SH3-GST (tracks c and d). Panel B shows the pellet (tracks b, d, f, and h) and supernatant (tracks a, c, e, and g) fractions for experimentsto determine the association of either h6.1 (tracks e—f, inclusive) or Da-h6.1 (tracks a—d) inclusive with either GST (tracks c, d, g, and h) or LYNSH3-GST (tracks a, b, e, and f). Panel C shows the pellet (tracks a and d) and supernatant (tracks b and c) fractions in experiments to determinethe association of Db-h6.1 with either GST (tracks a and b) or LYN SH3-GST (tracks c and d). Panel D demonstrates PhosphorImager data showingthat immunoprecipitated pde46 becomes labeled through [32P]ATP phosphorylation in the presence of protein kinase A. Panel E shows Phosphor-Imager data indicating that LYN SH3 is able to bind labeled pde46 after phosphorylation by PKA and [32P]ATP. The identity of this labeled bandwas confirmed using immunoblotting with PDE4A-specific antisera. Panel F shows that LYN SH3-GST (4 mg of protein) was able to pull down allof the immunoreactive pde46 in a cytosol/high speed supernatant fraction from forskolin-treated COS7 cells (100 mg of protein).



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

which was readily differentiated from that of pde46 (Fig. 5B).Such data provide independent evidence in support of an in-teraction between LYN and pde46 occurring in the particulatefraction of COS7 cells. Our confocal analyses might also implythat in intact COS7 cells the major fraction of pde46 is essen-tially particulate/LYN-associated. It is thus possible that cel-lular disruption may lead to the release of a fraction of pde46,

but not LYN, which is subsequently found in the high speedsupernatant (cytosol) fraction.

Within the sequence of pde46 are consensus motifs for pro-tein kinase A to elicit phosphorylation. We have thus at-tempted to ascertain whether pde46 would still be able tointeract with LYN SH3 under conditions of elevated cAMPwhere protein kinase A might be expected to be activated andpde46 could possibly become phosphorylated. We show here(Fig. 2D) that whereas pde46 can indeed be phosphorylated byPKA in vitro, this phosphorylated species is still capable ofbinding to LYN SH3 (Fig. 2E). We also noted that pde46 ob-tained from COS7 cells treated with the adenylyl cyclase acti-vator, forskolin, and the nonspecific PDE inhibitor, isobutyl-methylxanthine, in order to increase intracellular cAMP levels,did not alter the ability of pde46 to complex LYN SH3 (Fig. 2F).Under the conditions of such an experiment it is not known towhat extent pde46 might have become phosphorylated by PKA;nevertheless, the entire soluble pde46 component could bebound to LYN SH3 (Fig. 2F). Such data indicate that underconditions of elevated cAMP levels pde46 can still associatewith the LYN SH3 domain.

PDE4-selective inhibitors serve as potent anti-inflammatoryagents of potential therapeutic use (15–18). Of these, rolipramhas served as the paradigm. However, an enigma associatedwith this particular compound is its apparent ability to dis-criminate between two conformational states of PDE4 isoen-zymes that exhibit different affinities for inhibition by rolipram

TABLE IIInhibition of PDE4A species by rolipram

Data show IC50 values given as means 6 S.D. for n 5 3 separate experiments in each instance. Values are expressed in mM rolipram and wereobtained from dose-effect studies performed as described under “Experimental Procedures.” Assays were done with 1 mM cAMP as substrate. Nodifferences in the Km values using cAMP as substrate were noted for the various species bound to SH3 fusion proteins compared with those valuesfound for the corresponding enzyme expressed in the various subcellular fractions (,5% change; n 5 3). Similarly, the various mutants showedsimilar Km cAMP values compared with the parent species. The form of the Dixon plot is indicated as linear (L) or nonlinear (NL), namely parabolicwith, given in parentheses (n), the degree of nonlinearity (cooperativity) as assessed by fitting Dixon plot data to the equation y 5 mxn 1 C, wheren is equivalent to the Hill coefficient and is equal to unity for an enzyme obeying simple Michaelian kinetics of inhibition. Data are given forenzymes expressed in COS-7 unless stated otherwise. PDE activities (nmol/min/mg protein) of enzymes are given in parentheses for the source ofenzyme assayed. In experiments utilizing complexes of PDE enzymes and SH3 domains then, 200 mg of protein COS-7 cell lysate was used togetherwith 23 200 mg of the various GST fusion proteins as described under “Experimental Procedures.”

PDE4A form Source of enzyme assayed IC50 (mM)rolipram Dixon plot (n)

h6.1 Cytosolic (6.5 6 0.3) 0.80 6 0.12 L (0.98)h6.1 P1 fraction (3.6 6 0.2) 0.090 6 0.035 NL (0.23)h6.1 FYN SH3-associated (6.3 6 0.8) 0.057 6 0.010 NL (0.30)h6.1 LYN SH3-associated (6.0 6 0.5) 0.023 6 0.008 NL (0.21)Da h6.1 Cytosolic (6.7 6 0.3) 0.72 6 0.12 L (1.06)Db h6.1 Cytosolic (6.3 6 0.8) 0.68 6 0.10 L (0.99)pde46 Cytosolic (5.3 6 0.8) 1.25 6 0.15 L (0.99)pde46 P1 fraction (3.8 6 0.6) 0.15 6 0.07 NL (0.28)pde46 P2 fraction (2.2 6 0.3) 0.12 6 0.05 NL (0.31)Db pde46 Cytosolic (7.3 6 0.8) 1.1 6 0.2 L (0.99)Db pde46 P1 fraction (2.7 6 0.7) 1.1 6 0.1 L (1.0)Db pde46 P2 fraction (3.4 6 0.9) 0.95 6 0.18 L (1.02)pde46 FYN SH3-associated (5.5 6 0.7) 0.42 6 0.11 NL (0.3)pde46 LYN SH3-associated (4.8 6 0.6) 0.074 6 0.005 NL (0.22)Db pde46 LYN-associated (7.6 6 0.7) 1.2 6 0.1 L (1.02)rpde6 Cytosolic (6.1 6 0.4) 1.59 6 0.50 L (0.98)rpde6 P1 fraction (4.4 6 0.2) 2.56 6 0.04 L (1.10)rpde6 P2 fraction (3.0 6 0.3) 1.08 6 0.04 L (0.98)rpde6 LYN SH3-associated (6.2 6 0.6) 1.75 6 0.35 L (1.02)Met26 RD1 Cytosolic (7.8 6 0.7) 0.60 6 0.10 L (1.05)pde46 Cytosol from FSK-treated cells (4.8 6

0.6)1.15 6 0.08 L (0.98)

pde46 Cytosol from forskolin-treated cells 1LYN SH3-associated (4.5 6 0.7)

0.10 6 0.03 NL (0.23)

pde46 Cytosolic 1 GST (5.5 6 0.4) 1.36 6 0.07 L (1.02)pde46 Immunoprecipitated cytosolic form

(5.1 6 0.2)1.29 6 0.10 L (0.98)

h6.1 Cytosolic COS1 (6.0 6 0.5) 0.08 6 0.02 NL (0.40)Db-h6.1 Cytosolic COS1 (5.9 6 0.3) 0.61 6 0.05 L (1.02)pde46 Cytosolic COS1 (5.9 6 0.6) 0.12 6 0.05 NL (0.38)rpde6 Cytosolic COS1 (6.6 6 0.9) 1.70 6 0.4 L (0.99)Met26-RD1 Cytosolic COS1 (8.1 6 1.1) 0.58 6 0.08 L (0.97)

TABLE IIISubcellular distribution of PDE4A species in transfected COS cellsCOS cells were transfected, harvested, disrupted, and subjected to

differential centrifugation as described under “Experimental Proce-dures” to give a low speed P1 pellet fraction, a high speed P2 pelletfraction, and a high speed supernatant (s/n) fraction. Data are fromthree separate experiments. Distribution is given as a percentage of theimmunoreactive species found in each fraction using antisera specificfor either human or rat PDE4A isoenzymes. Unless stated otherwise,COS-7 cells were used.

Distribution

P1 P2 s/n

% % %

pde46 19 6 4 26 6 3 55 6 5Db pde46 9 6 1 21 6 3 70 6 8h6.1 23 6 4 1 6 0.5 76 6 6Da h6.1 1 6 1 3 6 2 96 6 7Db h6.1 0.6 6 1 3 6 1 96.4 6 7rpde6 21 6 3 28 6 4 51 6 4Met26-RD1 0.1 6 0.6 5 6 4 94.9 6 3h6.1 (COS1 cells) 27 6 5 5 6 4 68 6 1



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(15, 16). The molecular basis underlying these two proposedconformational states, at least as regards PDE4A isoenzymes,is unknown. Of particular interest then was our striking ob-servation (12) that, expressed transiently in COS7 cells, theparticulate form of pde46 was found to be profoundly moresensitive to inhibition by rolipram than the cytosolic form ofpde46. Not only this, but the kinetic mechanism of rolipraminhibition of particulate-associated pde46 appeared to be al-tered in a fashion that implied that the enzyme in this fractionhad undergone a conformational change (12). Here we evalu-ated the ability of rolipram to inhibit pde46 when complexedwith the SH3 domains of both LYN (Fig. 6A and Table II) andFYN (Table II) provided as GST fusion proteins. These dataclearly demonstrated that SH3-bound pde46 exhibited a pro-found increase in its sensitivity to inhibition by rolipram. In-deed, the IC50 values for inhibition of LYN SH3- and FYNSH3-associated pde46 were ;17- and ;3-fold lower, respec-tively, than those observed for cytosolic pde46 expressed inCOS7 cells (Table II). Such differences were of a similar mag-nitude (;13-fold) to that reported previously by us (12) forparticulate-associated pde46 (IC50 5 0.2 mM) compared withcytosolic pde46 (IC50 5 2.6 mM) expressed in transiently trans-fected COS7 cells. We determined, as a control, that the addi-tion of purified GST to cytosolic pde46 did not affect the sensi-tivity of this enzyme to inhibition by rolipram (Table II). In afurther control we attempted to determine whether complexformation per se would alter the sensitivity of pde46 to rolipramby analyzing cytosolic pde46 which had been immunoprecipi-tated with an antiserum specific to PDE4A. This immobilizedform of pde46 did not show any change in the sensitivity andkinetics of inhibition by rolipram (Table II). Thus particulatepde46 did not show an altered sensitivity to rolipram inhibitionmerely on the basis that it was immobilized; rather, the specificinteraction of an appropriate SH3 domain with its LR2 region

was required.Dixon plots of the reciprocal of reaction velocity versus roli-

pram concentration have been shown to be linear for the cyto-solic form of pde46 but parabolic for the particulate enzymeexpressed in COS7 cells (12). Such a profound change is indic-ative of an altered kinetic status of the particulate form ofpde46. This has been interpreted (12) as being due to a confor-mation-induced change in the particulate enzyme that alteredthe kinetics of inhibition from simple competitive to partialcompetitive in nature. Although two alternative possibilitieshave been suggested (3), namely that the particulate fraction ofCOS7 cells might contain pde46 as either a mixture of twoconformational states with different affinities for rolipram orone exhibiting negatively cooperative kinetics of inhibition, inboth instances SH3 domain interaction would have to achieve a

FIG. 4. Expression of LYN in COS7 cells. Panel A shows an im-munoblot using a mAb specific for LYN probing the P1, P2, and highspeed supernatant (s/n) fractions of COS7 cells (25 mg of protein perlane). A doublet of 56 and 53 kDa was seen in both the P1 and P2fractions, but no immunoreactivity was observed in the cytosol fraction.Panel B shows the P2 pellet fraction treated with either buffer, 2 M

NaCl, 5% Triton X-100, or NaCl 1 Triton X-100, and then the residualpellet (p) and supernatant (s) were separated and immunoblotted forLYN (25 mg of protein per lane).

FIG. 3. Interaction of the LR2 region of HSPDE4A with LYN SH3. Panel A shows pull-down assays were done as described under“Experimental Procedures.” An epitope (VSV)-tagged version of LR2 was generated as a GST fusion protein and analyzed for interaction with bothGST and a LYN SH3-GST fusion protein. The experiment shown is typical of one done on three separate occasions and reflects an immunoblotprobed using an antiserum specific for GST. GST (track a), GST-LYN SH3 (track i), and GST-LR2-VSV (track h) are shown to migrate as singleimmunoreactive species on SDS-PAGE with molecular masses of 28, 36, and 33 kDa, respectively. In some instances a VSV-specific mAb was usedfor immunoprecipitation. Thus indicated in the row labeled, VSV ippt mAb, the symbol 1 indicates the use of the specific anti-VSV mAB, thesymbol 2 if no immunoprecipitation was performed, and the letter c if a control mAb was employed. Probes of immunoprecipitates showed thatthe use of nonspecific antibody failed to immunoprecipitate either GST-LR2-VSV (track b) or GST-LYN SH3 (track d) or a mixture of both of theseproteins (track f). Use of an anti-VSV mAb immunoprecipitated GST-LR2-VSV (track c) but did not immunoprecipitate GST-LYN SH3 (track e)when these species were alone exposed to this antibody (labeled as 1). However, using a mixture of GST-LR2 versus plus GST-LYN SH3 thenanti-VSV antibody immunoprecipitated both species (track g) as indicated by a doublet detected using the anti-GST antibody. Panel B shows thebinding of [35S]methionine-labeled h6.1, generated in a TNT-coupled transcription-translation system, to the P1 fraction of COS7 cell membranesas detected by PhosphorImager analysis. No binding to the P2 membrane fraction was detected (data not shown). Track a demonstrates h6.1binding when h6.1 was incubated alone with membranes; track b indicates the abrogation of binding when incubations were done with h6.1 in thepresence of 100 nM of the human PDE4A-LR2 region expressed as a GST fusion protein; and panel c reflects binding of h6.1 occurring withincubation done in the presence of 100 nM GST. This is a typical experiment of one done on two separate occasions. Details are given under“Experimental Procedures.”



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIG. 5. Interaction of pde46 and LYN in COS7 cells. Panel A, the P2 pellet fraction (500 mg of protein) from both COS7 and COS1 cells thathad been transiently transfected with a plasmid encoding pde46 was solubilized using RIPA buffer and then subjected to immunoprecipitationusing either an anti-LYN polyclonal antiserum or a control antiserum. The immunoprecipitate was then subjected to SDS-PAGE and immuno-blotting. In the upper panel immunoblots were developed using an antiserum specific for PDE4A and in the lower panel a mAb specific for LYN.Cytosol (500 mg of protein) from pde46-transfected COS1 and COS7 cells (as indicated) was subjected to immunoprecipitation using polyclonalantisera specific for either LYN or SRC as well as a nonspecific antisera (control). Blots were then developed using an antibody specific for PDE4A.Panel B, COS7 cells were analyzed using a laser scanning confocal microscope. The upper set of pictures relates to cells transfected to expresspde46. A series of 0.25-mm optical sections were analyzed for the co-localization studies. Here we show an optical section taken through the centerof the cell that has been probed with a PDE4A-specific antiserum (detected with goat anti-rabbit IgG labeled with FITC; rhodamine red), and alsowith a specific LYN mAb (detected with a goat anti-mouse IgG labeled with FITC; fluorescein green). The pde46 “image” (pde46, red) and LYNimage (LYN, green) are given together with a combined (superimposed) image (pde46 1 LYN combined) plus a combined image of another cell(pde46 1 LYN combined (2)). The pattern of immunofluorescence of both LYN and pde46 in all optical sections (;30 at 0.25 nM) taken through thesecells was very similar and in each instance yielded a uniform yellow image indicative of a high degree of co-localization seen in three different



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

transfection studies. Analyses were also done to compare the distribution of pde46 with Gsa and LYN with the rat short form PDE4A, RD1. In thepde46 analysis with Gsa a PDE4A mAb was employed, and anti-mouse IgG was labeled with ALEXA594 (red) and used for its detection, whereasGsa was probed with a specific rabbit polyclonal antibody with detection using an anti-rabbit IgG labeled with FITC (green). In the RD1 analysiswith LYN, a PDE4A-specific antiserum was used to probe RD1 with detection using goat anti-rabbit IgG labeled with FITC (red) and LYN wasprobed using a specific mAb with detection using a goat anti-mouse IgG labeled with FITC (green). Analyses were repeated using differentcombinations of fluorescent labeled antisera with similar results.

FIG. 6. Rolipram inhibition of LYN SH3-bound pde46. Panel A shows the dose-dependent inhibition, by rolipram, of soluble cytosolic pde46(●) and of LYN SH3-bound pde46 (E); panel B shows the Dixon plot transform of the reciprocal of the PDE activity against [rolipram] for cytosolicpde46 (●) and LYN-SH3 bound pde46 (E); panel C shows the dose-dependent inhibition, by rolipram, of Db-pde46 found in the soluble cytosolicfraction (●), the P2 fraction (f), and when LYN SH3 bound (E); panel D shows the Dixon plot transform for particulate-bound Db-pde46 (f) andLYN SH3-bound Db-pde46 (E). PDE4 enzymes were all expressed in COS7 cells. Where appropriate, in these experiments 200 mg of protein ofCOS7 cell lysate was used together with 23 200 mg of the various GST fusion proteins as described underr “Experimental Procedures.” Assays weredone at 1 mM cAMP substrate using preparations with activities shown in Table II. Data are mean 6 S.D. for n 5 3 separate experiments.



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

conformational change in pde46 which led to altered kinetics ofrolipram inhibition. In a similar fashion to that seen for par-ticulate-associated pde46, we see here that Dixon replots (Fig.6B) for rolipram inhibition of LYN SH3-bound pde46 were bothparabolic with similar Hill coefficients that were strikingly lessthan unity (Table II). Similarly, analyzing the N-terminal trun-cate h6.1 bound to the SH3 domains of both LYN and FYN, wealso observed a profound increase in sensitivity to inhibition byrolipram compared with the soluble enzyme (Fig. 7A and TableII) as well as parabolic Dixon plots compared with the linearones seen for the cytosolic form of h6.1 expressed in COS7 cells(Fig. 7B and Table II). Furthermore, we show here that, as withpde46, the particulate (P1) associated form of h6.1 also exhib-ited an enhanced sensitivity to inhibition by rolipram andparabolic Dixon replots, compared with its soluble (cytosolic)form (Table II and Fig. 7, panels A and B).

We would like then to suggest that it is SH3 domain bindingto the LR2 region that is responsible for triggering a conforma-tional change in the catalytic unit of the particulate bound

forms of pde46 and h6.1 and that is detected by a profoundalteration in the kinetics of rolipram inhibition of these en-zymes. As indicated by the studies described above, it wouldseem that the particulate, but not soluble (cytosolic), form ofpde46 is associated with LYN in COS7 cells. We thus proposethat it is the interaction between the LR2 region of pde46 andh6.1 with the LYN SH3 domain that underpins the alteredkinetics of rolipram inhibition seen for the particulate forms ofboth these enzymes (Table II). In order to try and gauge this weanalyzed (Fig. 6, panels C and D) the kinetics of rolipraminhibition of Db-pde46. This mutant, although expected to in-teract with LYN SH3 through its N-terminal region, has adisrupted LR2 region (Fig. 1) which, on the basis of studiesdone using Db-h6.1 (Fig. 2), will be unable to interact with theSH3 domain of LYN. Analyses were done comparing the solu-ble, cytosolic form of Db-pde46 with both this form bound toLYN SH3 and the Db-pde46 form expressed in the particulatefraction of transfected COS7 cells (Table II and Fig. 6 panels Cand D). As distinct from native pde46, the Db-pde46 mutantexhibited dose-effect curves for rolipram inhibition that weresimilar in form for both the cytosolic, the particulate, and theLYN SH3-bound states (Fig. 6, panels C and D). Additionally,Dixon plots of the reciprocal of PDE activity against rolipramconcentration were also linear for both the LYN SH3-boundand the particulate-bound forms of Db-pde46 (Fig. 6, D), as wellas those for Db-h6.1 (Table II). Interestingly, the IC50 valuesderived for inhibition of Db-pde46 by rolipram in these variousstates mirrored that exhibited by the cytosolic form of pde46(Table II), indicating that this deletion “traps” the enzyme inthe low affinity state for rolipram inhibition. Additional evi-dence that it is essential to have an LR2 region able to interactwith SH3 domains to elicit a heightened sensitivity to inhibi-tion by rolipram can also be demonstrated by analysis of rpde6,the rodent homologue of pde46. We have shown previously (11)that particulate rpde6 did not exhibit any increase in sensitiv-ity to rolipram inhibition compared with its cytosol form, andwe confirm this observation here (Table II). In addition, weshow here that association of cytosolic rpde6 with LYN SH3 didnot engender any change in sensitivity to inhibition by rolip-ram (Table II) and, furthermore, Dixon analyses of rolipraminhibition of particulate-associated rpde6 were linear and in-dicative of kinetics of simple competitive inhibition by rolipram(Table II and data not shown), unlike those for particulatepde46 (12). Such data are all consistent with the importance ofthe proline- and arginine-rich sequences found in the humanPDE4A LR2 region for the SH3- and particulate association-mediated change in rolipram kinetics of the human PDE4Aenzyme, pde46.

While rolipram serves as the paradigm for a PDE4-selectiveinhibitor that can discriminate between the two proposed con-formational states of PDE4 isoenzymes, it has also been sug-gested that certain other selective PDE4 inhibitors are not ableto be similarly discriminatory (15, 16). Thus the PDE4-selec-tive inhibitor SB207499 (Fig. 8A) has been demonstrated (35)to inhibit similarly the two conformational “states” that PDE4enzymes(s) adopt and that can be discriminated by rolipram.On this basis, if SH3 interaction with the LR2 region of pde46offered a means of “switching” PDE4 conformation, one mightpredict that such an interaction would not affect inhibition ofpde46 by SB207499. Indeed this seems to be the case (Fig. 8B)as the IC50 values for SB207499 of the cytosolic, particulate(P2), and LYN SH3-bound forms of pde46 were very similar at0.12 6 0.02, 0.10 6 0.02, and 0.15 6 0.04 mM, respectively (n 53 separate experiments; means 6 S.D.). RP73401 (Fig. 8A) hasbeen shown (36) to be unable to discriminate between the twoconformational states of PDE4 detected by altered rolipram

FIG. 7. Rolipram inhibition of LYN SH3-bound h6.1. Panel Ashows the dose-dependent inhibition of h6.1 found in the cytosol (●)compared with that found in the P1 fraction (f) and when bound toLYN SH3 (E); panel B shows the Dixon transform of the reciprocal ofthe PDE activity against [rolipram] for cytosolic h6.1 (●), P1 fractionpellet-associated h6.1 (f), and h6.1 bound to LYN SH3 (E). PDE4enzymes were expressed in COS7 cells. Where appropriate, in theseexperiments 200 mg of protein of COS7 cell lysate was used togetherwith 23 200 mg of the various GST fusion proteins as described under“Experimental Procedures.” Data show means 6 S.D. for n 5 3 separateexperiments. Assays were done at 1 mM cAMP substrate using prepa-rations with activities shown in Table II.



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

inhibition. We observed here that RP73401 inhibited the cyto-solic, P2 particulate and LYN SH3-associated forms of pde46similarly (Fig. 8C) with IC50 values of 1.0 6 0.2, 1.5 6 0.3, and0.9 6 0.4 nM, respectively (n 5 3 separate experiments). Thusthe particulate and LYN SH3-bound forms of pde46 appear toreflect a distinct conformational state of the enzyme that isdetectable by increased sensitivity to inhibition by rolipram. Aspde46 is expressed in many cell types (6), it is possible thatsuch a conformer may provide at least a fraction of the highaffinity rolipram-inhibited fraction reported by many investi-gators in crude cell systems (3, 16, 37–39).

It is thus likely that pde46 expressed in different cell typesmay exhibit markedly different sensitivities to inhibition byrolipram, dependent upon whether its LR2 region is interactingwith an SH3 domain-containing protein or not. Indeed, themagnitude of any alteration in rolipram IC50 value may reflectthe nature of the interacting SH3 domain containing protein,as pde46 association with LYN SH3 and FYN SH3 yieldedbound enzymes that exhibited rather different IC50 values forinhibition by rolipram (Table II). The putative interaction be-tween human PDE4A isoenzymes and SH3-containing proteinsmight not only be expected to occur in cell particulate fractionsbut also with cytosolic SH3 containing proteins in a cell type-specific fashion. This may provide an explanation for observa-

tions indicating that pde46 and h-pde1, a species equivalent toh6.1, expressed in different systems from the COS7 cells usedin this study, yielded parabolic Dixon plots for rolipram inhi-bition (36, 40, 41). Intriguingly, both of these groups showedthat apparently normal kinetics of rolipram inhibition ensuedwhen grossly N-terminal truncated species, which lacked theLR2 region, were used (36, 41). Certainly, if soluble pde46,expressed in COS1 cells (41), and soluble h6.1 (h-pde1), ex-pressed in Saccharomyces cerevisiae (36, 40), were able to in-teract with a cytosolic, SH3 domain-containing protein thensuch truncation, which served to remove the LR2 domain,would be expected to convert the complex kinetics of rolipraminhibition to a simple Michaelian state. As the COS1 cell sys-tem was experimentally accessible to us, we took this as amodel system to evaluate our proposal. We were able to confirmthe observations of Owens et al. (41) that, unlike expression inthe cytosol of COS7 cells (Table II), pde46 expressed in thecytosol of COS1 cells yielded parabolic Dixon plots for rolipraminhibition (Table II). Additionally, we also expressed h6.1 inCOS1 cells and found (Fig. 9), again in dramatic contrast toexpression in COS7 cells, nonlinear Dixon plots for rolipraminhibition (Fig. 9 and Table II). In both these instances thecytosolic forms of these enzymes expressed in COS1 cells wereconsiderably more sensitive to inhibition by rolipram than

FIG. 8. Inhibition of pde46 by thePDE4-selective inhibitors RP73401and SB207499. Panel A, structure of ro-lipram, RP73401, and SB207499; panel B,SB207499 dose inhibition data for the in-hibition of pde46 activity from transientlytransfected COS7 cells using the highspeed supernatant/cytosol (s/n) fraction(●), the particulate (P2) pellet fraction(f), and the cytosol fraction bound to LYNSH3 (E); panel C, RP73401 dose inhibi-tion data for the inhibition of pde46 activ-ity from transiently transfected COS7cells using the high speed supernatant/cytosol (s/n) fraction (●), the particulate(P2) pellet fraction (f), and the cytosolfraction bound to LYN SH3 (E). Whereappropriate, in these experiments 200 mgof protein of COS7 cell lysate was usedtogether with 23 200 mg of the variousGST fusion proteins as described under“Experimental Procedures.” The dose-ef-fect data represent the average of threeseparate experiments using different celltransfections. Assays were done at 1 mM

cAMP substrate using preparations withactivities shown in Table II.



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

when they were expressed in COS7 cells (Table II). However,we were also able to demonstrate that Db-h6.1, the mutantwhose crippled LR2 region was unable to interact with SH3domains (Fig. 2), exhibited normal Michaelian kinetics of roli-pram inhibition when expressed in COS1 cells (Fig. 9 and TableII). This mutant was also similarly sensitive to inhibition byrolipram when it was expressed in both COS1 and COS7 cells(Table II). Furthermore, when rpde6, the rat homologue ofpde46, was expressed in COS1 cells, the cytosolic form of thisenzyme exhibited normal Michaelian kinetics of inhibition byrolipram (Table II) as did the cytosolic rat N-terminal PDE4Atruncate, Met26-RD1 (Fig. 9). Such observations indicate theimportance of an intact human PDE4A LR2 domain in allowingcytosolic PDE4A species expressed in COS1 cells, rather thanCOS7 cells, to exhibit non-Michaelian kinetics of rolipram in-hibition. We suggest that in COS1 cells, as distinct from COS7cells, cytosolic pde46 may be interacting through its LR2 do-main with an SH3-containing protein, and it is this interactionthat is responsible for switching its conformation and thusaltering its kinetics of inhibition by rolipram. To investigatethis possibility, we examined whether pde46 could be co-immu-noprecipitated with an SRC family tyrosyl kinase from thecytosol of COS1 cells. Although we were unable to co-immuno-precipitate pde46 from the cytosol of either COS1 or COS7 cellswith LYN (Fig. 5A), we discovered that pde46 could be immu-noprecipitated with SRC itself from the high speed superna-tant fraction of COS1 cells but not from COS7 cells (Fig. 5A).The pde46 enzyme that was co-immunoprecipitated with SRCkinase from the high speed supernatant fraction of COS1 cellsexhibited a similar (102 6 18%; mean 6 S.D.; n 5 3) activity tothat of pde46 (100%; 1 mM cAMP substrate) expressed in thehigh speed supernatant fraction of COS7 cells, where it was notassociated with SRC kinase (Fig. 5A). This is consistent withthe lack of change in the PDE activity of pde46 we observedupon its association with SRC SH3 (see below). The amount ofpde46 that could be immunoprecipitated with SRC kinase fromthe high speed supernatant fraction of COS1 cells varied in a

range of 20–38% (range; n 5 3) of the total pde46 in thefraction. This may indicate that either not all of the pde46 isbound to SRC kinase in the cytosol of COS1 cells or thatcomplexes have been disrupted during the processes of celllysis, fractionation, and immunoprecipitation. Nevertheless,such data clearly indicate that such an interaction does occur inthe high speed supernatant analyzed. This suggests that PDEassays done on this fraction will possibly monitor two popula-tions of pde46, one which is bound to SRC kinase and one whichis not. That population bound to SRC kinase will exhibit anincreased sensitivity to inhibition by rolipram. Thus the pres-ence of two enzyme populations of pde46, found in the highspeed supernatant fraction of COS1 cells, with very differentsensitivities to inhibition by rolipram will in itself serve toexacerbate the nonlinear, parabolic nature of Dixon replots (3).Thus the association of cytosolic pde46 with SRC kinase inCOS1 cells, but not COS7 cells, may provide the molecularbasis of the differences in kinetics of rolipram inhibition of thishuman PDE4A enzyme expressed in these two different cellbackgrounds.

Catalytic activity toward cAMP did not appear to alter sub-sequent to the interaction of pde46, expressed in the cytosol ofCOS7 cells, with LYN SH3. Thus the free enzyme exhibited aKm value of 2.6 6 0.6 mM, whereas that complexed to LYN SH3exhibited a Km value of 2.9 6 0.5 mM (mean 6 S.D.; n 5 3separate experiments). In addition there was little change inthe Vmax value of the LYN SH3-bound enzyme, which was 97 618% (n 5 3) that of the enzyme found in the high speed super-natant (100%). Similar data were found for rpde6, with Km

values of 2.4 6 0.7 and 3.2 6 0.4 (mean 6 S.D.; n 5 3 separateexperiments) for the free and LYN SH3-bound enzymes, re-spectively. Additionally the Vmax value of the LYN SH3-com-plexed enzyme was 96 6 8% (mean 6 S.D.; n 5 3 separateexperiments) that of the free enzyme, indicating that no changein activity occurred.

CONCLUSION

We would like to suggest that pde46 and, indeed, presumablyall human PDE4A isoenzymes will be able to undergo a con-formational change in their catalytic unit that is controlled bya “switch” located in their exon 8-encoded (32) LR2 region. Thiscan be operated by interaction with the SH3 domains of certainproteins, with a propensity for the involvement of those of SRCfamily tyrosyl kinases. Such an interaction may be of relevancein that tyrosyl protein kinases, such as LYN, are of crucialimportance in controlling the function of a variety of cell types,including T-cells (42) and monocytes (43), where PDE4-selec-tive inhibitors can potently inhibit cell function and exert anti-inflammatory effects (15). The switch region in human PDE4Aenzymes is located within LR2. It appears to be critically de-pendent upon an insert that is found in human but not in ratPDE4A forms (32). This contains the five residue repeatPRPRP (residues 314–318) that is required to create a putativeSH3 binding motif of the form, RXXPXXP. There is a precedentfor conformational changes in proteins that are subject to in-teraction with SH3 domain containing proteins in that thebinding of FYN SH3 to the HIV-1 Nef protein causes a changein the conformation of the proline-rich helical region in Nef(44). PDE4 enzymes are multidomain proteins, and it is possi-ble that an SH3 domain-induced change in the structure of theLR2 region could trigger an alteration in the conformation ofthe catalytic unit that is detected by altered inhibition by thecompetitive inhibitor, rolipram. Certainly there is a precedentfor this in that Conti and co-workers (45, 46) have shown thatprotein kinase A-mediated phosphorylation within the UCR1region of HSPDE4D3 can activate this isoenzyme. Such a mod-ification also appears to increase the sensitivity of PDE4D3 to

FIG. 9. Inhibition of h6.1 transiently expressed in COS1 cells.Dixon replot analyses are shown for rolipram inhibition of cytosol/highspeed supernatant fractions of COS1 cells transfected to express eitherh6.1 (Œ), Db-h6.1 (‚), or Met26-RD1 (l). These data are typical ofexperiments done on three separate occasions using different cell trans-fections. Assays were done at 1 mM cAMP substrate using preparationswith activities shown in Table II.



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

inhibition by rolipram through a conformational change whichis distinct from that which leads to enzyme activation (47).Such data indicate that conformational changes in PDE4 N-terminal regions are able to alter the conformation and func-tioning of the catalytic unit. The suggestion has been made (16,39) that PDE4 enzymes may be able to adopt distinct confor-mations that are reflected by different susceptibilities to inhi-bition by rolipram. The PKA-mediated phosphorylation ofHSPDE4D3 may present one possible route for this to beachieved (47, 48). Here we suggest that an additional routemay be provided by human PDE4A isoenzymes when theyinteract through their LR2 region with appropriate SH3 do-main-containing proteins. That this interaction causes such aprofound change in the sensitivity of these enzymes to inhibi-tion by rolipram might be expected to have consequences forthe development of PDE4 inhibitors. For example, the samePDE4A isoenzyme may exhibit very different sensitivities toinhibition by certain PDE4-selective inhibitors in differentcells, subcellular fractions, and changes in the conditions of cellactivation. The identification of such a molecular switch alsooffers the possibility of developing agents able to interact withthe human PDE4A LR2 domain which either mimic or ablatethe action triggered by SH3 binding and thus may either en-hance or depress the ability of PDE4A enzymes to be inhibitedby compounds akin to rolipram.

There is considerable similarity between the sequences of thecatalytic regions of various PDE family members (3, 6, 7).Colicelli and co-workers (49, 50) have devised an ingeniousmeans of identifying residues within PDE4 which are essentialfor selective inhibition by rolipram. These all map within adiscrete region of ;70 residues which encompasses part of theC-terminal end of the catalytic unit and part of the C-terminalregion itself (Fig. 1). This “inhibitor selectivity” region is en-coded within a single exon (exon 15) that is unique to the PDE4family (32). It is thus tempting to suggest that if this inhibitorselectivity region defines specificity for rolipram inhibition,then the binding of SH3 domains to the LR2 region of humanPDE4A isoenzymes may trigger conformational changes withinthe inhibitor selectivity region. Intriguingly, it has been noted(51) that certain mutations in the inhibitor selectivity region,while exerting severe effects on inhibition of the enzyme byrolipram, have little effect on inhibition by RP73401. Thisindicates that there are binding interactions within the inhib-itor selectivity region that are specific for each of these PDE4-selective inhibitors. Indeed, structural differences between ro-lipram and RP73401 (Fig. 8A) would indicate that this might beexpected. The conformational change elicited by the interactionof an SRC family tyrosyl kinase SH3 domain with the LR2region of human PDE4A may then extend to specific regions atthe C-terminal end of the catalytic unit that are probed byrolipram and not by RP73401. Thus subtle and localizedchanges ensue through this interaction. The precise nature ofsuch changes will require delineation subsequent to three-dimensional structural analyses of a human PDE4A whichincludes the LR2 domain.

We suggest that the particulate form of pde46 expressed inCOS7 cells interacts with the tyrosyl kinase LYN. The basis ofsuch a contention lies upon our observations that (i) thesespecies can be co-immunoprecipitated, (ii) they were shown toco-localize in immunofluorescence studies, (iii) they are bothfound in the P1 and P2 pellet fractions of COS7 cells wherethey are similarly resistant to release by Triton X-100 and high[NaCl], and (iv) that the functional change in rolipram inhibi-tion seen for the particulate form of pde46, compared with itscytosolic form, can be mimicked upon the binding of the cyto-solic form to a LYN SH3. We localize the site of interaction of

LYN SH3 which leads to altered rolipram inhibition to the LR2region of pde46 using both a deletion strategy, comparison withrat homologues, and by demonstrating the interaction of achimeric LR2 region with a chimeric LYN SH3 region. Al-though a diverse range of proteins exhibit SH3 domains, thenumber of proteins that have been identified as being able tobind them is still relatively small. This study identifies a pos-sible contender and points to the SH3 domain interaction trig-gering a conformational change in the multi-domain PDE4Aenzyme. Notwithstanding this, the putative physiological roleof an interaction between the LR2 region of pde46 and anSH3-containing protein remains to be ascertained.

REFERENCES

1. Rubin, C. S. (1994) Biochim. Biophys. Acta 1224, 467–4792. Houslay, M. D., and Milligan, G. (1997) Trends Biochem. Sci. 22, 217–2243. Houslay, M. D., Sullivan, M., and Bolger, G. B. (1997) Adv. Pharmacol. 44,

225–3424. Faux, M. C., and Scott, J. D. (1996) Trends Biochem. Sci. 21, 312–3185. Beavo, J. A. (1995) Physiol. Rev. 75, 725–7486. Bolger, G. (1994) Cell. Signalling 6, 851–8597. Conti, M., Nemoz, G., Sette, C., and Vicini, E. (1995) Endocr. Rev. 16, 370–3898. Juilfs, D., Fulle, H. J., Zhao, A. Z., Houslay, M. D., Garbers, D., and Beavo,

J. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3388–33959. Shakur, Y., Pryde, J. G., and Houslay, M. D. (1993) Biochem. J. 292, 677–686

10. Shakur, Y., Wilson, M., Pooley, L., Lobban, M., Griffiths, S. L., Campbell,A. M., Beattie, J., Daly, C., and Houslay, M. D. (1995) Biochem. J. 306,801–809

11. McPhee, I., Pooley, L., Lobban, M., Bolger, G., and Houslay, M. D. (1995)Biochem. J. 310, 965–974

12. Huston, E., Pooley, L., Julien, J., Scotland, G., McPhee, I., Sullivan, M., Bolger,G., and Houslay, M. D. (1996) J. Biol. Chem. 271, 31334–31344

13. Bolger, G. B., McPhee, I., and Houslay, M. D. (1996) J. Biol. Chem. 271,1065–1071

14. Bolger, G. B., Erdogan, S., Jones, R. E., Loughney, K., Scotland, G., Hoffmann,R., Wilkinson, I., Farrell, C., and Houslay, M. D. (1997) Biochem. J. 328,539–548

15. Torphy, T. J., Barnette, M. S., Hay, D. W. P., and Underwood, D. C. (1994) Env.Health Perspect. 102, 79–84

16. Souness, J. E., and Rao, S. (1997) Cell. Signalling 9, 227–23617. Giembycz, M. A. (1996) Trends Pharmacol. Sci. 17, 331–33618. Schudt, C., Tenor, H., and Hatzelmann, A. (1995) Eur. Respir. J. 8, 1179–118319. Bolger, G., Michaeli, T., Martins, T., St John, T., Steiner, B., Rodgers, L.,

Riggs, M., Wigler, M., and Ferguson, K. (1993) Mol. Cell. Biol. 13,6558–6571

20. Pawson, T. (1995) Nature 373, 573–58021. Saksela, K., Cheng, G., and Baltimore, D. (1995) EMBO J. 14, 484–49122. Sullivan, M., Egerton, M., Shakur, Y., Marquardson, A., and Houslay, M. D.

(1994) Cell. Signalling 6, 793–81223. Wilson, M., Sullivan, M., Brown, N., and Houslay, M. D. (1994) Biochem.l J.

304, 407–41524. O’Connell, J. C., McCallum, J. F., McPhee, I., Wakefield, J., Houslay, E. S.,

Wishart, W., Bolger, G., Frame, M., and Houslay, M. D. (1996) Biochem. J.318, 255–262

25. Huston, E., Lumb, S., Russell, A., Catterall, C., Ross, A. H., Steele, M. R.,Bolger, G. B., Perry, M., Owens, R., and Houslay, M. D. (1997) Biochem. J.328, 549–558

26. Laemmli, U. K. (1970) Nature 222, 680–68527. Scotland, G., and Houslay, M. D. (1995) Biochem. J. 308, 673–68128. Smith, K. J., Scotland, G., Beattie, J., Trayer, I. P., and Houslay, M. D. (1996)

J. Biol. Chem. 271, 16703–1671129. Thompson, W. J., and Appleman, M. M. (1971) Biochemistry 10, 311–31630. Marchmont, R. J., and Houslay, M. D. (1980) Biochem. J. 187, 381–39231. Bradford, M. M. (1976) Anal. Biochem. 72, 248–25432. Sullivan, M., Rena, G., Begg, F., Gordon, L., Olsen, A. S., and Houslay, M. D.

(1998) Biochem. J. 333, 693–70333. Yi, T., Bolen, J. B., and Ihle, J. N. (1991) Mol. Cell. Biol. 11, 2391–239834. Chang, B. Y., Conroy, K. B., Machleder, E. M., and Cartwright, C. A. (1998)

Mol. Cell. Biol. 18, 3245–325635. Barnette, M. S., Christensen, S. B., Essayan, D. M., Grous, M., Prabhakar, U.,

Rush, J. A., Kagey-Sobotka, A., and Torphy, T. J. (1998) J. Pharmacol. Exp.Ther. 284, 420–426

36. Jacobitz, S., McLaughlin, M. M., Livi, G. P., Burman, M., and Torphy, T. J.(1996) Mol. Pharmacol. 50, 891–899

37. Souness, J. E., Carter, C. M., Diocee, B. K., Hassall, G. A., Wood, L. J., andTurner, N. C. (1991) Biochem. Pharmacol. 42, 937–945

38. Souness, J. E., and Scott, L. C. (1993) Biochem. J. 291, 389–39539. Torphy, T. J., Dewolf, W., Green, D. W., and Livi, G. P. (1993) Agents Actions

43, 51–7140. Torphy, T. J., Stadel, J. M., Burman, M., Cieslinski, L. B., McLaughlin, M. M.,

White, J. R., and Livi, G. P. (1992) J. Biol. Chem. 267, 1798–180441. Owens, R. J., Catterall, C., Batty, D., Jappy, J., Russell, A., Smith, B.,

O’Connell, J., and Perry, M. (1997) Biochem. J. 9, 575–58542. Erpel, T., and Courtneidge, S. A. (1995) Curr. Opin. Cell Biol. 7, 176–18243. Herrera-Velit, P. R. N. E. (1157) J. Immunol. 156, 1157–116544. Arold, S., Franken, P., Strub, M.-S., Hoh, F., Benichou, S., Benarous, R., and

Dumas, C. (1997) Structure 5, 1361–137245. Alvarez, R., Sette, C., Yang, D., Eglen, R. M., Wilhelm, R., Shelton, E. R., and



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Conti, M. (1995) Mol. Pharmacol. 48, 616–62246. Sette, C., Iona, S., and Conti, M. (1994) J. Biol. Chem. 269, 9245–925247. Hoffmann, R., Wilkinson, I. R., McCallum, J. F., Engels, P., and Houslay, M. D.

(1998) Biochem. J. 333, 139–14948. Sette, C., and Conti, M. (1996) J. Biol. Chem. 271, 16526–16534

49. Pillai, R., Kytle, K., Reyes, A., and Colicelli, J. (1993) Proc. Natl. Acad. Sci.U. S. A. 90, 11970–11974

50. Pillai, R., Staub, S. F., and Colicelli, J. (1994) J. Biol. Chem. 269, 30676–3068151. Atienza, J. M., Susanto, D., Huang, C., McCarty, A. S., and Colicelli, J. (1999)

J. Biol. Chem. 274, 4839–4847



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Annette H. Ross, Emma S. Houslay and Miles D. HouslayIan McPhee, Stephen J. Yarwood, Grant Scotland, Elaine Huston, Matthew B. Beard,

HSPDE4A4B: CONSEQUENCES FOR ROLIPRAM INHIBITIONChange in the Catalytic Region of Human cAMP-specific Phosphodiesterase

Association with the SRC Family Tyrosyl Kinase LYN Triggers a Conformational

doi: 10.1074/jbc.274.17.117961999, 274:11796-11810.J. Biol. Chem.

http://www.jbc.org/content/274/17/11796Access the most updated version of this article at

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/274/17/11796.full.html#ref-list-1

This article cites 51 references, 29 of which can be accessed free at


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/content/274/17/11796

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;274/17/11796&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/274/17/11796

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=274/17/11796&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/274/17/11796

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/274/17/11796.full.html#ref-list-1

http://www.jbc.org/

the j b c © 1999 by the american society for biochemistry ... · tively spliced regions (3,...

Documents