The Role of Phosphomannose Isomerase in Leishmania mexicanaGlycoconjugate Synthesis and Virulence*

Received for publication, October 10, 2000Published, JBC Papers in Press, November 17, 2000, DOI 10.1074/jbc.M009226200

Attila Garami and Thomas Ilg‡

From the Max-Planck-Institut fur Biologie, Corrensstrasse 38, Tubingen 72076, Federal Republic of Germany

Phosphomannose isomerase (PMI) catalyzes the re-versible interconversion of fructose 6-phosphate andmannose 6-phosphate, which is the first step in the bio-synthesis of activated mannose donors required for thebiosynthesis of various glycoconjugates. Leishmaniaspecies synthesize copious amounts of mannose-con-taining glycolipids and glycoproteins, which are in-volved in virulence of these parasitic protozoa. To inves-tigate the role of PMI for parasite glycoconjugatesynthesis, we have cloned the PMI gene (lmexpmi) fromLeishmania mexicana, generated gene deletion mutants(Dlmexpmi), and analyzed their phenotype. Dlmexpmimutants lack completely the high PMI activity found inwild type parasites, but are, in contrast to fungi, able togrow in media deficient for free mannose. The mutantsare unable to synthesize phosphoglycan repeats [-6-Galb1–4Mana1-PO4-] and mannose-containing glycoi-nositolphospholipids, and the surface expression of theglycosylphosphatidylinositol-anchored dominant sur-face glycoprotein leishmanolysin is strongly decreased,unless the parasite growth medium is supplementedwith mannose. The Dlmexpmi mutant is attenuated ininfections of macrophages in vitro and of mice, suggest-ing that PMI may be a target for anti-Leishmania drugdevelopment. L. mexicana Dlmexpmi provides the firstconditional mannose-controlled system for parasite gly-coconjugate assembly with potential applications forthe investigation of their biosynthesis, intracellularsorting, and function.

Leishmania are protozoan parasites and the causativeagents of a spectrum of animal and human diseases. Their lifecycle includes flagellated promastigote stages that reside in themidgut lumen of the sandfly vector and a nonmotile amastigotestage that lives within the mammalian macrophage, where itcolonizes the phagolysosomal compartment (1). Leishmaniaspecies synthesize large amounts of glycoconjugates that in-clude the unusual glycoinositolphospholipids (GIPLs),1 the con-

served protein-linked glycosylphosphatidylinositol (GPI) mem-brane anchors, glycoproteins with uncommon N-linkedglycans, and a unique family of phosphoglycan-modified mole-cules that encompasses lipid-linked (lipophosphoglycan, LPG),protein-linked (proteophosphoglycans, PPGs), and unlinkedforms (PG). It is believed that these are key molecules for theremarkable resistance of Leishmania parasites against thehostile habitats within their host organisms. The structure ofthese parasite glycoconjugates has been analyzed in extensivedetail (2–4), and some information on their biosynthesis hasbeen generated (4–6). The glycan backbones of these glycosy-lated Leishmania molecules consist predominantly of the mon-osaccharides Man and Gal, with smaller amounts of GlcNAc,GlcNH2, Glc, D-Ara, and myo-inositol present. It has been dem-onstrated that GDP-Man, Dol-P-Man, UDP-Gal, UDP-Glc, andGDP-D-Ara are used as monosaccharide donors for parasiteglycoconjugate assembly (6–10). Given the high biosynthesisrates, a large and/or rapidly replenishable pool of these acti-vated sugar precursors must exist. In particular the acquisitionor biosynthesis as well as the activation of Man is predicted tobe of prime importance to the parasites, as all classes of Leish-mania glycoconjugates contain this hexose. In yeast and inmammalian cells the activated Man donors GDP-Man and Dol-P-Man are synthesized from Man-6-PO4 by the enzymes phos-phomannomutase, GDP-Man pyrophosphorylase, and Dol-P-Man synthase (Fig. 1). Man-6-PO4 is a central metabolite inthis pathway and may be synthesized in two different ways:exogenous Man, if available, is taken up by the cells into thecytosol by glucose transporters (11) or a more specific mannosetransporter and then phosphorylated by hexokinase (Fig. 1)(12). Alternatively, Frc-6-PO4 is converted to Man-6-PO4 in areaction catalyzed by phosphomannose isomerase (PMI) (Fig.1) (13). Lack of the latter enzyme leads to a conditional lethalphenotype in yeast (14) and a severe metabolic disease inhumans (15–17), which demonstrates the essential role of PMIfor these organisms. By contrast, the mannose pathway inLeishmania is largely unexplored despite the fact that it islikely to be of central importance for the synthesis of mostLeishmania glycoconjugates and that it may, therefore, be apromising target for the design of new anti-parasitic drugs.

In this study, we report the cloning of the L. mexicana PMIgene (lmexpmi) and the generation of gene deletion mutants(Dlmexpmi) that possess no PMI enzymatic activity. Lack ofPMI leads to slowed growth in standard media, but in contrastto yeast, L. mexicana Dlmexpmi mutants do not require theaddition of Man to the growth medium for viability. L. mexi-cana Dlmexpmi mutants are sensitive to high mannose concen-trations, they show profound down-regulation of LPG, GIPL,and leishmanolysin (gp63) biosynthesis, and secrete undergly-

* The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby marked“advertisement” in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

The nucleotide sequence(s) reported in this paper has been submittedto the GenBankTM/EBI Data Bank with accession number(s) AJ300464.

‡ To whom correspondence should be addressed: Tel.: 49-7071-601-238; Fax: 49-7071-601-235; E-mail: thomas.ilg@tuebingen.mpg.de.

1 The abbreviations used are: GIPL, glycoinositolphospholipid; PG,unlinked phosphoglycan; LPG, lipophosphoglycan; PPG, proteophos-phoglycan; mPPG, membrane-bound PPG; GPI, glycosylphosphatidyli-nositol; DIG, digoxygenin; PCR, polymerase chain reaction; PAGE,polyacrylamide gel electrophoresis; Dol-P-Man, dolicholphosphate-mannose; Man-6-PO4, mannose 6-phosphate; PMI, phosphomannoseisomerase; SAP, underglycosylated acid phosphatase; WT, wild type;SDM, semi-defined medium 79; iFCS, heat-inactivated fetal calf se-

rum; bp, base pair(s); UTR, untranslated repeat; mAb, monoclonalantibody; HPTLC, high performance thin layer chromatography; FACS,fluorescence-activated cell sorting; D-Ara, D-arabinose.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 9, Issue of March 2, pp. 6566–6575, 2001© 2001 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org6566

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

cosylated acid phosphatase (SAP). Furthermore, L. mexicanaDlmexpmi promastigotes are attenuated in their infectivity tomacrophages and mice. All these effects can be partially or fullyreversed by addition of low concentrations of Man to the growthmedium and by lmexpmi gene addback. The results of thisstudy suggest that PMI activity is not essential for L. mexi-cana, but these parasites require this enzyme to maintain theirhigh rate of glycoconjugate synthesis and full virulence.

MATERIALS AND METHODS

Parasite Culture and Experimental Infections of Mice and PeritonealMacrophages—Promastigotes of the L. mexicana wild type (WT) strainMNYC/BZ/62/M379 and derived mutants were grown at 27 °C in semi-defined medium 79 (SDM) supplemented with 4% heat-inactivated fetalcalf serum (iFCS) as described previously (18). Infection of mice with107 stationary phase promastigotes and infection of mouse peritonealmacrophages were performed as outlined earlier (19). Growth curves ofL. mexicana WT and mutants were obtained by seeding SDM/4% iFCSsupplemented with or without various concentrations of Man (2 mM to10 mM) with 2 3 106 promastigotes and counting the parasite numbersat 8- to 24-h intervals. In some experiments, growth curves were deter-mined in the presence or absence of 10 mM swainsonine in the standardgrowth medium.

Cloning of the L. mexicana lmexpmi Gene, Generation of Gene Knock-out and Gene Addback Mutants, Heterologous Expression of PMI, andGeneration of Antibodies—DNA techniques were performed as de-scribed previously (20). A 300-bp fragment of the L. major pmi gene wasobtained from L. major LRC-L137/V121 genomic DNA by polymerasechain reaction (PCR) using the degenerate primers TT(A/G)TGGATG-GG(A/G/C/T)AC(A/G/C/T)CA(C/T)CC and GCCAT(C/T)TC(A/G/C/T)GG-(C/T)TT(A/G)TT that were derived from the conserved Candida albic-ans and Homo sapiens PMI peptide sequences LWMGTHP andNHKPEMA. The PCR product was subcloned into pCR2.1 (Invitrogen)and sequenced. The digoxygenin-labeled PCR product was used toscreen a l-DashII library (21) derived from genomic L. mexicana DNA.Positive clones were subcloned into pBSK1 (Stratagene) or pGEM-5z(Promega) and sequenced on both strands by the dideoxy chaintermination method using an ALFexpress automated sequencer(Amersham Pharmacia Biotech) as described earlier (20). The openreading frame corresponding to lmexpmi was identified by homology to

known PMI genes in the data base and by determination of the splicedleader site (20). Double-targeted gene replacement was performed byPCR amplification of the 59-untranslated region (59-UTR) of lmexpmiusing the primers KO1 (AATGCGGCCGCATGCATCTTCTGTGCGTG-TC) and KO2 (AGTACTAGTACAGACGTAGCGGAGTTGCTTG) and byamplification of the 39-UTR of lmexpmi using the primers KO3 (AGT-ACTAGTGGATCCCCGAGTTTCCTTCAACATTG) and KO4 (CTTAAG-CTTATGCATGCTCTCATCACGAGTG). The underlined sequences ind-icate introduced restriction sites. The NotI/SpeI-cut lmexpmi 59-UTRPCR DNA fragment, the BamHI/HindIII-cut lmexpmi 39-UTR PCRDNA fragment, and a SpeI/BamHI DNA fragment containing a hyg-romycin phosphotransferase gene (hyg) (21) were ligated consecutivelyinto pBSK1. For the second lmexpmi gene replacement cassette, aSpeI/BamHI fragment encoding the phleomycin binding protein gene(phleo) was used (19). The hyg- and phleo-containing gene replacementcassettes were excised from the plasmids by NsiI digestion and trans-fected into L. mexicana promastigotes as previously described (20).Selection in 96-well microtiter plates and analysis of positive cloneswere performed as outlined earlier (19). lmexpmi 59-UTR and openreading frame DNA probes were generated by PCR using aPCR-DIG labeling kit (Roche Molecular Biochemicals) using the primerpairs GAGGGGAAGATGGTGGTGAG/GCTCCACCTTCTCCCTGCTAand TTCACCTTGGCAGACCCCTC/GAAGTTTGCCGAGGAGCTGC,respectively. For gene addback and heterologous expression studies, theopen reading frame of lmexpmi was amplified from a lmexpmi gene-containing plasmid using the primers CCATGGATCCATGTCTGAGC-TCGTCAAGC and AATAGATCTAGATTACTTGTCGCTCAAGTC.Episomal gene addback was achieved by cloning the BamHI/XbaI-cutPCR fragment into pX (22) and transfection of L. mexicana Dlmexpmipromastigotes with this construct as described earlier (20, 23). Trans-fectants were selected by growth in SDM/4% iFCS containing 10–50mg/ml G418 (Roche Molecular Biochemicals). Alternatively, the lmex-pmi gene was expressed under the control of the rRNA promoter, whichis known to lead to high level expression not only in promastigotes butalso in amastigotes (24). For the construction of an integration vector,pFW31 (25) was first linearized by digestion with AgeI. The purifiedDNA fragment (9347 bp) was then subjected to partial digestion withAflII generating digestion products with lengths of 7769, 6720, 2627,1578, and 1049 bp. The largest fragment lacking the lmxmbap openreading frame, but preserving the following spliced leader addition andpolyadenylation sites, was then ligated with the annealed primersCCGGTCTAGATCTGCGGCCGCGGCGCGCC and TTAAGGCGCGCC-GCGGCCGCAGATCTAGA yielding pRIB. The gene-containing PCRproduct (see above) was digested with BglII and BamHI and ligated intoBglII/BamHI-cut pRIB yielding pRIBlmexpmi. Correct orientation waschecked by restriction enzyme digests. For chromosomal integrationinto the ribosomal locus of L. mexicana, the integration cassette wasexcised by digestion with PacI and PmeI (24, 25), gel-purified, andtransfected into L. mexicana. Recombinant clones were isolated bylimiting dilution on 96-well plates in SDM medium containing 20 mg/mlhygromycin, 2.5 mg/ml phleomycin, and 20 mM puromycin. The sequencedata for the lmexpmi-containing DNA fragment has been submitted tothe EMBL data base under accession number AJ300464.

High level expression of L. mexicana PMI in Escherichia coli M15 asinclusion bodies was achieved by cloning the BamHI/BglII-cut lmexpmiPCR fragment into pQE30 followed by transformation of the bacteria.The inclusion bodies were solubilized in 8 M urea, and denatured PMIwas then purified by nickel-nitrilotriacetic acid-agarose chromatogra-phy as described by the manufacturer (Qiagen). Rabbits were immu-nized with 200 mg of purified recombinant protein, which was dissolvedin 8 M urea, 50 mM NaH2PO4, pH 4.8, and emulsified with 50% (v/v)complete Freund’s adjuvant for primary immunizations and with 50%incomplete Freund’s adjuvant (v/v) for all subsequent booster immuni-zations. Serum was obtained 10–14 days after each booster immuniza-tion. The antiserum was affinity-purified on recombinant protein thathad been electrotransferred to polyvinylidene difluoride membranesafter SDS-polyacrylamide electrophoresis (PAGE) as described earlier(20).

Analytical Procedures—Production of SDS-cell lysates, discontinu-ous SDS-PAGE, immunoblotting using the monoclonal antibodies(mAbs) LT6 and L7.25 (directed against [PO4-6Galb1–4Mana1-]x (x 5unknown) and [Mana1–2]0–2Mana1-PO4, respectively) (18), affinity-purified rabbit anti-L. mexicana SAP antibodies (26) and affinity-puri-fied rabbit anti-L. mexicana PMI antibodies, as well as acid phospha-tase enzyme assays (27) were performed as described earlier (19). Totallipids from washed L. mexicana promastigotes were obtained by twoextractions with chloroform/methanol/water (4:8:3, v/v). High perform-ance thin layer chromatography (HPTLC, Silica Gel 60, Merck,

FIG. 1. Putative pathways of mannose 6-phosphate and glyco-conjugate biosynthesis in L. mexicana. Glc-T, glucose transporter;Man-T, mannose transporter; HK, hexokinase; PGI, phosphoglucoseisomerase; PMI, phosphomannose isomerase. Glc-6-P, glucose 6-phos-phate; Frc-6-P, fructose 6-phosphate; Man-6-P, mannose 6-phosphate.The indication of GDP-Man and Dol-P-Man as Man donors for Leish-mania glycoconjugate synthesis is based on studies published earlier byothers (6, 7, 43).

Phosphomannose Isomerase of Leishmania mexicana 6567

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Darmstadt, Germany) of total lipids was performed as described byMcConville et al. (28) using the solvent chlorofom/methanol/1 M NH4OH(10:10:3, v/v). Glycolipids on HPTLC plates were selectively stained byorcinol/H2SO4 spraying. L. mexicana promastigotes were metabolicallylabeled by incubating 5 3 107 cells/ml overnight at 27 °C with 10 mCi/mlmyo-[3H]inositol, 20 mCi/ml [3H]GlcNH2, or 50 mCi/ml [2-3H]Man (Hart-mann Analytics) in myo-inositol- or Glc/GlcNH2- or Glc/Man-free SDMmedium, respectively. In labelings with myo-[3H]inositol and [3H]Gl-cNH2, the lipid extracts were further purified by 1-butanol/H2O phaseseparation (28). Radioactively labeled lipids of the 1-butanol phase wereseparated by HPTLC and detected by spraying with 3H-ENHANCE(Dupont) followed by fluorography. Delipidated cells labeled with myo-[3H]inositol or [2-3H]Man were incubated with benzonuclease to cleavenucleic acids (20) and then separated by SDS-PAGE. Labeled com-pounds in acrylamide gels were detected by immersion of the polyacryl-amide gel in Amplify (Amersham Pharmacia Biotech), followed by dry-ing and fluorography.

To generate L. mexicana total cell lysates, 5 3 109 promastigoteswere resuspended in cold homogenization buffer (50 mM triethylamine/HCl, pH 7.0, 0.1 mM EDTA, 2.5 mM MgCl2 containing 20 mg/ml leupep-tin and 0.5 mM phenylmethylsulfonyl fluoride), sonicated on ice, andcentrifuged at 13,000 3 g for 30 min. The pellet was resuspended in thesame volume homogenization buffer. Enzyme assays were performed in50 mM triethylamine/HCl, pH 7.0, 0.1 mM EDTA, 2.5 mM MgCl2 at 25 °Cwith 0.1% bovine serum albumin. For PMI assays, this buffer wassupplemented with 0.5 mM NADP1 (Roche Molecular Biochemicals), 2.5mM Man-6-PO4 (Merck, Darmstadt, Germany), 2 units/ml phosphoglu-cose isomerase (Roche Molecular Biochemicals) and 2 units/ml glucose-6-phosphate dehydrogenase (Roche Molecular Biochemicals). Hexoki-nase was measured in assay buffer with addition of 5 mM glucose, 1 mM

ATP, and 2 units/ml glucose-6-phosphate dehydrogenase, whereas thephosphoglucomutase assay required the addition of 2 mM glucose1-phosphate and 2 units/ml glucose-6-phosphate dehydrogenase. En-zyme assays were started by the addition of 5–10 ml of cell lysate,ultracentrifugation supernatants, or resuspended pellets, and the ab-sorbance at 340 nm was recorded over 2.5–10 min. One unit of enzymeactivity is defined as the amount of enzyme converting 1 mmol ofsubstrate/min into the respective product. Total protein of cell lysateswas estimated according to Peterson (29).

Immunofluorescence Microscopy and FACS of Leishmania Promas-tigotes and Infected Macrophages—Immunofluorescence microscopyand fluorescence-activated cell sorting (FACS) studies on Leishmaniapromastigotes and infected macrophages were performed as describedpreviously (19) using the mAbs (18) LT6, L7.25, LT17 (most likelydirected against [PO4-6(Glcb1–3)Galb1–4Mana1-]x, x 5 unknown),mAb L3.8 (directed against a polypeptide epitope of L. mexicana leish-manolysin/gp63), and the biotinylated lectin concanavalin A (Sigma).The mAbs were diluted 1:2 to 1:10 (hybridoma supernatant) or 1:500 to1:2000 (ascites fluid), and the lectin was used at 10 mg/ml. Bound mAbsand the biotinylated lectin were detected by incubation with Cy3-la-beled goat anti-mouse IgG/IgM (Dianova, 1:500) and fluorescein isothio-cyanate-labeled streptavidin (Sigma, 1:250), respectively.

RESULTS

Isolation of the L. mexicana lmexpmi Gene and Generation ofGene Deletion Mutants by Targeted Gene Replacement—For thecloning of the Leishmania PMI gene, a degenerate PCR primerpair was constructed from the peptide sequences LWMGTHPand NHKPEMA, which are conserved in C. albicans and H.sapiens PMI (Fig. 2). PCR was performed using L. mexicana, L.donovani, and L. major genomic DNA as templates. Only L.major DNA yielded a PCR product of the expected size (270–300 bp), and sequencing of this DNA fragment revealed anopen reading frame with high homology to known PMIs (datanot shown). The DIG-labeled PCR fragment was used to screena l-DashII library of genomic L. mexicana DNA. Sequencing ofa lmexpmi gene-containing DNA fragment revealed an openreading frame of 1266 bp encoding a protein of 46.5 kDa, whichshowed 40–42% identity to the Saccharomyces cerevisiae, C.albicans, and H. sapiens PMI polypeptide sequences. Completeconservation was observed for the amino acids that have beenshown to serve as a ligand for a Zn21 cation in the active siteand for amino acids lining the substrate binding pocket (Fig. 2)(30). The predicted involvement of Zn21 in the catalytic activity

of L. mexicana PMI was corroborated by its complete inhibitionby 5 mM o-phenanthroline (data not shown). Southern blots ofL. mexicana genomic DNA indicated the presence of a singlegene copy (Fig. 3B and data not shown). Gene replacementcassettes containing the resistance markers phleo and hygwere constructed, and two rounds of targeted gene replacementwere performed (Fig. 3A). Plating of transfected cells on SDMmedium with or without additional Man (0.5 mM) yielded aboutthe same number of clones that lacked the lmexpmi open read-ing frame (Fig. 3B). This result was remarkable, because dele-tion of the PMI gene in yeast led to a Man-dependent pheno-type (14).

L. mexicana Dlmexpmi Mutants Are Deficient in PMI Activityand Exhibit a Growth Defect That Can Be Both Reversed andExacerbated by Man Complementation—Immunoblots of L.mexicana promastigote and amastigote total cell lysates probedwith affinity-purified antibodies raised against Escherichia co-li-expressed L. mexicana PMI revealed that PMI was expressed

FIG. 2. Alignment of L. mexicana PMI with various PMI aminoacid sequences. S. cerevisiae (S. cer., accession number m85238 (14)),C. albicans (C. alb., accession number X82024 (39)), and H. sapiens (H.sap., accession number X76057 (36)). Amino acids conserved in PMI ofall four species are indicated by stars. Amino acids involved in theformation of the active site pocket (30) are marked by arrows, thoseforming the coordination sphere of the active site Zn21 ion are indicatedby black bars.

Phosphomannose Isomerase of Leishmania mexicana6568

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

at very similar levels in both parasite life stages (Fig. 4A).Ultracentrifugation experiments on sonicated cell lysates dem-onstrated that .95% of L. mexicana PMI activity is soluble(data not shown). The PMI protein band was completely absentin overexposed immunoblots of L. mexicana Dlmexpmi mutants(Fig. 4B), and PMI enzyme assays revealed that these mutantswere completely deficient in PMI activity, whereas the activi-ties of other metabolic enzymes like phosphoglucomutase orhexokinase showed little change or were even elevated (Fig.4C). L. mexicana Dlmexpmi mutant promastigotes exhibitedslowed growth in standard SDM medium (Fig. 5B) comparedwith wild type parasites (Fig. 5A). This growth defect could beovercome partially by the addition of 20 mM (not shown) or fullyby the addition of 200 mM Man to the medium (Fig. 5B), but 2mM Man led again to slow growth and a bloated shape of thecells, whereas 10 mM Man inhibited growth and ultimatelykilled most of the parasites (Fig. 5B). In contrast, neithergrowth nor cell shape of L. mexicana wild type cells and ofDlmexpmi mutant promastigotes carrying episomal copies ofthe lmexpmi gene were affected by high Man concentrations(Fig. 5C).

L. mexicana Dlmexpmi Mutant Promastigotes Show Im-paired Synthesis of Glycoconjugates That Can Be Reversed byMan Complementation of the Growth Medium—Immunoblots

of L. mexicana WT total cell lysates probed with the anti-PO4-6Galb1–4Mana1-repeat mAb LT6 showed a strong signal inthe low molecular weight range that corresponds to LPG, and aweaker signal in the stacking gel and the top of the separatinggel due to the presence of membrane-bound proteophosphogly-can (mPPG (20, 31)) (Fig. 6A, lane 1). The L. mexicana Dlmex-lpg1, which is specifically defective in LPG synthesis (19),showed only the signal for mPPG (Fig. 6A, lane 6). In contrast,none of the four L. mexicana Dlmexpmi null mutants investi-gated showed any reaction with mAb LT6 on immunoblots.This result was confirmed by FACS analysis of live promastig-otes, where the Dlmexpmi mutant clones examined showedonly negligible surface fluorescence, in contrast to Dlmexlpg1promastigotes, which displayed at least some LT6 epitopes ontheir surface, most likely due to mPPG expression (Fig. 7A).Likewise, surface binding sites for LT17, an mAb most likelyrecognizing glucosylated disaccharide phosphate repeats (20),were down-regulated by a factor of 10–20 (data not shown).The binding of the anti-[Mana1–2]0–2Mana1-PO4 cap mAbL7.25 on blots to proteins of L. mexicana Dlmexpmi promastig-ote total cell lysates was only slightly affected compared withwild type parasite lysates, but a shift of all antibody-recognizedproteins to lower apparent molecular mass was clearly visible,which may indicate decreased glycosylation (Fig. 6C). A lowerlevel of glycosylation on surface molecules in L. mexicana

FIG. 3. Targeted gene replacement of the lmexpmi alleles. A,restriction map of the lmexpmi locus. The resistance genes phleo andhyg and the primer binding sites (KO1–4) for the construction of genedeletion cassettes are indicated. B, Southern blot analysis of PstI re-striction enzyme-digested chromosomal DNA (5 mg) from L. mexicanawild type (lanes 1) and a Dlmexpmi mutant (lanes 2). DNA was sepa-rated on an ethidium bromide-containing 0.7% agarose gel (right pan-el), blotted onto a nylon membrane, and incubated with either a DIG-labeled lmexpmi open reading frame (ORF) probe (middle panel) or aDIG-labeled lmexpmi 59-untranslated region (UTR) probe (left panel).The sizes of DNA standards are indicated in kilobases.

FIG. 4. Analysis of PMI in L. mexicana wild type (WT) and aDlmexpmi mutant. A, SDS-PAGE/immunoblot of total cell lysates ofL. mexicana promastigotes (lane 1, 2.5 3 106 parasites, correspondingto ;10 mg of protein) and lesion-derived amastigotes (lane 2, 2.5 3 106

parasites, corresponding to ;3.5 mg of protein, and lane 3, 7 3 106

parasites, corresponding to ;10 mg of protein). The blots were probedwith affinity-purified rabbit anti-L. mexicana PMI antibodies. B, SDS-PAGE/immunoblot of total cell lysates (2.5 3 106 promastigotes) of L.mexicana WT (lane 1) and a Dlmexpmi mutant (lane 2). C, enzymaticactivity of PMI, phosphoglucomutase (PGM), and hexokinase (HK) infreeze/thaw/sonication lysates of L. mexicana WT and of L. mexicanaDlmexpmi.

Phosphomannose Isomerase of Leishmania mexicana 6569

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Dlmexpmi was also detected in FACS analyses with the lectinconcanavalin A, where a strongly decreased signal intensitywas observed compared with wild type parasites (Fig. 7C). Thisdecrease in concanavalin A labeling was not due to the loss ofLPG and mPPG in Dlmexpmi mutants, as L. mexicana Dlmex-lpg2 promastigotes, which lack both molecules on the surfacedisplay more binding sites for this lectin than wild type para-sites (32). The surface binding of mAb L3.8 (33, 34) directedagainst the GPI-anchored metalloproteinase leishmanolysin/gp63 was decreased on Dlmexpmi mutants by a factor of 10(Fig. 7D), despite the fact that the absence of LPG in generalincreases accessibility of this surface glycoprotein, as shown byanalysis of Dlmexlpg1 and Dlmexlpg2 mutants (19, 32) (Fig.7D). The absence or decrease of LT6, LT17, L3.8, and con-canavalin A binding sites on L. mexicana Dpmi mutants wascorroborated by immunofluorescence labels on fixed promastig-otes (Fig. 8, B, F, N, and R), and close inspection of the mutantpromastigotes revealed a shorter, rounded cell shape in com-parison to wild type controls (Fig. 8, I and J). Finally, the twosubunits of SAP, which are N-glycosylated and O-phosphogly-cosylated glycoproteins, showed strong mobility shifts in im-munoblot studies for the L. mexicana Dlmexpmi mutant com-

pared with the wild type, which is indicative of under-glycosylation (Fig. 6D). The biosynthesis and surface display ofLPG and mPPG (Figs. 6B, 7B, 8D, and 8H), the surface expres-sion of leishmanolysin/gp63 and concanavalin A binding sites(Fig. 8, P and T), the glycosylation of SAP (Fig. 6D), and normalcell shape (Fig. 8, I–L) could be reconstituted in the mutants byepisomal expression of lmexpmi from pX or by chromosomalintegration of lmexpmi into the ribosomal locus, which demon-strated that the observed defects were due to the loss of thelmexpmi gene. Furthermore, LPG and mPPG synthesis in thelmexpmi mutants could also be reconstituted by addition ofMan into the medium. At 20 mM mannose, synthesis of LPG andmPPG could be detected in mutant promastigotes and at 200mM Man, almost wild type levels of these molecules were foundin immunoblots (Fig. 6B), FACS analysis (Fig. 7B), and immu-nofluorescence microscopy (not shown). Similarly, the electro-phoretic mobility of SAP decreased upon medium complemen-tation with 20 mM Man and was indistinguishable from wildtype SAP when 200 mM Man was added. Higher concentrationsof this sugar did not lead to a further increase in PG synthesis,most likely due to its toxic effects (see above).

HPTLC analysis of a total lipid fraction of the L. mexicanalmexpmi mutant showed the absence of orcinol/H2SO4-stain-able GIPLs, whereas the main L. mexicana GIPLs iM2, iM3,and iM4 (28) could be easily detected by this method in wildtype parasites (Fig. 9A). Likewise, these GIPLs were largelyabsent from the total lipid fraction of [3H]GlcNH2-labeled lmex-

FIG. 5. Influence of Man on the growth curves of L. mexicanaWT (A), L. mexicana Dlmexpmi (B), and L. mexicana Dlmexpmi 1pXlmexpmi (C). The standard error of each quadruplicate count isindicated.

FIG. 6. SDS-PAGE/immunoblots. A, total cell lysates of promastig-otes (1 3 107) from L. mexicana WT (lane 1), four different Dlmexpmimutant clones (lanes 2–5), and L. mexicana Dlmexlpg1 (lane 6). B, totalcell lysates of promastigotes (2.5 3 107) from L. mexicana Dlmexpmi(lane 1), L. mexicana Dlmexpmi 1 pRIBlmexpmi (lane 2), L. mexicanaWT (lane 3), and L. mexicana Dlmexpmi grown in the absence (lane 4)and the presence of Man (lane 5, 20 mM; lane 6, 200 mM). The blots in Aand B were probed with mAb LT6. C, total cell lysates of promastigotes(1 3 107) from L. mexicana WT (lane 1) and a Dlmexpmi mutant (lane2) probed with mAb L7.25. D, L. mexicana promastigote culture super-natant containing 20 milliunits of SAP. Lanes 1, 3–5, and 9, L. mexicanaWT; lanes 2, 6–8, and 10, L. mexicana Dlmexpmi. Parasite cultures forlanes 3 and 6 were grown in the absence, lanes 4 and 7 in the presenceof 20 mM, and lanes 5 and 8 in the presence of 200 mM Man. Lanes 1–8were probed with affinity-purified anti-SAP polypeptide antibodies,lanes 9 and 10 with mAb L7.25. The borders between stacking gels andseparating gels are indicated by arrows. The positions of SAP1 andSAP2 are marked by asterisks.

Phosphomannose Isomerase of Leishmania mexicana6570

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

pmi mutant parasites (Fig. 9B). Instead, three new major la-beled glycolipid species not present in the wild type parasiteswere observed, which migrated faster on the TLC indicative ofa less hydrophilic nature (Fig. 9B). Like LPG and mPPG syn-thesis, GIPL synthesis could also be partially reconstituted byMan complementation of the growth medium, although, evenat 200 mM, synthesis of the largest GIPL species iM4 was notobserved (Fig. 9C).

[3H]Man Labeling and Swainsonine Treatment of L. mexi-cana Promastigotes—In [3H]Man labels of L. mexicana wildtype promastigotes, only about 2–3% of the offered radiolabelwas incorporated in overnight labeling of parasites and couldbe detected in cellular and secreted macromolecules like PPGs,leishmanolysin/gp63 and SAP (Fig. 10, A–C) and in GIPLs (Fig.9D). This low incorporation rate was independent of the pres-ence or absence of 1 mM glucose in the labeling medium (Fig.10A). By contrast, L. mexicana lmexpmi mutants increasedMan incorporation 20- to 30-fold compared with wild type par-asites, and more than 60% of the offered radiolabel was foundin cellular and secreted macromolecules (Fig. 10, A–C), GIPLs,and uncharacterized compounds in the lipid fraction, mostlikely intermediates of GIPL, LPG, and GPI synthesis (Fig.9D). This dramatic increase in metabolic labeling efficiency isspecific for [3H]Man, because radioactivity incorporation ratesof [3H]GlcNH2 and myo-[3H]inositol labels are very similar inthe wild type and the Dlmexpmi mutant.

Swainsonine is a potent and specific inhibitor of lysosomala-mannosidase of various eukaryotes (35). This enzyme is es-sential for the degradation of glycoprotein N-glycans. The ad-dition of 10 mM swainsonine had little effect on the growth ofwild type promastigotes, whereas the growth of L. mexicanaDlmexpmi is retarded by about 50% (Fig. 11). This result is anindication that, under limiting Man supply, Leishmania mayrely partially on the degradation of glycoproteins to acquirethis hexose.

L. mexicana Dlmexpmi Mutants Are Attenuated but Remain

Infectious to Macrophages and Mice—L. mexicana Dlmexpmiwas less efficient in establishing and maintaining an infectionin mouse peritoneal macrophages than the parental wild typestrain (Fig. 12A). Addback of the lmexpmi gene to the mutant,either on an episome or by insertion into the chromosome at theribosomal locus, led to increased infectivity that did not, how-ever, reach wild type levels. Phosphoglycan synthesis of intra-cellular parasites in infected macrophages was down-regulatedin L. mexicana Dlmexpmi mutants compared with wild typeparasites, but both LT6 and LT17 epitopes could be clearlydetected (Fig. 13, compare A–D with E–H). This result is re-markable, because cultured promastigotes exhibit no LT6 andvery low levels of LT17 epitopes (Fig. 8, B and F). Wild typelevels of parasite PG repeat expression in infected macro-phages was observed when Dlmexpmi mutants with episomalcopies of lmexpmi were used for infection experiments (Fig. 13,I–L). In mouse infection experiments, L. mexicana Dlmexpmiled to much smaller lesions compared with wild type parasites,but, surprisingly, this mutant was infectious to these mammals(Fig. 12, B and C). Complementation of Dlmexpmi by episomalgene copies or by integration of lmexpmi into the ribosomallocus led to markedly increased virulence, as indicated by ac-celerated lesion growth in infected BALB/c mice (Fig. 12, Band C).

DISCUSSION

In all eukaryotes investigated so far, the reversible isomer-ization of Frc-6-PO4 and Man-6-PO4 catalyzed by PMI is thefirst step in the biosynthesis of the activated Man donors GDP-Man and Dol-P-Man (Fig. 1), which are required for the bio-synthesis of many glycoproteins, glycolipids, and, in the case offungi, cell wall components.

In this study, we have cloned, sequenced, and functionallycharacterized the PMI of the parasitic protozoon L. mexicanaas a first step in the investigation of the Leishmania Manpathway. L. mexicana promastigotes express high levels of PMI

FIG. 7. FACS analysis of live L. mexicana WT and different mutant promastigotes. A and B, mAb LT6 directed against [-6Galb1–4Mana1-PO4] repeats; C, concanavalin A; D, mAb L3.8 directed against a polypeptide epitope of leishmanolysin (gp63).

Phosphomannose Isomerase of Leishmania mexicana 6571

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

(;40 milliunits/mg of protein, assay at 25 °C), which exceed theaverage enzyme activity in mammalian tissue more than 15-fold (2.6 milliunits/mg of protein, assay at 37 °C) (36). Simi-larly, high PMI activity as in L. mexicana is found in thepathogenic yeast C. albicans (75 milliunits/mg of protein, assayat 37 °C) (37). L. mexicana PMI is a soluble enzyme that isequally expressed at the protein level in insect stage promas-tigotes and mammalian stage amastigotes. Immunofluores-cence studies on permeabilized promastigotes suggest a cyto-plasmic localization, as indicated by a diffuse fluorescencesignal throughout the cell body (data not shown). The geneencoding L. mexicana PMI, lmexpmi, was isolated by a PCRapproach using degenerate oligonucleotide primers, and itsprimary structure is ;40% identical to that of S. cerevisiae, C.albicans, or human PMI protein sequences. Two rounds oftargeted gene replacement led to lmexpmi null mutants(Dlmexpmi) lacking detectable PMI activity. These mutantswere able to multiply in standard growth medium, even wheniFCS had been dialyzed extensively to remove possible traces ofMan (data not shown). This lack of dependence on exogenousfree Man is surprising and in contrast to S. cerevisiae, Asper-gillus nidulans, and C. albicans, where loss of PMI activity islethal, even in complex media, unless Man is provided (14, 38,39). In humans, the hereditary disease congenital disorder ofglycosylation (CDG) type Ib has its basis in PMI deficiency, butalthough the tissues of patients contain less enzyme than thatof healthy controls, complete absence of PMI has never beenobserved and may be incompatible with life (40). Furthermore,there are no reports about vertebrate cell lines that lack PMI

activity. A possible explanation for the unexpected viability ofL. mexicana Dlmexpmi in the absence of Man could be thedegradation of serum glycoproteins by the parasites as a sourceof Man. Our observation that swainsonine, a potent inhibitor oflysosomal a-mannosidase (35), inhibits the growth of Dlmexpmimarkedly, although affecting the growth of wild type cells onlymarginally, supports this view. Alternatively, L. mexicana maynot need Man for viability in culture.

However, although PMI is not essential, the absence of thisenzyme has several severe consequences for L. mexicana. First,growth of L. mexicana Dlmexpmi promastigotes in standardmedium is slower compared with wild type parasites and thecells show a distinctive rounded shape. Both the growth defectand the change in morphology can be corrected by the additionof 200 mM Man to the growth medium or by genetic complemen-tation. Remarkably, addition of 2 mM Man leads again to agrowth defect, and 10 mM Man completely inhibits growth andultimately kills the cells. By contrast, wild type parasites orDlmexpmi gene addback mutants are unaffected by additions ofhigh Man concentrations to the medium. This observation isreminiscent of the toxicity of nutritional Man to apidae, theso-called honey bee syndrome. It has been suggested that animbalance between high hexokinase and low PMI activities inhoney bees, which leads to an accumulation of potentially toxicMan-6-PO4 and, possibly, to ATP depletion, is the cause of thissyndrome (41).

Second, lack of PMI activity leads to drastic down-regulationof glycoconjugate synthesis in L. mexicana promastigotes: Acombination of immunoblot, FACS, and immunofluorescence

FIG. 8. Immunofluorescence andlight microscopy of L. mexicana wildtype and PMI-deficient mutant pro-mastigotes. L. mexicana WT (A, E, I, M,Q); L. mexicana Dlmexpmi (B, C, F, G, J,N, O, R, S); L. mexicana Dlmexpmi 1pRIBlmexpmi (D, H, L, P, T); L. mexicanaDlmexpmi 1 pXlmexpmi (K). mAb LT6 (A,B, D); mAb LT17 (E, F, H); mAb L7.25(I--L); mAb L3.8 (M, N, P); concanavalin A(Q, R, T); light microscopy (C, G) as cor-responding controls for B and F, respec-tively; 4,6-diamidino-2-phenylindol stain-ing (O, S). The exposure times withinrows are identical.

Phosphomannose Isomerase of Leishmania mexicana6572

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

microscopy studies suggest that Dlmexpmi promastigotesgrown in standard medium are unable to synthesize phospho-glycan repeat-modified LPG and PPGs. Furthermore, a de-crease in surface binding sites for concanavalin A as well asmobility shifts in SDS-PAGE of many cellular proteins and thedominant secreted glycoprotein SAP suggest a general under-glycosylation of glycoproteins in these mutants. Finally, thesynthesis of the dominant promastigote GIPLs iM2, iM3, iM4,and EPiM3 (28) is down-regulated to such an extent that theycould not be detected by the methods employed in this study. Ithas been suggested that Man-containing GIPLs are essentialfor L. mexicana viability (42). The results of this study demon-strate, however, that their biosynthesis can be down-regulatedto undetectable levels without affecting parasite viability inculture. Metabolic [3H]GlcNH2 labeling revealed new, morehydrophobic GIPL species in the Dlmexpmi mutants, which arenot present in wild type parasites. It is likely that they repre-sent GIPL precursors like GlcNH2-phosphatidylinositol or Gl-cNAc-phosphatidylinositol species, although this suggestion re-quires proof by structure analysis. The defect in glycoconjugatesynthesis can be partially or fully restored by lmexpmi geneaddback or by the addition of 200 mM Man to the growthmedium. In metabolic labeling experiments with [3H]Man,Dlmexpmi promastigotes incorporate about 30 times more ra-dioactivity into their glycoconjugates than wild type parasites,which use this hexose very inefficiently for biosynthesis. Thisresult suggests that, under normal culture conditions, the ma-jority of Man-6-PO4 in L. mexicana originates from the Glc-6-PO4/Frc-6-PO4 pool (Fig. 1) of the promastigote and not fromMan. Whether this hexosemonophosphate pool is fed by exog-enous Glc or by gluconeogenesis, or both, remains unclear. Thisis in contrast to the situation in humans, where, in most tis-sues, the bulk of Man-6-PO4 utilized for glycoprotein synthesisis not derived from Glc-6-PO4 but originates from Man in

serum, where its concentration is around 50 mM. A specific Mantransporter, which is only weakly affected by the large excess ofGlc in serum (;5 mM), ensures efficient uptake of this hexose

FIG. 9. Silica gel 60 HPTLC analysis of the predominant pro-mastigote glycolipids of L. mexicana. A, total lipids from 2 3 108 L.mexicana WT or Dlmexpmi promastigotes were loaded onto an HPTLCplate. After chromatography, glycolipids were visualized by orcinol/H2SO4 spraying. B, total lipids from 5 3 106 [3H]GlcNH2-labeled pro-mastigotes (;100,000 cpm) were loaded onto an HPTLC plate. Afterchromatography, glycolipids were visualized by fluorography. C, totallipids from 2 3 108 L. mexicana Dlmexpmi promastigotes grown in theabsence or presence of 2–200 mM mannose were loaded onto an HPTLCplate, and glycolipids were visualized by orcinol/H2SO4 spraying. D,total lipids from 107 [3H]Man-labeled L. mexicana WT and Dlmexpmipromastigotes (;20,000 and 400,000 cpm, respectively) were loadedonto an HPTLC plate. After chromatography, glycolipids were visual-ized by fluorography. The positions of the abundant L. mexicana GIPLsare indicated by the bars, the start and front of the TLCs are marked byS and F, respectively. Asterisks mark new [3H]glucosamine-labeledcompounds accumulating in Dlmexpmi mutants. FIG. 10. Metabolic labeling of L. mexicana WT and Dlmexpmi

promastigotes. A, incorporation of [3H]Man, [3H]GlcNH2, and myo-[3H]inositol into the cells and secreted macromolecules, which had beenseparated from low molecular weight compounds by Centricon 3 ultra-filtration. Cells were exposed to the radioactive compound for 20 h inGlc-free SDM. In some experiments, 1 mM Glc was added to the labelingmedium (1Glc). B and C, SDS-PAGE of [3H]Man-labeled promastigotes(2.5 3 107, B) and macromolecules from their culture supernatant (C).Lanes 1, L. mexicana WT; lanes 2, L. mexicana Dlmexpmi.

FIG. 11. Growth curves of L. mexicana WT and Dlmexpmi inthe presence and absence of the a-mannosidase inhibitorswainsonine.

Phosphomannose Isomerase of Leishmania mexicana 6573

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

(12, 42). Our finding that [3H]Man labeling of L. mexicanapromastigotes is also only marginally affected by a more than10,000-fold excess of Glc over [3H]Man suggests that the par-asites may also possess a similarly efficient and specific Manuptake system.

A third consequence of the lack of PMI for the parasites is amarked decrease in virulence. In macrophage infection studies,Dlmexpmi parasites are less successful in colonizing host cells

than the parental wild type line, and in mouse infections, lesiongrowth is much slower. Episomal and, in particular, chromo-somal integration addback of the lmexpmi gene to Dlmexpmimutants improves their ability to persist and multiply withinmacrophages and leads to increased virulence to BALB/c mice.The fact that the Dlmexpmi mutants, although severely atten-uated, are still infectious to macrophages and mice is at first

FIG. 12. Analysis of macrophage and mouse infection by L.mexicana WT, Dlmexpmi, and lmexpmi gene addback mutants.A, infection of peritoneal macrophages by L. mexicana wild type, Dlmex-pmi, Dlmexpmi 1 pXlmexpmi, Dlmexpmi 1 pRIBlmexpmi. Peritonealmacrophages were infected at a ratio of 2 stationary phase promastig-otes per cell. The percentage of infected macrophages was counted 6days after the infection. B and C, infection of Balb/c mice with L.mexicana WT, Dlmexpmi, and lmexpmi gene addback mutants. Micewere challenged with 107 L. mexicana promastigotes in the right hindfootpad. The swelling caused by L. mexicana wild type, Dlmexpmi,Dlmexpmi 1 pXlmexpmi, Dlmexpmi 1 pRIBlmexpmi are shown in Band C, respectively. The infection experiments were performed in trip-licate, and the standard error is indicated.

FIG. 13. Immunofluorescence of saponin-permeabilized peri-toneal macrophages infected with five L. mexicana WT (A–D),Dlmexpmi (E–H), or Dlmexpmi 1 pXlmexpmi (I–L) promastigotesper host cell. Infected macrophages were labeled after 3 days inculture with the mAbs LT6 (A, E, I), LT17 (B, F, J). Counterstaining ofthe same specimen for DNA was performed with 4,6-diamidino-2-phe-nylindol (C, D, G, H, K, L). Leishmania-infected macrophages that canbe recognized by the intracellular spot-like 4,6-diamidino-2-phenylindolsignals of the parasite kinetoplasts are marked by arrows, whereasuninfected cells are marked by asterisks. The exposure times are iden-tical for specimens stained with the same antibody.

Phosphomannose Isomerase of Leishmania mexicana6574

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

unexpected, because the general impairment of glycoconjugatesynthesis (2), in particular the defect of GIPL assembly (43),should preclude virulence completely. However, those Dlmex-pmi promastigotes that survive within macrophages transforminto amastigotes and, remarkably, synthesize glycoconjugatesdisplaying mAb LT6 and LT17 epitopes, although at lowerlevels than either wild type or lmexpmi gene addback mutants.Because L. mexicana Dlmexpmi promastigotes in culture needexogenous Man added to their medium to regain this biosyn-thetic ability, this result suggests that amastigotes have accessto some macrophage-derived Man within the parasitophorousvacuole.

PMI of the pathogenic fungus C. albicans is currently beinginvestigated as a target to combat fungal infections (30). Ourresults suggest that the inhibition of this enzyme in Leishma-nia amastigotes colonizing a human lesion may lead to drasti-cally slowed parasite growth, which may enable the immunesystem to eradicate the infection. Therefore, L. mexicana PMImay be a valid target for the development of new anti-Leish-mania drugs. The Dlmexpmi mutant generated in this studyprovides the first Man-dependent conditional system for thesynthesis of Leishmania phosphoglycans, GIPLs, and possiblyGPI anchors and N-glycans, which could be exploited for theinvestigation of biosynthesis, intracellular transport, and bio-logical functions of these parasite glycoconjugates.

Acknowledgments—We thank Dorothee Harbecke and MonikaDemar for excellent technical assistance and Suzanne Gokool and PeterOverath for helpful comments on the manuscript.

REFERENCES

1. Alexander, J., and Russell, D. G. (1992) Adv. Parasitol. 31, 175–2542. Descoteaux, A., and Turco, S. J. (1999) Biochim. Biophys. Acta 1455, 341–3523. McConville, M. J., and Ferguson, M. A. J. (1993) Biochem. J. 294, 305–3244. Ilg, T. (2000) Parasitol. Today 16, 489–4975. Beverley, S. M., and Turco, S. J. (1998) Trends Microbiol. 6, 35–406. Ralton, J. E., and McConville, M. J. (1998) J. Biol. Chem. 273, 4245–42577. Carver, M. A., and Turco, S. J. (1991) J. Biol. Chem. 266, 10974–109818. Schneider, P., McConville, M. J., and Ferguson M. A. J. (1994) J. Biol. Chem.

269, 18332–183379. Moss, J. M., Reid, G., Mullin, K. A., Zawadzki, J. L., Simpson, R. J., and

McConville, M. J. (1999) J. Biol. Chem. 274, 6678–668810. Mahoney, A. B., and Turco, S. J. (1999) Arch. Biochem. Biophys. 372, 367–37411. Gould, G. W., and Holman, G. D. (1993) Biochem. J. 295, 329–34112. Panneerselvam, K., and Freeze, H. H. (1996) J. Biol. Chem. 271, 9417–942113. Gracy, R. W., and Noltmann, E. A. (1969) J. Biol. Chem. 243, 3161–3168

14. Smith, D. J., Proudfoot, A., Friedli, L., Klig, L. S., Paravic, G., and Payton,M. A. (1992) Mol. Cell. Biol. 12, 2924–2930

15. de Koning, T. J., Dorland, L., van Diggelen, O. P., Boonman, A. M. C., de Jong,G. J., van Noort, W. L., De Schryver, J., Duran, M., van den Berg, I. E. T.,Gerwig, G. J., Berger, R., and Poll-The, B. T. (1998) Biochem. Biophys. Res.Commun. 245, 38–42

16. Niehues, R., Hasilik, M., Alton, G., Korner, C., Schiebe-Sukumar, M., Koch,H. G., Zimmer, K.-P., Wu, R., Harms, E., Reiter, K., von Figura, K., Freeze,H. H., Harms, H. K., and Marquardt, T. (1998) J. Clin. Invest. 7, 1414–1420

17. Jaeken, J., Matthijs, G., Saudubray, J.-M., Dionisi-Vici, C., Bertini, E., deLonlay, P., Henri, H., Carchon, H., Schollen, E., and van Schaftingen, E.(1998) Am. J. Hum. Genet. 62, 1535–1539

18. Ilg, T., Harbecke, D., Wiese, M., and Overath, P. (1993b) Eur. J. Biochem. 217,603–615

19. Ilg, T. (2000) EMBO J. 19, 1–1120. Ilg, T., Montgomory, J., Stierhof, Y.-D., and Handman, E. (1999) J. Biol. Chem.

274, 31410–3142021. Wiese, M., Ilg, T., Lottspeich, F., and Overath, P. (1995) EMBO J. 14,

1067–107422. Cruz, A., Coburn, C. M., and Beverley, S. M. (1991) Proc. Natl. Acad. Sci.

U. S. A. 89, 7170–717423. LeBowitz, J. H., Coburn, C. M., McMahon-Pratt, D., and Beverley, S. M. (1990)

Proc. Natl. Acad. Sci. U. S. A. 87, 9736–974024. Misslitz, A., Mottram, J. C., Overath, P., and Aebischer, T. (2000) Mol. Bio-

chem. Parasitol. 107, 251–26125. Benzel, I., Wiese, F., and Wiese, M. (2000) Mol. Biochem. Parasitol. 111, 77–8626. Stierhof, Y.-D., Wiese, M., Ilg, T., Overath, P., Haner, M., and Aebi, U. (1998)

J. Mol. Biol. 282, 137–14827. Ilg, T., Stierhof, Y. D., Etges, R., Adrian, M., Harbecke, D., and Overath, P.

(1991) Proc. Natl. Acad. Sci. U. S. A. 88, 8774–877828. McConville, M. J., Collidge, T. A., Ferguson, M. A. J., and Schneider, P. (1993)

J. Biol. Chem. 268, 15595–1560429. Peterson, G. L. (1983) Methods Enzymol. 91, 95–11930. Cleasby, A., Wonacott, A., Skarzynski, T., Hubbard, R. E., Davies, G. J.,

Proudfoot, A. E. I., Bernard, A. R., Payton, M. A., and Wells, T. N. C. (1996)Nat. Struct. Biol. 3, 470–479

31. Piani, A., Ilg, T., Elefanty, E. G., Curtis, J., and Handman, E. (1999) MicrobesInfect. 1, 589–599

32. Ilg, T., Demar, M., and Harbecke, D. (2001) J. Biol. Chem. 276, 4988–499733. Russell, D. G. (1987) Eur. J. Biochem. 164, 213–22134. Ilg, T., Harbecke, D., and Overath, P. (1993a) FEBS Lett. 327, 103–10735. Elbein, A. D. (1991) FASEB. J. 5, 3055–306336. Proudfoot, A. E. I., Turcatti, G., Wells, T. N. C., Payton, M. A., and Smith, D. J.

(1994) Eur. J. Biochem. 219, 415–42337. Proudfoot, A. E. I., Payton, M. A., and Wells, T. N. C. (1994) J. Prot. Chem. 13,

619–62738. Smith, D. J., and Payton, M. A. (1994) Mol. Cell. Biol. 14, 6030–603839. Smith, D. J., Proudfoot, A. E. I., Detiani, M., Wells, T. N. C., and Payton, M. A.

(1995) Yeast 11, 301–31040. Freeze, H. H., and Aebi, M. (1999) Biochim. Biophys. Acta 1455, 167–17841. Sols, A., Cadenas, E., and Alvarado, F. (1960) Science 131, 297–29842. Panneerselvam, K., Etchinson, J. R., and Freeze, H. H. (1997) J. Biol. Chem.

272, 23123–2312943. Ilgoutz, S. C., Zawadzki, J. C., Ralton, J. E., and McConville, M. J. (1999)

EMBO J. 18, 2746–2755

Phosphomannose Isomerase of Leishmania mexicana 6575

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from

Attila Garami and Thomas IlgSynthesis and Virulence

GlycoconjugateLeishmania mexicanaThe Role of Phosphomannose Isomerase in

doi: 10.1074/jbc.M009226200 originally published online November 17, 20002001, 276:6566-6575.J. Biol. Chem. 

  10.1074/jbc.M009226200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/276/9/6566.full.html#ref-list-1

This article cites 43 references, 18 of which can be accessed free at

by guest on March 10, 2019

http://ww

w.jbc.org/

Dow

nloaded from