the journal of biological vol. 266, no. 17, june 15, pp. … · 2001-06-09 · fuged at 500,000 x g...

”” Medicine, Indianapolis, Indiaia 46202

1~

A protein of apparent M, = 15,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis is the major plasma membrane substrate for CAMP-dependent protein kinase (PK-A) and protein kinase C (PK-C) in several different tissues. In the work described here, we purified, cloned, and sequenced the canine cardiac sarcolemmal “15-kDa protein.” The amino terminus of the purified protein was not blocked, allowing determination of 50 consecutive residues by standard Ed- man degradation. Overlapping proteolytic phosphopeptides yielded 22 additional residues at the carboxyl terminus. Dideoxy sequencing of the full-length cDNA confirmed that the 15-kDa protein contains 72 amino acids, plus a 20-residue signal sequence. The mature protein has a calculated M, = 8409. There is one hydrophobic membrane-spanning segment composed of residues 18-37. The acidic amino-terminal end (residues 1-17) of the protein is oriented extracellularly, whereas the basic carboxyl-terminal end (residues 38- 72) projects into the cytoplasm. The positively charged carboxyl terminus contains the phosphorylation sites for PK-A and PK-C. In the transmembrane region, the 15-kDa protein exhibits 52% amino acid identity with the “7” subunit of Na,K-ATPase. High stringency Northern blot analysis revealed that 15-kDa mRNA is present in heart, skeletal muscle, smooth muscle, and liver but absent from brain and kidney. We propose the name “phospholemman” for the 15-kDa protein, which denotes the protein’s location within the plasma membrane and its characteristic multisite phosphorylation.

A protein of apparent M, = 15,000 is the major plasmalem- mal substrate for PK-A’ and PK-C in several different tissues. This “15-kDa protein” was first described in cardiac sarcolemmal vesicles (1-5) and has since been identified in plasma

* This work was supported by Grants HL28556 and HL06308 from the National Institutes of Health and by the Herman C. Krannert Fund. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s1 M63934.

The abbreviations used are: PK-A, CAMP-dependent protein kinase; PK-C, protein kinase C; EGTA, [ethylenebis(oxyetbyl- enenitri1o)ltetraacetic acid; Pipes, 1,4-piperazinediethanesulfonic acid SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis.

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 266, No. 17, Issue of June 15, pp. 11126-11130,1991 Printed in U. S.A.

Purification and Complete Sequence Determination of the Major Plasma Membrane Substrate for CAMP-dependent Protein Kinase and Protein Kinase C in Myocardium*

(Received for publication, February 22, 1991)

Cathy J. Palmer, Bruce T. Scott, and Larry R. Jones From the Krannert Institute of Cardioloev and the Deoartments of Medicine and Pharmacology, Indiana University School of

membranes from skeletal (6, 7) and smooth (8-10) muscle, liver ( l l ) , and adrenal tumor cells (12). Stimulation of these tissues with different agonists leads to phosphorylation of the 15-kDa protein by Ca2+- and CAMP-dependent mechanisms (8-14). In cardiac muscle, phosphorylation of the 15-kDa protein occurs after activation of either CY- or ,&adrenergic receptors, and correlates with an increase in contractility (13, 14). In spite of its prominence as a major plasma membrane phosphoprotein, the precise function of the 15-kDa protein remains undefined. No sequence information on the protein has yet been reported nor has the protein been purified.

In the work described here, we report on the purification and complete amino acid sequence of the cardiac sarcolemmal 15-kDa protein. The protein is quite small and contains a single transmembrane domain. A highly basic carboxyl-terminal tail projects into the cytoplasm, which contains several protein kinase phosphorylation sites. Knowledge of the protein structure gives some clues regarding 15-kDa protein function, which are briefly discussed.

EXPERIMENTAL PROCEDURES

Isolation of ”P-Labeled 15-kDa Protein from Canine Cardiac Sar- colemmal Vesicles-Sarcolemmal vesicles were isolated from dog left ventricles as described previously (15). By omitting NaCl from the

tained which exhibited &fold greater phosphorylation of the 15-kDa homogenization buffer and gradient solutions, membranes were ob-

protein compared with our earlier study (5). Protein concentrations were determined by the method of Lowry et al. (16).

Sarcolemmal vesicles were permeabilized by freeze-thaw shock and phosphorylated by endogenous PK-C (5). Freeze-thaw-treated sarcolemmal vesicles were preincubated for 2 min at 30 “C in buffer containing 75 mM Pipes-Tris (pH 6.8), 7.5 mM MgC12, 0.75 mM EGTA, and 0.88 mM CaCI2 (1.0 mg of protein/2 ml). Phosphorylation was initiated by adding 80 PM [y-3ZP]ATP (500 pCi/mg protein) and incubating at 30 “C for 2 min. Reaction mixtures were then centri- fuged at 500,000 X g for 7 min at 4 “C. Pellets were solubilized in electrophoresis sample buffer (5), and SDS-PAGE was performed according to the method of Laemmli (17) using three-well 15% polyacrylamide gels (16 cm X 18 cm X 1.5 mm). Each well was loaded with 325 p g of solubilized sarcolemmal membranes containing approximately 125 pmol of ”P-labeled 15-kDa protein. Following electrophoresis, sample lanes were cut horizontally into 2-mm slices and analyzed for labeled 15-kDa protein by Cerenkov counting. Radioac- tive protein was electroeluted using a Bio-Rad Mini Protean I1 apparatus and then concentrated using Centricon-10 Microconcen- trators (Amicon) and precipitated (18). Protein precipitates were solubilized in 70% formic acid containing 1 mg/ml CNBr and incu- bated in absence of light at 25 “C for 16 h and then dried in a Savant Speed-Vac and solubilized in electrophoresis sample buffer. SDS- PAGE was performed, and sample lanes were cut and analyzed by Cerenkov counting as above. The 15-kDa protein was electroeluted, concentrated, and precipitated as before. Some fractions were further purified by high pressure liquid chromatography using a C, reverse- phase column equilibrated with 0.1% trifluoroacetic acid in water and

11126

Sarcolemmal Phosphoprotein Sequence Determination 11 127

developed with a linear gradient o f 0.1"; trifluoroacetic arid in pro- panol-I. Column fractions were monitorrrl hy al~sorl)ance at 214 nrn and hv Cerenkov counting.

l ' rntw/yt ic 1)igrstion nnd l 'uri/icntinn o/ l ' t t o s p t l r ~ ~ ~ ~ ~ ~ ~ l i r l r ~ s - l ' u r i - lied and precipitated preparations ol phosphorylated I 5 - k I h protein were dissolved in cleavnge l )uf l~r conta in ing 1 : l O or 1:20 weight ratios ofprotease to substrate (estimated hy "I' incorporation). I'roteolvsis by diphenylcarl~amvl rhloritle-tr~~;ltecl trypsin was condwtetl lor 18 h a t 37 "C in 1 0 0 mM ammonium t)ic;~rl)onate (pH KO). I O mM CaCI:!. Digestion with .Slnp~tv/ocf~rc~~s nurcws v8 protease was perfhrmed in 50 mM ammonium acetate (pH 4 .0 ) fnr 18 h at 37 "C. lieactions were terminated with 0.1 M acetic arid, applied to I-ml iron-affinitv columns, and phosphopept ides eluted I)y increasing pH or phosphate gradients ( 1 9 ) . I'hosphopept itlrs eluting at pH ti:{- 1 0 . 3 were lurt her purified by high pressure liquid rhromntographv using a revrrse phase colrrmn equilil)rated with 0.1'; trilluoroacetic acid in watrr antl developed with a linear gradient of O.lCE trifl~roroacetic arid in ace- tonitrile.

Amino Acid .Sryuc.ncc, Annlysis-Protein and phosphopeptide sequences were determined using an Applied Hiosystems model 470A gas-phase protein seqwnator ( ' L O ) .

Lihrnry Scrwning nnd cl1NA Srqurncing-A canine cardiac X g t l O lihrarv (21) was plated in C600 Hfl b:schrrichin coli. Replicate nitrocellulose lifts were prehyhridized for :1 h at 42 "(' in 6 X SSC ( 1 x SSC = 150 mM NaCI, 15 mM sodium citrate, pH 7.0), 1 X 1)enhartlt's solution (0 .02T polvvinvlpvrrolidone. 0.02C; Ficoll, 0.02"; Irovine serum alhumin), O . I C i ) SIX, and 1 0 0 p g denntured salmon sprrm DNA/ml (22). T h e lilwary was scrernrtl with two trligonucleot idr prohes hsed on reverse-translated amino-terminal Iresidr~es 4 - 1 4 ) and phosphopeptide (residues 5'1-61 1 s e q u ~ n r c s o f t he I5 -k lh p rn - tein, consisting o f all pnssil)le codon representations in pnsitions o f degeneracv. 0ligonuclrotitlt.s for screening were 5' end-lnl)rletl using 1'4 polvnucleotitle kinase and [ ~ - " I ' ] A T l ' ( 2 2 ) . lilts were hylrritlizetl for 18 h at 42 "C, then washed three times in 6 X SS(' at 42 " ( * for 30 min and in 2 x SCC at 42 "C for 30 min. Cross-reacting positive clones identified I)y autoradiography were plaque-purified hv three additional rounds of screening. Srveral putative l5-kl)a clones were suhcloned into the b h R I s i teofp l~ l r~escr ip t I I S K vector (Stratagene) for nucleic arid sequence analvsis. D N A sequencing was performed in both directions by the dideoxy method f2:1) using synthetic oligo- nucleotide primers and '1'7 I)NA polvmerase.

Nor t t t rm N / o t Ann/ysis--'l'otal R N A was isolated from diffrrrnt dog tissues (24) and transferred to nitrocellulose after electrophoresis of IO-pg aliqr~ots in denaturing formaldehyde, 1.5"E agarose gels (25). Northern hlots were prehvhridized for 2 h at 65 "C in 50'';. formamide containing 4 X SSC. 5 X Ilenhardt's solution. 250 pg denatured salmon sperm I)NA/ml, 0.05 M sodium phosphate (pH 6.5). 0.1";. SDS, 1 mM E M " , and 1 mg/ml IIiNA. Full-lendh. anti-sense "1'- laheled RNA prolw was svnt hesized hv transcription wing the line- arized pHluescript I I S K sr~l)rlone as template, l(r-"I']ATl', and '1'3 RNA polymerase (26) . Blots were hvhritlized for 18 h at 6.5 "(: and then washed in 2 X SSC, 0.2'; SIX a t 55 "(' for 30 min. 0.5 X SSC, 0.2''; SIIS at 65 "C for 30 min, and twice in 0 . 1 X SS(', n.1"; SI>S at 70 "C for 30 min.

.Src~uc~nrc~Ann/y.srs-(lomputcr analyses o f nucleic acid antl protein seqnences were performed using the PC (lene antl lntelligenetics computer progrtlms. Hvtlropat hv analvsis was performed according to the procedure o f Kvte and Ihol i t t le ( 2 7 ) using a 1 9 amino arid window.

RESULTS

1.5-kDa Protrin Isolation-The 15-kDa protein is the major substrate phosphorylated in sarcolemmal vesicles hy endogenous PK-C ( 5 ) (Fig. 1, SI,). Phosphorylated 15-kDa protein was purified from sarcolemmal vesicles by serial electrophoresis and elect.roelution, providing essentially complete recov- ery of radioact.ive protein at. each step. The initial electroeluted sample contained a broad hand of Coomassie Blue staining material with a rnohilky corresponding to that of the 15-kDa protein (Fig. 1, E l ) . A suhstantial purification was achieved hy treating sample E l with CNHr, which did not cleave the 15-kDa protein, hut shifted other proteins in this

31 -

22 -

14 -

region of the gel downward as cleavage fragments o f incwased mobility (Fig. 1, ( 'B r ) . '.'P-I,aheIed protrin w a s highly enriched in the final electroeluted samplr antl coincided with a single Coomassie Blue staining hand (Fig. 1, 1 2 ) .

Amino Acid Sryucncr I~rtrrminalir~n-Sam~,lc E2 was further purified hy reverse-phase chromatography and srlhierted to automated Edman degradation. The single radioactive peak from the reverse phase column, containing 380 pmol o f incorporated "P, yielded a single sequence n f 50 amino acid residues (Fig. 'W, linr 0). In other experiments. four prnteolytic phosphopeptides (100-200 pmol each) were isolated and sequenced. Two of the tr.yptic phosphopepticles werr limit pep- t,ides (Fig. 'W, lints h and c ) , whereas one was the prodtlct o f incomplete digestion (Fig. 2A, linr d ) . A singlr phosphopeptide was isolated from the V8 digest, whosr sequence over- lapped all three tryptic phosphopeptidrs (Fig. ?A. linv ( 8 ) .

More than 90";; of the incorporated ' . 'I' WAS loralizetl t c r the region encompassed hv these phosphopept ides.

Nuclric Acid Squcnrc Ihtrrminntion-A canine I r f t ven- tricular cDNA lihrarv was screened tvith t w o rrrlrlndant o l i - gonucleotide probes encoding for amino acid residues 4 - 1 4 and 54-61. Three cross-reacting positive clones u'ercx ident ified from 10' recornhinant plaques. All thrrr r lones were similar in size and suhsequentlv shown to coda for the same protein. T h e nucleotide sequence and deduced amino acid s e q u e n c e are shown in Fig. 2 8 . The cDNA was 656 nrlclrotitles Irrnz, consisting of a single open reading framr o f 279 h s ~ pairs flanked hv 102 and 27.5 hase pairs of 5 ' - and : ~ ' - r ~ n t r a n s l : ~ t e d sequence, respectively. An A at position -3 fc)llowed by 11 (;

at position +4, t.ypical for translation initiation I % ) . sur- rounded the initiating AT(; codon. which was in-frame cvith a downstream terminating TA(; codon. A poIy;wl(myht ion signal (29) near the 3' end was followed by ;I p ( ~ l y ( A ) t n i l 01

$0 nucleotides, suggesting that a full-leng.. h co1)y o f t h c - mKNA was sequenced.

11128 Sarcolemmal Phosphoprotein Sequence Determination

6- -86 TGGGCCAGGGGGTCCAMGTGCTCACCCCCGGCACAGCCGACGTTTGGGGGCCTT -102 CCCGCAGGACCAGCTC

-31 -20

-14 19

6 1 1

103 15

145 29

187 43

22 9 57

CTTTCAGCAGGGGACAGCCTGACTGGGGACG ATG GCA CCT C K CAC CAC net A l a Pro L e u Ils His

ATC TTG GTT CTC TGT GTG GGT TTC CTC ACC ACG GCC ACC GCA Ile L e u V a l L e u C y s V a l G l y P h e Leu T h r T h r A l a T h r A l a

G M GCG CCA CAG G M CAC GAC CCG TTC ACC TAC GAC TAC C M 6111 nie Pro 61n 61u Hir Rrp pro he mr ryr nap ryr 6111

Ser Leu Rrg I k Rla Ila L m

Rrg Rrg Cya Rrg Cyr

Lyr rho 6111 bin 6in Rrg mr 61y 61u pro arp 61u 6lu

Elu 61y Rr Phe Rrg Ser Ser 110 Rrg Rrg Leu Ser lk Rrg

K C CTG CGG ATC GGA GGC CTC ATC ATC GCC GGG A K CTC TTC

A K CTC GGT ATC CTC A X : GTC CTG AGC M A AGA TGC CGG TGC

AM TTC MC CAG CAG CAG AGG ACT GGG G M CCT GAT G M GAG

GAG GGA ACT TTC CGC AGC K C ATC CGC CGT CTG K C ACC CGC

271 AGG CGG T U kXCACCTGGCGCGATGGMCCCXXCWGK-GG 7 1 Rrg Rrg end

323 G C T A C C C T G G G C G G C G G G G G G A G G A G M G C O l Y C 378 GGGGGGCTCTCTTGCCTCTCACCTTTGTCACCCCCACAGGATTCCCCCTWGCC 433 TGATGCCTCCCACCCACCACCTGTGCGCCCACCGCCACCTGGACTGCCC~ 488 CCAGCCCTGCCCCCGCAGGCTCCTCXTGCCGCCCAGACTT-TWCGTTG 542 CTTTTCTCTCTTGAno,

-5.0 J I I I I

10 ~ 3 0 4 0 1 ( 0 7 0

FIG. 2. Amino acid sequence of 15-kDa protein. A, protein sequence determined by Edman degradation: line a, amino-terminal sequence; lines b-d, sequence of tryptic phosphopeptides; line e, V8- protease phosphoptptide sequence. A , 3 denotes indeterminate residues. €3, cDNA and deduced amino acid sequence. The nucleotide sequence is numbered with +1 corresponding to the first base of initiating codon ATG. The stop codon and polyadenylation signal are shown in bold. A,i,,, denotes the poly(A) tail. The sequence of the mature protein is shown in bold italics and begins a t +l. The signal sequence is shown in plain text. The transmembrane region of the mature protein is underlined. C, hydropathy plot of mature protein, with negative values reflecting hydrophobicity.

Protein Sequence Analysis-The mature 15-kDa protein contained 72 amino acid residues with a calculated molecular weight of 8409. The deduced amino acid sequence (Fig. 2B) corresponded exactly to the protein sequence (Fig. 2 A ) , demonstrating that we had sequenced the entire protein by standard Edman degradation techniques. cDNA sequencing also revealed that the protein contained a typical signal sequence (residues -20 through -l), with 2 basic residues located amino-terminally, followed by a hydrophobic core and a small aliphatic residue (alanine) a t position -1 (30). The presence of a cleaved signal sequence is consistent with the amino terminus of the mature protein being unblocked. Likewise, the absence of methionine in the mature protein explained the lack of effect of CNBr on its mobility in SDS gels.

A distinguishing feature of the 15-kDa protein is its highly basic nature, with a calculated isoelectric point of 9.7. Most of the basic residues are concentrated at the carboxyl-terminal region, where consensus phosphorylation sites for PK-A and PK-C are found (31). The phosphorylated forms of the protein

FIG. 3. Cartoon model of 15-kDa protein. Amino acid num- bers are shown in parentheses, and positions of positive (Lys and Arg) and negative (Asp and Glu) residues along the sequence are indicated by pluses and minuses, respectively. Potential phosphorylation sites corresponding to serines 62, 63, and 68 and threonine 69 are designated by Ps. OUT and IN designate the outer and inner surface of the plasma membrane, respectively.

Gamma E N E I D I Y D E T V ~ N G I l l F n A L A ~ V ~ L V O I O 15-kDa Q E H D P F T Y D Y O S L R I G G L I I A G I L F I L G I L I V L

FIG. 4. Sequence identity between residues 4-36 of the 15- kDa protein and y subunit residues (Ref. 32) of Na,K-ATPase. Identical residues are boxed.

have neutral or slightly acidic isoelectric points (6).2 Hydropathy analysis (Fig. 2C) revealed the presence of a

single hydrophobic domain of 20 uncharged amino acids (residues 18-37), sufficient to cross the sarcolemmal membrane, which separated the acidic amino-terminal end of the protein from the basic carboxyl-terminal end. A stop-transfer sequence, Arg-Arg-Cys-Arg-Cys-Lys (residues 38-43), was im- mediately adjacent to the transmembrane segment on the carboxyl side, consistent with the protein positioned in the membrane with its 35 carboxyl-terminal residues facing the cytoplasm (30). The 15-kDa protein can thus be defined as a class I, bitopic integral membrane protein by nature of its cleavable signal peptide and the stop-transfer sequence (30). A cartoon of the membrane topology of the 15-kDa protein is presented in Fig. 3.

Nucleic Acid and Protein Sequence Data Bank Compari- sons-Comparison of the amino acid sequence of the cardiac 15-kDa protein with proteins in the National Biomedical Research Foundation Protein Identification Resources data base revealed sequence similarity with the “7 subunit,” or “proteolipid,” of Na,K-ATPase isolated from sheep kidney (32). Residues 4-36 of the 15-kDa protein exhibited 52% identity with the partial sequence of the y subunit (Fig. 4). Search of a recent release of the GenBank nucleic acid data base revealed no nucleic acid sequences homologous with the 15-kDa clone.

Tissue Distribution of Cardiac 15-kDa mRNA-High-stringency Northern blot analysis was performed with the full- length antisense mRNA. A major hybridizing RNA species of about 700 nucleotides, approximating the size of the cDNA insert of the sequenced clone, was observed (Fig. 5, arrow).

C. J. Palmer and L.R. Jones, unpublished observations.

Sarcolemmal Phosphoprotein Sequence Determination 1 1 129

4.40 -

2.27 -

1.35 -

0.24 - FIG. 5. Northern blot showing tissue distrihution of 1 5-kDn

protein mKNA. ‘I’he orrow indicates the I5-kl)a protein mltNA. The hylmitlizinx I):lntl t ~ t 4.4 kilol)ases ( k h ) coincided with ‘LH S rRNA. Alter n ten-times longer :~utorntliographic exposure. a faint l.5-kI)a mltNA signal W:IS d r t c ~ t c ~ l in t h c ~ brain sample h u t was insignificant compartd with t h a t i n t ht, muscle and liver snmples.

15-kDa mRNA was detected at high levels in heart as well a s in aorta, esophagus, stomach, skeletal muscle (triceps), and liver. No significant 15-kDa mRNA was detected in kidney or brain.

DISCUSSION

T h e molecular weight of the 15-kDa protein determined from the deduced amino acid sequence (8409) was suhstan- tially less than that estimated by SDS-PAGE. It is unlikely that the protein is a sulfhydryl-linked dimer, since its mobility in SDS-gels is not changed by boiling in the presence or absence of sulfhydryl-reducing agents. The nomenclature of “15-kDa protein” (5,6, 13) or “16-kDa protein” (8,9, 11) used previously for this entity is inappropriate when, in fact, the actual molecular mass is approximately one-half this value. Therefore, we propose the name “phospholemman” for this protein, indicat.ing a major phosphoprotein substrate localized to the plasmalemma.

The amino acid sequence of phospholemman was consistent with previous studies suggest.ing multiple, separate sites phosphorylated by at least two protein kinases. The carhoxyl- terminal region of phospholemman contained predicted phosphorylation sites for I’K-A and PK-C, a s well as for cGM1’- dependent and Ca”+/calmodulin-dependent protein kinases (31). Our own studies,:’ however, revealed that the protein was not a subst.rate for the latter two kinases, which is consistent with the results of Walaas ct ai. (6, 7), who examined the phosphoprotein in skeletal muscle plasma membranes. We ohserved only serine phosphorylation of phospholemman using I’K-A, whereas I’K-C phosphorylated both serine and threonine residues (data not shown).

The mRNA transcript of phospholemman was not limited to heart hut was present in all muscle t?ipes a s well a s in liver. An interesting finding was t he lack of significant phospholemman mRNA in dog kidney and brain, even though phospholemman shares sequence similarity with the y subunit of Na,K-ATPase isolated from sheep kidney. Brain and kidney

contain relatively high levels of Na.K-ATPase and so would be predicted t o contain high levels of y subunit. The inability of the probe to hybridize with an mHNA species in brain and kidney could mean that the y suhunit and phospholemman are products of different genes, an idea supported by comparison of our cDNA sequence to the kidney y su1)unit c I )SA sequence.’ The y subunit of Na,K-ATPase is not known to be phosphorylated, and it may be that phospholemman has evolved specifically t o allow regulation by multisite phosphorylation (1-14).

Phospholemman shows many similarities t o the regulatory protein, phospholamhan, which is localized to sarcoplasmic reticulum in heart and modulates the activity of the sarcoplasmic reticulum calcium pump (33, 34). Both proteins are small, highly basic, and possess single membrane-spanning domains consisting entirely of uncharged residues (X5). Both proteins are oriented with their most positively charged re- gions directed toward the cytoplasm, where the sites nt phosphorylation are localized (35). Multisite phosphorylation of both proteins occurs in intact myocardium 1)y protein kinases which are activated by CAMP and calcium (13, 14, :3f), and phosphorylation of both proteins produces substantial changes in charge, with isoelectric points changing from approximately 10 to 5 or f ( 3 7 ) . A short region of’ sequence similarity between phospholamhan and phospholemman. where 7 out of 9 residues are identical, is especially intriguing.

I ’ h o . ; ~ ~ h ~ ~ l t ~ r n r ~ ~ : ~ n - ‘H S S I -H H I . S T If H H7” I ’ l ~ o s ~ ~ h ~ ~ l : t m t ~ ; ~ n - 1H-S A I H H A S T I I< M’”

Ser’’’ and Thr” of phospholamhan in this region are phosphorylated exclusively hv PK-A and multifunctional Cn.’+/ calmodulin-dependent protein kinase, respectively ( 3 . 5 ) . Con- sensus phosphorylation site data ( 3 1 ) suggest that Ser“’ o f phospholemman is a prime target for P K - A phosphorylation. Although phospholemman is not a substrate for C‘a”’/calmod- din-dependent protein kinase, the position of 3 consecutive carboxyl-terminal arginine residues (residues 70-72). as well as arginine residues 61,65, and 66, suggest that serine residues 62, 63, and 68 and threonine residue 69 are all potential substrates for PK-C. Several peptides encompassing residues 61-72 were isolated as phosphopeptides, demonstrating that serine and threonine residues in this region of the molecule are phosphorylated. As suggested for phospholamhan (:38), i t is possihle that alteration of membrane surface charge sec- ondary to phospholemman phosphorylation may play a role in phospholemman function. I’hosphorylation-indrlccd per- turbation of sarcolemmal surface charge could alter the local calcium concentration, with resultant effects on activities o f co-localized channels, pumps, and/or antiporters. Hecently, a cardiac delayed rectifier 1.k channel has heen cloned and sequenced (39). which shows some structural similarity t o phospholemman. Both proteins are small and traverse the sarcolemmal membrane once. The membrane-spanning re- gions of both proteins are enriched in glycine and contain no charged residues. The possibility that phospholemman is a channel should also be considered.

I t c ~ / ~ n o r r . / r ~ c / , ~ m ~ ~ ~ ~ ~ . ~ ~ ~ ~ ~ ~ t h a n k Joyre I h v u k ~ t l o r protvin :Ind pvptidv scyuencing, 1,isa 1,rwis for secrt~tari:ll nssistance, : 1 n d Stc.vc8 ( ‘ a l a l o r providing helpful comments on the mnnrlscript. \ \ I , a l w th l lnk I < . 1:orl)ush and li. Mwcrr for acct*ss t o the cI)SA st’quvnw o f t h c a 7 srll)unit o f Sa,K-A’l’l’ase.

~~~ ~~ .

13. k‘orhsh and It. \lc~rcc~r. pc.rson;rl ( . ( l l l l l l l l l l l i c : l t i o l l .

11130 Sarcolemmal Phosphoprotein Sequence Determination

REFERENCES

1. Jones, L. R., Besch, H. R., Jr., Fleming, J. W., McConnaughey, M. M., and Watanabe, A. M. (1979) J. Biol. Chem. 254, 530- 539

2. Jones, L. R., Maddock, S. W., and Besch, H. R., Jr. (1980) J. Bid. Chem. 255,9971-9980

3. Jones, L. R., Maddock, S. W., and Hathaway, D. R. (1981) Biochim. Biophys. Acta 641,242-253

4. Manalan, A. S., and Jones, L. R. (1982) J. Biol. Chem. 257,

5. Presti, C. F., Scott, B. T., and Jones, L. R. (1985) J. Biol. Chem.

6. Walaas, S. I., Horn, R. S., Albert, K. A., Adler, A., and Walaas,

7. Walaas, S. I., Horn, R. S., Nairn, A. C., Walaas, O., and Adler,

8. Boulanger-Saunier, C., Kattenberg, D. M., and Stoclet, J.-C.

9. Boulanger-Saunier, C., and Stoclet, J.-C. (1987) Biochem. Bio-

10. Sarcevic, B., Brookes, V., Martin, T. J., Kemp, B. E., and Robin-

11. Cooper, R. H., Kobayashi, K., and Williamson, J. R. (1984) FEBS

12. Widmaier, E. P., Osawa, S., and Hall, P. F. (1986) Endocrinology

13. Presti, C. F., Jones, L. R., and Lindemann, J . P. (1985) J. Biol.

14. Lindemann, J. P. (1986) J. Biol. Chem. 261, 4860-4867 15. Jones, L. R. (1988) Methods Enzymol. 157, 85-91 16. Lowry, 0. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J.

(1951) J. Biol. Chem. 193, 265-275 17. Laemmli, U. K. (1970) Nature 227, 680-685 18. Wessel, D., and Flugge, U. I. (1984) Anal. Biochem. 138, 141-

10052-10062

260,13879-13889

0. (1988) Biochim. Biophys. Acta 968, 127-137

A. (1988) Arch. Biochem. Biophys. 262, 245-258

(1985) FEBS Lett. 193, 283-288

phys. Res. Commun. 143, 517-524

son, P. J. (1989) J. Biol. Chem. 264, 20648-20654

Lett. 166,125-130

118,701-708

Chem. 260,3860-3867

143

19. Anderson, L., and Porath, J. (1986) Anal. Biochem. 154, 250-

20. Cala, S. E., and Jones, L. R. (1991) J. Biol. Chem. 266,391-398 21. Scott, B. T., Simmerman, H. K. B., Collins, J. H., Nadal-Ginard,

B., and Jones, L. R. (1988) J. Biol. Chem. 263,8958-8964 22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

23. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467

24. Soiero, R., Birnboim, H., and Darnell, J. (1966) J. Mol. Biol. 19,

25. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A. 77, 5201- 5205

26. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K., and Green, M. R. (1984) Nucleic Acids Res. 12, 7035-7056

27. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Bid. 157, 105-132 28. Kozak, H. (1989) J. Cell Biol. 108, 229-241 29. Proudfoot, J. M., and Brownlee, G. G. (1976) Nature 265, 211-

30. Von Heijne, G. (1990) J. Membr. Biol. 115, 195-201 31. Kemp, B., and Pearson, R. B. (1990) Trends Biochem. Sci. 1 5 ,

32. Collins, J., and Leszyk, J . (1987) Biochemistry 26, 8665-8668 33. Tada, M., and Kadoma, M. (1989) BioEssays 1 0 , 157-163 34. Jorgensen, A. O., and Jones, L. R. (1986) J. Cell Biol. 261,3775-

3781 35. Simmerman, H. K. B., Collins, J. H., Theibert, J . L., Wegener,

A. D., and Jones, L. R. (1986) J. Biol. Chem. 261, 13333-13341 36. Wegener, A. D., Lindemann, J. P., Simmerman, H. K. B., and

Jones, L. R. (1989) J. Biol. Chem. 264, 11468-11474 37. Jones, L. R., Simmerman, H. K. B., Wilson, W. W., Gurd, F. R.

N., and Wegener, A. D. (1985) J. Biol. Chem. 260,7721-7730 38. Chiesi, M., and Schwaller, R. (1989) FEBS Lett. 244, 241-244 39. Folander, K., Smith, J. S., Antanavage, J., Bennett, C., Stein, R.

B., and Swanson, R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,

254

362-373

214

342-346

2975-2979

the journal of biological vol. 266, no. 17, june 15, pp. … · 2001-06-09 · fuged at 500,000 x g...

Documents