the of biological chemistrv vol. 263, no 11, issue of ... · the journal of biological chemistrv ai...

THE JOURNAL OF BIOLOGICAL CHEMISTRV ai 1988 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 263, No . 11, Issue of April 15, pp. 5446-5454,1988 Printed in U.S.A.

Carboxyl Groups Near the Active Site Zinc Contribute to Catalysis in Yeast Alcohol Dehydrogenase*

(Received for publication, October 9, 1987)

Axel J. Ganzhorn and Bryce V. Plapp From the Department of Biochemistry, The University of Iowa, Zowa City, Zowa 52242

The importance of carboxyl groups near the active site zinc for the catalytic function of alcohol dehydrogenase I from Saccharomyces cerevisiae was examined by directed mutagenesis and steady state kinetics. Asp- 49 was changed to asparagine and Glu-68 to glutamine (residue numbering as for horse liver enzyme). The catalytic efficiencies (V/K,) for ethanol oxidation and acetaldehyde reduction were decreased by factors of 1000 with the Asn-49 mutant and 100 with the Gln- 68 enzyme. For the Asn-49 mutant, dissociation constants for coenzymes increased v-fold, and Michaelis and inhibition constants for substrates and substrate analogs increased by factors of 20-50. The turnover numbers were reduced 50-fold for ethanol oxidation and 15-fold for acetaldehyde reduction. Product and dead-end inhibition studies and kinetic isotope effects showed that the mechanism with NAD+ and ethanol was rapid equilibrium random, in contrast to the ordered mechanism of wild-type enzyme. Alcohol dehydrogenase I and the Asn-49 mutant had similar CD spectra and 2 zinc atoms/subunit, but slightly different UV absorption and fluorescence spectra. The Gln-68 mutant resembled the wild-type enzyme in most kinetic constants, but the turnover number for ethanol oxidation decreased 35-fold, and K d for NAD’ and K, for acetaldehyde increased by factors of 4 and 50, respectively. The pK values for VI and V,/K,, for ethanol oxidation were shifted from 7.7 (wild-type) to 6.8 in the Gln-68 and 6.2 in the Asn-49 mutant. The altered electrostatic environment near the active site zinc apparently decreases activities by hindering isomerizations of enzyme-substrate complexes.

The structures of horse liver alcohol dehydrogenase and its complexes with coenzymes and substrates (Eklund et al., 1976, 1981, 1982a, 1984) show two carboxyl groups near, but not directly ligated to, the active site zinc. The carboxylate of Asp-49 forms a hydrogen bond to the imidazole of His-67, one of the zinc ligands, whereas GIu-68 is located behind the metal ion, opposite the substrate binding site (Fig. 1). Amino acid sequence alignments (Jornvall et al., 1987) indicate that both residues are conserved in mammalian alcohol dehydrogenases (von Bahr-Lindstrom et al., 1986; Crabb and Edenberg, 1987; Edenberg et al., 1985), as well as in higher plants (Chang and Meyerowitz, 1986; Dennis et al., 1985) and fungi (Jornvall et

* This work was supported by Grant AA06223 from the National Institute on Alcohol Abuse and Alcoholism, United States Public Health Service. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dedicated to Prof. Gerhard Pfleiderer on the culmination of his career.

al., 1978; McKnight et al., 1985). Schematic views of the active sites of the horse liver and yeast enzymes have been presented (Plapp et al., 1987).

The active site zinc binds alcohol directly as a fourth ligand (Eklund et al., 1982a; Eklund and Brandkn, 1983). It may facilitate proton release from the substrate or, in acetaldehyde reduction, polarize the carbonyl group to allow hydride transfer. It has been suggested that the ligand field at the active site metal ion determines the pK values of zinc-bound water and alcohol, which in turn could govern the pH dependence of the enzyme (Andersson et al., 1981). The accumulation of negative charges (Cys-46, Cys-174, Glu-68, Asp-49) may serve to modulate the polarizing effect of the metal in order to facilitate hydride transfer to NAD’ and to prevent substrates and products from binding too tightly (Kvassman et al., 1981).

To evaluate the role of the conserved carboxyl groups, we used oligonucleotide-directed mutagenesis in the homologous yeast enzyme to replace Asp-49 with asparagine and Glu-68 with glutamine.’ The neutralization of negative charges, without altering residues directly coordinated to the active site zinc, should provide a test of the influence on catalysis of the electrostatic environment of the metal ion.

EXPERIMENTAL PROCEDURES

Materials-The mutagenic oligonucleotides (the points of mutation are underlined), TGTCACACTAACTTGCACGC (Asn-49) and GGTGGTCACCAAGGTGCCGG (Gln-68), were made on a Beckman DNA synthesizer by the phosphoramidite method (Beaucage and Caruthers, 1981). Kits for cloning and dideoxy sequencing as well as DNA modifying enzymes were purchased from either Bethesda Re- search Laboratories or New England Biolabs. The lithium salt of NAD+ and the disodium salt of NADH, both 100% grades, were obtained from Boehringer Mannheim. Ethanol-& (99% D) was from Fluka, 2,2,2-trifluoroethanol and pyrazole from Aldrich. The yeast strain and the plasmid used for expression of mutant and wild-type alcohol dehydrogenases, as well as growth media, were described earlier (Ganzhorn et al., 1987).

Mutagenesis-The YEpl3 shuttle vector containing the 7-kilobase BanHI insert with the ADHl gene was digested with restriction enzyme SphI, and the 1.6-kilobase fragment containing the ADHl gene was isolated from an agarose gel and ligated into M13mp18RF phage (Messing, 1983). Mutations were produced using the two- primer method of Zoller and Smith (1984), and confirmed by dideoxy sequencing (Sanger et al., 1977). No other changes were found throughout the entire coding sequence. Double stranded phage DNA was isolated from infected Escherichia coli JMlOl cells (Birnboim, 1983) and digested with SphI enzyme; the fragment containing the mutagenized ADHl gene was purified on a gel and religated into the YEpl3 vector. The directions in the cloning manual by Bethesda Research Laboratories were followed for the ligation reactions. The plasmid was produced in E. coli HBlOl and used to transform yeast cells by the lithium acetate method (It0 et al., 1983). Transformants were selected on minimal medium for acquisition of the LEU2 marker gene.

The numbering of residues in the yeast enzyme corresponds to the sequence of the horse liver enzyme, based on the alignment of Jornvall et al. (1978).

5446

Carboxyl Groups in Alcohol Dehydrogenase 5447

FIG. 1. The active site zinc and its environment in a model of yeast alcohol dehydrogenase. The model was based on the structure of the horse liver enzyme complexed with NAD' and p- bromobenzyl alcohol (Eklund et al., 1982a), with amino acid residues substituted according to the proposed alignment (Jornvall et al., 1978). The metal ion is ligated by the sulfur atoms of cysteine residues 46 and 174, the imidazole group of His-67, and the substrate ethanol. Asp-49 is shown with its carboxylate hydrogen bonded to His-67, and the carboxylate of Glu-68 interacts with the guanidino group of Arg-369, which in turn binds an oxygen of the coenzyme pyrophosphate.

Enzyme Purification-Starter cultures were grown aerobically to full density in 50 ml of selective minimal medium and used to inoculate 6 liters of rich medium. The enzymes were purified and characterized as described previously (Ganzhorn et al., 1987). The concentration of active sites in the mutant enzymes could not be determined by titration with NAD+ and pyrazole, since the enzymes had low affinity for NAD+. The turnover numbers are therefore based on the enzyme concentration, determined spectrophotometrically by using a value for Af.:E of 1.26 at 280 nm (Hayes and Velick, 1954).

Spectra-UV-Spectra were recorded on a Beckman DU-7 spectrophotometer interfaced to an IBM PC/AT computer. Difference spectra were calculated after base line corrections using a PASCAL program. Fluorescence measurements were obtained on a SLM Model 4800 fluorometer. CD spectra were recorded using a Aviv-Cary cir- cular dichroism apparatus. Zinc content was determined with an atomic absorption spectrophotometer (Perkin-Elmer) after the enzyme was dialyzed against 50 mM Tris-HC1 buffer, pH 7.9, containing 1 mM EDTA.

Peptide Mapping-The proteins were pyridylethylated (Hermod- son et al., 1973) and digested with trypsin. Peptides were analyzed on a Synchropak RP-P column (25 cm X 4.1 mm) at a flow rate of 1 ml/ min, applying a linear gradient of 3-36% acetonitrile in 0.1% triflu- oroacetic acid for 2 h. The absorbance was monitored at 229 and 254 nm. The peptide containing Asn-49 was identified by the high absorbance at 254 nm due to the pyridylethyl group (second major peak) and purified further on the Synchropak column with a shallower gradient. Its sequence was determined with an Applied Biosystems Model 470A Gas-Phase instrument with on-line analysis of the phenylthiohydantoins and integration of the areas with a Waters Chromatography Data System.

Kinetic Studies-Initial velocity studies were performed in a physiological buffer of 83 mM potassium phosphate with 40 mM KC1 at pH 7.3 and 30 "C by varying the concentrations of substrate and coenzyme within a 9-fold range around K,,,. Activity was determined by measuring the change in absorbance at 340 nm on a Cary 118C spectrophotometer interfaced to an IBM PC/XT computer equipped with a Data Translation 2805 A/D board. A FORTRAN program was used to estimate initial velocities by a linear or parabolic fit of the time course. Initial velocities were fitted with Equation 1.

VAB U =

K A b + K & + K S + A B (1)

If only one substrate was varied, as in most of the experiments on isotope effects, data were fitted by the Michaelis-Menten equation. FORTRAN programs (Cleland, 1979), run on a VAX 11/780 computer, were used for these fits and for product and dead-end inhibition studies.

Buffers containing 20 mM NaP,O, and various concentrations of sodium phosphate (190 mM total ionic strength) were used for pH dependence studies. Initial velocity data at each pH were fitted with Equation 1. The program NONLIN (C. M. Metzler, The Upjohn Co.) was used for the least squares fitting in determining pK values.

Preparation of (4R)[4-2H]Nicotinumuie Adenine Dinucleotide-20 mM NAD', 200 mM ethanol-d,, and 50 mM semicarbazide in 5 ml of 0.1 M glycine/NaOH, pH 9.5, were mixed with 50 units of alcohol dehydrogenase I. After 15 min, the reaction mixture was applied to a DEAE-cellulose column (2 X 40 cm, Whatman DE32), which was developed with a 500-ml linear gradient from 10 mM sodium phosphate, pH 8, to 200 mM phosphate and 100 mM KCl, pH 8. Fractions absorbing at 340 nm were pooled, yielding 2.7 mM (4R)[4-'H]nicotinamide adenine dinucleotide with an A260/A310 of 2.3. Although this preparation may contain some impurities, iu1th-r Fx-ification steps (Loesche et al., 1980; Newton et al., 1983) could degrade the (4R)[4- 'Hlnicotinamide adenine dinucleotide. As a control, NADH was prepared by the same procedure and found to have the same kinetic parameters as commercial NADH with alcohol dehydrogenase I.

RESULTS

Characterization of Enzymes-Fig. 2 shows the electropho- retic mobilities of the Asn-49 and Gln-68 mutants as compared to alcohol dehydrogenase I on a nondenaturing polyacrylamide gel. The decrease in negative charge, caused by the replacement of a carboxylate with a carboxamide group was apparent in both mutant enzymes. Furthermore, enzyme activity and protein showed exactly the same mobility. This indicates that the low activity found in the modified enzymes was not due to contamination by wild-type enzyme or partial deamidation.

Both mutants were characterized by peptide mapping and compared to the wild-type enzyme. The chromatograms of the tryptic digests were so similar that the elution of no peptide appeared to be altered in the mutants. The peptide containing Asn-49 was purified, and its sequence was confirmed through 10 cycles of Edman degradation.

Heat inactivation studies (Fig. 3) showed that the Asn-49 mutation decreased the stability of the protein by about 2 "C. This may be due to less stable hydrogen bonds with the carboxamide as compared to the carboxylate or to local perturbations of structure.

The zinc content was 1.9 atoms/subunit for the asparagine mutant and 2.1 for alcohol dehydrogenase I. This result agrees with the numbers reported by Klinman and Welsh (1976). However, other investigators found only 1 zinc atom/subunit in yeast alcohol dehydrogenase (Vallee and Hoch, 1955; Syt- kowski, 1977). It does not seem likely, in our case, that the discrepancy can be explained by nonspecific binding of the metal in excess of 1 atomlsubunit, since the enzyme was extensively dialyzed against buffer containing EDTA. En- zymes from different sources, produced and purified under

5448 Carboxyl Groups in Alcohol Dehydrogenase

1 2 3 4 5 6 FIG. 2. Nondenaturing polyacrylamide gel electrophoresis

of mutant and wild-type yeast alcohol dehydrogenases. Lanes 1-3 were stained for protein with 0.1% Coomassie Blue; lanes 4-6 were stained for activity with 0.5 M ethanol, 1 mM NAD', 0.024 mg/ ml phenazine methosulfate, and 0.4 mg/ml nitro blue tetrazolium in 0.1 M Tris-HC1, pH 8.0. Lanes I and 4, alcohol dehydrogenase I-Asn (14 pg for protein, 140 pg for activity stain); lanes 2 and 5, alcohol dehydrogenase I (10 pg); lanes 3 and 6 (14 pg), alcohol dehydrogenase I-Gln.

- I

C .- E

Ad-

50 55 60 65 70 75

Temperature ("C) FIG. 3. Irreversible heat inactivation of wild-type (0) and

Asn-49 (0) enzyme. Enzyme at 1.2 mg/ml in 50 mM Tris-HC1, pH 7.9, was incubated at the indicated temperatures. Samples were withdrawn periodically and assayed a t 30 "C. The wild-type enzyme was diluted 1000-fold prior to assay. The rate of inactivation followed a first order process and observed rate constants were calculated.

different conditions may have different zinc contents. In any case, the experiment shows that the mutation did not result in any significant zinc loss.

Spectral Properties-The far ultraviolet CD spectra of alcohol dehydrogenase I and the Asn-49 mutant were indistin- guishable and indicated that the overall secondary structure was not changed substantially by the mutation.

The UV difference spectrum of the enzyme caused by the change from Asp-49 to Asn is shown in Fig. 4.4. The dominant peak at 300 nm is due to a blue shift in the spectrum, which is consistent with the removal of a negative charge near a tryptophan residue (Ananthanarayanan and Bigelow, 1969). The model of the active site of yeast alcohol dehydrogenase (Fig. 1) shows that the carboxylate of Asp-49 does not directly

I A

260 300 340

-.- 300 350 400

Wavelength, nm

FIG. 4. Spectral changes in alcohol dehydrogenase I caused by the Asp-49 to Asn mutation. A, UV difference spectrum, calculated by subtracting the spectrum of the Asn-49 mutant from the wild-type spectrum. The absorbance spectra were recorded with 12.7 p~ enzyme in 50 mM Tris-HC1, pH 7.9. A6 is the difference extinction coefficient in M" cm". B, fluorescence emission spectra of wild-type (ZZ) and mutant (I) enzyme. The protein solution (2.5 PN) in 50 mM Tris-HC1, pH 7.9, was excited at 280 nm.

contact tryptophans 57 and 93.' However, Tyr-140 is between Trp-57 and Asp-49. Excitation decreases the pK of the tyro- sine hydroxyl, and the proton can be transferred to a nearby base, such as the carboxylate (Brand and Witholt, 1967). The temporary negative charge on Tyr-140 should in turn decrease the absorbance of Trp-57 at 300 nm. With the asparagine mutant, the proton transfer would no longer be facilitated, and absorbance should be larger. If the model is correct, the negative charge on Tyr-140 should quench the tryptophan fluorescence relatively more in the wild-type enzyme (Cowgill, 1963) than in the asparagine mutant. This is indeed the case as shown in Fig. 4B.

Kinetic Mechanism-The initial velocity patterns for both mutant enzymes indicated a sequential Bi mechanism for forward and reverse reactions. The order of coenzyme and substrate binding was investigated by product and dead-end inhibition studies, as well as by kinetic isotope effects. Alcohol dehydrogenase I from Saccharomyces cerevisiae was shown to bind coenzymes before other substrates in a predominantly ordered mechanism (Ganzhorn et al., 1987). This is in agreement with the kinetic deuterium isotope effects (Table I). For alcohol dehydrogenase I, the effect on VJK, was smaller than on Vl/Kb, suggesting that NAD' binds before ethanol. (The still significant size of "VJK,, is probably due to dissociation of NAD' from the ternary complex, as suggested by Silver- stein and Boyer (1964) and Dickinson and Monger (1973).) However, for the Asn-49 enzyme, DVl/K, was similar to "VI/ Kb, indicating essentially a rapid equilibrium random mechanism (Northrop, 1982). In agreement with this conclusion, trifluoroethanol, an inactive substrate analog, was a competitive inhibitor against ethanol and a noncompetitive inhibitor against NAD' (Fig. 5A). The isotope effects and dead-end

Carboxyl Groups in Alcohol Dehydrogenase 5449 TABLE I

Deuterium isotope effects for ethanol oxidation Initial velocity studies were performed at pH 7.3, 30 "C. The

concentration of ethanol or ethanol-& was varied with NAD' fixed at 10 mM. At pH 7.3 data were also obtained by varying NAD' at 500 mM (Asn-49) or 200 mM (Gln-68) ethanol.

Enzyme Isotope effects"

DV. VI fK. DV.fK.

Wild-type pH 7.3

Asn-49 pH 6.0 pH 7.3 pH 7.6 pH 9.0

pH 6.2 pH 7.3 pH 7.6 pH 9.0

Gln-68

1.8

1.9 2.1 2.0 1.6

2.7 2.6 2.8 2.2

1.8 3.2

NDb 2.3

ND 2.2 2.3

2.4 ND 2.3

ND 2.8 2.6 ND

3.0 2.4

ND 2.5

"Nomenclature of Northrop (1982); K. and Kb are Michaelis constants for NAD' and ethanol, respectively.

ND, not determined.

80

60 40

30

3 20 40

lo M

0 0

3 20 -

D -

0 - 2 0 2 4 6 8 1 0 1 2 - 5 0 5 1 0 ! 5 2 0 2 5 3 0

VM Ethcmd VM Ethand 25

20

15

3 0 5

0 - 2 0 0 2 0 4 0 6 0 8 0 K X ) 1 2 0 - 2 0 0 2 0 4 0 6 0 8 0 1 0 0 1 2 0

VM Acetddehyde VM Acetddehyde

FIG. 5. Product and dead-end inhibition patterns for mutant enzymes. u has units of AA,,/min. A, Asn-49, inhibition by 2,2,2-trifluoroethanol (0, 10,20, and 40 mM) at 5 mM ethanol, 380 nN enzyme. B, Asn-49, inhibition by NADH (0, 0.2, 0.4, and 0.8 mM) at 10 mM NAD+ in a cuvette with 2-mm path length, 840 nN enzyme. C, Asn-49, inhibition by NAD+ (0, 2.4, 4.8, and 9.6 mM) at 0.2 mM NADH, 31 n N enzyme. D, Gln-68, inhibition by 2,2,2-trifluoroethanol (0, 10, 20, and 40 mM) at 5 mM ethanol, 340 nN enzyme. E, Gln-68, inhibition by NADH (0, 0.025, 0.05, and 0.1 mM) at 2 mM NAD', 53 nN enzyme. F, Gln-68, inhibition by NAD' (0, 2.2, 4.5, and 8.9 mM) at 0.2 mM NADH, 8 n N enzyme.

inhibition results are not consistent with a predominantly ordered mechanism for ethanol oxidation with the Asn-49 mutant.

In product inhibition experiments with the Asn-49 mutant, NADH was a competitive inhibitor against NAD' or ethanol

(Fig. 5B), and NAD' was a competitive inhibitor against NADH, but noncompetitive against acetaldehyde as the varied substrate (Fig. 5C). Acetaldehyde and ethanol were noncompetitive inhibitors versus NAD' and NADH, respectively. Ethanol and acetaldehyde were mutually competitive. (With the wild-type enzyme, the coenzymes were mutually competitive, whereas ethanol was noncompetitive against acetaldehyde, and acetaldehyde could be shown to be noncompetitive against ethanol only in very precise experiments.) A simple rapid equilibrium random mechanism for forward and reverse reactions is ruled out by the noncompetitive inhibition patterns, but a mechanism including dead-end complexes could explain most of the patterns. However, kinetic isotope effects with (4R)[4-ZH]nicotinamide adenine dinucleotide and acetaldehyde were small (DV2 = 1.2; DV2/Kq = 1.3; DV2/K, = 1.4), suggesting high commitment factors in the reverse reaction. These results are not consistent with the rapid equilibrium assumption. (As a control, the isotope effects with wild-type enzyme were found to be DV2 = 0.7, DV2/Kq = 0.9, and "V2/ K, = 1.3. These values were not significantly different from those with the mutant.) For the Asn-49 mutant we therefore propose random binding of NAD' and ethanol in rapid equilibrium, and ordered addition of NADH and acetaldehyde (Scheme I), as the simplest mechanism consistent with the patterns in Fig. 5, A-C.

K h J \ K h EA

SCHEME I

The complete kinetic equation for the mechanism in Scheme I was derived using the method of Cha (1968):

The expression is similar to the one for the Ordered Bi Bi mechanism, except that it has an additional term in BP, and terms in BQ and BPQ are missing. In addition, as suggested by Dalziel and Dickinson (1966) for a general mechanism of alcohol dehydrogenases, an enzyme-ethanol-NADH complex may form, which could account for the noncompetitive inhibition of NADH by ethanol.

For the Gln-68 mutant, the noncompetitive product inhibition patterns (Fig. 5, E and F ) are consistent with the Ordered Bi Bi mechanism, but trifluoroethanol inhibition (Fig. 5 0 ) and deuterium isotope effects (Table I) indicate that binding of NAD' and ethanol is random.

These results suggest that the three enzymes have the same general mechanism with different magnitudes of rate constants and degrees of randomness. The mechanism of the glutamine mutant appears to be more random than that of wild-type alcohol dehydrogenase I, but not rapid equilibrium random as with the asparagine enzyme. The binding of NADH and acetaldehyde appears to be ordered steady state, rather than rapid equilibrium ordered, for both mutant enzymes, since none of the initial velocity patterns intersected on the l / v axis.

Kinetic Constants-Initial velocity studies provided kinetic constants (Table 11) for the enzymatic reactions and dissociation constants for some inhibitors. The equilibrium constants calculated from the Haldane relationship were in good agreement with the experimentally determined value of 10 PM

5450 Carboxyl Groups in A

(Sund and Theorell, 1963), indicating the self-consistency of the kinetic constants.

Both mutations decreased the turnover numbers for ethanol oxidation about 40-fold, whereas those for acetaldehyde reduction were decreased 15-fold (Asn enzyme) and 2.3-fold (Gln enzyme). Replacement of Asp-49 with Asn decreased affinities of the enzyme for a variety of ligands. Dissociation constants for enzyme-coenzyme complexes (Kk, K,) increased 7-fold. The 50-fold increase in K, and the 25-fold effect on Kb may be due only partly to a binding effect. In the ordered mechanism of wild-type enzyme, Michaelis constants are not simple dissociation constants (Plapp, 1973), whereas they are in the rapid equilibrium mechanism of Scheme I. Thus, K, and Kb could increase even without a change in affinity. The mutant enzymes also had about 10-20-fold lower affinities for trifluoroethanol, the inactive analog of ethanol. K, values increased about 50-fold. The kinetic constants for the Gln-68 mutant, except for Vl, K,, and K,, resembled those of wild- type enzyme.

The R values showed that 81% of the Gln-68 enzyme is in

TABLE I1 Kinetic constants for mutant enzymes

Initial velocity studies were performed at pH 7.3 and 30 "C. Enzyme

Wild-typeb Am-49 Gln-68 Kinetic constants"

KO, mM 0.17 9.0 0.41 Kb, mM 17 430 41 K,, m M 1.1 50 56 Kg, mM 0.11 0.9 0.16 K,, mM 0.92 5.8 3.5 Ka, mM 90 250' NDd K,, mM 1.1 36' ND K,. mM 0.031 0.24 0.029 V J E , s - ~ 340 7.5 9.9 VzIEt, s-: 1700 113 730 VJKb, s- mM" 20 0.018 0.24 V2/K,, s-' mM" 1550 2.3 13 K,, P M 22 16 R'

8

Activity, s - ~ 400 0.75 15 Ki(EA.TFEh my" 2.8 59 25 KNE.TFEI, mM', 62 85

0.25 -0.7 0.81

K,,,I~, mM' 0.011 2.4 ND K;.=i&, mMk 1.2 8.2 ND

KO, Kb, K,, and K, are the Michaelis constants for NAD+, ethanol, acetaldehyde, and NADH, respectively. K, values are inhibition constants. Vl/Et and V2/Et are the turnover numbers of forward and reverse reaction. Standard errors ranged from 5 to 15% in product inhibition, 10 to 25% in initial velocity studies.

Data from product inhibition studies (Ganzhorn et al., 1987). Uncorrected slope inhibition constants. ND, not determined.

e Equilibrium constant, calculated from: K., = (V,Kd(,H+)/ (V,KdC,), where [H'] = 5 X lo-' M.

'Fraction of the enzyme in the ternary complex, calculated from (Janson and Cleland, 1974): R = [ ( l - K./K,)/Vl + (1 - K,/K,)/V2] / ( l / V l + l/VZ).

Turnover number in standard assay (Plapp, 1970) at 30 "C, based on spectrophotometric determination of enzyme concentration.

Dissociation constant of trifluoroethanol from the E . NAD+ complex. Determined from the intercept effects in the patterns of Fig. 5, A and D.

Dissociation constant of trifluoroethanol from the free enzyme. Determined from the slope effects in the patterns of Fig. 5, A and D.

J Competitive inhibition by pyrazole. Wild-type: 0,5,10, and 20 p~ inhibitor versus 7.1,10,16.7, and 50 mM ethanol at 1 mM NAD', 0.67 nN enzyme. Asn-49 mutant: 0, 5, 10, and 20 mM inhibitor versu.s 71, 100,167, and 500 mM ethanol at 10 mM NAD', 360 nN enzyme.

Competitive inhibition by sodium azide (0, 16.7, 25, and 50 mM for wild-type and 0, 50, 100, and 200 mM for mutant enzyme) with ethanol as the varied substrate.

dcohol Dehydrogenase

the ternary complex as compared to 25% with wild-type enzyme. For the asparagine mutant the calculation gave a negative number, showing again that the mechanism cannot be ordered.

Constants from product inhibition studies in Fig. 5 were determined and corrected for the concentration of the fixed substrate. Correction factors were obtained from Equation 2 for the asparagine enzyme and from the kinetic equation for the Ordered Bi Bi mechanism for the glutamine mutant. The corrected values were in good agreement with the constants in Table 11, giving additional support to the proposed mech- anisms.

pH Dependence-An ionizable group with a pK of 7.6-8.2 appears to be involved in catalysis by yeast alcohol dehydrogenase (Klinman, 1975; Dickenson and Dickinson, 1975; Cook and Cleland, 1981a). The kinetic constants for ethanol oxidation by both mutant enzymes at different pH values are summarized in Table 111, and Fig. 6 shows the pH dependencies of VJK,. pK values are given in Table IV. For the Asn- 49 enzyme, pK values for Vl and Vl/Kb were the same within the error limits. Kb itself did not show any significant pH dependence. This result indicates that binding of ethanol to the enzyme-NAD+ complex is not pH dependent (no pertur- bation of pK upon substrate binding) and also supports the conclusion that Kb is a dissociation constant. It appears that a group with a pK of about 6.2 must be unprotonated for the reaction to proceed at maximum rate.

With the glutamine enzyme, the pH dependence leveled off between pH 7 and 8, but then rose again. The data were best fitted to a function with two pK values and two active forms of deprotonated enzyme, but the higher pK was out of the accessible pH range and not well determined. If the first part

TABLE I11 pH dependence of kinetic constants

From initial velocity studies as described under "Experimental Procedures." Standard errors of the fits to Equation 1 were usually less than 20% of the values.

Asn-49 5.9 6.1 6.24 6.5 7.0 7.3 7.7 8.4 8.7

Gln-68 5.9 6.2 6.35 6.5 6.7 7.0 7.3 7.6 8.0 8.5 9.0 9.5

S-1

2.0 6.7 3.0 7.8 2.8 4.5 5.2 5.8 7.1 10.6 6.5 9.0 5.6 8.3 6.1 10.1 7.1 11.4

2.1 0.77 2.7 0.79 4.6 ND" 4.5 0.83 6.0 ND 8.4 0.45 9.9 0.41

14.5 ND 16.7 0.66 21.1 0.77 34.3 0.91 49.9 0.95

V, K"

mM

370 420 280 380 540 430 280 510 470

44 52 54 45 49 44 41 53 62 55 62 55

KO

4.5 4.3 5.8 7.3 7.6 5.8

18.0 12.5 12.2

5.5 2.3 ND 2.6 ND 2.5 3.5 ND 3.2 5.3 7.3 7.6

K,

Asn-49 5.9 260 0.18 70 0.026 7.3 110 0.9 50 0.24

a ND. not determined.


-2.5 5 6 7 8 9 1 0

PH FIG. 6. pH dependence of Asn-49 (0) and Gln-68 (0) mu-

tants.

TABLE IV pK values for ethanol oxidation

Enzyme VI VJKb

PK y" PK Y C' m"s"

Wild-typeb 7.0 f 0.2 500 f 20 7.7 f 0.1 29 f 2 Asn-49' 6.3 f 0.1 6.9 f 0.1 6.1 f 0.1 0.016 f 0.001 Gln-6@ 6.9 f 0.1 15 f 2 6.7 f 0.1 0.27 f 0.03

9.2 f 0.3 64 f 13 9.6 f 0.6 2 f 2 Maximal limiting rate above the pK value.

* Data from R. M. Gould: fitted by Equation 3 of Dworschack and Plapp (1977).

and Y the pH independent constant.

"

e Fitted to logy = log Y - log( 1 + (H')/K) where y is the observed,

Fitted with Equation 4 of Dworschack and Plapp (1977).

of the curve in Fig. 6 was fitted to an equation with a single pK value (Footnote c in Table IV), a pK value of 6.7 was obtained. Again, the pK values for Vl and were identical within the error limits. The unusual pH dependence curve may be due to the deprotonation of the two ionizable groups in the proton relay system: His-51 and the zinc alcohol (Eklund et al., 1982a). Evidence for two active deprotonated states in the liver enzyme (Dworschack and Plapp, 1977; Hennecke and Plapp, 1983) and in the yeast enzyme (Cook and Cleland, 1981b) has been obtained previously. In summary, the pH dependencies show that the pK of a catalytic group (or system) in alcohol dehydrogenase I is reduced by 1.4 units in the asparagine and by 0.8 units in the glutamine mutant.

Isotope Effects-The data in Table I suggest that hydride transfer is at least partially rate-limiting with wild-type and mutant enzymes. The effects were clearly bigger in the glutamine mutant. With Asn-49 enzyme, DVl appeared to be slightly smaller than DVJKb, but the difference may be within the experimental error, at least at the lower pH values. The isotope effects did not show a significant pH dependence, and there was no increase at pH values below the pK affecting catalysis. This result, together with the fact that DVl and "V1/ Kb were similar, indicates that external commitment factors do not play a significant role and that internal isotope effects are being measured for both enzymes even at neutral pH (Cook and Cleland, 1981a). This means that substrates are released rapidly from the ternary complex (as compared to the rate of hydrogen transfer), and NADH release cannot be a rate-limiting step. This is in contrast to the findings with alcohol dehydrogenase I, where DVl was pH dependent and much smaller than DV1/Kb, suggesting partially rate-limiting release of the coenzyme.*

* R. M. Gould, unpublished experiments.

DISCUSSION

Amidating the carboxylate of Asp-49 reduced the catalytic efficiency (V/K) by 1000-fold for both ethanol oxidation and acetaldehyde reduction; amidation of Glu-68 decreased eff- ciencies 100-fold. Turnover numbers with ethanol decreased by about 40-fold, and affinities for coenzymes, substrates, and inhibitors decreased by up to 20-fold. In addition, the mutations changed the mechanism from preferred ordered to a more random one for ethanol oxidation, with binding of substrates and coenzymes approaching rapid equilibrium in the asparagine mutant.

Two basic effects should be considered in explaining the altered kinetics of the mutant enzymes: structural perturbations and electrostatic effects. Even though there was no evidence for major structural changes, since both enzymes were still active and minimal changes were detected in CD, UV, and fluorescence spectra, the mutations may slightly alter the local structure near the active site zinc. Our model of this region (Fig. 1) suggests that the mutant enzymes should be able to accommodate the additional hydrogen atoms of the carboxyamide group, but the removal of negative charges could disturb the geometry around the active site metal. The small decrease in heat stability of the Asn-49 mutant may indicate a local structural change. Dutler and Ambar (1983) have suggested that the zinc ligands rearrange during catalysis. Thus, subtle changes in the positioning of the ligands to the zinc could affect hydride transfer and account for the low turnover numbers. According to this interpretation, the affinities of coenzymes, substrates, and inhibitors are decreased by 5-20-fold because the proper positioning and activation of substrates requires small conformational changes that exclude water from the active site and increase the strength and number of interactions with ligands.

An alternative explanation for the changes in kinetic constants is that the increased electrostatic potential near the active site zinc, due to removal of negative charges, directly affects the binding of ligands and activation of the subtrates. The zinc ion is thought to perturb the pK of the alcohol so that it deprotonates under physiological conditions and is activated for hydride transfer (Kvassman et al., 1981). Elec- tron withdrawing groups on a series of primary alcohols decreased the reaction rate with horse liver alcohol dehydrogenase, as characterized by a Hammett p value of about -1 (Blackwell and Hardman, 1975). However, yeast and liver alcohol dehydrogenases showed only small electronic effects withp-substituted benzyl alcohols, whereas the benzaldehydes were characterized by a p value of 1-2 (Klinman, 1972, 1976; Hardman et al., 1974; Dworschack and Plapp, 1977). Thus, the zinc polarizes the carbonyl group of bound aldehyde and promotes attack of hydride ion. However, these effects on alcohol and aldehyde must be well balanced; if the electrostatic potential is too high, it may be detrimental for catalysis in both directions.

Amidation of either carboxyl group decreased pK values for vl/Kb about 1 unit. This change is consistent with the conclusion of Andersson et al. (1981) that one additional negative charge among the protein ligands should raise the pK value of a ligand by about 2 pH units. Outer sphere ligands should strongly contribute, also. The removal of one negative charge in the mutants should decrease the pK value of water or alcohol bound to zinc. Thus, the decreased activities of both mutants for oxidizing ethanol may be due to slower hydride transfer rates caused by increased polarization of the substrate.

Although-the origins of pK values for coenzyme and substrate binding and hydrogen transfer reactions of horse liver


and yeast alcohol dehydrogenases have not been established (Klinman, 1975; Dickenson and Dickinson, 1975; Kvassman and Pettersson, 1980; Cook and Cleland, 1981b; Dietrich et al., 1983; Hennecke and Plapp, 1983; Makinen et al., 1983; Bertini et al., 1984; Sartorius et al., 1987), the pK value near 7 for VI could be due to the alcohol bound to zinc in the proton relay system (Eklund et al., 1982a; Pettersson, 1987). For both mutant enzymes, the major effect of pH was on V,, whereas Kb was pH independent. The wild-type enzyme also has pH-independent Kb values for butanol, p-methylbenzyl alcohol, and 2-propanol, whereas it has different pK values for vl and Vl/& in ethanol oxidation, due to partially rate- limiting coenzyme release (Klinman, 1975; Dickenson and Dickinson, 1975; Cook and Cleland, 1981a). The pH independence of Kb may arise simply because the pK values of the water and alcohol ligated to the catalytic zinc in the enzyme- NAD' complex are the same. The pH dependence of VI then reflects the faster rate of hydride transfer of the deprotonated ternary complex.

For acetaldehyde reduction, however, the decrease in catalytic efficiency ( V2/Kp) of the mutants is not as readily explained by electrostatic effects since the higher positive charge at the zinc should facilitate hydride transfer. Nevertheless, stronger polarization may prevent the alkoxide intermediate (Sartorius et al., 1987) from being protonated and decrease the pK of the enzyme-NAD+-alcohol complex and the rate of alcohol release. In this case, the reaction should be faster at a pH below the pK of the catalytic system. The data in Table I11 show only a moderate increase in the turnover number of the asparagine mutant at pH 5.9. (Lower pH values might provide more conclusive evidence, but the enzymes are not stable under such conditions.) That ethanol binding ( l/Kb) to the mutant dehydrogenases is pH independent over the pH range from 6 to 9 also does not support the suggestion that protonation of the alkoxide is limiting.

Affinities of enzyme for both coenzymes (l/Kh and l/Kk) were decreased 7-fold. A simple electrostatic model of the horse liver enzyme has been used to explain the pH dependencies of coenzyme binding (Pettersson and Eklund, 1987); removal of one negative charge near the zinc should increase the affinities of the mutant enzymes for coenzyme. Since this is contrary to the observations, the simple model is not a complete explanation.

The electrostatic model also does not account for the increased Michaelis constants for ethanol and acetaldehyde and increased dissociation constants for inhibitors that bind to the zinc. The mutant enzymes bound trifluoroethanol 10-20 times more weakly than did the wild-type enzyme. (Thus, the 25-fold increase in Kb for ethanol probably is due to a large effect on binding.) Azide was also bound about 7 times less well to the Asn-49 mutant. These weaker affinities are not expected from simple electrostatic effects, since a more posi- tively charged zinc site should attract the negatively charged ligands more strongly.

A larger effect (220-fold) was found for the binding of pyrazole in its ternary complex with enzyme and NAD'. In horse liver alcohol dehydrogenase, the pyrazole N2 nitrogen binds directly to the active site zinc and N1 forms a covalent bond with the pyridinium C4 atom of NAD' (Eklund et al., 1982b). It has been suggested that the inhibitor forms a transition state-like complex (Theorell and Yonetani, 1963). The weaker binding of pyrazole to the Asn-49 mutant is another indication that the transition state for catalysis is highly unfavorable. ( Vl/Kb is reduced more than 1000-fold.)

In general, then, the effects of the mutations on binding are not readily explained by simple electrostatic effects,

whereas the effects could be explained if the binding of the various ligands is coupled to conformational changes that are required to form an active complex.

Horse liver alcohol dehydrogenase changes conformation upon coenzyme binding, effectively closing the cleft between the catalytic and coenzyme binding domains (Eklund et al., 1981). This rearrangement may account for theordered mechanism in enzyme catalysis. The change requires the nicotinamide part of the coenzyme (Nordstrom and Brandim, 1975) and a substrate or inhibitor bound to the active site zinc (Sartorius et al., 1987), whereas the presence of the zinc ion itself is not necessary (Schneider et al., 1983). From spectro- scopic studies with Co2+-substituted horse liver alcohol dehydrogenase, it was concluded that negatively charged ligands (alkoxide, OH-, C1-) stabilize the closed conformation of the enzyme (Maret and Zeppezauer, 1986; Sartorius et al., 1987).

It is not known if coenzyme binding in the yeast enzyme causes similar conformational changes. Fluorometric studies (Karlovii: et al., 1976) and the substrate specificity of a mutant alcohol dehydrogenase I (Leu-294) suggest that the active enzyme is in the "closed" form (Ganzhorn et al., 1987). Fur- thermore, wild-type yeast enzyme also follows a preferred ordered mechanism, suggesting that the enzyme rearranges after NAD+ binds. The Asp-49 to Asn substitution changes the mechanism for ethanol oxidation from Ordered Bi Bi to rapid equilibrium random. The mutation might be equivalent to the replacement of a negatively charged ligand with a neutral one, thereby making the closed conformation less favored. The effect could be mediated by small structural perturbations. Therefore, NAD' and ethanol may both bind to an open enzyme form. Without the requisite conformational change, substrates and coenzyme would not bind as tightly. Furthermore, in an open conformation, the pyrazole N1 nitrogen could no longer form a covalent bond to the C4 carbon in NAD', and the affinity for this inhibitor would decrease.

That the removal of negative charges near the active site zinc affects conformational changes is consistent with the isotope effects. Since hydride transfer could be rate-limiting in the rapid equilibrium mechanism, intrinsic deuterium isotope effects could be measured. However, the isotope effects (DVl/Kb at pH 7.3) were only 2.3 for the Asn-49 and 3.0 for the Gln-68 enzymes, and they are not reduced by external commitment factors as indicated by their independence of pH. The intrinsic isotope effect ( D k ) for yeast alcohol dehydrogenase with 2-propanol as substrate is 5.7 (Cook and Cleland, 1981a). However, lower values have been measured for the oxidation of benzyl alcohol catalyzed by the horse liver enzyme (Scharschmidt et al., 1984). For yeast formate dehydrogenase, Dk was only 2.2 (Hermes et al., 1984). The intrinsic isotope effect in those cases depended on the redox potential of the nucleotide, and the lower values were ascribed to a late transition state. In contrast, a symmetrical transition state was assumed for 2-propanol oxidation by yeast alcohol dehydrogenase. Primary alcohols have a more positive redox potential than secondary ones, and the increased polarizing effect of the metal ion in both mutant enzymes will make the reaction energetically even less favorable. This causes the transition state to become late, and the measured isotope effects may be intrinsic.

If, however, coenzyme and substrate bind to an open enzyme form, the resulting ternary complex might have to rearrange before hydride transfer can take place. Such a step produces an internal commitment factor, providing a second explanation for the low isotope effects in ethanol oxidation.


In this case, the mechanism in Scheme I must include an extra step:

E A B ” E A B * - E P Q kn km kn ku

The additional step could reduce the magnitude of the observed effect (Cook and Cleland, 1981a). Thus, both a late transition state, as discussed above, and internal commitment factors due to isomerizations of ternary complexes may account for the low isotope effects.

Comparing the two mutant enzymes, one might expect that the Gln-68 change would have more severe effects on the catalytic properties of the enzyme, since the residue is closer to the active site zinc. However, this mutation is less detrimental to catalysis, and the mechanism appears to be more ordered than in the Asn-49 mutant. Furthermore, its pK value for ethanol oxidation is shifted less than that of the asparagine enzyme. Perhaps the negative charge of Glu-68 is partially neutralized by Arg-369. In addition, changes at position 49 are relayed to the metal ion by the inner sphere ligand, His- 67, which is hydrogen bonded to Asp-49. The curious pH dependence of the Gln-68 mutant may reflect the involvement of the zinc alcohol and His-51, which are part of the potential proton relay system (Eklund et al., 1982a).

In summary, removing negative charges near the active site zinc considerably decreases catalysis by yeast alcohol dehydrogenase. The effect cannot be assigned to a single isolated step in catalysis, but rather is due to a change in the overall enzyme mechanism, coupled with changes in coenzyme and substrate binding, as well as hydride transfer and deprotonation steps. Residues that are not directly involved in binding substrates contribute to catalysis. With respect to the mutations reported here, we think that electrostatic effects leading to an increased polarizing potential of the catalytic zinc account for the decreased pK values for catalysis, and some of the loss of activity, but that local structural perturbations also apparently affect conformational changes that are required for proper binding of coenzymes and substrates. The carboxyl groups of Asp-49 and Glu-68 are necessary to modulate the effective charge on the metal ion and create an electrostatic environment that is suitable for rearrangements around the catalytic zinc.

Acknowledgments-We thank Darla Ann Kratzer for excellent technical assistance, Hans Eklund and T. Alwyn Jones for crystal- lographic coordinates and advice on molecular graphics, David W. Green for building a model of the yeast enzyme, E. T. Young and B. D. Hall for yeast strains and the plasmid containing the ADHl gene, and Doo-Hong Park and Asgar Zaheer for determining the amino acid sequence of the tryptic peptide. Services were provided by the Facilities for Protein Structure, Diabetes Endocrinology Research Center, and Image Analysis.

REFERENCES Ananthanarayanan, V. S., and Bigelow, C. C. (1969) Biochemistry 8 ,

Andersson, P., Kvassman, J., Lindstrom, A., Oldin, B., and Petters-

Beaucage, S. L., and Caruthers, M. H. (1981) Tetrahedron Lett. 22,

Bertini, I., Gerber, M., Lanini, G., Luchinat, C., Maret, W., Rawer, S., and Zeppezauer, M. (1984) J. Am. Chem. SOC. 106 , 1826-1830

Birnboim, H. C. (1983) Methods Enzymol. 100,243-255 Blackwell, L. F., and Hardman, M. J. (1975) Eur. J. Biochem. 5 5 ,

Brand, L., and Witholt, B. (1967) Methods Enzymol. 11 , 776-856 Cha, S. (1968) J. Biol. Chem. 2 4 3 , 820-825 Chang, C., and Meyerowitz, E. M. (1986) Proc. Natl. Acad. Sci.

Cleland, W. W. (1979) Methods Enzymol. 6 3 , 103-138

3717-3728

son, G. (1981) Eur. J. Biochem. 113,425-433

1859-1862

611-615

U. S. A. 83, 1408-1412

Cook, P. F., and Cleland, W. W. (1981a) Biochemistry 20,1797-1805 Cook, P. F., and Cleland, W. W. (1981b) Biochemistry 20,1805-1816 Cowgill, R. W. (1963) Biochim. Biophys. Acta 7 5 , 272-273 Crabb, D. W., and Edenberg, H. J. (1987) Gene 48,287-290 Dalziel, K., and Dickinson, F. M. (1966) Biochem. J. 100 , 34-46 Dennis, E. S., Sachs, M. M., Gerlach, W. L., Finnegan, E. J., and

Dickinson, F. M., and Monger, G. P. (1973) Biochem. J. 131, 261-

Dickenson, C. J., and Dickinson, F. M. (1975) Biochem. J. 147,303-

Dietrich, H., MacGibbon, A. K. H., Dunn, M. F., and Zeppezauer, M. (1983) Biochemistry 22,3432-3438

Dutler, H., and Ambar, A. (1983) in The Coordination Chemistry of Metalloenzymes (Bertini, I., Drago, R. S., and Luchinat, C., eds) pp. 135-145, D. Reidel Publishing Co., Boston, MA

Dworschack, R. T., and Plapp, B. V. (1977) Biochemistry 16, 2716- 2725

Edenberg, H. J., Zhang, K., Fong, K., Bosron, W. F., and Li, T.-K. (1985) Proc. Natl. Acad. Sci. U. S. A. 82 , 2262-2266

Eklund, H., and Briindkn, C.-I. (1983) in Zinc Enzymes (Spiro, T. G., ed) pp. 124-152, John Wiley, New York

Eklund, H., Nordstrom, B., Zeppezauer, E., Soderlund, G., Ohlsson,

Akeson, A. (1976) J. Mol. Biol. 102 , 27-59 I., Boiwe, T., Soderberg, B.-O., Tapia, O., Brandin, C.-I., and

Eklund, H., Samama, J.-P., Wallin, L., Brandin, C.-I., Akeson, A., and Jones, T. A. (1981) J. Mol. Biol. 146 , 561-587

Eklund, H., Plapp, B. V., Samama, J.-P., and Brandin, C.-I. (1982a) J. Biol. Chem. 2 6 7 , 14349-14358

Eklund, H., Samama, J.-P., and Wallbn, L. (1982b) Biochemistry 2 1 ,

Eklund, H., Samama, J.-P., and Jones, T. A. (1984) Biochemistry 2 3 ,

Ganzhorn, A. J., Green, D. W., Hershey, A. D., Gould, R. M., and

Hardman, M. J., Blackwell, L. F., Boswell, C. R., and Buckley, P. D.

Hayes, J. I., Jr., and Velick, S. F. (1954) J. Biol. Chem. 207,225-244 Hennecke, M., and Plapp, B. V. (1983) Biochemistry 22,3721-3728 Hermes, J. D., Morrical, S. W., O’Leary, M. H., and Cleland, W. W.

Hermodson, M. A., Ericsson, L. H., Neurath, H., and Walsh, K. A.

Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol.

Janson, C. A., and Cleland, W. W. (1974) J. Biol. Chem. 249 , 2562-

Jornvall, H., Eklund, H., and Brandin, C.-I. (1978) J. Biol. Chem.

Jornvall, H., Persson, B., and Jeffery, J. (1987) Eur. J. Biochem.

Karlovii., D., Amiguet, P., Bonner, F. J., and Luisi, P. L. (1976) Eur.

Klinman, J. P. (1972) J. Biol. Chem. 2 4 7 , 7977-7987 Klinman, J. P. (1975) J. Biol. Chem. 2 5 0 , 2569-2573 Klinman, J. P. (1976) Biochemistry 15, 2018-2026 Klinrnan, J. P., and Welsh, K. (1976) Biochem. Biophys. Res. Com-

Kvassman, J., and Pettersson, G. (1980) Eur. J. Biochem. 103, 565-

Kvassman, J., Larsson, A., and Pettersson, G. (1981) Eur. J. Biochem.

Loesche, W., Wenz, I., Till, U., Petermann, H., and Horn, A. (1980)

Makinen, M. W., Maret, W., and Yim, M. B. (1983) Proc. Natl. Acad.

Maret, W., and Zeppezauer, M. (1986) Biochemistry 2 6 , 1584-1588 McKnight, G. L., Kato, H., Upshall, A., Parker, M. D., Saari, G., and

O’Hara, P. J. (1985) EMBO J. 4 , 2093-2099 Messing, J . (1983) Methods Enzymol. 101,20-78 Newton, C. J., Faynor, S. M., and Northrup, D. B. (1983) Anal.

Biochem. 132,50-53 Nordstrom, B., and Briindin, C.-I. (1975) in Structure and Confor-

mation of Nucleic Acids and Protein-Nucleic Acid Interactions (Sun- daralingam, M., and Rao, S. T., eds) pp. 387-395, University Park Press, Baltimore

Peacock, W. J. (1985) Nucleic Acids Res. 13 , 727-743

270

311,541-547

4858-4866

5982-5996

Plapp, B. V. (1987) J. Biol. Chem. 262,3754-3761

(1974) Eur. J. Biochem. 5 0 , 113-118

(1984) Biochemistry 23,5479-5488

(1973) Biochemistry 12,3146-3153

163, 163-168

2566

253,8414-8419

167 , 195-201

J. Biochem. 6 6 , 277-284

mun. 70,878-884

575

114,555-563

Methods Enzymol. 66 , l l -23

Sci. U. S. A. 80, 2584-2588

Northrop, D. B. (1982) Methods Enzymol. 8 7 , 607-625 Pettersson, G. (1987) CRC Crit. Rev. Biochem. 21 . 349-389


Pettersson, G., and Eklund, H. (1987) Eur. J. Biochem. 166, 157- zauer, M. (1983) EMBO J. 2, 685-689 161 Silverstein, E., and Boyer, P. D. (1964) J. Biol. Chem. 239, 3908-

Plapp, B. V. (1970) J. Biol. Chem. 246,1727-1735 Plapp, B. V. (1973) Arch. Biochem. Biophys. 166, 112-114 Plapp, B. V., Ganzhorn, A. J., Gould, R. M., Green, D. W., and

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad.

Sartorius, C., Gerber, M., Zeppezauer, M., and Dunn, M. F. (1987)

Scharschmidt, M., Fisher, M. A., and Cleland, W. W. (1984) Biochem-

Schneider, G., Eklund, H., Cedergren-Zeppezauer, E., and Zeppe-

Hershey, A. D. (1987) Prog. Clin. Biol. Res. 232, 227-236

Sci. U. S. A. 74,5463-5467

Biochemistry 26,871-882

istry 23,5471-5478

3914

Vol. 7, pp. 25-83, Academic Press, Orlando, FL Sund, H., and Theorell, H. (1963) in The Enzymes (Boyer, P. D., ed)

Sytkowski, A. J. (1977) Arch. Biochem. Biophys. 184,505-517 Theorell, H., and Yonetani, T. (1963) Biockm. 2. 338,537-553 Vallee, B. L., and Hoch, F. L. (1955) Proc. Natl. Acad. Sci. U. S. A.

von Bahr-Lindstrom, H., Hoog, J.-O., Heden, L.-O., Kaiser, R., Fleetwood, L., Larsson, K., Lake, M., Holmquist, B., Holmgren, A., Hempel, J., Vallee, B. L., and Jornvall, H. (1986) Biochemistry 26,

41,327-338

2465-2470 Zoller, M. J., and Smith, M. (1984) DNA (N. Y . ) 3,479-488

the of biological chemistrv vol. 263, no 11, issue of ... · the journal of biological chemistrv ai...

Documents