the of chemistry vol. 266, no. issue pp. 18895-18906, …material in 30 min at 30 "c)/mg,...

T H E J O U R N A L OF BIOLOGICAL CHEMISTRY (0 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 266, No. 28, Issue of October 5, pp. 18895-18906, 1991 Printed in U. S. A .

Mechanism of DNA A Protein-dependent pBR322 DNA Replication DNA A PROTEIN-MEDIATED TRANS-STRAND LOADING OF THE DNA B PROTEIN AT THE ORIGIN OF pBR322 DNA*

(Received for publication, January 18, 1991)

Camilo A. ParadaS and Kenneth J. Marians From the Program in Molecular Biology, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center, New York, New York 10021 and the Graduate Program in Molecular Biology, Cornell University Graduate School of Medical Sciences, New York, New York 10021

pBR322 DNA can be replicated via a DNA A-dependent pathway mediated by its binding to the two DNA A-binding sites (dnaA boxes) present near the plasmid origin. DNA synthesis requires the transcription of RNA I1 (the leading-strand primer precursor) to generate a specific unwound structure in the region containing the dnaA boxes. In this structure, the DNA containing the dnaA boxes can take the form of either a RNA 11-parental H strand pBR322 DNA hybrid opposed by the displaced parental L strand (in the absence of RNase H and DNA polymerase I), or a nascent leading strand-parental H strand DNA duplex opposed by the displaced parental L strand (in the presence of RNase H and DNA polymerase I). These findings defined three types of potential sites for productive DNA A binding: (i) the displaced parental L single strand, (ii) a hairpin formed by the inverted repeat of the two dnaA boxes, and (iii) either the RNA-DNA duplex or the nascent leading strand-parental DNA duplex. By using a combination of: (i) inhibition of the replication of a plasmid carrying oriC by oligonucleotides of various dnaA box sequences and conformation, (ii) a gel mobility shift assay to measure DNA A binding to the same oligonucleotide substrates, (iii) replication of pBR322 DNA templates with either one or no dnaA box, and (iv) photocross-linking to demonstrate DNA A binding to an RNA-DNA hybrid, evidence is presented here that DNA A-mediated pBR322 DNA replication proceeds by a mechanism in which DNA A binds to the duplex side of the unwound origin structures and loads the DNA B protein in trans to the displaced parental L strand DNA.

The DNA A protein is essential for the initiation of Esch- erichia coli DNA replication (1-3). This protein binds to a 9- base pair consensus sequence (5’-TTAT(C/A)CA(C/A)A-3’ (4)) that is present four times within the minimal origin region, oriC (4-7). The cooperative binding of the DNA A protein to its cognate binding sites results in the formation of a complex nucleoprotein structure (4). Initiation of replication occurs after the specific and localized unwinding of three A + T-rich 13-mers within oriC when DNA A directs the loading

* This work was supported by National Institutes of Health Grant GM34558. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Present address: Laboratory of Biochemistry and Molecular Bi- ology, The Rockefeller University, 1230 York Ave., New York, NY 10021.

of the DNA B helicase from a DNA B-DNA C complex to this single-stranded bubble (8-11). Subsequent bidirectional replication occurs via the combined action of the DNA B helicase, the DNA polymerase I11 holoenzyme (pol I11 HE’), and the DNA G primase (8).

There are also DNA A-binding sites present at the origin regions of several plasmid and phage DNAs. In the case of pBR322 plasmid DNA, two DNA A-binding sites are located, in the form of an inverted repeat, between the origin of DNA replication and the (6x174-type) primosome assembly site (PAS) (see Fig. 5). One of these, termed the dnaA box, fits the consensus sequence precisely while the other, termed the dna-“A” box, deviates from the consensus sequence by two nucleotides (see Fig. 5).

Function of the 6X174-type primosome (requiring the action of the DNA B, DNA C, DNA T, DNA G, PRI A (factor Y or protein n’), PRI B (protein n), and PRI C (protein n”) proteins (12-15)) in pBR322 DNA replication has been established by studies both in uiuo (16) and in uitro (17-19). Here the RNA polymerase (RNAP)-synthesized RNA I1 forms a stable hybrid with the leading-strand template DNA that leads to specific DNA unwinding in the origin region. When present, RNase H specifically processes this hybrid at one of three consecutive AMP residues (defined as the origin of DNA replication) within a cluster of 5 AMP residues leading to the formation of the leading-strand primer. DNA polymerase I (pol I) extends this primer for 200-400 nucleotides (nt), generating the nascent 6sL fragment (20) and leading to the activation of the PAS on the lagging-strand template by its conversion from a double-stranded to a single-stranded form (17). Subsequent assembly of the 6X174-type primosome leads, in the presence of the DNA pol I11 HE, to the formation of a replication fork that then completes the uni- directional replication of the plasmid DNA (17). In the absence of RNase H, the extension of the RNA 11-pBR322 DNA hybrid downstream of the origin activates the PAS and allows assembly of the 6X174-type primosome (19).

Several observations suggest that pBR322 DNA replication can also be mediated by the action of the DNA A protein, Thermoinactivation of a dnuA temperature-sensitive allele led to a decreased rate of DNA synthesis of a pBR322 plasmid harbored in this mutant strain, resulting in a switch from the normal 8-type replication mechanism to an RNAP-independ-

The abbreviations used are: pol 111 HE, polymerase 111 holoenzyme; RNAP, E. coli RNA polymerase; nt, nucleotide(s); pol I, E. coli DNA polymerase I; SSB, E. coli single-stranded DNA-binding protein; PAS, primosome assembly site; GMS, gel mobility shift; ds, double-stranded; ss, single-stranded exoIII, E. coli DNA exonuclease 111; HEPES, 4-(2-bydroxyethyl)-l-piperazineethanesulfonic acid; SDS, sodium dodecyl sulfate; BrdUrd, 5-bromodeoxyuridine.

18895

18896 DNA A-initiation of pBR322 DNA Replication

ent rolling circle-type mechanism (21, 22). It has also been shown, either by using extracts prepared from strains over- producing the DNA A protein or by using partially purified preparations of DNA A protein to supplement crude extracts (23, 24), that the DNA A protein could stimulate pBR322 DNA replication in uitro. This has led to the suggestion that assembly of the oriC-type primosome (requiring the action of the DNA A, DNA B, DNA C, and DNA G proteins for assembly mediated by DNA A binding to its cognate binding sites (25, 26)) could substitute (or perhaps supplement) for the function of the @X174-type primosome during pBR322 DNA replication (24). However, the mechanism by which the DNA A protein could engineer the assembly of the oriC-type primosome during pBR322 DNA replication has remained obscure.

In this study we have examined the enzymatic requirements and molecular events that lead to DNA A-mediated replication of pBR322 DNA. We find that either pol I-catalyzed synthesis of the 6sL fragment (in the presence of RNase H) or extension, in the absence of RNase H, of the RNA II- pBR322 DNA hybrid downstream of the dnaA boxes is required for subsequent DNA A-mediated DNA replication. This localized unwinding of the region of DNA containing the dnaA boxes generates three types of possible binding sites for DNA A in these D- or R-looped regions: (i) the dnaA boxes on the displaced parental L strand, (ii) a hairpin formed between the inverted repeat of the two dnaA boxes on the displaced parental L strand, or (iii) the duplex dnaA box sequences that are either in the form of a nascent DNA- parental DNA duplex (in the presence of RNase H or pol I) or in the form of a RNA-DNA hybrid (in the absence of RNase H and pol I). Evidence is presented that the primary DNA A-binding site is actually that represented by the third type, leading to the conclusion that the DNA B replication fork helicase is, via its interaction with the bound DNA A protein, loaded in trans to the displaced plasmid L strand that then serves as the lagging-strand DNA template.

MATERIALS AND METHODS

DNA-Supercoiled pBR322 DNA, harbored in the E. coli strain CR34, and supercoiled pCM959 plasmid DNA, a minichromosome (4012 base pairs) containing the origin region of E. coli chromosomal DNA (-697 to +3335) harbored in E. coli CM987, were prepared according to Marians et al. (27).

Enzymes-The following replication proteins were purified from E. coli as described by Minden and Marians (17) (their specific activities in units (1 nmol of dTMP incorporated into acid-insoluble material in 30 min at 30 "C)/mg, unless indicated otherwise are given in parentheses): RNA polymerase (2.6 X lo')), RNase H ((2.4 X lo5) 1 unit caused the release of 1 nmol of ["HIAMP as acid-soluble radioactivity from a ["H]poly(A)-poly(dT) substrate in 30 min at 37 "C), DNA polymerase I ((2.8 X 10') 1 unit catalyzed the incorporation of 10 nmol of [,'H]TTP into acid-insoluble product in 30 min at 37 "C), DNA ligase ((1.3 X 10') 1 unit joined 1 nmol of 5'-[3'P] dT,, annealed to poly(dA) in 20 min a t 37 "C), DNA pol III* (1.1 X lo:'), GYR A subunit ((1.5 X 10') 1 unit converted 0.2 pg of form I' DNA to form I in 20 min at 30 "C), GYR B subunit (4.5 x lo5), DNA N (the p subunit of the DNA pol 111 HE (1.2 X lo')), DNA C (3.4 X IO"), DNA B (2.9 X lo ') , DNA G (1.9 X lo4), and the single-stranded DNA-binding protein (SSB). The DNA A protein (814 units/mg) was purified from E. coli N4830(pBF1509) as described by Sekimizu et al. (28), except that a gel filtration (Sephacryl S-200) column was used instead of the Superose HPLC column. During purification, DNA A activity was assayed using the reconstituted pCM959 DNA replication

acid-insoluble product of 1 nmol of ['H]dTTP/30 min a t 30 "C. HU system. One unit of DNA A protein catalyzed the incorporation into

protein, from E. coli strain DM700, was purified as described by Dixon and Kornberg (29) with some modifications. Cells were lysed by the Brij-lysozyme method (30) followed by high-speed centrifugation (100,000 X g). The supernatant was discarded and the pellet was resuspended in 50 mM Tris-HC1 (pH 7.5 a t 4 "C), 5 mM dithiothreitol,

10% glycerol, 2% deoxycholate, and 2 M NaC1. This suspension was blended to an even consistency and the insoluble material pelleted by centrifugation. The cleared supernatant was mixed with an equal volume of 30% polyethylene glycol 6000 and 2 M NaC1. After 1 h a t 4 "C, the insoluble material was removed by centrifugation and the supernatant was dialyzed against 50 mM Tris-HC1 (pH 7.5 a t 4 "C), 1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol for 15 h. Chro- matography on double-stranded DNA cellulose, phosphocellulose, and hydroxylapatite was then as described (29). Exonuclease 111 and RNasin were from Promega, creatine kinase (type I) was purchased from Sigma.

pBR322 DNA Replication in Vitro-Standard reaction mixtures (12.5 pl) contained 40 mM HEPES/KOH (pH 8.0), 40 p~ each of GTP, UTP, and CTP, 2 mM ATP, 40 p~ each of dATP, dGTP, dCTP, and [a-"P]dATP (3,000-10,000 cpm/pmol), 7 mM MgOAc, 40 mM KCl, 10 mM dithiothreitol, 40 pg/ml of tRNA, 2 units of RNasin, 26 p M NAD, 1 unit/ml of DNA ligase, 4 mM phosphocreatine, 500 ng of creatine kinase, 100 pg/ml of bovine serum albumin, 100 ng (300 pmol of nucleotide) of supercoiled pBR322 DNA, 63 units of RNA polymerase, 0.25 unit of DNA C, 0.13 unit of DNA B, 0.78 unit of DNA G, 135 ng of DNA A, 3.2 units of DNA N, 0.65 unit of pol HI*, 270 units of GYR A, 60 units of GYR B, and 480 ng of SSB. RNase H (0.2 unit) and DNA polymerase I (0.15 unit) were present as indicated. The reaction mixtures were assembled a t room temperature (24 "C) and incubated for 30 min a t 37 "C. Reactions were terminated by the addition of EDTA to 20 mM and the replication products were then treated with 50 ng of RNase A for 10 min a t 37 "C. Sodium dodecyl sulfate and proteinase K were then added to 0.5% and 100 pg/ml, respectively, and the reaction mixture incubated for 10 min a t 37 "C. An aliquot of the reaction was used to measure acid-insoluble radioactivity and the remainder of the reaction mixture was mixed with 0.2 volumes of a loading dye solution (60 mM EDTA, 2.4% Sarkosyl, 60% glycerol, 1.2 mg/ml bromphenol blue, and 1.2 mg/ml of xylene cyanol) and the products were analyzed by electrophoresis through agarose gels.

oriC DNA Replication in Vitro-Standard reaction mixtures (12.5 pl) contained 40 mM HEPES/KOH (pH 8.0), 400 pM each of GTP, UTP, and CTP, 2 mM ATP, 80 p~ each of dATP, dGTP, dCTP, and [3H]dTTP (100-200 cpm/pmol), 10 mM MgOAc, 10 mM dithiothreitol, 4 mM phosphocreatine, 500 ng of creatine kinase, 100 pg/ml of bovine serum albumin, 8 pg/ml of rifampicin, 100 ng (300 pmol of nucleotide) of pCM959 DNA (31), 20 ng of HU protein, 0.25 unit of DNA C, 0.13 unit of DNA B, 0.78 unit of DNA G , 135 ng of DNA A, 3.2 units of DNA N, 0.65 unit of pol HI*, 270 units of GYR A, 60 units of GYR B, and 480 ng of SSB. The reaction mixtures were assembled at room temperature (24 "C) and incubated for 30 min a t 30 "C. The reactions were stopped by the addition of 0.1 ml of 0.2 M sodium pyrophosphate, 0.1 ml of 1 mg/ml heat-denatured calf thymus DNA (as carrier), and 3 ml of 5% trichloroacetic acid. The reaction mixtures were then placed on ice for 10 min and the acid-insoluble material was collected by filtration on glass fiber filters. The radioactivity retained was then determined by liquid scintillation spec- trometry.

Gel Electrophoresis-The replication products were fractionated by electrophoresis through vertical (0.3 X 10 X 12 cm) 1% agarose gels (Seakem, Rockland, ME) in Tris acetate buffer (50 mM Tris-HC1, pH 7.9,40 mM NaOAc, and 1 mM EDTA) at 2.5 V/cm for 12 h. Gels were dried under vacuum and autoradiographed.

Transcription of RNA II-Specific transcription of the RNA primer was as described previously by Parada and Marians (19). RNAP was first incubated with the DNA in the presence of UpU, GTP, CTP, and ATP. This directed initiation to the RNA I1 promoter and resulted in the generation of a 23-mer (step 1). Rifampicin was then added to prevent any new initiations (step 2). Finally, UTP was added, resulting in the generation of the full-length transcript (step 3). In this report, the incubation time for step 3 was changed to 5-7 min a t 37 "C. Transcription was then terminated by the addition of streptolydigin to 200 bg/ml, followed by incubation for 1-2 min on ice and then for another 7 min at 37 "C.

Staged Transcription of RNA I I for pBR322 DNA Replication- Specific RNA I1 transcription was as indicated above in the absence of DNA gyrase. Following termination of transcription by the addition of streptolydigin (step 3), the reaction mixtures were adjusted to pBR322 DNA replication conditions. The replication proteins were then added as indicated above (making a final volume of 18 pl) and the reaction mixtures incubated for 30 min at 37 "C. The reaction products were then analyzed as described above.

Determination of the Length of the RNA II-pBR322 DNA Hybrid-

DNA A-initiation of pBR322 DNA Replication 18897

Specific transcription of RNA I1 was as indicated above with the inclusion of 2 p~ [cY-:~'P]GTP (at 500,000 cpm/pmol) during step 1. G T P was added subsequently to 3 mM during the elongation step, thereby diluting the specific activity of the [a-"P]GTP 1500-fold. Under these conditions, RNA I1 was preferentially labeled in the first 23 nucleotides. Following transcription of RNA 11, DNA gyrase (250 units of GYR A and 60 units of GYR B) was added and the reaction mixture was incubated for 20 min a t 37 "C in order to stabilize the hybrid. The reaction products were freed of protein (as described above). KC1 was added to 200 mM and the reaction mixture incubated on ice for 10 min. The K+/SDS precipitate was removed by centrifugation in a microfuge and the reaction products were isolated by spin dialysis, as described by Kreuzer and Alberts (32), through columns of Sepharose 4B equilibrated under transcription reaction conditions. The reaction products were then treated with exonuclease 111 (in a 10-pl reaction mixture) for 20 min a t 37 "C followed by electrophoresis through a 4% (201, acry1amide:bisacrylamide) polyacrylamide gel containing 50% urea using Tris borate (100 mM Tris borate and 2 mM EDTA) as the running buffer. The gel was then dried under vacuum and autoradiographed.

Nascent Leading-strand DNA Synthesis (6sL Fragment)-Specific RNA I1 transcription was as indicated above with the addition of RNase H (0.2 unit) and DNA gyrase during the elongation step. After the addition of streptolydigin (step 3) to terminate transcription, all the dNTPs, including [w3'P]dATP (130,000 cpm/pmol), were added to 5 p ~ . Following the addition of DNA polymerase I (0.15 unit), the reaction mixtures (final volume of 10 pl) were incubated for 3 min a t 37 "C and then for another 4 min at 37 "C after the concentration of the dNTPs was raised to 200 p ~ . The reaction was stopped by the addition of EDTA to 20 mM and the reaction products analyzed by

shown). The ds oligonucleotides were then diluted to 70 nM and used as substrates in the GMS assays. Double-stranded oligonucleotides that were used to compete DNA A protein binding to the ds dnaA box (Fig. 6B) were annealed as above a t a concentration of 20 pM. The ss oligonucleotide, ss dna-"A"-A (hairpin) (Fig. 6B), was self- annealed as above at 2.5 p~ and then diluted to 70 nM for use as a substrate in the GMS assays. The extent of hairpin formation of this oligonucleotide was determined by native polyacrylamide gel electrophoresis and treatment with exonuclease I (data not shown). The RNA oligomer complementary to the ss dnaA-H oligomer (Fig. 6B) was prepared by T7 RNA polymerase-catalyzed oligonucleotide synthesis. Two synthetic complementary oligonucleotides (38-mers) containing a T7 promoter (%mer) 5' of the ds dnaA box (20-mer) were

by T7 RNA polymerase in the presence of [(U-'~P]GTP (30-40 cpm/ annealed as indicated above and used as a template for transcription

pmol) as indicated by Milligan et al. (33). The reaction products were then electrophoresed through a denaturing polyacrylamide gel, located by autoradiography, electroeluted from the gel slices, and pre- cipitated with 95% ethanol. Following centrifugation, the pellet was washed twice with 70% ethanol, and resuspended in hybridization buffer (as indicated above) to which RNasin (150 units/ml) had been added. The ss RNA and the complementary ss dnaA-H oligonucleotide were annealed as indicated above and used either as substrate or competitor in the GMS assay.

Construction of pBR322 DNA Carrying Mutated dnaA Boxes- Specific site-direct mutagenesis was as described in the "Muta-Gene in Vitro Mutagenesis Kit Instruction Manual" from Bio-Rad. The template was recombinant f l phage DNA carrying the entire L strand of pBR322 inserted into the EcoRI site of flR229 (34). The following changes were made:

dpa - "A" box dnaA box Wild-type pBR322 DNA 5'CCT GCG TTA TCC CC? GAT ?CT GTG GAT A.A!C CGT ATT-3' L

3'GGA CGC AAT AGG GGA CTA AGA CAC CTA TTG GCA TAA-5' H

NdeI , dnaA box pBR(-"A") 5'-CCT GCC ATC ATA TGC CAT TCT GTG GAT d C CGT AAT- 3' L

3'-GGA CGG TAG TAT ACG GTA AGA CAC CTA TTG GCA TAA-5' H

AccI Xba I pBR(-"A",-A) 5'-CCT GCG AAG TAT ACT GAT TCT TG$ CTA GAC CGT ATT- 3' L

- 3"GGA CGC TTC ATA TGA CTA AGA ACA GAT CTG GCA TAA-5' H

electrophoresis through polyacrylamide gels. Gel Mobility Shift Assay for DNA A Binding to Oligonucleotides-

Standard reaction mixtures (5 p l ) contained 20 mM HEPES/KOH (pH 8.0), 5 mM MgOAc, 1 mM EDTA, 4 mM dithiothreitol, 0.2% Triton X-100, 5 mg/ml of bovine serum albumin, 100 p M ATP, and single- or double-stranded oligonucleotide (35 fmol) as indicated. After the addition of DNA A, the reaction mixtures were incubated for 5-7 min on ice and then for another 5-7 min at room temperature (about 24 "C). The samples were then loaded directly onto vertical (0.12 X 10 X 12 cm) 10% (60:1, acry1amide:bisacrylamide) polyacrylamide gels that had been pre-run for 30-45 min a t room temperature. Electrophoresis was at 7 V/cm for 3 h using 50 mM Tris borate and 1 mM EDTA as the running buffer. The gel was then soaked in a fixing solution (10% acetic acid and 5% glycerol) for 10 min a t room temperature and then dried under vacuum onto DE81 paper (What- man) before autoradiography. The bands corresponding to bound and free substrate were excised from the gel, and the Cerenkov radioactivity present was determined.

Oligonucleotide Substrates for the Gel Mobility Shift Assay-Several synthetic oligonucleotides, as indicated in Fig. 6B, were used in the gel mobility shift (GMS) assays. Single-stranded (ss) oligonucleotides at a final concentration of 10 p~ were phosphorylated at the 5' end using [r-:"P]ATP and T4 polynucleotidyl kinase, diluted with hybridization buffer (50 mM HEPES/KOH (pH 8.0), 8 mM MgC12, and 6 mM dithiothreitol) to a final concentration of 70 nM and used as substrates in the GMS assay. When double-stranded (ds) oligonucleotides were used as substrates, '"P-labeled ss oligonucleotides were annealed a t a concentration of 2.5 p M each in a hybridization mixture (50 p1 in hybridization buffer) by heating for 2 min a t 39 "C and then incubating for an additional 3 h a t 30 " C . Under these conditions, greater than 90% of the oligonucleotides were annealed, as determined by electrophoresis through native polyacrylamide gels (data not

Mutant pBR322 DNAs were recovered from the replicative form of the fl-pBR322 chimeras by transformation into DH5a of a religated EcoRI digest followed by selection for ampicillin resistance. Super- coiled plasmid DNAs were prepared as described above and used as templates in the replication assays as indicated.

Photocross-linking-Specific RNA I1 transcription was as indicated above with some modifications: during transcription of RNA I1 (step 3), UTP was substituted by BrdUTP and the [a-""PIGTP (20,000 cpm/pmol) was added 1-2 min after the addition of all four rNTPs in order to favor labeling of RNA I1 in the region downstream of the origin. 6sL nascent leading-strand DNA formation was as indicated above with the substitution of BrdUTP for TTP. Both the R-looped ["'PIRNA 11-pBR322 DNA and D-looped ["P]6sL fragment-pBR322 DNA were freed of protein and the templates isolated by spin dialysis through Sepharose 4B columns equilibrated under pBR322 DNA replication reaction conditions. Reaction mixtures, containing 0.2% Triton X-100 and either of the radioactive templates, were incubated in the presence of DNA A (in a final volume of 10 pl) for 5 min on ice and then for another 5-7 min a t room temperature (about 24 "C). The reaction mixture were then transferred to ice and irradiated with UV light for 20 min as indicated by Marcinak et al. (35). The reaction mixtures were then treated with a mixture of nucleases (15 units/ml of RNase TI, 140 units/ml of RNase H, 7 pg/ml of RNase A, and 1.3 X lo7 units/ml of exonuclease 111) for 10 min at 37 "C, heated for 3 min a t 100 "C, placed on ice for 5 min, and then incubated with PI nuclease (10 units/ml). The reaction products were then analyzed by electrophoresis through a 12.5% (30:1, acry1amide:bisacrylamide) polyacrylamide SDS gel, dried under vacuum, and autoradiographed.

RESULTS

DNA A Protein-mediated pBR322 DNA Replication Re- quires Transcription by RNA Polymerase-Replication in ui-


tro of a plasmid carrying oriC depends on the ability of DNA A to unwind an A + T-rich region to the left of the four dnaA boxes (8, 36). Assembly of a replication fork under these circumstances follows after DNA A guides the replication fork helicase, DNA B, to this denatured region. There are no similar A + T-rich sequences present near the two dnaA boxes in the origin region of pBR322 DNA, suggesting that during DNA A-dependent replication, the localized unwinding nec- essary for replication fork assembly might be mediated in some other fashion. Since, under the usual replication conditions, both pBR322 DNA replication and origin unwinding is dependent on the action of RNAP (17, 37, 38), the role of transcription in DNA A-dependent pBR322 DNA replication was investigated.

DNA A-mediated pBR322 DNA replication was reconstituted using a combination of the DNA B, DNA C , and DNA G proteins, the DNA pol I11 HE, SSB, and DNA gyrase. Under these conditions, stimulation of the replication reaction by DNA A was completely dependent on the action of RNAP (Fig. lA), as indicated by the inhibition of DNA synthesis in the presence of rifampicin. DNA A stimulated incorporation by roughly 2-fold. As previously determined by Seufert and Messer (24), strand-selection analysis (17) demonstrated that in the absence of DNA A, only leading-strand DNA was produced, whereas in its presence both leading- and lagging-strand DNA was synthesized (data not shown).

Initiation of pBR322 DNA replication usually requires RNase H-catalyzed processing of the RNAP-generated transcript, RNA 11, followed by the extension of this 3'-OH primer terminus by pol I to give the nascent leading-strand (39, 40). Surprisingly, DNA A stimulated DNA synthesis to an equal extent both in the presence and absence of RNase H and pol I (Fig. 1A). The products of DNA replication under both conditions, however, were identical and were similar to those produced during 4X174-type primosome-dependent pBR322 DNA replication (41). The majority of DNA products were

A. B.

E 35

RNdseH.POII + " 1 2 3 4 5 6

f j:r-,. , 4 + , , , 0 0 IO0 200 300 400

DNA A Protein (ng) DNAAlnal - 235 270 - 135 270

FIG. 1. DNA A-dependent pBR322 DNA replication. Repli- cation reactions were with pRR322 DNA as template (35 fmol) in the presence of [ n-:"P]dATP as described under "Materials and Methods" with increasing amounts of DNA A protein either in the presence or absence of rifampicin as indicated, and in the presence (0) or the absence (0) of RNase H and pol I. A, DNA synthesis was measured by acid precipitation (average of three experiments). R, aliquots from reaction mixtures (from an experiment independent of those used in A ) with representative concentrations of DNA A were electrophoresed at 2 V/cm for 15 h through a 1% agarose gel with Tris acetate as the running buffer. The gel was dried under vacuum and then autoradiographed. The replication products synthesized in the presence (lanes 1-3) or absence (lanes 4-6) of RNase H and pol I are shown. No DNA A protein was present in the reaction mixtures analyzed in lanrs I and 4 , whereas those analyzed in lanes 2 and 5 contained 135 ng of DNA A and those analyzed in lanes 3 and 6 contained 270 ng of DNA A. RC, LRI, FII , and II:II , indicate rolling circle product, late replicative intermediate, form I1 DNA, and interlinked form I1:form I1 DNA dimers, respectively.

present as either form I1 DNA or multiply linked form 1I:form I1 DNA dimers (Fig. 1B). This was expected, since DNA ligase, which is required for sealing the nascent DNA strands (42), had been omitted from the reaction.

Previous studies from this laboratory (19) demonstrated that in the absence of RNase H and pol I and in the presence of DNA gyrase, the RNA 11-pBR322 DNA hybrid could be extended for 3 kb downstream of the origin. Thus, the equiv- alence of DNA A-dependent DNA synthesis in the presence or absence of RNase H and pol I suggested that it was the extension of a nascent strand of nucleic acid, DNA in the former case and RNA in the latter, downstream of the origin and past the dnaA boxes that was required to observe stimulation of pBR322 DNA replication by DNA A.

Transcriptional Activation of pBR322 Supports oriC-type Primosome-dependent DNA Replication-The requirement for RNAP during DNA A-dependent pBR322 DNA synthesis suggested that specific transcription of RNA I1 was involved either directly, by acting as a leading-strand primer, or indi- rectly, by acting to generate a required structure. In order to study the role of RNA I1 in DNA A-dependent pBR322 DNA synthesis, a transcriptionally activated pBR322 DNA was used as a template.

Stable ternary complexes between pBR322, RNAP, and a nascent RNA I1 can be produced by first directing initiation to the RNA I1 promoter with the dinucleotide UpU and then allowing elongation in the absence of UTP and in the presence of rifampicin to proceed for 23 nt to the point where the first UMP residue is required (43). Subsequent elongation of these transcripts in the presence of all four NTPs and DNA gyrase results in the formation of an extensive hybrid between RNA I1 and the DNA that extends 3 kilobases downstream of the origin (19). If RNase H is either included in the elongation reaction or added subsequently, an active primer end can be generated (39, 44). In order to avoid this extensive RNA II- pBR322 DNA hybrid formation, DNA gyrase was not included in the reaction mixtures used here during the preparation of the transcriptionally activated template DNA.

An activated pBR322 DNA (prepared as described above in the absence of RNase H and DNA gyrase) was used as a template for DNA A-dependent DNA replication in reaction mixtures containing the DNA A, DNA B, DNA C , DNA G, and SSB proteins, DNA gyrase, and the DNA pol I11 HE. Under these conditions, the activated DNA was as active a template (Table I) as pBR322 was in complete reaction mixtures (i.e. containing RNAP) (Fig. 1).

When RNase H and pol I were included in the replication reaction mixture, DNA synthesis decreased to one-sixth the initial value when DNA A, DNA B, or DNA C were omitted

TABLE I Transcriptionally activated pRR322 DNA supports oriC-type

primosome-dependent DNA synthesis pBR322 DNA was transcriptionally activated in the absence of

DNA gyrase as described under "Materials and Methods." After the addition of streptolydigin, the template was used for DNA A-dependent DNA replication with the omission of the indicated proteins from the reaction mixture. Acid-insoluble radioactivity was determined.

DNA synthesis

Omitted With RNase H Without RNase H and pol I and pol I pmol dAMP incorporated/30 min

None 36.0 27.0 DNA A 6.7 4.4 DNA C 5.7 2.5 DNA I3 6.7 DNA G

2.2 20.0 9.4


from the incubation (Table I). Thus, DNA synthesis under these conditions was presumably a result of the assembly of an oriC-type primosome. Omission of primase from the reaction mixture resulted in a decrease in DNA synthesis to roughly one-half the initial value. This was expected since, under these circumstances, DNA B was present on the DNA to act as a DNA helicase and leading-strand synthesis (primed by the RNase H-processed RNA 11) could continue un- impeded. The nascent DNA synthesized in this reaction was shown to be exclusively leading-strand product by strand- selection analysis (data not shown).

I t was surprising to find that the transcriptionally activated template also supported significant DNA A-dependent DNA synthesis in the absence of RNase H and pol I (Table I). DNA replication under these conditions was also a result of assembly of the oriC-type primosome, as shown by the 6- and 10- fold decreases in DNA synthesis when DNA A and either DNA B or DNA C, respectively, were omitted from the reaction mixture.

To ensure that DNA replication using the transcriptionally activated template was comparable to that observed when pBR322 was used in the concerted reaction (i.e. that described in Fig. 1 and Table I), the “’P-labeled products of the DNA replication reaction were visualized by native agarose gel electrophoresis (Fig. 2). In the absence of RNase H and pol I, the products were primarily form I1 DNA and late replicative intermediate (LRI) (Fig. 2, lanes 2-4). Even though DNA ligase was present in this reaction, replication could not be completed, since the 5’ + 3‘ exonuclease of pol I is required to remove the ribonucleotide that forms the junction between RNA primers and nascent DNA. This could be seen clearly when these products were compared with those formed in the presence of RNase H and pol I (Fig. 2, lanes 10-12), where the major products were form I and form I1 DNA and supercoiled form 1:form I DNA dimers. In the presence of RNase H and in the absence of pol I, DNA synthesis was reduced considerably (Fig. 2, lanes 6-8). At the concentration of RNase H used, some of the RNA 11-pBR322 DNA hybrid is resistant to digestion (39, 40) and can be extended by the DNA pol I11 HE, leading to subsequent DNA A-dependent lagging-strand synthesis. This low level of DNA synthesis could be eliminated completely by increasing the RNase H

LRI -

- R N a s e H + RNase H + R N a s e H ~ POI I . POI I + POI I

-n- 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

- LRI

11:11 -I - P I

DNA A (ng) - 68 135 270 - 68 135 270 - 68 135 270

FIG. 2. Transcriptionally activated pBR322 DNA supports DNA A-dependent DNA replication. pHR322 DNA was activated by specific transcription of RNA I1 in the presence of DNA gyrase as described under “Materials and Methods.” The transcriptionally activated template was used to support DNA A-dependent replication in the absence (lanes 1-4) or presence (lanes 5-8) of RNase H and in the presence of both RNase H and pol I (lanes 9-12). The reaction products were Cree of RNA and protein and analyzed by agarose gel electrophoresis and for incorporation of [a-:’”P]dATP into acid-insol- uhle product as described under “Materials and Methods.”

concentration 5-fold (data not shown). This also indicated that the DNA A-dependent pBR322 DNA replication observed in the absence of RNase H and pol I required extension of the RNA 11-DNA hybrid downstream of the origin past the dnaA boxes.

In the absence of RNase H and pol I (and DNA gyrase) the hybrid formed between RNA I1 and the leading-strand template DNA is known to extend downstream of the origin a t least past the PAS on the lagging-strand template, since subsequent addition of the 4x174 primosomal proteins and SSB to the transcriptionally activated DNA results, in the presence of ATP, in extensive unwinding of the pBR322 DNA (19). Thus, under the conditions described above, it was not clear how the oriC-type primosome, which during replication of oriC-containing DNAs requires that the dnaA boxes be double-stranded, gained access to the pBR322 DNA template. In order to determine how this might occur, we investigated the structure of the region near the dnaA boxes on the transcriptionally activated template both in the presence and absence of RNase H and pol I.

Duplex Unwinding of the Parental DNA A-binding Sites Is Required for pBR322 DNA Replication by the oriC-type Pri- mosome-In order to ascertain the nature of the RNA II- DNA hybrid in the region of the dnaA boxes, its length was determined. RNA 11, prepared as described in the previous section, varied in length from 800 to 1300 nt in length as determined by denaturing polyacrylamide gel electrophoresis (Fig. 3). Since the first 555 n t of the RNA I1 transcript do not participate in hybrid formation (39,44), this suggests that the actual RNA 11-pBR322 DNA hybrid formed under these conditions was between 250 and 750 n t in length. This is more than sufficient to insure that the parental dnaA boxes were unwound and that the parental H strand of this region was in the form of an RNA-DNA hybrid.

Exonuclease I11 (which can digest double-stranded DNA or a RNA-DNA hybrid in the 3‘ -+ 5’ direction) (exo 111) was used to determine whether the RNA-DNA hybrid was in the form of a continuous duplex or existed as a mixture of regions where the parental H strand DNA was single-stranded because the RNA had paired with itself. The RNase H activity

1 2 3 4 5 6 7 8 M

primer RNA -w

I - 1353 - 1078 , - 817

t - 603

. F II

- 310

RNAse H - + Exo 111 (units) - 25 50 100 200 -

FIG. 3. The RNA 11-pBR322 DNA hybrid is completely duplex in nature. pRR322 DNA was transcriptionally activated in the absence of DNA gyrase and in the presence of [e-’”PICTP. After termination of transcription by the addition of streptolydigin, the RNA-DNA hybrid was stabilized by incubation in the presence of DNA gyrase followed by deproteinization and isolation by spin dialysis as described under “Materials and Methods.” This material was then treated as follows, prior to analysis by electrophoresis through a denaturing 4% acrylamide gel: lanes 1, 3, and 8, no additional treatment; lane 2, treatment with 0.2 unit of RNase H; lanes 4-7, treatment with the indicated amounts of exo 111. The gel was dried under vacuum and autoradiographed.


of exo I11 (45,46) will only digest an RNA-DNA hybrid of the former type. Treatment of the transcriptionally activated template with exo I11 resulted in the digestion of a significant portion of the RNA I1 greater than 555 nt in length (Fig. 3, lanes 4-8). The limit digestion product comigrated with the product of RNase H digestion (Fig. 3, lane 2). Thus, the extensive RNA 11-DNA hybrid formed to transcriptionally activate pBR322 was completely duplex in nature. Therefore, when using the transcriptionally activated DNA as a template in the absence of RNase H and pol I, the region of the dmA boxes was R-looped, with the parental H strand making an RNA-DNA hybrid and the parental L strand displaced and in a single-stranded conformation (and coated with SSB).

This situation is presumably similar to that occurring in the presence of RNase H and pol I, where the nascent leading- strand DNA should extend past the dnaA boxes. In order to confirm this, the length of the nascent leading-strand DNA synthesized by pol I from the transcriptionally activated template was determined (Fig. 4). Pol I-catalyzed nascent leading- strand DNA synthesis was more efficient when the RNA II- pBR322 DNA hybrid was either processed by RNase H in the presence of DNA gyrase (compare lanes 3 and 4 in Fig. 4) or when RNase H was omitted from the reaction (compare lanes 1 and 2 in Fig. 4). This most likely reflects an increased stability of the RNA primer on the DNA.

In order to estimate the length of the nascent DNA, the products of reaction were heat-denatured and treated with a mixture of ribonucleases to degrade the RNA 11. A population of nascent DNA ranging between 210 and 280 n t was observed when the RNase-treated material was electrophoresed through a denaturing polyacrylamide gel (Fig. 4, lane 5 ) . This is long enough to extend downstream past the dnaA boxes. Thus, similar to the case observed in the absence of RNase H and pol I, in their presence, the active template for DNA A- dependent pBR322 DNA synthesis was one in which the region of the parental dmA boxes was D-looped, with the parental H strand making a duplex with the nascent leading- strand and the parental L strand displaced and single- stranded.

1 2 3 4 5 M

- 404

- 327

DNAgyr - + - + + RNase H - - + + +

POI1 + + + + + RNase A - +

FIG. 4. Length of the DNA polymerase I-synthesized nascent leading-strand DNA. pBK.322 DNA was transcriptionally activated in the absence of DNA gyrase as described under "Materials and Methods." Pol I-catalyzed leading-strand DNA synthesis was then performed in the presence or absence of DNA gyrase and RNase H as indicated. The products were denatured and analyzed by electrophoresis through a denaturing 8% polyacrylamide gel. The replication products shown in lane 5 were treated with RNase A, as described under "Materials and Methods," before loading. The arrows on the right indicate the major pol I-synthesized products and their sizes.

These observations eliminated the possibility that the DNA A protein was binding to the parental duplex form of the d m A boxes to catalyze the subsequent assembly of the oriC- type primosome. What, then, is the productive binding site for DNA A under these conditions?

Possible DNA A-binding Sites in R- and D-looped pBR322 DNA-Duplex unwinding of the dnaA boxes leads to the generation of several possible DNA A-binding sites (Fig. 5). In the presence of RNase H and pol I, the region of the dnaA boxes takes the form of a nascent leading strand-parental H strand DNA duplex opposed by a displaced parental L strand (Fig. 5, i); whereas, in their absence, there exists a RNA II- parental H strand DNA hybrid opposed by the displaced parental L strand (Fig. 5, iu). DNA A (dotted circle in Fig. 5) could bind to these regions in several different ways. The productive binding site could be the displaced parental L strand when it is either a single strand (Fig. 5, i and iu) or a hairpin structure formed by the annealing of the inverted repeat of the dnaA box and dm-"A" box sequences (Fig. 5, ii and u). On the other hand, DNA A may not bind productively to the parental L strand, but could bind to the duplex structures formed by either the RNA 11-parental H strand DNA hybrid (Fig. 5, vi) or the nascent leading strand-parental H strand duplex (Fig. 5, iii).

In order for the binding of DNA A to any of these possible binding sites to lead to subsequent DNA replication, the 5' + 3' directionality of the DNA B helicase activity and the rightward direction (in Fig. 5) of the replication fork during

5' V 4

.cI

l&J vA L

3' u n

- RNA - naxccnl DNA

- oalenlal DNA

FIG. 5. Potential DNA A-binding sites in activated pBR322 DNA. The model is discussed in detail in the text. Thin lines, parental DNA; moderately thick lines, nascent DNA; thick lines, RNA 11; inuerted triangle, origin of leading-strand DNA synthesis; striped boxes, DNA A-binding sites; dashed circle, DNA A.


DNA A-dependent pBR322 DNA replication demonstrated previously be Seufert and Messer (24) (and confirmed by us (data not shown)), must be taken into account. In structures i, ii, iv, and v in Fig. 5, loading of the DNA B protein in cis directly to the parental L strand would satisfy these requirements. Although, in the case of possibilities i and iv in Fig. 5, this would require DNA A binding to single-stranded DNA, an activity not yet demonstrated. Binding of DNA A to the duplex structures in iii or vi in Fig. 5 could lead to loading of the DNA B protein to the parental H strand, however, it would subsequently move in the opposite direction needed for replication fork propagation. It would seem, given this config- uration, that in order to generate proper replication fork movement, DNA B would have to be loaded in trans to the displaced parental L strand.

DNA A was known to bind dnaA box sequences that were in a duplex DNA conformation (4). On the other hand, DNA A binding to single-stranded DNA sequences has not been reported. Recently, DNA A was shown to bind a hairpin sequence from plasmid R6K comprised of two dnaA boxes in the form of an inverted repeat and catalyze the assembly of the oriC-type primosome in cis to the contiguous single strand (47). In order to distinguish between these possible modes of DNA A binding, we studied the affinity of DNA A for a series of oligonucleotides (Fig. 6B) with sequences comprised of the pBR322 dnaA or dna-"A" box using a variety of assays.

- - 100 s C ._ c

80 ._ - a G)

60 a

40 Z

ss dna AL

ss pBR 2002

ss dna AH

hairpin

ds dna " A box

RNNDNA hybrld

0 2 4 6 8

Oligonucleotide (pmol)

B ds dna A box 5 - GATTCTGTGGATAACCGTAT

3" CTMGACACCTATTGGCATA

- u

5 ' - CCTGCGTTATCCCCTGATTC ds dna " A 3 ' - GGACGCAATAGGGGACTMG

- -

1 0

- 3 ' L - 5 ' H

- 5 ' H - 3 ' L

ssdna"A-A 5 ' - CCTGCGTTATCCCCTGATTCTGTGGATMCCGTATT -3'L - -

(hairpin)

RNNDNA hybrid 5 - GAVVCVGVGGAVAACCGVAV -3 ' L 3" CTAAGACACCTATTGGCATA - 5 ' H -

ss pBR 2002 5 - GGACGCGGATGMCAGGCAG -3 ' L

FIG. 6. Effect of various oligonucleotides comprised of DNA A-binding site sequences on oriC plasmid DNA replication. A, oriC replication reactions were as described under "Materials and Methods" in the presence of [w~*P]~ATP and the indicated amounts of various oligonculeotides. pCM959 DNA and inhibitor oligonucleotide (when added) were both present in the reaction mixture before the addition ol* any replication proteins. Replication activity was measured as acid-insoluble radioactivity. B, nucleotide sequences of the different oligonucleotide competitors.

Inhibition of oriC Plasmid DNA Replication by Oligonucle- otides Comprised of the DNA A-binding Site Sequences from pBR322"The enzymatic requirements for replication of a plasmid carrying oriC (pCM959 (31)) are identical (with the exception of a requirement for protein HU) to those for DNA A-dependent pBR322 DNA replication, although the molecular events required for initiation are quite different. Because of the presence of four dnaA boxes in oriC, the affinity of DNA A for pCM959 should be high. Thus, it should be possible to derive an order for the binding affinity of DNA A for various oligonucleotide substrates by determining how effectively they compete for DNA A during oriC plasmid DNA replication. Effective competition could be scored by the inhibition of DNA synthesis in the presence of the competing oligonucleotides.

A series of oligonucleotides were synthesized for use in these studies (Fig. 6B). These were: (i) 20-mers comprised of the sequence of the pBR322 dnaA box, (ii) 20-mers comprised of the sequence of the pBR322 dna-"A" box, (iii) a 36-mer comprised of pBR322 L strand sequences incorporating both the dnaA and dna-"A" box so that hairpin formation could occur, (iv) an L strand RNA 20-mer complementary to the H strand dnaA box sequence to form an RNA-DNA hybrid, and (v) a nonspecific 20-mer comprised of pBR322 sequences from coordinates 2002-2021.

The inhibitory properties of these oligonucleotides were examined in oriC replication reaction mixtures containing pCM959 DNA, the DNA A, DNA B, DNA C, DNA G, SSB, and HU proteins, DNA gyrase, and the DNA pol I11 HE (Fig. 6A). As expected, the ds dnaA box was the best competitor, inhibiting the reaction by 85% when 2.5 pmol (as molecules) was added to the reaction mixture and nearly completely when 10 pmol was added. Given the presence of five DNA A- binding sites on pCM959 (four in oriC and one in mioC), 78% inhibition should have been observed at 0.63 pmol of oligonucleotide if each binding site acted independently. Instead we observed only 33% inhibition at this concentration of oligonucleotide (data not shown). The likely reason for this is that the four DNA A-binding sites in oriC bind the protein cooperatively.

Both the RNA-DNA hybrid and the ds dna-"A" box competed about half as well as the ds dnaA box, whereas the ss oligonucleotides, dna-A-L, dna-A-H, or the nonspecific pBR322, did not compete at all. Pretreatment of the RNA- DNA hybrid with RNase H eliminated its inhibitory effect (data not shown). The ss dna-"A"-A hairpin sequence competed at a level intermediate between that of the ss oligonucleotides and the ds dna-"A" box. The observed differences in the apparent plateau value of inhibition with the various oligonucleotides presumably reflects the differences in the equilibrium constants for DNA A binding to these species compared to its binding to the pCM959 DNA.

This analysis confirmed that DNA A bound most stably to the cannonical DNA A-binding site represented by the ds dnaA box sequence and was also significant in indicating that DNA A could associate with an RNA-DNA hybrid. However, this assay was not completely specific in competing for DNA A binding. For example, the observed lack of inhibition by the ss oligonucleotides could be a result of SSB binding to the oligonucleotide preventing DNA A binding. In a similar vein, the inefficient competition by the hairpin oligonucleotide might also be a result of SSB acting to melt out a relatively unstable hairpin. Thus, in order to assess more precisely the ability of DNA A to bind these various substrates, a gel mobility shift assay was developed.

A Gel Mobility Shift Assay for DNA A Binding to Oligonu-


cleotides-The technique of scoring protein binding to cognate DNA sequence because of a reduced mobility during gel electrophoresis of the DNA-protein complex compared to that of the DNA (48-53) has been sensitive and easily quantifiable. We therefore developed such an assay to study DNA A binding to oligonucleotides. The critical features of this assay were the inclusion of ATP in the binding reaction to stabilize the DNA-protein complex, as well as 0.2% Triton X-100 and a high concentration of bovine serum albumin to prevent the aggregation of DNA A in solution.

Under these conditions, the addition of increasing amounts of DNA A to binding reaction mixtures containing the 5’-:”P- labeled ds dnaA box sequence resulted in the retardation of the mobility of the oligonucleotide when the reactions were analyzed by electrophoresis through 10% polyacrylamide gels (Fig. 7). The reaction mixtures contained 35 fmol of DNA substrate. DNA A binding activity could be detected a t DNA A to DNA ratios of less than 1:l (Fig. 7A). In the linear part of the binding curve (Fig. 8), only one-half of the oligonucleotide that disappeared from the “free” band appeared in the “bound” band. The remainder could be accounted for by the smear between these two distinct bands on the gel. This probably reflects the equilibrium constant of the binding reaction, in that a significant fraction of the bound oligonucleotide dissociated from the DNA-protein complex during electrophoresis. However, it is likely that one DNA A mon- omer was sufficient to bind one oligonucleotide.

If the observed mobility shift was the result of a simple binding event between DNA A and the oligonucleotide, then competition by the same unlabeled oligonucleotide should result in an apparent inhibition of binding as a direct function of dilution. This proved to the case (Fig. 7B).

Since the assay seemed to be both sensitive and valid, we used it to compare the binding of DNA A to the oligonucleotides described in Fig. 623. As in the experiments described in the previous section, the best substrate for binding was the canonical ds dnaA box. Of the other oligonucleotides, only the ss dna-“A-A hairpin and ds dna-“A” box demonstrated stable binding, although their relative affinities were reversed compared to the data in Fig. 6A. None of the ss oligonucleotides or the RNA-DNA hybrid showed stable binding. This order was preserved when the oligonucleotides were used as competitors in reaction mixtures containing 44 fmol of DNA A and 35 fmol of ““P-labeled ds dnaA box oligonucleotide (Fig. 9).

In each case, the ss dm-“A”-A hairpin oligonucleotide was shown to have higher affinity for DNA A than the ds dna-

FIG. 7 . Gel mobility shift assay for DNA A binding to oligonucleotides. Reaction mixtures were as described under “Materials and Methods” and were incubated for 5-7 min on ice and then for another 5-7 min at room temperature (24 “C) before fractionation by electrophoresis through a 10% ( 6 0 1 acry1amide:hisacrylamide) polyacrylamide gel. The gel was dried, autoradiographed, the bound and free bands were excised, and the Cerenkov radioactivity present determined. A, binding of DNA A to the ds dnaA box oligonucleotide substrate. H, the binding of DNA A (44 fmol) to ‘”P-labeled ds dnaA box oligonucleotide (35 fmol) was competed by the indicated amounts of unlabeled ds dnaA box oligonucleotide.

A. 1 2

bound +

free -

“A” box, suggesting that their apparent inversion of affinity in competition during oriC plasmid DNA replication (Fig. 6A) was, in fact, a result of SSB-induced melting of the hairpin. On the other hand, in contrast to the oriC replication assay (Fig. 6A), the RNA-DNA hybrid showed no activity as a binding substrate in the gel mobility shift assay. One possible explanation for this is that observable binding of DNA A to the RNA-DNA hybrid might require the high concentrations of DNA A present in the replication reaction mixtures, because the active species in replication may be oligomerized DNA A protein.

The data presented thus far (Figs. 6-9) effectively ruled out the first possibility described in Fig. 5, however, the second and third possibilities remained equally likely. In order to focus specifically on the second possibility, i.e. DNA A binding to a hairpin formed by the inverted repeat of the dm-A and dna-“A” box sequences on the displaced plasmid L strand, the DNA A-dependent DNA replication of pBR322 plasmid DNAs mutated to carry either one or no DNA A-binding sites was studied.

DNA A Protein-mediated DNA Replication of pBR322 DNA Derivatives Carrying Mutated DNA A-binding Sites-Oligo- nucleotide site-directed mutagenesis was used as described under “Materials and Methods” to inactivate the sequences of the dnaA boxes in pBR322 DNA, generating one template (pBR(-“A”)) carrying only the dmA box and another template (pBR(-“A”,-A)) that contained no active DNA A-binding site. Since only one DNA A-binding site was present in pBR(-“A”), hairpin formation on the displaced parental L strand in either the activated R- or D-looped template DNA could not occur. Therefore, the inability of the pBR(-“A”) template to support DNA A-dependent replication activity would indicate that hairpin formation was required and that the second possibility (Fig. 5) was the most likely mechanism of DNA A action.

Both mutant DNAs were as active a template for DNA A- dependent DNA replication as wild-type pBR322 DNA (Table 11). This was particularly surprising in the case of the pBR(-“A”,-A) DNA template, since DNA A should not be able to bind this DNA. However, our experience in developing the gel mobility shift assay had indicated that aggregated DNA A protein could bind nonspecifically to DNA. This could conceivably account for the observed replication activity. Since consistent results with the gel mobility shift assay were only observed in the presence of 0.2% Triton X-100 (to disaggregate the DNA A protein in solution), the effect of this detergent on the replication of these templates in the recon-

Binding 3 4 5 6 7

B. Competition

1 2 3 4 5 6 7

I 4- bound

- free

DNAA(fmo1) - 11 22 4 4 88 175 350

Substrate bound (fmol) 0 6 11 18 23 26 27 - - 1X 2.5X 5X (OX 25X ds dna A box (-fold molar excess) 0 25 12 I O 6.5 2.2 0.5 Substrate bound (fmol)


”1 dSdnaAbx 25

f Io/ 15 / I

: 10 hairpin D

ln 5 ds dna .A’ b x

5s dna AHIs d m AL RNAIDNA hybrd 0

0 50 100 150 200 250 300 350

DNA A Protein (lmol)

FIG. 8. DNA A binding to various oligonucleotides as measured by the gel mobility shift assay. Binding assays were as described in the legend to Fig. 7 and under “Materials and Methods.”

0 5 1 0 1 5 2 0 2 5

Competitor (-fold molar excess)

FIG. 9. Competition of DNA A binding by various oligonucleotides. Binding assays were as described in the legend to Fig. 7 and under “Materials and Methods” in the presence of DNA A (44 fmol), ‘”P-labeled ds dnaA box (35 fmol), and the indicated amounts of the unlabeled competitor oligonucleotides.

TABLE I1 DNA A-dependent DNA replication with pBR322 DNA templates

carrying mutated DNA A-binding sites DNA replication reaction mixtures were as described under “Ma-

terials and Methods.” DNA synthesis was determined by the incorporation of la-”’PldATP into acid-insoluble Droduct.

DNA synthesis

Template Without DNA A” With DNA A

-RNase H +RNaseH -RNase H +RNaseH -pol I +po l I -pol I + pol1

pmol dAMPf30 min pBR322 9.2 13.7 22.1 30.3

pBR(-“A”,-A) 8.5 13.0 20.0 29.0 pBR(-“A”) 10.4 13.6 20.5 26.8

“ Only leading-strand DNA synthesis is obtained when DNA A is absent from the replication reaction mixture.

stituted system was examined (Fig. 10). DNA A-dependent replication of wild-type pBR322 in

either the presence or absence of RNase H and pol I was essentially unaffected by the inclusion of as much as 1.6% Triton X-100 in the reaction mixture (Fig. 10). On the other hand, replication of the pBR(-“A”,-A) DNA template was inhibited 5-6-fold by 0.4% Triton X-100 under either set of replication conditions (Fig. lo), indicating that aggregated DNA A protein was, in fact, responsible for the observed replication activity in the absence of the detergent. Replica- tion of the template containing only the dnaA box (pBR-“A) was inhibited less than 2-fold by the detergent (Fig. 10). This suggests that hairpin formation between the two dnaA box sequences on the displaced plasmid L strand in wild-type pBR322 DNA was not required for DNA A-dependent pBR322 DNA replication, thereby eliminating the second

possibility as a mechanism that could mediate this reaction. These observations implied that during DNA A-dependent

pBR322 DNA replication, DNA A was binding to the double- stranded sites provided by either the RNA 11-parental H strand DNA hybrid in the R-loop formed in the absence of RNase H and pol I, or to the nascent leading strand-parental H strand DNA duplex in the D-loop formed in the presence of RNase H and pol I. In order to confirm this, the binding of DNA A directly to the activated templates was examined.

Binding of DNA A to Activated pBR322 DNA Templates- Binding of DNA A to the nascent 6sL leading-strand DNA could be scored directly using activated D-looped pBR322 DNA made in a reaction mixture that included [ C Y - ~ ~ P I ~ N T P S . Specific binding of DNA A to the nascent 32P-labeled leading strand DNA-parental H strand duplex in the D-looped substrate should be apparent by the ability of the bound protein to protect the nascent DNA from digestion by exo 111. The nascent 6sL leading-strand DNA in this substrate was between 150 and 300 nt in length (Fig. ll, lane l ) and was completely sensitive to digestion by exo I11 (Fig. 11, lane 2). The addition of increasing concentrations of DNA A to the reaction mixture resulted in the appearance of four bands (Fig. 11, lanes 3-8), corresponding to positions at which further digestion by exo I11 had been prevented by bound DNA A. Since the 5‘ end of the 6sL DNA fragment was fixed by RNase H processing of the RNA 11-DNA hybrid, the length of these protected fragments was a measure of the distance of their 3‘ end from the origin. When mapped in this manner to the origin region of pBR322 DNA, these exo I11 stop sites were clustered near the position of the dnaA boxes. In addition, the extent of protection from exo I11 digestion was maximal at the same concentration of DNA A that was required for maximum DNA synthetic activity. This analysis therefore confirms the conclusion that in pBR322 DNA activated by D-loop formation, DNA A binds to the duplex dnaA box sequences formed by the nascent 6sL leading-strand DNA and the parental H strand template DNA.

In principle, this assay should also be able to detect DNA A binding to ”’P-labeled RNA I1 in the RNA 11-parental H strand DNA hybrid present in activated R-looped pBR322 DNA. However, this proved difficult to detect (data not shown). This most likely reflected the instability of the binding of DNA A to a RNA-DNA hybrid. Based on the other analyses presented here, this is clearly a much more transient interaction than DNA A binding to a bona fide dnaA box. Therefore, a more sensitive assay, photocross-linking, was used to detect binding of DNA A to the RNA-DNA hybrid.

RNA I1 was transcribed in the presence of BrdUTP and [CY-~’PP]GTP. DNA A was bound to this R-looped template and photocross-linked to the RNA by UV illumination under DNA replication reaction conditions. The material was then digested with a mixture of DNases and RNases and label transfer from the RNA to DNA A was assessed by electrophoresis through denaturing polyacrylamide gels containing SDS (Fig. 12). A similar experiment was used as a control where the substrate was D-looped DNA prepared in the presence of BrdUTP and [cY-~’P]~ATP (Fig. 12). A labeled polypeptide band that migrated with an apparent molecular mass expected for DNA A (52 kDa (64)) was observed when both the RNA 11-pBR322 DNA hybrid (Fig. 12, lanes 4 and 5 ) and the nascent 6sL fragment-pBR322 DNA template (Fig. 12, lane 6) were used as substrates in the photocross-linking reaction. Label transfer was a result of specific DNA A binding, since it was eliminated when an excess of the ds dnaA box oligo was present in the reaction mixture (Fig. 12, lanes 3 and 8). In addition, photocross-linking of DNA A to

18904

FIG. 10. Effect of Triton X-100 on DNA A-dependent DNA replication with pBR322 DNA templates carrying mutated dnaA box sequences. Replication reaction mixtures as. described under "Materials and Methods" contained the indicated pBR322 DNA template and varying concentrations of Triton X-100. A, in the presence of RNase H and pol I. R, in the absence of RNase H and pol I. Replication activity was determined by the incorporation of [ n-:"P]dATP into acid-insoluble product. 100% activity corresponds to the incorporation data given in Table 11.

DNA A-initiation of pBR322 DNA Replication

A. +(RNase H, Pol I )

0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6

Triton X-100 (%)

310 ~

234 - 281 -

194 -

118 -

72 -

+ Ex0 111 - M 1 2 3 4 5 6 7 8 9

- d

DNA A (ng) - - 68 135 203 270 405 540 -

0 20 40 60 80 100 * I 1 1 1 1

t t t t n

d c ba

FIG. 11. Binding of DNA A to pBR322 DNA activated by D-loop formation. D-looped pBR322 DNA was prepared as described under "Materials and Methods" in the presence of dATP. Reaction mixtures containing the D-looped substrate and either no DNA A (lanes I, 2, and 9) or the indicated amounts of DNA A (lanes 3-8) were incubated a t room temperature (24 "C) for 10 min. Exo I11 was then added to the reaction mixtures analyzed in lanes 2- 8 and the incubation continued for 20 min a t 30 "C. The digestion was terminated by the addition of EDTA to 20 mM, the samples were heat-denatured, and then treated with RNase A. The reaction products were then analyzed by electrophoresis through a 8% (20:1, acrylamide:bisacrylamide) polyacrylamide gel containing 50% urea. The gel was dried and autoradiographed. The schematic drawing under the gel autoradiograph illustrates the position of the DNA A- induced exo 111 stop sites with respect to the origin (inverted triangle) and the dnaA box sequences.

the labeled RNA I1 required formation of the RNA 11-pBR322 DNA hybrid, since it was blocked by pretreatment of the hybrid with RNase H at a concentration sufficient to generate the RNA primer for leading-strand synthesis (Fig. 12, lune 2). This analysis indicates that DNA A can bind under DNA replication reaction conditions to the RNA 11-parental H

B. - (RNase H. Pol I )

0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6

Triton X-100 (%)

"c

RNA ll-pBR322 DNA hybrid 6sL frag.-pBR322 DNA I , - 1 2 3 4 5 6 7 8 kDa

,- I - 200

97

68 ,52 43

25

18

- 12

RNase H + DNA A (ng) - 270 270 270 405 270 270 -

Nucleases ds dna A oligo + +

I I + FIG. 12. Photocross-linking of DNA A to pBR322 DNA ac-

tivated by R-loop formation. R- or D-looped pBR322 DNAs were made as described under "Materials and Methods" in the presence of BrUTP and [n-:"P]GTP or BrdUTP and [n-:"P]dATP, respectively. Reaction mixtures containing either R- (lanes 1-5) or D-looped (lanes 6-8) substrate, DNA A (lanes 2-7), and ds dnaA box oligonucleotide (20 pmol) (lanes 3 and 7 ) were incubated a t room temperature (24 "C) for 20 min. The reaction mixture shown in lane 2 was treated with RNase H (0.2 unit) prior to the addition of DNA A. Samples were then exposed to UV light, digested with several nucleases as described under "Materials and Methods," and the products analyzed by electrophoresis through a SDS-polyacrylamide gel (12.5%, 301, acrylamide:bisacrylamide). The gel was dried and autoradiographed. The 38-kDa labeled species observed in lane 6 is most likely photolytically cleaved DNA A. The preparation of DNA A used in these experiments (which was the only protein preparation present in the photocross- linking reaction mixture) contained, as the major band, only the 52- kDa DNA A polypeptide and had no contaminant polypeptide of 38 kDa when analyzed by silver staining of SDS-polyacrylamide gels.

strand DNA hybrid in a pBR322 template activated by R- loop formation.

DISCUSSION

pBR322 DNA can be replicated by alternative enzymatic pathways both in vivo and in vitro. Lagging-strand DNA synthesis can be catalyzed by either the 4X174-type (17, 18) or the oriC-type primosome (23, 24). Examination of the enzymatic requirements and the molecular events occurring prior to 4X174-type primosome-catalyzed DNA synthesis has led to the conclusion that transcription of the RNA primer is the key step required for initiation (17, 18). In the absence of


RNase H, this leads to the extension of the RNA 11-pBR322 DNA hybrid downstream of the origin (19). When RNase H is available to process the RNA 11-DNA hybrid and pol I is available to bind the primer terminus, leading-strand DNA synthesis extends downstream of the origin (20,39). In either case, the PAS on the parental L strand is activated by virtue of its displacement from a double-stranded to single-stranded conformation and can subsequently catalyze assembly of the dX174-type primosome that, in combination with the DNA pol I11 HE, is responsible for replication of the remainder of the template.

On the other hand, the mechanism by which binding of the DNA A protein to the origin of pBR322 DNA leads to replication of the plasmid is unknown. We have studied DNA A- dependent pBR322 DNA replication in a system reconstituted with purified E. coli replication proteins in order to gain insight to this mechanism.

RNAP-catalyzed transcription of RNA 11, the leading- strand primer precursor, was required for DNA A-dependent pBR322 DNA replication. However, DNA replication was nearly as efficient when RNase H and pol I, which are required for processing and elongating the primer, respectively, were omitted from the reaction as when they were present. This suggested that transcription of the primer was required, but that it need not be processed by RNase H.

The initiation events were examined more closely by staging the replication reaction and separating the transcriptional events from DNA synthesis. It was clear, using a transcriptionally activated DNA template, that pBR322 could be replicated specifically by the oriC-type primosome, whether or not RNase H and pol I were included during the DNA synthesis step. This strongly suggested that localized unwinding of the origin region (including the dnaA boxes), either by the RNA 11-DNA hybrid or by the nascent leading strand, was crucial in order to activate the template for subsequent DNA A-dependent DNA replication. This was confirmed by dem- onstrating the presence of these conformations in the transcriptionally activated template either in the presence or absence of RNase H and pol I.

This led us to examine which of the possible modes of DNA A binding to an R- or D-looped pBR322 DNA (Fig. 5) represented the mechanism responsible for DNA A-dependent initiation of pBR322 DNA replication.

By studying systematically with several different assay systems DNA A binding to various substrates designed to mimic the possible conformations available to the protein, we have been able to eliminate all but one possible mechanism. Binding of DNA A to dnaA box sequences in the displaced parental L strand maintained in a completely single-stranded conformation in the R- or D-looped activated pBR322 template DNA was shown to be very unlikely. Single-stranded oligonculeotides comprised of either the H or L strand of the dnaA box were incapable of inhibiting, by competition for DNA A, oriC DNA replication, did not form stable complexes with DNA A as assayed by gel mobility shift analysis, and could not compete for DNA A binding to the ds dnaA box oligonucleotide in the same gel retardation assay.

On the other hand, binding of DNA A to a hairpin formed in the displaced parental L strand because of the inverted repeat of the dm-“A” and dmA box sequences seemed a more likely possibility. An oligonucleotide capable of forming such a hairpin structure did compete in the oriC DNA replication assay and could form a stable complex with DNA A measur- able by gel mobility shift analysis. However, this possible mode of DNA A binding to the activated R- or D-looped pBR322 DNA templates cannot be the major mechanism

5 ’ 0 0

i i)

L 3”

DNA0:DNAC

. e

FIG. 13. Model for DNA A-mediated trans-strand loading of DNA B to the L strand of pBR322 DNA. The model is described in detail in the text. Thin lines, parental DNA; thick lines, nascent leading-strand D N A thick striped line, RNA 11; striped rectangles, dnaA boxes. The 5’ + 3’ arrow denotes the direction of replication fork movement.

accounting for DNA A-dependent pBR322 DNA replication, since template DNAs carrying only an active dnaA box sequence could replicate quite well, either in the presence or absence of RNase H and pol I. Hairpin formation cannot occur with this template.

This therefore suggested that DNA A-dependent pBR322 DNA replication was mediated via binding of DNA A to the nascent leading-strand DNA-parental H strand template DNA duplex or to the RNA 11-parental H strand DNA hybrid in the activated D- or R-looped pBR322 DNA templates, respectively. Binding of DNA A to this structure in the D- looped template could be demonstrated directly and was con- sonant with the binding activity of the ds dnaA box sequence in the other assays described herein. Binding of DNA A to the RNA-DNA hybrid, although specific, was clearly more transient, seemed to require oligomerization of DNA A, and was observed only by the photocross-linking of DNA A to the RNA-DNA hybrid and by the ability of the RNA-DNA hybrid oligonucleotide to compete for DNA A during oriC DNA replication.

A model that incorporated these observations was therefore developed to describe the initiation events during DNA A- dependent pBR322 DNA replication (Fig. 13). The rightward direction of DNA replication as indicated in the model for DNA A-dependent pBR322 replication was established by Seufert and Messer (24) and has been confirmed (data not shown). Localized unwinding of the region encompassing the dnaA box sequences on pBR322 DNA occurs via the formation of the RNA-DNA hybrid in the absence of RNase H and pol I or because of the formation of the nascent leading strand- parental H strand duplex in the presence of RNase H and pol I (Fig. 13, i). DNA A binds to the duplex sites so generated. Oligomerization of the DNA A protein might then act to


displace some of the SSB from the adjacent parental L strand (Fig. 13, ii). An observation in support of this step was made by Masai et al. (47), who demonstrated that DNA A could be isolated bound to an SSB-coated ss DNA containing a duplex dnaA box as a hairpin structure. Subsequent incubation of this complex with DNA B and DNA C resulted in DNA B gaining access to the ss DNA, suggesting that DNA A alone, or the interaction of DNA A bound to DNA with DNA B, could effect the displacement of SSB. Thus, in the model presented here, because of its likely ability to interact with the DNA A protein by protein-protein interactions, the DNA B protein is loaded in trans to the available single-stranded site from the DNA B-DNA C complex in solution (Fig. 13, iii). The DNA B helicase is now oriented properly so that it can act to propagate a replication fork as it moves in the 5' + 3' direction along the lagging-strand template, the parental L strand.

This mechanism can explain all previous observations of DNA A-dependent pBR322 DNA replication (23, 24). The intimate association of RNA primer synthesis with DNA A action had previously been noted by Seufert et al. (54). The mechanism proposed here accounts for their observation that when pBR322 derivatives deleted of the endogenous dnaA box sequences were used as templates, the efficiency of rescue of DNA A-dependent replication by an exogenously inserted DNA A-binding site decreased as the new site was moved further downstream of the original position. The likely reason for thi is that those exogenously inserted sites were now too far dhnstream to be within the domain of the D-loop re- quir'ed for activation of the template.

The novel mechanism of DNA A action described here brings to three the possible ways DNA A can mediate the access of DNA B to the template DNA. The other two are by the concerted action of DNA A in the nucleoprotein complex at oriC to both unwind the adjacent A + T-rich 13-mers and direct DNA B to the unwound site (4, 8, 9), and by DNA A binding to a hairpin sequence in a recombinant single- stranded phage DNA directing DNA B to the contiguous single strand (47).

Although the mechanism described here accounts for DNA A-dependent pBR322 DNA replication, it does not offer any insight to the possible interaction between a dX174-type primosome and an oriC-type primosome that might be present simultaneously on the DNA. This can presumably happen in the case of pBR322 DNA and may also occur during chromosomal DNA replication, since there are apparently several potential dX174-type PAS sequences 2 kilobases clockwise of oriC (55, 56). Studies addressing the possible consequence of this interaction are in progress.

Acknowledgments-We thank Drs. J. Hunvitz, M. O'Donnell, and S . Rabkin for their critical reading of the manuscript and D. Valentin for the artwork.

REFERENCES 1. Fuller, R. S., Kaguni, J. M., and Kornberg, A. (1981) Proc. Natl. Acad. Sci.

2. Hirota, Y., Ryter, A., and Jacob, F. (1968) Cold Spring Harbor Symp. Qwnt .

3. Hirota, Y., Mordoh, J., and Jacob, F. (1970) J. Mol. Biol. 53, 369-387 4. Fuller R. S. Funnell B. E. and Kornber A (1984) Cell 38,889-900 5. Chakiabort;, T., Yashinagi, K., Lother, 8 , and Messer, W. (1986) EMBO

U. S. A. 78, 7370-7374

Eiol. 33,677-693

J. 1, 1545-1549

5817-5821 6. Fuller, R. S., and Kornberg, A. (1983) Proc. Natl. Acad. Sci. U. S. A . 80,

8. Bramhill, D., and Kornberg, A. (1988) Cell 52,743-755 7. Hansen, F., Hansen, E., and Atlung, T. (1982) EMBO J. 1, 1043-1048

9. Sekimizu, K., Bramhill, D., and Kornber A (1987) Cell 50,259-265 10. Baker, T. A., Sekimizu, K., Funnell, B. %., and Kornberg, A. (1986) Cell

11. Baker, T. A,, Funnell, B. E., and Kornberg, A. (1987) J. Biol. Chem. 262, 53-64

f i877-f iRR5 12.

13.

14.

15.

16. 17. 18. 19. 20.

Arai, K., Low, R., Kobori, J., Sblomai, J., and Kornberg, A. (1981) J. Biol.

Arai, K., McMacken, R., Yasuda, S., and Kornberg, A. (1981) J. Biol. Chem.

Nurse, P., DiGate, R. J., Zavitz, K. H., and Marians, K. J. (1990) Proc.

Lee, E. H., Masai, H., Allen, G. C., and Kornberg, A. (1990) Proc. Natl.

Masai, H., and Arai, K. (1989) J. Eacteriol. 171, 2975-2980 Minden, J. S., and Marians, K. J. (1985) J. Biol. Chem. 260,9316-9325 Masai, H., and Arai, K. (1988) J. Biol. Chem. 263,15016-15023 Parada, C., and Marians, K. J. (1989) J. Biol. Chem. 264,15120-15129 Sakakibara. Y.. and Tomizawa. J.-I. (1974) Proc. Natl. Acad. Sci. U. S. A.

". . "" Chem. 256,5273-5280

256, 5281-5286

Natl. Acad. Sci. U. S. A . 87,4615-4619

Acad. Sci. U. S. A . 87,4620-4624

, , I

71, 1403-1407 21. Polaczek, P., and Ciesla, Z. (1984) Mol. Gen. Genet. 194, 227-231 22. Abe, M. (1980) J. Bacteriol. 141, 1024-1030 23. Ma, D., and Cam bell, J. L. (1988) J. Biol. Chem. 263,15008-15015 24. Seufert, W., and Lesser, W. (1987) Cell 48, 73-78 25. Kaguni, J. M., and Kornberg, A. (1984) Cell 38,183-190 26. van der Ende, A,, Baker, T. A,, Ogawa, T., and Kornberg, A. (1985) Proc.

27. Marians, K. J., Soeller, W., and Zipursky, S. L. (1982) J. Biol. Chem. 257,

28. Sekimizu, K., Yung, B. Y., and Kornberg, A. (1988) J. Biol. Chem. 263,

29. Dixon, N. E., and Kornberg, A. (1984) Proc. Natl. Acad. Sci. U. S. A . 81,

30. Greenbaum, J. H., and Marians, K. J. (1984) J. Biol. Chem. 259, 2594-

Natl. Acad. Sci. U. S. A . 82, 3954-3958

5656-5662

7136-7140

424-428

31.

32. 33.

34.

35.

36. 37. 38. 39.

Mei'er, M., Beck, E., Hansen, F. G., Bergman, H. J., Messer, W., von 2601

deyenburg, K., and Schaller, H. (1979) Proc. Natl. Acad. Scr. U. S. A . 76,580-584

Kreuzer, K. N., and Alberts, B. M. (1984) J. E d . Chem. 259,5339-5346 Milligan, J. F., Groeher, D. R., Witherell, G. W., and Uhlenbeck, 0. C.

Boeke, J. D., Vovis, G. F., and Zinder, N. D. (1976) Proc. Natl. Acad. Sci.

Marcinak, R. A,, Garcia-Blanco, M. A,, and Sharp, P. A. (1990) Proc. Natl.

Sekimizu, K., Bramhill, D., and Kornber , A. (1987) Cell 50,259-265 Itoh, T., and Tomizawa, J.-I. (1982) Nuckic Acids Res. 10,5949-5965 Masukata, H., Dasgupta, S., and Tomizawa, J. (1987) Cell 51,1123-1130 Itoh. T.. and Tomizawa. J. (1980) Proc. N ~ t l . Acad. Scr. U. S. A . 77,2450-

(1987) Nucleic Acids Res. 15,8783-8798

U. S. A. 76, 2699-2702

Acad. Sci. U. S. A. 87, 3624-3628

, . .

40. Selzer, G., and Tomizawa, J. (1982) Proc. Natl. Acad. Sci. U. S. A . 79,

41. Minden, J. S., and Marians, K. J. (1986) J. Biol. Chem. 261, 11906-11917 42. Masamune, Y., Frenkel, G. D., and Richardson, C. C. (1971) J. Biol. Chem.

43. Tomizawa, J., and Itoh, T. (1982) Cell 31, 575-583 44. Masukata H., and Tomizawa, J. (1984) Cell 36,513-522 45. Weiss, B. i1976) J. Biol. Chem. 251, 1896-1901 46. Rogers, S. G., and Weiss, B. (1980) Gene (Amst . ) 11, 187-192 47. Masai. H. J.. Nomura, N.. and Arai, K. (1990) J. Biol. Chem. 265, 15134-

2454 '

7082-7086

246,6874-6879

48. 49. 50. 51. 52. 53.

54.

55.

56.

15144 Fried M. and Crothers, D. (1981) Nucleic Acids Res. 9, 6505-6525 Garnkr, M . , and Revzin, A. (1981) Nucleic Acids Res. 9,3047-3060 Fried, M. G., and Crothers, D. M. (1984) J. Mol. Biol. 172, 241-262 Strauss F. and Varshavsky, A. (1984) Cell 37,889-901 Conawd d W , and Conaway, R. C. (1990) Science 248,1550-1553 Horikosti M . Yamamoto T., Ohkuma, Y., Weill, P. A,, and Roeder, R. G.

Seufert, W., Dobrinski, B., Lurz, R., and Messer, W. (1988) J. Biol. Chem.

Stuitje, A. R., Weisheek, P. J., and Meijer, M. (1984) Nucleic Acids Res.

Seufert, W., and Messer, W. (1986) EMBO J. 5, 3401-3406

. .

(1990) dell 61, 1171-1158

263,2719-2723

12,3321-3332

the of chemistry vol. 266, no. issue pp. 18895-18906, …material in 30 min at 30 "c)/mg,...

Documents