the tria project: genomics of the mountain pine beetle system
DESCRIPTION
This is a presentation given by Dr.Janice Cooke to the Genome Alberta Board of Directors on Sept,25, 2012.TRANSCRIPT
The Tria Project: Genomics of the Mountain Pine Beetle System
Janice Cookeand the Tria Consortium
State of the mountain pine beetle outbreak: context for using a genomics approach in combatting the epidemic
Introduction to the Tria Project and the Tria TeamKey outcomes from the Tria Project to date
Filling knowledge gaps and making discoveries Linking genomics and risk assessment Using genomics to inform policy makers and forest
managersPerspectives and future directions
Outline
Jack Scott, University of Alberta
Unprecedented spread of mountain pine beetle during the current outbreak
10 µm
10 µm
Adrianne Rice
Data: Little (1971); S. Taylor, G. Thandi, D. Yemshinov
(Canadian Forest Service)
Unprecedented spread of mountain pine beetle during the current outbreak
The Tria Project: A large-scale multidisciplinary collaborative effort
Physiological & Functional
Genomics
Ecology
Population Genomics
Environmental & EconomicRisk Models
Janice Cooke
How gene products work
Genetic variation across landscapes
How organisms function & interact in nature
MPB vector
Jack Scott
Adrianne Rice
Pine host
Fungalpathogen
Policy development;
Forest management
and spread control
programme planning
Stakeholders& End Users
Genomic
Resources
The Tria Project: A large-scale multidisciplinary collaborative effort
University of Alberta
University of British Columbia
University of Northern British Columbia
Natural Resources Canada – Canadian Forest Service
Michael Smith Genome Sciences Centre – BC Cancer Agency
University of Minnesota
Stakeholdersand Endusers
Policy development;
Forest management and spread
control programme
planning
Functional & physiological
genomics
Population genomics
Ecosystem ecology
Risk modeling, monitoring & assessment
B. Cooke, Aukema,
Hauer,Lewis
Mountain pine
beetle
Huber, KeelingBohlmann
Sperling, Coltman,
Murray
Erbilgin, Evenden
Fungal associates
Breuil,Bohlmann
Hamelin, Sperling
UNBC, UBCUA, UNBC UA, UBC
UBC UBC, UA UA, CFS, UMinn
Breuil, K Lewis J. Cooke, Erbilgin
UBC, UNBC, UA
PinesJ Cooke, Bohlmann
Coltman, J Cooke
Erbilgin, K Lewis
UA, UBC UA UA, UBC
Interactions
Huber, Breuil, J Cooke, Bohlmann
Coltman, Sperling, Hamelin
Erbilgin, Evenden
UNBC, UBC, UA UA, UNBC UA, UBC
ReGenomic resources
Bohlmann, Breuil, J Cooke, Hamelin, Huber, Jones, Keeling, Murray, Sperling
UBC, UNBC, UA, BCGSC
Genomes and Genomic Resources
…AAGAGAGCCTGTCGCTAAATGCAAGCCTTGAGTACC…
Chromosomes
Expressed gene sequences
Genetic linkage map (relative positions of gene-based or anonymous markers)
Genome sequence
(Adapted from Paul & Ferl, 2000)
Physiological genomics: monitoring large numbers of genes simultaneously
for gene activity levels
Physiological genomics: monitoring large numbers of genes simultaneously
for gene activity levels
Sequence data enables high-throughput analyses of many genes and/or many individuals simultaneously
Population genomics: assessing genetic variation in large numbers
of individuals simultaneously
Population genomics: assessing genetic variation in large numbers
of individuals simultaneously
A B C … n
1
2
3
…
n
Gene Markers
Ind
ivid
ual
s
A/A A/G G/G
Sequence data enables high-throughput analyses of many genes and/or many individuals simultaneously
Tria-Generated Genomic Resources
Janice Cooke
Jack Scott
Adrianne Rice
Mountain Pine Beetle Draft whole genome sequence Expressed gene sequences Expressed gene sequence clones Microsatellite markers Single nucleotide polymorphism gene markers Protein “fingerprints”
Mountain Pine Beetle
Fungal spp. Pines – lodgepole and jack pine
Whole genome sequence
Draft High-quality reference plus additional strains (G.
clavigera); Draft (O. piceae)
No
Expressed gene sequences
Yes Yes (G. clavigera, O. piceae) Yes
Expressed gene sequence clones
Yes Yes (G. clavigera) Yes
Microsatellite markers Yes Yes – multiple spp. Yes
Single nucleotide polymorphism gene markers
Yes Yes – multiple spp. Yes
Protein “fingerprints” Yes No No
High-throughput gene expression tools
Ref-Seq Ref-Seq Microarrays
Genomic resources enabled Tria researchers to document beetle spread into jack pine
Genomic resources enabled Tria researchers to document beetle spread into jack pine
Lodgepole and jack pine can be difficult to tell from hybrids, and the hybrid zone was not well-defined
Lodgepole and jack pine can be difficult to tell from hybrids, and the hybrid zone was not well-defined
Catherine Cullingham, University of Alberta
Using molecular markers to distinguish lodgepole pine, jack pine and their hybrids
Using molecular markers to distinguish lodgepole pine, jack pine and their hybrids
Lodgepole pineJack pineHybrid
Catherine Cullingham, University of Alberta
Catherine Cullingham, University of Alberta
Pine marker analyses revealed mountain pine beetle range expansion into jack pine
Pine marker analyses revealed mountain pine beetle range expansion into jack pine
Catherine Cullingham, University of AlbertaData: Little (1971), D. Yemshinov (Canadian Forest Service)
Bringing a regional issue to national significanceBringing a regional issue to national significance
Alberta Sustainable Resources Development Adriana ArangoJanice Cooke
Defenses differ in lodgepole and jack pine, and are further altered by drought
At least some mountain pine beetle fungal associates can detoxify pine defense compounds
http://flickr.com/photos/19964825@N00/2495786445/
10 µm
10 µm
Adrianne Rice
Genetic analyses provided strong evidence of beetle dispersal from northern BC into northwestern AB
Genetic analyses provided strong evidence of beetle dispersal from northern BC into northwestern AB
Samarasekara et al 2012
Beetles can migrate longer
distances than
previously supposed
Beetles can migrate longer
distances than
previously supposed
Beetles in novel habitats: are they becoming more cold tolerant?
Beetles in novel habitats: are they becoming more cold tolerant?
Cullingham and Janes, unpublished
Selection (cold winter
temperatures)
Frequency5%
Frequency20%
Geographic features
EcoregionsGenetic variation
Pines, beetle and fungal associates all show genetic variation across the landscape
Pines, beetle and fungal associates all show genetic variation across the landscape
Pathways by which genomics data informmodel-based risk assessment
The current MPB outbreak has provided excellent proof of concept for application of genomics to forest pest management.
MPB, fungal and pine populations are heterogeneous This landscape-level non-uniformity could affect
MPB spread Genomics is already informing Risk Assessment
Risk Assessment and risk models also inform genetics research by identifying knowledge gaps
Genomics is already informing Tree Improvement Other possibilities for applying genetics to
reforestation and genetic conservation strategies
Perspectives
Lorraine Maclauchlan, BC Ministry of Forests and Range Rory McIntosh, Saskatchewan Environment
Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn
Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn
East of the Rockies, why isn’t the outbreak unfolding as models predicted in the mid 2000s? Will the outbreak reach Ontario? If so, when?
Genomics-enhanced risk models How much does genetic variation in mountain pine beetle,
pine host and fungal pathogen matter in outbreak dynamics? Integrated genomic landscape mapping
We are only just beginning to understand how the players in the mountain pine beetle system interact, and how these interactions might affect outbreak dynamics
Functional and physiological genomics investigations have provided novel insights
Future Research Needs
Continued integration of mountain pine beetle research across disciplines and across scales
Complex problems require holistic approaches Genomics enables integration
Future Research Needs
Project LeadersJanice Cooke (U of A)Jörg Bohlmann (UBC)
Co-Investigators Brian Aukema (U Minn)Colette Breuil (UBC)David Coltman (U of A)Barry Cooke (CFS)Nadir Erbilgin (U of A)Maya Evenden (U of A)Richard Hamelin (CFS)Grant Hauer (U of A)Robert Holt (GSC)Dezene Huber (UNBC)Steven Jones (GSC)Christopher Keeling (UBC)Marco Marra (GSC)Brent Murray (UNBC)Felix Sperling (U of A)Tim Williamson (CFS)
Research TechniciansSean BromilowJeremiah BolstadStephanie BeauseigleTiffany BonnetMarie BourassaStephanie BoychukWilliam ClarkAmanda CookhousePat CraneSophie DangChristina ElliotHarpreet DullatMatt FergusonJoël FillonLeonardo GalindoHannah HendersonEd HuntRobert JagodzinskiBrad JonesChelsea JuLaura KennedySusanne King-JonesChris KonchalskiJordan KoopmansBen LaiMaria LiYisu LiEmilia LimLinette LimMiranda MeentsDominik RoykoHarpreet SandhuBin ShanAndrea SinghBill SperlingTalya TruantTyler WatsonCaroline WhitehouseMack Yuen
Project Management Matthew Bryman (U of A)Karen Reid (UBC)
Postdocs / Research AssociatesEri AdamsJay AndersonAdriana ArangoCelia BooneCatherine CullinghamWalid El KayalKatrin GeislerDawn HallSajeet HaridasUljana HesseKate HrinkevichPatrick JamesJasmine Janes
Neils JensenLjerka LahInka LusebrinkMario Pineda-KrchIsidro OjedaCaitlin PittAdrianne RiceJeanne RobertAmanda RoeKishan SambarajuAmy Thommasen Clement TsuiYe Wang
Graduate StudentsSepideh AlamoutiNic BartellChristine ChuiErin ClarkScott DiGuistiniHoney-Marie de la Giroday
Lina FarfanJordie FraserChris HansenLily KhadempourEuwing TeenYe WangGayathri Weerasuriya
Undergraduate StudentsSimon AllardTravis AllenKyle ArtymKathryn BerrySimren BrarHuang-Ju ChenTiffany ClarkeCharles CopelandJulia DamShane DoddridgePatrick GaudetAndrew HoCierra HoecherByron KnollSiew Law
Jean LinskyRosalyn Loerke Fang Yuan LuoMehvash MalikSophia McClairGenny MichielRhiannon MontgomeryMarcelo MoraBoyd MoriMike PriorTing PuAndrew SharpPatrick WelshChristina Wong