the tria project: genomics of the mountain pine beetle system

29
The Tria Project: Genomics of the Mountain Pine Beetle System Janice Cooke and the Tria Consortium

Upload: genome-alberta

Post on 11-May-2015

1.676 views

Category:

Technology


3 download

DESCRIPTION

This is a presentation given by Dr.Janice Cooke to the Genome Alberta Board of Directors on Sept,25, 2012.

TRANSCRIPT

Page 1: The Tria Project: Genomics of the Mountain Pine Beetle System

The Tria Project: Genomics of the Mountain Pine Beetle System

Janice Cookeand the Tria Consortium

Page 2: The Tria Project: Genomics of the Mountain Pine Beetle System

State of the mountain pine beetle outbreak: context for using a genomics approach in combatting the epidemic

Introduction to the Tria Project and the Tria TeamKey outcomes from the Tria Project to date

Filling knowledge gaps and making discoveries Linking genomics and risk assessment Using genomics to inform policy makers and forest

managersPerspectives and future directions

Outline

Page 3: The Tria Project: Genomics of the Mountain Pine Beetle System

Jack Scott, University of Alberta

Unprecedented spread of mountain pine beetle during the current outbreak

10 µm

10 µm

Adrianne Rice

Page 4: The Tria Project: Genomics of the Mountain Pine Beetle System

Data: Little (1971); S. Taylor, G. Thandi, D. Yemshinov

(Canadian Forest Service)

Unprecedented spread of mountain pine beetle during the current outbreak

Page 5: The Tria Project: Genomics of the Mountain Pine Beetle System

The Tria Project: A large-scale multidisciplinary collaborative effort

Physiological & Functional

Genomics

Ecology

Population Genomics

Environmental & EconomicRisk Models

Janice Cooke

How gene products work

Genetic variation across landscapes

How organisms function & interact in nature

MPB vector

Jack Scott

Adrianne Rice

Pine host

Fungalpathogen

Policy development;

Forest management

and spread control

programme planning

Stakeholders& End Users

Genomic

Resources

Page 6: The Tria Project: Genomics of the Mountain Pine Beetle System

The Tria Project: A large-scale multidisciplinary collaborative effort

University of Alberta

University of British Columbia

University of Northern British Columbia

Natural Resources Canada – Canadian Forest Service

Michael Smith Genome Sciences Centre – BC Cancer Agency

University of Minnesota

Page 7: The Tria Project: Genomics of the Mountain Pine Beetle System

Stakeholdersand Endusers

Policy development;

Forest management and spread

control programme

planning

Functional & physiological

genomics

Population genomics

Ecosystem ecology

Risk modeling, monitoring & assessment

B. Cooke, Aukema,

Hauer,Lewis

Mountain pine

beetle

Huber, KeelingBohlmann

Sperling, Coltman,

Murray

Erbilgin, Evenden

Fungal associates

Breuil,Bohlmann

Hamelin, Sperling

UNBC, UBCUA, UNBC UA, UBC

UBC UBC, UA UA, CFS, UMinn

Breuil, K Lewis J. Cooke, Erbilgin

UBC, UNBC, UA

PinesJ Cooke, Bohlmann

Coltman, J Cooke

Erbilgin, K Lewis

UA, UBC UA UA, UBC

Interactions

Huber, Breuil, J Cooke, Bohlmann

Coltman, Sperling, Hamelin

Erbilgin, Evenden

UNBC, UBC, UA UA, UNBC UA, UBC

ReGenomic resources

Bohlmann, Breuil, J Cooke, Hamelin, Huber, Jones, Keeling, Murray, Sperling

UBC, UNBC, UA, BCGSC

Page 8: The Tria Project: Genomics of the Mountain Pine Beetle System

Genomes and Genomic Resources

…AAGAGAGCCTGTCGCTAAATGCAAGCCTTGAGTACC…

Chromosomes

Expressed gene sequences

Genetic linkage map (relative positions of gene-based or anonymous markers)

Genome sequence

(Adapted from Paul & Ferl, 2000)

Page 9: The Tria Project: Genomics of the Mountain Pine Beetle System

Physiological genomics: monitoring large numbers of genes simultaneously

for gene activity levels

Physiological genomics: monitoring large numbers of genes simultaneously

for gene activity levels

Sequence data enables high-throughput analyses of many genes and/or many individuals simultaneously

Page 10: The Tria Project: Genomics of the Mountain Pine Beetle System

Population genomics: assessing genetic variation in large numbers

of individuals simultaneously

Population genomics: assessing genetic variation in large numbers

of individuals simultaneously

A B C … n

1

2

3

n

Gene Markers

Ind

ivid

ual

s

A/A A/G G/G

Sequence data enables high-throughput analyses of many genes and/or many individuals simultaneously

Page 11: The Tria Project: Genomics of the Mountain Pine Beetle System

Tria-Generated Genomic Resources

Janice Cooke

Jack Scott

Adrianne Rice

Mountain Pine Beetle Draft whole genome sequence Expressed gene sequences Expressed gene sequence clones Microsatellite markers Single nucleotide polymorphism gene markers Protein “fingerprints”

Mountain Pine Beetle

Fungal spp. Pines – lodgepole and jack pine

Whole genome sequence

Draft High-quality reference plus additional strains (G.

clavigera); Draft (O. piceae)

No

Expressed gene sequences

Yes Yes (G. clavigera, O. piceae) Yes

Expressed gene sequence clones

Yes Yes (G. clavigera) Yes

Microsatellite markers Yes Yes – multiple spp. Yes

Single nucleotide polymorphism gene markers

Yes Yes – multiple spp. Yes

Protein “fingerprints” Yes No No

High-throughput gene expression tools

Ref-Seq Ref-Seq Microarrays

Page 12: The Tria Project: Genomics of the Mountain Pine Beetle System

Genomic resources enabled Tria researchers to document beetle spread into jack pine

Genomic resources enabled Tria researchers to document beetle spread into jack pine

Page 13: The Tria Project: Genomics of the Mountain Pine Beetle System

Lodgepole and jack pine can be difficult to tell from hybrids, and the hybrid zone was not well-defined

Lodgepole and jack pine can be difficult to tell from hybrids, and the hybrid zone was not well-defined

Catherine Cullingham, University of Alberta

Page 14: The Tria Project: Genomics of the Mountain Pine Beetle System

Using molecular markers to distinguish lodgepole pine, jack pine and their hybrids

Using molecular markers to distinguish lodgepole pine, jack pine and their hybrids

Lodgepole pineJack pineHybrid

Catherine Cullingham, University of Alberta

Page 15: The Tria Project: Genomics of the Mountain Pine Beetle System

Catherine Cullingham, University of Alberta

Pine marker analyses revealed mountain pine beetle range expansion into jack pine

Pine marker analyses revealed mountain pine beetle range expansion into jack pine

Page 16: The Tria Project: Genomics of the Mountain Pine Beetle System

Catherine Cullingham, University of AlbertaData: Little (1971), D. Yemshinov (Canadian Forest Service)

Bringing a regional issue to national significanceBringing a regional issue to national significance

Page 17: The Tria Project: Genomics of the Mountain Pine Beetle System

Alberta Sustainable Resources Development Adriana ArangoJanice Cooke

Defenses differ in lodgepole and jack pine, and are further altered by drought

Page 18: The Tria Project: Genomics of the Mountain Pine Beetle System

At least some mountain pine beetle fungal associates can detoxify pine defense compounds

http://flickr.com/photos/19964825@N00/2495786445/

10 µm

10 µm

Adrianne Rice

Page 19: The Tria Project: Genomics of the Mountain Pine Beetle System

Genetic analyses provided strong evidence of beetle dispersal from northern BC into northwestern AB

Genetic analyses provided strong evidence of beetle dispersal from northern BC into northwestern AB

Samarasekara et al 2012

Beetles can migrate longer

distances than

previously supposed

Beetles can migrate longer

distances than

previously supposed

Page 20: The Tria Project: Genomics of the Mountain Pine Beetle System

Beetles in novel habitats: are they becoming more cold tolerant?

Beetles in novel habitats: are they becoming more cold tolerant?

Cullingham and Janes, unpublished

Selection (cold winter

temperatures)

Frequency5%

Frequency20%

Page 21: The Tria Project: Genomics of the Mountain Pine Beetle System

Geographic features

EcoregionsGenetic variation

Pines, beetle and fungal associates all show genetic variation across the landscape

Pines, beetle and fungal associates all show genetic variation across the landscape

Page 22: The Tria Project: Genomics of the Mountain Pine Beetle System

Pathways by which genomics data informmodel-based risk assessment

Page 23: The Tria Project: Genomics of the Mountain Pine Beetle System
Page 24: The Tria Project: Genomics of the Mountain Pine Beetle System

The current MPB outbreak has provided excellent proof of concept for application of genomics to forest pest management.

MPB, fungal and pine populations are heterogeneous This landscape-level non-uniformity could affect

MPB spread Genomics is already informing Risk Assessment

Risk Assessment and risk models also inform genetics research by identifying knowledge gaps

Genomics is already informing Tree Improvement Other possibilities for applying genetics to

reforestation and genetic conservation strategies

Perspectives

Page 25: The Tria Project: Genomics of the Mountain Pine Beetle System

Lorraine Maclauchlan, BC Ministry of Forests and Range Rory McIntosh, Saskatchewan Environment

Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn

Page 26: The Tria Project: Genomics of the Mountain Pine Beetle System

Mountain pine beetle at the leading edge of the outbreak: new surprises at every turn

Page 27: The Tria Project: Genomics of the Mountain Pine Beetle System

East of the Rockies, why isn’t the outbreak unfolding as models predicted in the mid 2000s? Will the outbreak reach Ontario? If so, when?

Genomics-enhanced risk models How much does genetic variation in mountain pine beetle,

pine host and fungal pathogen matter in outbreak dynamics? Integrated genomic landscape mapping

We are only just beginning to understand how the players in the mountain pine beetle system interact, and how these interactions might affect outbreak dynamics

Functional and physiological genomics investigations have provided novel insights

Future Research Needs

Page 28: The Tria Project: Genomics of the Mountain Pine Beetle System

Continued integration of mountain pine beetle research across disciplines and across scales

Complex problems require holistic approaches Genomics enables integration

Future Research Needs

Page 29: The Tria Project: Genomics of the Mountain Pine Beetle System

Project LeadersJanice Cooke (U of A)Jörg Bohlmann (UBC)

Co-Investigators Brian Aukema (U Minn)Colette Breuil (UBC)David Coltman (U of A)Barry Cooke (CFS)Nadir Erbilgin (U of A)Maya Evenden (U of A)Richard Hamelin (CFS)Grant Hauer (U of A)Robert Holt (GSC)Dezene Huber (UNBC)Steven Jones (GSC)Christopher Keeling (UBC)Marco Marra (GSC)Brent Murray (UNBC)Felix Sperling (U of A)Tim Williamson (CFS)

Research TechniciansSean BromilowJeremiah BolstadStephanie BeauseigleTiffany BonnetMarie BourassaStephanie BoychukWilliam ClarkAmanda CookhousePat CraneSophie DangChristina ElliotHarpreet DullatMatt FergusonJoël FillonLeonardo GalindoHannah HendersonEd HuntRobert JagodzinskiBrad JonesChelsea JuLaura KennedySusanne King-JonesChris KonchalskiJordan KoopmansBen LaiMaria LiYisu LiEmilia LimLinette LimMiranda MeentsDominik RoykoHarpreet SandhuBin ShanAndrea SinghBill SperlingTalya TruantTyler WatsonCaroline WhitehouseMack Yuen

Project Management Matthew Bryman (U of A)Karen Reid (UBC)

Postdocs / Research AssociatesEri AdamsJay AndersonAdriana ArangoCelia BooneCatherine CullinghamWalid El KayalKatrin GeislerDawn HallSajeet HaridasUljana HesseKate HrinkevichPatrick JamesJasmine Janes

Neils JensenLjerka LahInka LusebrinkMario Pineda-KrchIsidro OjedaCaitlin PittAdrianne RiceJeanne RobertAmanda RoeKishan SambarajuAmy Thommasen Clement TsuiYe Wang

Graduate StudentsSepideh AlamoutiNic BartellChristine ChuiErin ClarkScott DiGuistiniHoney-Marie de la Giroday

Lina FarfanJordie FraserChris HansenLily KhadempourEuwing TeenYe WangGayathri Weerasuriya

Undergraduate StudentsSimon AllardTravis AllenKyle ArtymKathryn BerrySimren BrarHuang-Ju ChenTiffany ClarkeCharles CopelandJulia DamShane DoddridgePatrick GaudetAndrew HoCierra HoecherByron KnollSiew Law

Jean LinskyRosalyn Loerke Fang Yuan LuoMehvash MalikSophia McClairGenny MichielRhiannon MontgomeryMarcelo MoraBoyd MoriMike PriorTing PuAndrew SharpPatrick WelshChristina Wong