The UbiI (VisC) Aerobic Ubiquinone Synthase Is Required forExpression of Type 1 Pili, Biofilm Formation, and Pathogenesis inUropathogenic Escherichia coli

Kyle A. Floyd,a Courtney A. Mitchell,b Allison R. Eberly,a Spencer J. Colling,a Ellisa W. Zhang,a William DePas,c Matthew R. Chapman,c

Matthew Conover,d Bridget R. Rogers,b Scott J. Hultgren,d Maria Hadjifrangiskoua

Department of Pathology, Microbiology & Immunology, Vanderbilt University School of Medicine, Nashville, Tennessee, USAa; Department of Chemical and BiomolecularEngineering, Vanderbilt University, Nashville, Tennessee, USAb; Department of Molecular, Cellular & Developmental Biology, University of Michigan—Ann Arbor, AnnArbor, Michigan, USAc; Department of Molecular Microbiology & Microbial Pathogenesis, Washington University School of Medicine in Saint Louis, St. Louis, Missouri,USAd

ABSTRACT

Uropathogenic Escherichia coli (UPEC), which causes the majority of urinary tract infections (UTI), uses pilus-mediated adher-ence to initiate biofilm formation in the urinary tract. Oxygen gradients within E. coli biofilms regulate expression and localiza-tion of adhesive type 1 pili. A transposon mutant screen for strains defective in biofilm formation identified the ubiI (formerlyvisC) aerobic ubiquinone synthase gene as critical for UPEC biofilm formation. In this study, we characterized a nonpolar ubiIdeletion mutant and compared its behavior to that of wild-type bacteria grown under aerobic and anoxic conditions. Consistentwith its function as an aerobic ubiquinone-8 synthase, deletion of ubiI in UPEC resulted in reduced membrane potential, dimin-ished motility, and reduced expression of chaperone-usher pathway pili. Loss of aerobic respiration was previously shown tonegatively impact expression of type 1 pili. To determine whether this reduction in type 1 pili was due to an energy deficit, wild-type UPEC and the ubiI mutant were compared for energy-dependent phenotypes under anoxic conditions, in which quinonesynthesis is undertaken by anaerobic quinone synthases. Under anoxic conditions, the two strains exhibited wild-type levels ofmotility but produced diminished numbers of type 1 pili, suggesting that the reduction of type 1 pilus expression in the absenceof oxygen is not due to a cellular energy deficit. Acute- and chronic-infection studies in a mouse model of UTI revealed a signifi-cant virulence deficit in the ubiI mutant, indicating that UPEC encounters enough oxygen in the bladder to induce aerobicubiquinone synthesis during infection.

IMPORTANCE

The majority of urinary tract infections are caused by uropathogenic E. coli, a bacterium that can respire in the presence andabsence of oxygen. The bladder environment is hypoxic, with oxygen concentrations ranging from 4% to 7%, compared to 21%atmospheric oxygen. This work provides evidence that aerobic ubiquinone synthesis must be engaged during bladder infection,indicating that UPEC bacteria sense and use oxygen as a terminal electron acceptor in the bladder and that this ability drivesinfection potential despite the fact that UPEC is a facultative anaerobe.

The distinct characteristics of biofilms make them a particularlysignificant concern in the clinical setting. The presence of ex-

tracellular matrix retards the penetration of antibiotics and pro-vides protection from innate immune responses, including op-sonization and phagocytosis (1, 2). In addition, the presence ofenvironmental gradients within the biomass leads to community“division of labor,” with subpopulations of bacteria exhibitingdifferential gene expression in response to local nutrient and ox-ygen availability and with some cells being essentially metaboli-cally dormant (3–5).

Recent studies in uropathogenic Escherichia coli (UPEC) bio-films have revealed the stratification of at least two types of adhe-sive fibers and possibly other factors in response to oxygen gradi-ents (4). In the urinary tract, biofilm formation by UPEC can leadto catheter-associated infections, as well as prostatitis, cystitis, andpyelonephritis, in both hospitalized and nonhospitalized individ-uals (6, 7). UPEC strains can adhere to bladder and kidney cells, aswell as to catheter material, by using adhesive pili assembled by thechaperone-usher pathway (8–10). In particular, type 1 pili, en-coded by the fim operon, have been shown to be a critical biofilmdeterminant both in vitro and in vivo (11). In the bladder lumen,

UPEC bacteria use type 1 pili to engage urothelial cells and be-come internalized (9, 12–17). In this intracellular niche, UPECbacteria expand into biofilm-like intracellular bacterial commu-nities (IBCs) in the host cell cytosol; these IBCs comprise 104 to105 bacteria that are tightly packed at least in part due to expres-

Received 12 January 2016 Accepted 4 May 2016

Accepted manuscript posted online 9 May 2016

Citation Floyd KA, Mitchell CA, Eberly AR, Colling SJ, Zhang EW, DePas W,Chapman MR, Conover M, Rogers BR, Hultgren SJ, Hadjifrangiskou M. 2016. TheUbiI (VisC) aerobic ubiquinone synthase is required for expression of type 1 pili,biofilm formation, and pathogenesis in uropathogenic Escherichia coli. J Bacteriol198:2662–2672. doi:10.1128/JB.00030-16.

Editor: G. A. O’Toole, Geisel School of Medicine at Dartmouth

Address correspondence to Maria Hadjifrangiskou,maria.hadjifrangiskou@vanderbilt.edu.

K.A.F. and C.A.M. contributed equally to this work.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.00030-16.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

2662 jb.asm.org October 2016 Volume 198 Number 19Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

sion of type 1 pili (11, 18). Within the intracellular environment,these bacteria are found under oxidative stress and have beenshown to utilize nonglucose nutrient sources (19). Studies withmurine models of acute and chronic infections have demon-strated that the IBC cascade contributes to disease severity andchronicity of infection (20–22). Studies assessing human urinevoided by patients with acute urinary tract infections (UTI) dem-onstrated the formation of IBCs in humans (23), while the prev-alence of IBCs in children is predictive of future recurrences (24).

Consistent with the importance of adhesive fibers in UPECbiofilm formation, a complex regulatory network modulates ex-pression and assembly of type 1 pili, which involve several cis- andtrans-acting factors. These factors affect production of type 1 piliby controlling promoter phase variation, transcription of the fimoperon, transcript/protein stability, or assembly of the pilus ap-pendages (25–32). The fim operon is under the control of a phase-variable promoter (33), the orientation of which is determined bythe activity of FimB and FimE recombinases, as well as additionalstrain-specific recombinase enzymes (34–36). In the majority of E.coli strains, FimB is bifunctional, inverting the fim promoter DNAelement between transcription-competent (fim ON) and tran-scription-incompetent (fim OFF) states; however, FimE typicallyonly inverts the promoter to a fim OFF transcription-incompetentstate (27, 33). Several transcriptional and posttranscriptional reg-ulators influence the expression and activity of the recombinasesand therefore indirectly affect fim promoter orientation underdifferent conditions (35, 37). The opposing activities of FimB andFimE, as well as stochastic engagement of each recombinase withthe fim promoter, lead to mixed populations of bacteria thatcarry the fim promoter element in the fim ON or fim OFF statewithin the same culture (27). In addition to controlling the orien-tation of promoter DNA, transcription of the fim operon is subjectto control by other DNA binding proteins that either affect fimtranscription directly or interfere with Fim recombinase activityon the fim promoter (26, 29, 30, 32, 38–43).

Each regulator acting on the fim promoter, or downstream ofit, is controlled by different environmental signals, such as nutri-ent availability, temperature, osmolality, and oxygen tension (4,38, 40–42, 44–46). For example, human urine contains factorsthat specifically inhibit both expression and function of type 1 pili(40). Thus, planktonic growth in urine induces a phase fim OFForientation of the fim promoter, thus preventing fim expression.However, surface association via type 1 pili favors the phase fimON state, even in the presence of urine. In the context of humancolonization/infection, UPEC-host interactions take place in sev-eral oxygen gradients; in the gastrointestinal tract, where UPECcan reside as a reservoir (48), the oxygen tension can vary between3 and 60 torr (0.4% to 8.4%) depending on the location (49).Upon exit into the environment, the oxygen tension surges to 21%and then drops again significantly (to 4% to 7%) in the bladderlumen (50).

Previous reports indicated the importance of aerobic respira-tion for enterohemorrhagic E. coli colonization in the murine in-testine (51). In the case of UPEC, studies from at least two differ-ent groups have demonstrated the importance of the aerobic armof the tricarboxylic acid (TCA) cycle in the virulence potential ofUPEC during acute UTI (45, 52). Specifically, in studies evaluatingthe effects of a sensor kinase deletion in UPEC, Hadjifrangiskou etal. demonstrated that disruption of the TCA cycle resulted in adrastic reduction of type 1 pili from the surface of UPEC bacteria

(45). More recent studies demonstrated that type 1 pilus expres-sion requires the presence of oxygen (4), raising the question ofwhether repression of type 1 pili in the absence of molecular oxy-gen is the result of diminished TCA flux and, therefore, reducedATP levels.

We previously reported the creation of a transposon mutantlibrary in the cystitis isolate UTI89, which we screened in multiplein vitro biofilm settings and identified mutants with broad biofilmdefects (53). Among the factors identified was visC, the disruptionof which significantly impaired biofilm formation in vitro and invivo (53). VisC was recently described to function as a C-5 hydrox-ylase during aerobic ubiquinone synthesis and was renamed UbiI(54). In this study, we created a nonpolar ubiI (visC) deletionmutant in UPEC strain UTI89 and characterized the resultingstrain (UTI89�ubiI) based on expression of extracellular append-ages under aerobic and anoxic conditions. We found that consis-tent with its role in ubiquinone-8 synthesis under aerobic condi-tions, deletion of ubiI led to measurably lower proton motive force(PMF) across the bacterial inner membrane and conferred resis-tance to energy-dependent antibiotic uptake. Consistent withlower electron transport chain (ETC) activity, UTI89�ubiI exhib-ited slower growth and had significantly reduced motility and ex-pression of other extracellular appendages that rely on ATP-de-pendent translocation across the inner membrane under aerobicconditions.

Under anoxic growth, ubiquinone-8 is replaced by menaqui-none-8, the synthesis of which does not require UbiI (54). Underanoxic growth, the motility and expression of S pili returned towild-type (WT) levels in UTI89�ubiI, indicating that the protonmotive force generated under anoxic growth is sufficient for thesecretion and function of extracellular appendages. However, ex-pression of type 1 pili remained diminished in both the wild typeand the ubiI mutant, albeit at different levels. Together these dataindicate that under anoxic conditions, expression of type 1 pili isnot reduced merely due to lower energy potential.

Analyses of the ubiI mutant in an acute and chronic UTI modelindicated a severe fitness defect, which was not mitigated by lock-ing the promoter of type 1 pili in the fim ON orientation. Thesedata strongly suggest that in the bladder environment, bacteria areexposed to some level of oxygen and thus require aerobic ubiqui-none synthesis to establish infection.

MATERIALS AND METHODSStrains and constructs. Nonpolar deletion of the ubiI gene in strainsUTI89 and UTI89_LON was performed using � Red recombinase-medi-ated recombination as previously described (55) and the primers ubiI(visC)_KO_L (TTAACGCAGCCATTCAGGCAAATCGTTTAATCCCATTGCCTGACGAATAAGTGTAGGCTGGAGCTGCTTC) and ubiI (visC)_KO_R (ATGCAAAGTGTTGATGTAGCCATTGTTGGTGGCGGCATGGTGGGGCTGGCCATATGAATATCCTCCTTAG). Verification of ubiIdeletion was performed using primers flanking the ubiI sequence, i.e., ubiI(visC)_KO_test_L (GGAAAATCTCCCGGCGAAAA) and ubiI (visC)_KO_test_R (GCGTCACGGACAGCCTTGTA). The complementationconstruct UTI89�ubiI/pUbiI was made by cloning the ubiI gene into theSmaI-XbaI restriction sites of vector pBAD33 (56), using the followingprimers: pBAD_visC_Fwd_SmaI (TCCCCCGGGATGCAAAGTGTTGATGTAGCCATT) and pBAD_visC_Rev_XbaI (GCTCTAATTAACGCAGCCATTCAGGCAAATCG). The resulting construct was verified by se-quencing.

Biofilm assays. Strains were grown logarithmically in 3 ml lysogenybroth (LB) and normalized to an optical density at 600 nm (OD600) of 1.

Aerobic Ubiquinone Synthesis Is Required during UTI

October 2016 Volume 198 Number 19 jb.asm.org 2663Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

Cultures were then diluted 200-fold in fresh LB and used to seed biofilmplates. Biofilm assays in LB at room temperature were performed in 96-well polyvinyl chloride (PVC) plates as previously described (57) andquantitatively measured 48 h postseeding, using crystal violet (58). Col-ony biofilms were seeded on minimal medium supplemented with ferriciron to induce the rugose phenotype, as previously described (59). Imageswere taken 48 h postseeding.

Growth curves. Bacterial cultures were seeded in LB, 0.1% arabinose,20 �g/ml chloramphenicol and incubated at 37°C overnight with shaking.Aliquots of overnight cultures were subcultured in 15 ml fresh LB, 0.1%arabinose, 20 �g/ml chloramphenicol and normalized to a starting OD600

of 0.05. Subcultures were incubated at 37°C under shaking conditions. A100-�l aliquot was removed from each culture hourly and diluted in 900�l fresh LB, and the OD600 was recorded using a Thermo Scientific Nano-Drop 2000 spectrophotometer. Growth curve measurements were re-peated three times.

Motility assays. Motility assays were performed as previously de-scribed (60). Briefly, strains were stabbed in soft LB agar (0.25%) contain-ing tetrazolium chloride (and 0.1% arabinose for complementation ex-periments), and incubated at 37°C for 7 h in the presence of atmosphericoxygen. Motility was recorded as the diameter (in millimeters) containingbacteria migrating away from the inoculation point. For the assays set upunder anoxic conditions (0% O2, 2 to 3% H2), bacteria were inoculatedand incubated in an anaerobic chamber for the duration of the assay.

Analyses for type 1 pili: HA, fimS phase, and immunoblot assays.Normalized cells (OD600 � 1) in 1� phosphate-buffered saline (PBS)from cultures grown statically in LB (with 0.1% arabinose for comple-mentation experiments) for 24 h at 37°C were used for all assays. Hemag-glutination (HA) analyses were performed as described previously (61);specifically, 25 �l of cells was serially diluted 2-fold in 96-well plates con-taining PBS or PBS plus 4% mannose. Washed guinea pig red blood cellsdiluted to an OD640 of 2.4 were dispensed in the wells containing thebacterial cell dilutions and incubated at 4°C overnight. The HA titer wasrecorded as the last dilution in which agglutination of the red blood cellswas observed. Phase assays were performed as described by Struve et al.(62), utilizing primers uti8 � 4907363_phaseL (GAGAAGAAGCTTGATTTAACTAATTG) and uti8 � 4907921_phaseR (AGAGCCGCTGTAGAACTCAGG) to amplify the UTI89 fim promoter region. Amplicons weredigested with 1 U of HinfI for 5 h at 37°C, and digestion products wereresolved on a 2% agarose gel. Immunoblot assays were performed as pre-viously described (4). Briefly, 1 ml of normalized cells was pelleted andresuspended in 100 �l Laemmli sample buffer containing beta-mercap-toethanol. Samples were acidified with 1 �l 1 M HCl, boiled for 10 min at100°C, and neutralized with NaOH. Samples were then run on 16% SDS-PAGE gels and transferred to nitrocellulose membranes with the Bio-RadTrans-Blot Turbo transfer system (7-min transfer at 1.3 A and 25 V). Aftertransfer, membranes were stained with Ponceau S (Sigma-Aldrich) tovalidate equal loading and transfer to the membrane. Equal loading wasalso confirmed by staining posttransfer gels with SimplyBlue Coomassieprotein stain (Invitrogen). Membranes were blocked overnight with 5%milk in 1� Tris-buffered saline with Tween 20 (TBST), incubated withprimary anti-FimA antibody (1:5,000) (53) for 1 h, incubated with horse-radish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody(Promega) for 30 min, treated with SuperSignal West Pico chemilumines-cent substrate (Thermo Scientific), and visualized on X-ray film (MidSci).Experiments were performed at least in triplicate from independentlygrown biological replicates.

Flow cytometry and PMF measurements. Membrane potential mea-surements were performed using the BacLight kit (Invitrogen) with thefollowing modifications to the manufacturer’s instructions. Bacterial cellswere normalized in PBS to an OD600 of 0.01 (�106 CFU/ml), and 0.5 mlof the normalized bacteria was incubated with 10 mM glucose and 30 mM3,3=-diethyloxacarbocyanine iodide (DiOC2) for 30 min at 300 rpm and37°C. For the depolarizing controls, 30 mM proton ionophore CCCP(carbonyl cyanide m-chlorophenylhydrazone) was added to abolish the

membrane potential. Some reaction mixtures contained EDTA at a finalconcentration of 1 mM, which was added to every reaction mixture simul-taneously with DiOC2. DiOC2 internalization was measured as a fluores-cence emission shift from green (membrane associated) to red (cytosolic),by calculating the ratio of cells emitting at 543 nm to cells emitting at 488nm. A total of 20,000 events were measured in every experiment. Theexperiment was repeated three times.

Metabolic phenotype microarrays. Metabolic profiling was per-formed according to the Biolog guidelines (Biolog, Hayward, CA) usingplate PM1. Bacteria from LB agar plates were resuspended to an 85%transmittance into 10 ml of IF-0a GN/GP base IF (Biolog Inc.) supple-mented with niacin (10 �g/ml). Microplate PM1 was inoculated with 100�l of the bacterial suspension and incubated at 37°C for 48 h (OmniLogincubator; Biolog). Optical density measurements were obtained at 15-min intervals (OmniLog PM DC 1.30.01 software). Data analysis andkinetic plot generation were performed using OmniLog PM software. Theaverage plot height was used for data comparisons, and a difference of20 was set as the significance threshold per the manufacturer’s instruc-tions.

TEM. Samples for transmission electron microscopy (TEM) were ob-tained from cultures grown statically for 24 h in LB at 37°C. Cells werenormalized in PBS as described above for the HA assays, and samples weresubmitted to the imaging facility for fixing and imaging by TEM. Samplesfrom three independently grown cultures per strain were sampled. Thepilus enumerator was blind with respect to the identity of the sample.

Antibiotic susceptibility assays. Strains were grown to an OD600 of 1and were spread to confluence on 150-mm LB agar plates. Gentamicinand streptomycin discs (both at 10-�g potency) were applied onto theagar plates, and the plates were incubated overnight at 37°C. Zones ofclearance were recorded as diameters (in millimeters). The susceptibilityassays were repeated four times. Average zones of clearance are reported.

Quantitation of ATP levels. ATP quantitation was performed usingthe CellTiter-Glo luminescent cell viability assay (Promega). Triplicatesamples of 50 �l of each culture per time point tested were transferred toa black-well, clear-bottom, 96-well plate (Costar). An equal volume (50�l) of CellTiter-Glo substrate-buffer mix was added to each well andmixed thoroughly. The plates were allowed to shake orbitally for 2 min tostabilize the signal, and then luminescence values of ATP were determinedusing a SpectraMax i3 instrument (Molecular Devices). Luminescencewas also determined for wells filled only with LB to subtract backgroundluminescence due to the medium. A standard curve was determined usingATP disodium salt hydrate (Sigma) to allow for ATP quantification of theunknown samples. Known concentrations of ATP disodium salt hydratewere diluted in LB, and the corresponding luminescence value was re-corded (after background subtraction of LB). To quantify the amount ofATP in cell cultures at each growth phase, we matched the luminescencevalues from the standard curve created. Experiments were performed withat least three biological replicates of three technical replicates. Statisticalanalyses were performed using a one-way analysis of variance (ANOVA)with a P of 0.05 (95% confidence interval) considered significant.

qPCR analyses. Samples for RNA extraction were obtained as previ-ously described (45) from cultures grown statically for 18 h at 37°C in LB.RNA extraction was performed using the RNeasy kit (Qiagen); RNA qual-ity was checked with a Bioanalyzer, and 1 �g of RNA was treated withDNase using DNase Turbo (Life Technologies-Thermo Fisher). Subse-quent cDNA synthesis was performed as previously described (45) usingSuperScript II or III, random hexamers, and deoxynucleoside triphos-phates (dNTPs) (Life Technologies-Thermo Fisher). Quantitative PCR(qPCR) was performed using the following primer sets: (i) for sdhB, sdh-B_Forw (AGCCGGGCAAGAAGATTG) and sdhB_Rev (ACCCGTCGAGTTTTTCGCGC); (ii) for mdh, mdh_Forw (CCACCGGCTTTCGCTTCAAC) and mdh_Rev (CATTCGTTCCAACACCTTTGTTGC); (iii) forfliM, fliM_Forw (GTCGGGGCCATCCGCATTCA) and fliM_Rev (GGGTAAACTCGCGGCCTTCC); (iv) for cydA, cydA_Forw (CTATGCGTATGGAGATGGTGAGC) and cydA_Rev (CGGCAGCCATACCGAAGC

Floyd et al.

2664 jb.asm.org October 2016 Volume 198 Number 19Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

TG); (v) for fimB, fimB_ Forw (GCATGCTGAGAGCGAGTGGGTA) andfimB_Rev (CTCCAGTGACAACCCGGCATTAC); (vi) for fimE, fimE_Forw (GAGCGTGAAGCCGTGGAACG) and fimE_Rev (GGCGAGAAAGCCGACTCCCA); (vii) for rrsH, rrsH_Forw (CGTTACCCGCAGAAGAAGCAC) and rrsH_Rev (GATGCAGTTCCCAGGTTGAGC). Deter-mination of relative fold change was calculated according to Pfaffl et al.(63), using rrsH as the housekeeping gene.

Mouse infections. Seven- to 9-week-old female C3H/HeN mice (Har-lan) were used in all studies presented here. Bacteria were instilled inmouse bladders by transurethral inoculation as previously described (64)using an inoculum size of 107 CFU in 50 �l PBS. Acute- and chronic-infection experiments were performed three times, and statistical analyseswere performed using the Mann-Whitney test (two tailed). A P of 0.05was considered significant. Early infection (3 h) studies with gentamicinprotection assays were performed once with at least five mice used perbacterial strain. At 3 h postinoculation, bladders were removed from sac-rificed animals, bisected, washed three times with PBS to remove looselyadherent bacteria, and treated with 50 �g/ml gentamicin for 90 min, aspreviously described (65). At the end of the 90-min incubation, bladderswere washed and homogenized to retrieve intracellular CFU. For each setof gentamicin-treated bladders, there was an age-matched set of five un-treated controls that were used to enumerate total number of CFU. Sta-tistical analyses were performed between groups using the two-tailedMann-Whitney test, with a P of 0.05 considered significant.

RESULTSDeletion of ubiI (visC) lowers the membrane potential of UPEC.The visC gene product, UbiI, has been recently biochemicallyidentified as a critical enzyme in the aerobic biosynthetic pathwayof ubiquinone-8 (54). We previously reported that a Tn::visCtransposon mutant was significantly impaired in its biofilm-form-ing capacity during aerobic growth in three different growthmedia (53). In order to evaluate the effects of UbiI on UPECpathogenic behavior, we created a clean ubiI deletion mutant,UTI89�ubiI, by following previously published methodology(55). The resulting mutant, UTI89�ubiI, was attenuated in itsability to form biofilm in LB (Fig. 1A), exhibited an altered colonybiofilm morphotype on solid agar (Fig. 1B), and exhibited a lagduring growth in rich media under aerobic conditions (Fig. 1C),consistent with previous observations reported for Tn::visC (53).

UbiI functions as a C-5 hydroxylase during aerobic ubiqui-none biosynthesis, and its deletion in the nonpathogenic E. colistrain MG1655 resulted in reduced amounts of ubiquinone-8 un-der aerobic conditions (54). Ubiquinones are central to oxidativephosphorylation, as they are reduced by complexes I and II duringoxidation of NADH, resulting in proton translocation across the

FIG 1 Deletion of ubiI leads to reduced biofilm formation, a lag during growth in rich medium under aerobic conditions, and reduced production of ATP. (A)Graph depicting percent biofilm formation by UTI89�ubiI compared to WT UTI89 on 96-well PVC plates during aerobic growth in lysogeny broth (LB)medium. Images on the right are representative 72-h confocal laser scanning microscopy (CLSM) images of WT UTI89 and the isogenic ubiI deletion mutant.(B) Images of representative colony biofilms formed by WT UTI89 and UTI89�ubiI during growth on minimal medium agar supplemented with ferric iron. (C)Growth curves of WT UTI89 containing empty pBAD33 plasmid, UTI89�ubiI containing empty pBAD33 plasmid, and complemented UTI89�ubiI/pUbiIduring aerobic growth in LB medium induced with 0.1% arabinose. (D) ATP values for WT UTI89 and UTI89�ubiI during different phases of growth, using astandard curve plotted for ATP quantitation (see Fig. S2 in the supplemental material) using the CellTiter-Glo luminescent cell viability assay (Promega) (see alsoMaterials and Methods). The standard curve was determined using ATP disodium salt hydrate (Sigma). All experiments were repeated at least three times.Statistical analyses in panels A and D were performed by one-way ANOVA with a P of 0.05 (95% confidence interval) considered significant.

Aerobic Ubiquinone Synthesis Is Required during UTI

October 2016 Volume 198 Number 19 jb.asm.org 2665Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

membrane and the generation of a proton gradient (47, 66, 67).We thus quantified differences in the PMF produced by WTUTI89 and UTI89�ubiI using flow cytometry and the oxocarbo-cyanine dye DiOC2. Membrane-associated DiOC2 emits greenfluorescence, and it is readily detectable in all bacteria. The pres-ence of membrane potential across the inner membrane facilitatesthe import of DiOC2 into the cytosol, where fluorescence emissionshifts to red (68). Flow cytometry measurements revealed thatDiOC2 internalization by UTI89�ubiI was consistently lower thanthat of WT UTI89 (see Fig. S1A, right panel, in the supplementalmaterial).

Reduction in PMF alters the levels of energy-dependent trans-port and has been reported to enhance tolerance to several antibi-otics (69). We therefore investigated the ability of UTI89�ubiI togrow in the presence of aminoglycosides, which require energy tobe imported across the inner membrane. Compared to WTUTI89, UTI89�ubiI grew in the presence of streptomycin andgentamicin (see Fig. S1B in the supplemental material). Subse-quent quantitation of ATP levels in WT UTI89 and UTI89�ubiIduring exponential, transition, and stationary phases of growthindicated consistently lower overall ATP levels in the ubiI deletionmutant than in WT UTI89 (Fig. 1D; see Fig. S2). Combined, thesestudies validated that UPEC UbiI is involved in PMF generation,as has been proposed for E. coli K-12.

Deletion of ubiI leads to reduced production of extracellularfibers during aerobic growth. Intact membrane potential iscritical for flagellar rotation, as well as Sec-dependent translo-cation of periplasmic and membrane proteins, including thesubunits that are required for the assembly of curli andchaperone-usher pathway pili that are important componentsof UPEC biofilms (70–74). Motility assays revealed thatUTI89�ubiI was consistently significantly less motile than WT

UTI89 during aerobic growth (Fig. 2A). This motility defectwas rescued in UTI89�ubiI/pUbiI, which harbors an extrach-romosomal wild-type copy of ubiI (Fig. 2A).

Elaboration of type 1 pili on the surface of E. coli bacteria me-diates adherence to mannosylated moieties and can thus be mea-sured by quantifying the agglutination of guinea pig red bloodcells that can be competitively inhibited by the addition of man-nose (hemagglutination assay) (61). Hemagglutination assaysdemonstrated a significant reduction in the ability of UTI89�ubiIto agglutinate red blood cells, compared to that of WT UTI89 (Fig.2B). Subsequent imaging of bacteria by transmission electron mi-croscopy (TEM) revealed a greater proportion of nonpiliated bac-teria in the UTI89�ubiI population (see Fig. S3 in the supplemen-tal material). Combined, these data suggested that a reduction inPMF in UTI89�ubiI impacts the elaboration of adhesive append-ages involved in biofilm formation.

In the same hemagglutination assays used to probe for type 1pili, S pili-mediated adherence can be evaluated as “mannose-resistant” hemagglutination, since S pili bind sialylated moietiesand are not competitively inhibited by the addition of mannose(28, 53). Previous studies have demonstrated that type 1 pili and Spili are inversely regulated; reduction in type 1 pilus productionleads to upregulation of S pili (28, 53). The hemagglutinationstudies with UTI89�ubiI indicated no increase in mannose-resis-tant HA (Fig. 2B); this observation suggests that reduction of type1 pili from the bacterial cell surface does not induce the typicalupregulation of the S pilus system in the ubiI deletion mutant.Subsequent qPCR analyses probing for the abundance of sfaA (theprimary S pilus subunit) indicated a marked reduction of the sfaAtranscript level in the ubiI deletion mutant, compared to WTUTI89 (Fig. 2C).

Expression of type 1 pili and flagellar motility are also inversely

FIG 2 Deletion of ubiI decreases motility and production of adhesive chaperone-usher pathway pili. (A) Assays comparing swimming motilities in WT UTI89,UTI89�ubiI, and complemented UTI89�ubiI/pUbiI on plasmid pBAD33 during aerobic growth in LB medium induced with 0.1% arabinose in the presence ofatmospheric oxygen. Motility was recorded as the diameter (in millimeters) containing bacteria migrating away from the inoculation point. The experiment wasrepeated three times. The graph depicts average diameters from the three experiments. Pictures depict representative motility phenotypes for the three strains.ns, nonsignificant. (B) Bar graph depicting HA titers by UTI89�ubiI and WT UTI89 in the presence and absence of 4% D-mannose. The small degree ofagglutination remaining in the WT strain is attributable to some expression of S pili. The graph depicts average HA titers from four independent experiments.Statistical analyses were performed using an unpaired, two-tailed Student’s t test, with a P of 0.05 (**) considered significant. (C) Expression profiles of the geneencoding the major subunit of S pili (sfaA) and one component of the flagellar switch complex (fliM) measured as a relative fold change normalized to thehousekeeping rrsH gene and compared to normalized expression in WT UTI89. The average from at least three independent biological replicates is shown, eachwith at least three technical replicates per qPCR run. Statistical analysis was performed with one-way ANOVA for panels A and C (*, P 0.05; **, P 0.001; ***,P 0.0001).

Floyd et al.

2666 jb.asm.org October 2016 Volume 198 Number 19Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

regulated (75). Yet, the ubiI deletion mutant simultaneously ex-hibited reduced motility and pilus-mediated adherence (Fig. 2Aand B). Previous studies demonstrated that disturbances in pro-ton flux across the membrane exert negative feedback on the tran-scription of flagellar genes (71). qPCR analysis probing for steady-state transcript levels of fliM (one of the flagellar motor subunitgenes) indicated a 3-fold reduction in UTI89�ubiI compared tothat in WT UTI89 (Fig. 2C), consistent with negative regulatoryfeedback in response to lower PMF across the membrane.

Previous studies demonstrated that interference with pilus as-sembly exerts negative feedback on the expression of the fimoperon (28, 45). This negative-feedback loop leads to inversion ofthe phase-variable fim promoter to a transcription-incompetentfim OFF orientation, primarily through the action of the dedicatedFimB and FimE recombinases (27). Utilizing a previously devel-oped PCR-based method that can distinguish between the fim ONand fim OFF states of the fim promoter, we determined that theUTI89�ubiI cultures had a greater proportion of the bacteria inwhich the fimS promoter was switched fim OFF, resulting in de-creased expression of the fim operon as measured by immunoblotassays for FimA protein levels (Fig. 3A). This increase in the fimOFF population, and reduction of FimA protein levels, was re-stored in the UTI89�ubiI/pUbiI strain (Fig. 3A). Parallel qPCRanalyses probed the steady-state transcript levels of genes encod-ing the fimB and fimE recombinases using cDNA made from aer-obically grown cultures incubated under pilus-inducing condi-tions (static growth for 48 h with a passage at 24 h [28]). Theseassays showed that fimE transcript levels remained unaffected, butthe fimB steady-state transcript level was reduced 4-fold inUTI89�ubiI compared to that of WT UTI89 (Fig. 3B). These datafurther suggest that deletion of ubiI leads to negative feedback thatresults in transcriptional repression of the fim operon and that thisfeedback is likely through repression of the fimB recombinasegene.

Defects in the assembly of type 1 pili have previously beenshown to exert negative feedback on the orientation of the pro-moter of the fim gene locus (28, 76). It is possible that insufficientenergy to translocate fim subunits across the inner membrane inthe ubiI mutant exerts a similar effect on fim promoter orienta-tion. To this end, we examined levels of surface pili in a ubiI mu-tant with the fim promoter genetically locked in a transcription-competent state (UTI89�ubiI_LON) by deleting ubiI from thepreviously established UTI89_LON strain (65). TEM analyses re-vealed that the numbers of surface pili in the UTI89�ubiI_LONstrain were as low as the numbers recorded for UTI89�ubiI (seeFig. S3 in the supplemental material). These data indicate thatrestoring expression of the fim operon in the absence of UbiI doesnot restore surface piliation.

Loss of UbiI exerts a negative impact on aerobic respirationcomponents. During respiration, ubiquinone reduction is cou-pled with NADH/FADH oxidation by respiratory complexes I andII (69). A drop in ubiquinone/menaquinone levels results in de-creased oxidation of FADH/NADH, which downregulates theFADH/NADH-producing steps of the TCA cycle (see Fig. S4A inthe supplemental material and reference 69). Given the implica-tion of UbiI in aerobic ubiquinone synthesis (54), we evaluatedthe effects of ubiI deletion on the expression of the cydA gene thatencodes subunit 1 of cytochrome bd-I, the primary terminal oxi-dase during aerobic growth of E. coli (77). To evaluate effects onthe aerobic arm of the TCA cycle, genes sdhB and mdh that encodethe succinate and malate dehydrogenase enzymes, respectively,were sampled by qPCR. Transcriptional analyses were performedon samples obtained during logarithmic growth with aeration,and under these conditions, expression of the three genes wassignificantly reduced in UTI89�ubiI compared to WT UTI89 (Fig.4A). Subsequent assessment of carbon source utilization byUTI89�ubiI, using Biolog phenotypic microarrays, revealed thatUTI89�ubiI exhibited a growth advantage in wells supplementedwith fumarate or malate substrates that succeed the FADH-pro-ducing step (see Fig. S4B). Interestingly, UTI89�ubiI exhibited adramatic growth defect in the presence of dulcitol (galactitol) (seeFig. S4B), a sugar alcohol that cannot be assimilated by organismsrich in ubiquinone-6, -7, and -8 (78). In E. coli, galactitol isbrought into the cell via the galactitol-specific (IIGat) phospho-transfer system (79). Although the basis of this difference betweenWT UTI89 and UTI89�ubiI has not been investigated, it is possi-ble that reduced PMF negatively impacts the expression or func-tion of the IIGat components or that the accumulation of interme-diates in the absence of UbiI, as reported by Hajj Chehade et al.(54), negatively affects galactitol import and/or use.

Anoxic growth restores UPEC motility and expression of Spili but does not restore expression of type 1 pili. The data pre-sented thus far demonstrate that UbiI is a critical component ofproton motive force generation under aerobic respiration condi-tions requisite for ubiquinone synthesis, and its deletion signifi-cantly impairs the expression of TCA cycle genes and UPECpathogenic determinants. Recent studies also indicated that oxy-gen is required for optimal expression of type 1 pili (4). This maybe due to differences in the proton motive force produced byanaerobic quinone synthases that replace UbiI during anoxicgrowth (54). To determine whether anoxic growth leads to anoverall downregulation of extracellular fibers, we tested themotility of WT UTI89 and UTI89�ubiI and the ability to ex-press S pili under anoxic conditions. Motility assays indicated

FIG 3 The fimB recombinase is downregulated in the ubiI mutant. (A) Top,analysis of the phase state of the fimS promoter region, through PCR amplifi-cation and restriction enzyme digestion as previously reported (4). Bottom,immunoblot analysis probing for the major pilin subunit FimA in samplescorresponding to those shown above, in the fimS phase assay. (B) Expression ofgenes encoding the two primary Fim site-specific recombinases (fimB andfimE) measured as a relative fold change normalized to the housekeeping rrsHgene and compared to normalized expression in WT UTI89. The average fromat least three independent biological replicates is shown, each with at least threetechnical replicates per qPCR run. Statistical analysis was performed with one-way ANOVA (*, P 0.05; **, P 0.001; ***, P 0.0001).

Aerobic Ubiquinone Synthesis Is Required during UTI

October 2016 Volume 198 Number 19 jb.asm.org 2667Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

that UTI89�ubiI was able to swim as well as WT UTI89 underanoxic conditions (Fig. 4B), and qPCR analyses demonstratedequal sfaA transcript levels between WT UTI89 and UTI89�ubiI(Fig. 4C). These observations were consistent with the hypothesisthat UbiI is dispensable under anoxic conditions, such that theUbiI-dependent proton flux across the inner membrane no longerinfluences motility or expression of S pili.

Under anoxic conditions, both WT UTI89 and UTI89�ubiIremained defective in their ability to express type 1 pili (Fig. 4D),in agreement with our previous report, demonstrating that com-plete lack of oxygen exerts a negative impact on the expression oftype 1 pili in UPEC (4). Combined, these data suggest that thedownregulation of type 1 pili under oxygen-deplete conditions isnot due to reduced energy production during anaerobic respira-tion.

Deletion of ubiI impairs UPEC virulence in the hypoxic blad-der environment. Although UPEC is a facultative anaerobe, pre-vious studies demonstrated that TCA cycle mutants displayed asignificant fitness disadvantage compared to the isogenic WTstrains in murine models of bladder infection (45, 52). This wouldsuggest that the bladder contains enough oxygen to induce aerobicrespiration in UPEC. Given the defects associated with deletion ofubiI under aerobic conditions, we hypothesized that UTI89�ubiIwould be attenuated in a mouse model of infection if enoughoxygen is present in the bladder to induce aerobic ubiquinonesynthesis. At 6 and 16 h postinfection, UTI89�ubiI exhibited a10-fold reduction in bladder colonization (Fig. 5A) and formedvery few to no IBCs (Fig. 5B). In the murine model of infectionused for these studies, mice either resolve the infection over aperiod of 48 to 72 h or elicit an exacerbated immune response thatsuppresses urothelial regeneration and facilitates chronic coloni-zation of the bladder surface by extracellular bacterial communi-

ties (20, 21). Evaluation of bladder titers at 2 weeks postinfectionrevealed that only 4 of 36 (11.1%) mice infected with UTI89�ubiIprogressed to chronic infection, compared to 27 of 34 (79%) miceinfected with WT UTI89 (Fig. 5A).

Consistent with the persisting piliation defect of UTI89�ubiI_LON (see Fig. S3 in the supplemental material), this strainexhibited the same defects as UTI89�ubiI, demonstrating a defectin the numbers of both intracellular and luminal bacteria withinthe bladder compared to WT UTI89 (Fig. 5C). These data suggestthat during acute bladder infection, there is enough oxygen toinduce aerobic respiration within UPEC, and impairment of aer-obic ubiquinone synthesis leads to reduced virulence in a murinemodel of infection.

DISCUSSION

In this work, we demonstrate that the ubiquinone-8 synthase UbiIis critical for the appropriate generation of PMF in UPEC duringaerobic growth and that its loss impairs the expression of severalmacromolecular structures that are critical for UPEC biofilm for-mation and virulence in the urinary tract. Although E. coli is aversatile microorganism, able to respire in the presence and ab-sence of oxygen as well as in the presence of different electronacceptors, our data indicate that aerobic conditions are optimalfor expression of type 1 pili and that interfering with aerobic res-piration impairs the ability of UPEC to successfully colonize themurine urinary tract. This result indicates that the bladder en-vironment contains enough oxygen to promote aerobic respi-ration and induce optimal virulence factor production byUPEC bacteria that ascend to this organ. Indeed, studies mea-suring dissolved oxygen in the urine of patients place the oxy-gen concentration at �4% to 7% (50), which is enough toinduce aerobic ubiquinone synthesis. This explains the viru-

FIG 4 Deletion of ubiI exerts a negative effect on components of aerobic respiration but does not impact anaerobic respiration. (A) Expression profiles of threegenes involved in the TCA cycle or aerobic respiration, i.e., sdhB, mdh, and cydA, measured as relative fold changes normalized to the housekeeping rrsH gene andcompared to normalized expression in WT UTI89. The average from at least three independent biological replicates is shown, each with at least three technicalreplicates per qPCR run. Statistical analysis was performed with one-way ANOVA (*, P 0.05; **, P 0.001; ***, P 0.0001). (B) Motility assay diameters ofWT UTI89 and the �ubiI mutant under anoxic conditions. The graph is representative of at least two biological replicates, each with at least three technical repeatsper strain. Statistical analysis was performed with Student’s t test. (C) Anoxic expression profile of the gene for the major subunit of S pili, sfaA, measured asrelative fold change normalized to the housekeeping rrsH gene and compared to normalized expression in WT UTI89. A representative experiment is shown withat least three technical replicates per qPCR run. (D) Immunoblot analysis for expression of the major subunit of type 1 pili, FimA in WT UTI89 or UTI89�ubiIsamples, grown under aerobic or anoxic conditions. The immunoblot is representative of at least three biological repeats.

Floyd et al.

2668 jb.asm.org October 2016 Volume 198 Number 19Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

lence defects associated with the ubiI mutant observed here andmutants within the TCA cycle previously reported to have se-vere defects during acute UTI (45, 52).

Our studies support a model in which deletions in TCA cycle

genes or ubiquinone synthesis impairs optimal proton flux, whichcannot be transcriptionally bypassed due to the presence of thepreferred electron acceptor (oxygen) at high enough concentra-tions to prevent the exchange of aerobic to anaerobic respiration

FIG 6 Model depicting potential mechanisms leading to repression of type 1 pili in the wild-type parent and the ubiI mutant under aerobic and anoxicconditions. (Left) When oxygen is present, aerobic ubiquinone synthesis requires the UbiI enzyme for the optimal synthesis of ubiquinones and the generationof appropriate PMF to sustain transport across the inner membrane. Deletion of ubiI lowers the PMF and compromises ATP-dependent transport. This leads toreduced translocation of Fim components and negative feedback that turns the fimS promoter to the fim OFF orientation by the action of the dedicated Fimrecombinases that results in lack of fim operon transcription. This mechanism would also explain the reduction in pilus expression in previously published TCAcycle mutants. The mechanism by which the reduction in PMF is transduced to the Fim recombinase machinery or genes is still unknown. (Right) Under anoxicconditions, aerobic ubiquinone synthesis by UbiI is dispensable, due to the use of menaquinones for anaerobic respiration or use of the fermentation pathway.Under these conditions, the PMF across the inner membrane is restored, restoring ATP-dependent transport and the elaboration of macromolecular structureson the bacterial surface. However, a yet unidentified mechanism senses the lack of oxygen (or the presence of a fermentation by-product?) and somehowtransduces this information to the regulatory network that controls expression of type 1 pili. The result is decreased fim expression and thereby pili on the surfaceof the bacteria, independent of an adequate energy supply typically required for their assembly. Whether this occurs differently in the ubiI mutant remainsunknown.

FIG 5 Deletion of ubiI attenuates virulence in a murine model of UTI, independent of the fimS promoter orientation. (A) Numbers of CFU recovered from thebladders of 7- to 8-week-old female C3H/HeN mice infected with either WT UTI89 or UTI89�ubiI at stages of acute or chronic UTI. The graph depicts numbersfrom two independent experiments. (B) Intracellular bacterial community (IBC) numbers at 6 and 16 h postinfection with WT UTI89 or UTI89�ubiI. Arepresentative from two experiments is shown. (C) Gentamicin protection assay for the analysis of intracellular versus luminal bacteria. The graph indicates thenumbers of CFU recovered from bladders infected with WT UTI89, UTI89�ubiI, or UTI89�ubiI_LON at 3 h postinoculation. On the left are numbers ofintracellular CFU recovered after a 90-min incubation of bisected bladders in gentamicin to eliminate extracellular bacteria. On the right are the numbers ofluminal CFU recovered from nontreated bladders. The experiment was performed once, with five mice per strain per treatment group. Significance wasdetermined for all experiments using the two-tailed Mann-Whitney test (*, P 0.05; **, P 0.001; ***, P 0.0001.)

Aerobic Ubiquinone Synthesis Is Required during UTI

October 2016 Volume 198 Number 19 jb.asm.org 2669Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

components. Based on this model, assembly of type 1 pili is com-promised because of reduced transport of subunits across the in-ner membrane, which as a result feeds back to repress fim operontranscription (Fig. 6). Such feedback has previously been demon-strated for pilus assembly mutants such as UTI89�fimD andUTI89�fimH (28, 80). Our study and others suggest that fim re-pression occurs at the level of the fim promoter switch, via imbal-anced expression of the Fim recombinases (4, 28, 40). The mech-anism by which fimB or fimE transcription and function arecontrolled in response to changes in proton flux remains unex-plored and is a subject of further study in our laboratory. Thisphenomenon appears to be true for other macromolecular struc-tures that rely on Sec-dependent translocation or proton flux fortransport or function, since motility and production of S pili arealso compromised under reduced PMF conditions in the ubiI mu-tant.

Interestingly, under conditions of complete anoxia, when UbiIbecomes dispensable due to its replacement by anaerobic quinonesynthases or by engagement of the fermentation pathway, mostenergy-dependent deficits such as motility and production of Spili are restored. This further confirms that anaerobic respirationdoes not require UbiI and that under such conditions enoughenergy is being produced to sustain the formation of macromo-lecular structures. Despite adequate energy generation during an-aerobic respiration, production of type 1 pili remains diminishedfor both wild-type UTI89 and the UTI89�ubiI mutant. These datacorroborate previous findings that oxygen-depleted conditionsspecifically repress type 1 pili but not other macromolecular fibersformed by the chaperone-usher pathway (4). This suggests thatthe mechanism by which wild-type UPEC responds to anoxic con-ditions to repress expression of the fim operon is distinct from theproposed mechanism in which reduced overall piliation resultsfrom compromised proton flux during anaerobic growth. Pre-liminary data indicate differential effects on fimB and fimE ex-pression under anoxic conditions (K. A. Floyd, unpublished data)in WT UTI89 that are distinct from the patterns observed forUTI89�ubiI during aerobic growth. We are currently exploringsensing mechanisms that may be directly involved in sensing ox-ygen fluctuations and transducing them to regulators of FimB andFimE. We have ruled out the major respiration two-componentsystem ArcA/B in previous studies (4) and are currently exploringthe effects of Fnr and OxyR in combination with studies aimed atdelineating additional factors mediating oxygen-dependent regu-lation of type 1 pili in multiple UPEC strains. In these studies, weare continuing the analysis of the ubiI mutant as a tool to distin-guish differences between the oxygen- and PMF-responsivemechanisms that regulate expression of type 1 pili. Analyses pre-sented in Fig. 4D, which indicate that during anoxic conditions,WT UTI89 exhibits a swift repression of type 1 pili whileUTI89�ubiI appears to have consistently low levels of FimA dur-ing both conditions tested, suggest that UTI89�ubiI may be over-all less sensitive to oxygen fluctuations in the surrounding envi-ronment. Ongoing studies are investigating this possibility.

In summary, emerging research continues to shed light on theeffects of environmental gradients on the expression and functionof gene products, especially in the context of pathogenesis. E. coli,a traditional commensal of the gastrointestinal tract, is a faculta-tive anaerobe that has long been thought to thrive in the near-anoxic environment of the gut. However, recent research indi-cates that the gut comprises pockets of oxygen (51, 81) and that

loss of aerobic respiration compromises E. coli fitness in the gut(51, 81). Here we demonstrate that the same is true for uropatho-genic E. coli in the bladder environment. We have built uponprevious work demonstrating that aerobic respiration is a criticaldeterminant for fitness in the urinary tract, despite the ability of E.coli to function as a facultative anaerobe.

ACKNOWLEDGMENTS

We are grateful to members of the Hadjifrangiskou laboratory for criticalreview of the manuscript.

This work was supported by the following: a Morse-Berg fellowship(Washington University School of Medicine) and Academic ProfessionalSupport fund APS 1-040520-9211 (Vanderbilt University School of Med-icine) (to M.H.); a Vanderbilt University dissertation enhancement grant(to K.A.F.); government support under and awarded by a U.S. Depart-ment of Defense, Air Force Office of Scientific Research, National DefenseScience and Engineering Graduate (NDSEG) fellowship (grant 32 CFR168a to C.A.M.); support from a Department of Education Graduate As-sistance in Areas of National Need (GAANN) fellowship (grantP200A090323 to C.A.M.); a National Gem Consortium fellowship (toC.A.M.); funds through the Vanderbilt University School of Engineering(to B.R.R.); the NIDDK F32 DK101171-02 fellowship (to M.C.); and NIHgrants P50 DK64540-010 and R01 AI02954921 (to S.J.H.).

FUNDING INFORMATIONThis work, including the efforts of Courtney A. Mitchell, was funded byUnited States Department of Defense NDSEG fellowship (32 CFR 168a).This work, including the efforts of Courtney A. Mitchell, was funded byUS Department of Education GAANN fellowship (P200A090323). Thiswork, including the efforts of Courtney A. Mitchell, was funded by Na-tional Gem Consortium fellowship (Fellowship). This work, including theefforts of Scott J. Hultgren, was funded by HHS | NIH | National Instituteof Allergy and Infectious Diseases (NIAID) (R01 AI02954921). This work,including the efforts of Matthew Conover, was funded by HHS | NIH |National Institute of Diabetes and Digestive and Kidney Diseases(NIDDK) (F32 DK101171-02). This work, including the efforts of Scott J.Hultgren, was funded by HHS | NIH | National Institute of Diabetes andDigestive and Kidney Diseases (NIDDK) (P50 DK64540-010).

The funders had no role in study design, data collection and interpreta-tion, or the decision to submit the work for publication.

REFERENCES1. Leid JG, Willson CJ, Shirtliff ME, Hassett DJ, Parsek MR, Jeffers AK.

2005. The exopolysaccharide alginate protects Pseudomonas aeruginosabiofilm bacteria from IFN-gamma-mediated macrophage killing. J Im-munol 175:7512–7518. http://dx.doi.org/10.4049/jimmunol.175.11.7512.

2. Parsek MR, Singh PK. 2003. Bacterial biofilms: an emerging link todisease pathogenesis. Annu Rev Microbiol 57:677–701. http://dx.doi.org/10.1146/annurev.micro.57.030502.090720.

3. Domka J, Lee J, Bansal T, Wood TK. 2007. Temporal gene-expression inEscherichia coli K-12 biofilms. Environ Microbiol 9:332–346. http://dx.doi.org/10.1111/j.1462-2920.2006.01143.x.

4. Floyd KA, Moore JL, Eberly AR, Good JA, Shaffer CL, Zaver H,Almqvist F, Skaar EP, Caprioli RM, Hadjifrangiskou M. 2015. Adhesivefiber stratification in uropathogenic Escherichia coli biofilms unveils oxy-gen-mediated control of type 1 pili. PLoS Pathog 11:e1004697. http://dx.doi.org/10.1371/journal.ppat.1004697.

5. Lewis K. 2005. Persister cells and the riddle of biofilm survival. Biochem-istry (Mosc) 70:267–274. http://dx.doi.org/10.1007/s10541-005-0111-6.

6. Foxman B. 2010. The epidemiology of urinary tract infection. Nat RevUrol 7:653– 660. http://dx.doi.org/10.1038/nrurol.2010.190.

7. Griebling TL. 2007. Urologic diseases in America, vol 07-5512. NIH,Washington, DC.

8. Jacobsen SM, Stickler DJ, Mobley HL, Shirtliff ME. 2008. Complicatedcatheter-associated urinary tract infections due to Escherichia coli and Pro-teus mirabilis. Clin Microbiol Rev 21:26 –59. http://dx.doi.org/10.1128/CMR.00019-07.

Floyd et al.

2670 jb.asm.org October 2016 Volume 198 Number 19Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

9. Martinez JJ, Mulvey MA, Schilling JD, Pinkner JS, Hultgren SJ. 2000.Type 1 pilus-mediated bacterial invasion of bladder epithelial cells. EMBOJ 19:2803–2812. http://dx.doi.org/10.1093/emboj/19.12.2803.

10. Mulvey MA, Lopez-Boado YS, Wilson CL, Roth R, Parks WC, HeuserJ, Hultgren SJ. 1998. Induction and evasion of host defenses by type1-piliated uropathogenic Escherichia coli. Science 282:1494 –1497. http://dx.doi.org/10.1126/science.282.5393.1494.

11. Wright KJ, Seed PC, Hultgren SJ. 2007. Development of intracellularbacterial communities of uropathogenic Escherichia coli depends on type 1pili. Cell Microbiol 9:2230 –2241. http://dx.doi.org/10.1111/j.1462-5822.2007.00952.x.

12. Bouckaert J, Berglund J, Schembri M, De Genst E, Cools L, Wuhrer M,Hung CS, Pinkner J, Slattegard R, Zavialov A, Choudhury D, Langer-mann S, Hultgren SJ, Wyns L, Klemm P, Oscarson S, Knight SD, DeGreve H. 2005. Receptor binding studies disclose a novel class of high-affinity inhibitors of the Escherichia coli FimH adhesin. Mol Microbiol55:441– 455.

13. Eto DS, Jones TA, Sundsbak JL, Mulvey MA. 2007. Integrin-mediatedhost cell invasion by type 1-piliated uropathogenic Escherichia coli. PLoSPathog 3:e100. http://dx.doi.org/10.1371/journal.ppat.0030100.

14. Hung CS, Bouckaert J, Hung D, Pinkner J, Widberg C, DeFusco A,Auguste CG, Strouse R, Langermann S, Waksman G, Hultgren SJ. 2002.Structural basis of tropism of Escherichia coli to the bladder during urinarytract infection. Mol Microbiol 44:903–915. http://dx.doi.org/10.1046/j.1365-2958.2002.02915.x.

15. Thankavel K, Madison B, Ikeda T, Malaviya R, Shah AH, ArumugamPM, Abraham SN. 1997. Localization of a domain in the FimH adhesin ofEscherichia coli type 1 fimbriae capable of receptor recognition and use ofa domain-specific antibody to confer protection against experimental uri-nary tract infection. J Clin Invest 100:1123–1136. http://dx.doi.org/10.1172/JCI119623.

16. Thumbikat P, Berry RE, Zhou G, Billips BK, Yaggie RE, Zaichuk T, SunTT, Schaeffer AJ, Klumpp DJ. 2009. Bacteria-induced uroplakin signal-ing mediates bladder response to infection. PLoS Pathog 5:e1000415. http://dx.doi.org/10.1371/journal.ppat.1000415.

17. Zhou G, Mo WJ, Sebbel P, Min G, Neubert TA, Glockshuber R, WuXR, Sun TT, Kong XP. 2001. Uroplakin Ia is the urothelial receptor foruropathogenic Escherichia coli: evidence from in vitro FimH binding. J CellSci 114:4095– 4103.

18. Justice SS, Hung C, Theriot JA, Fletcher DA, Anderson GG, Footer MJ,Hultgren SJ. 2004. Differentiation and developmental pathways of uro-pathogenic Escherichia coli in urinary tract pathogenesis. Proc Natl AcadSci U S A 101:1333–1338. http://dx.doi.org/10.1073/pnas.0308125100.

19. Conover MS, Hadjifrangiskou M, Palermo JJ, Hibbing ME, DodsonKW, Hultgren SJ. 2016. Metabolic requirements of Escherichia coli inintracellular bacterial communities during urinary tract infection patho-genesis. mBio 7:e00104-16. http://dx.doi.org/10.1128/mBio.00104-16.

20. Hannan TJ, Mysorekar IU, Hung CS, Isaacson-Schmid ML, HultgrenSJ. 2010. Early severe inflammatory responses to uropathogenic E. colipredispose to chronic and recurrent urinary tract infection. PLoS Pathog6:e1001042. http://dx.doi.org/10.1371/journal.ppat.1001042.

21. Hannan TJ, Totsika M, Mansfield KJ, Moore KH, Schembri MA,Hultgren SJ. 2012. Host-pathogen checkpoints and population bottle-necks in persistent and intracellular uropathogenic Escherichia coli blad-der infection. FEMS Microbiol Rev 36:616 – 648. http://dx.doi.org/10.1111/j.1574-6976.2012.00339.x.

22. Schwartz DJ, Conover MS, Hannan TJ, Hultgren SJ. 2015. Uropatho-genic Escherichia coli superinfection enhances the severity of mouse blad-der infection. PLoS Pathog 11:e1004599. http://dx.doi.org/10.1371/journal.ppat.1004599.

23. Rosen DA, Hooton TM, Stamm WE, Humphrey PA, Hultgren SJ.2007. Detection of intracellular bacterial communities in human uri-nary tract infection. PLoS Med 4:e329. http://dx.doi.org/10.1371/journal.pmed.0040329.

24. Scott VC, Haake DA, Churchill BM, Justice SS, Kim JH. 2015. Intra-cellular bacterial communities: a potential etiology for chronic lower uri-nary tract symptoms. Urology 86:425– 431. http://dx.doi.org/10.1016/j.urology.2015.04.002.

25. Aberg A, Shingler V, Balsalobre C. 2008. Regulation of the fimBpromoter: a case of differential regulation by ppGpp and DksA in vivo.Mol Microbiol 67:1223–1241. http://dx.doi.org/10.1111/j.1365-2958.2008.06115.x.

26. Blumer C, Kleefeld A, Lehnen D, Heintz M, Dobrindt U, Nagy G,

Michaelis K, Emody L, Polen T, Rachel R, Wendisch VF, Unden G.2005. Regulation of type 1 fimbriae synthesis and biofilm formation by thetranscriptional regulator LrhA of Escherichia coli. Microbiology 151:3287–3298. http://dx.doi.org/10.1099/mic.0.28098-0.

27. Gally DL, Leathart J, Blomfield IC. 1996. Interaction of FimB and FimEwith the fim switch that controls the phase variation of type 1 fimbriae inEscherichia coli K-12. Mol Microbiol 21:725–738. http://dx.doi.org/10.1046/j.1365-2958.1996.311388.x.

28. Greene SE, Pinkner JS, Chorell E, Dodson KW, Shaffer CL, ConoverMS, Livny J, Hadjifrangiskou M, Almqvist F, Hultgren SJ. 2014. Pilicideec240 disrupts virulence circuits in uropathogenic Escherichia coli. mBio5:e02038. http://dx.doi.org/10.1128/mBio.02038-14.

29. Kawula TH, Orndorff PE. 1991. Rapid site-specific DNA inversion inEscherichia coli mutants lacking the histonelike protein H-NS. J Bacteriol173:4116 – 4123.

30. Müller CM, Aberg A, Straseviciene J, Emody L, Uhlin BE, Balsalobre C.2009. Type 1 fimbriae, a colonization factor of uropathogenic Escherichiacoli, are controlled by the metabolic sensor CRP-cAMP. PLoS Pathog5:e1000303. http://dx.doi.org/10.1371/journal.ppat.1000303.

31. Schwan WR, Seifert HS, Duncan JL. 1994. Analysis of the fimB promoterregion involved in type 1 pilus phase variation in Escherichia coli. Mol GenGenet 242:623– 630. http://dx.doi.org/10.1007/BF00285286.

32. van der Woude MW, Braaten BA, Low DA. 1992. Evidence for globalregulatory control of pilus expression in Escherichia coli by Lrp and DNAmethylation: model building based on analysis of pap. Mol Microbiol6:2429 –2435.

33. Abraham JM, Freitag CS, Clements JR, Eisenstein BI. 1985. An invert-ible element of DNA controls phase variation of type 1 fimbriae of Esche-richia coli. Proc Natl Acad Sci U S A 82:5724 –5727. http://dx.doi.org/10.1073/pnas.82.17.5724.

34. Bryan A, Roesch P, Davis L, Moritz R, Pellett S, Welch RA. 2006.Regulation of type 1 fimbriae by unlinked FimB- and FimE-like recombi-nases in uropathogenic Escherichia coli strain CFT073. Infect Immun 74:1072–1083. http://dx.doi.org/10.1128/IAI.74.2.1072-1083.2006.

35. Hannan TJ, Mysorekar IU, Chen SL, Walker JN, Jones JM, Pinkner JS,Hultgren SJ, Seed PC. 2008. LeuX tRNA-dependent and -independentmechanisms of Escherichia coli pathogenesis in acute cystitis. Mol Micro-biol 67:116 –128.

36. Xia Y, Gally D, Forsman-Semb K, Uhlin BE. 2000. Regulatory cross-talkbetween adhesin operons in Escherichia coli: inhibition of type 1 fimbriaeexpression by the PapB protein. EMBO J 19:1450 –1457. http://dx.doi.org/10.1093/emboj/19.7.1450.

37. Klemm P. 1986. Two regulatory fim genes, fimB and fimE, control thephase variation of type 1 fimbriae in Escherichia coli. EMBO J 5:1389 –1393.

38. Aberg A, Shingler V, Balsalobre C. 2006. (p)ppGpp regulates type 1fimbriation of Escherichia coli by modulating the expression of the site-specific recombinase FimB. Mol Microbiol 60:1520 –1533. http://dx.doi.org/10.1111/j.1365-2958.2006.05191.x.

39. Corcoran CP, Dorman CJ. 2009. DNA relaxation-dependent phase bias-ing of the fim genetic switch in Escherichia coli depends on the interplay ofH-NS, IHF and LRP. Mol Microbiol 74:1071–1082. http://dx.doi.org/10.1111/j.1365-2958.2009.06919.x.

40. Greene SE, Hibbing ME, Janetka J, Chen SL, Hultgren SJ. 2015.Human urine decreases function and expression of type 1 pili in uro-pathogenic Escherichia coli. mBio 6:e00820. http://dx.doi.org/10.1128/mBio.00820-15.

41. Kuwahara H, Myers CJ, Samoilov MS. 2010. Temperature control offimbriation circuit switch in uropathogenic Escherichia coli: quantitativeanalysis via automated model abstraction. PLoS Comput Biol 6:e1000723.http://dx.doi.org/10.1371/journal.pcbi.1000723.

42. Schwan WR. 2011. Regulation of genes in uropathogenic Escherichia coli.World J Clin Infect Dis 1:17–25. http://dx.doi.org/10.5495/wjcid.v1.i1.17.

43. Xie Y, Yao Y, Kolisnychenko V, Teng CH, Kim KS. 2006. HbiF regulatestype 1 fimbriation independently of FimB and FimE. Infect Immun 74:4039 – 4047. http://dx.doi.org/10.1128/IAI.02058-05.

44. Gally DL, Bogan JA, Eisenstein BI, Blomfield IC. 1993. Environmentalregulation of the fim switch controlling type 1 fimbrial phase variation inEscherichia coli K-12: effects of temperature and media. J Bacteriol 175:6186 – 6193.

45. Hadjifrangiskou M, Kostakioti M, Chen SL, Henderson JP, Greene SE,Hultgren SJ. 2011. A central metabolic circuit controlled by QseC in

Aerobic Ubiquinone Synthesis Is Required during UTI

October 2016 Volume 198 Number 19 jb.asm.org 2671Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

pathogenic Escherichia coli. Mol Microbiol 80:1516 –1529. http://dx.doi.org/10.1111/j.1365-2958.2011.07660.x.

46. Rouquet G, Porcheron G, Barra C, Reperant M, Chanteloup NK,Schouler C, Gilot P. 2009. A metabolic operon in extraintestinal patho-genic Escherichia coli promotes fitness under stressful conditions and in-vasion of eukaryotic cells. J Bacteriol 191:4427– 4440. http://dx.doi.org/10.1128/JB.00103-09.

47. Galkin AS, Grivennikova VG, Vinogradov AD. 1999. ¡H�/2e stoichi-ometry in NADH-quinone reductase reactions catalyzed by bovine heartsubmitochondrial particles. FEBS Lett 451:157–161. http://dx.doi.org/10.1016/S0014-5793(99)00575-X.

48. Chen SL, Wu M, Henderson JP, Hooton TM, Hibbing ME, Hultgren SJ,Gordon JI. 2013. Genomic diversity and fitness of E. coli strains recoveredfrom the intestinal and urinary tracts of women with recurrent urinarytract infection. Sci Transl Med 5:184ra60. http://dx.doi.org/10.1128/mBio.00104-16.

49. He G, Shankar RA, Chzhan M, Samouilov A, Kuppusamy P, Zweier JL.1999. Noninvasive measurement of anatomic structure and intraluminaloxygenation in the gastrointestinal tract of living mice with spatial andspectral EPR imaging. Proc Natl Acad Sci U S A 96:4586 – 4591. http://dx.doi.org/10.1073/pnas.96.8.4586.

50. Wang ZJ, Joe BN, Coakley FV, Zaharchuk G, Busse R, Yeh BM. 2008.Urinary oxygen tension measurement in humans using magnetic reso-nance imaging. Acad Radiol 15:1467–1473. http://dx.doi.org/10.1016/j.acra.2008.04.013.

51. Jones SA, Chowdhury FZ, Fabich AJ, Anderson A, Schreiner DM,House AL, Autieri SM, Leatham MP, Lins JJ, Jorgensen M, Cohen PS,Conway T. 2007. Respiration of Escherichia coli in the mouse intestine.Infect Immun 75:4891– 4899. http://dx.doi.org/10.1128/IAI.00484-07.

52. Alteri CJ, Smith SN, Mobley HL. 2009. Fitness of Escherichia coli duringurinary tract infection requires gluconeogenesis and the TCA cycle. PLoSPathog 5:e1000448. http://dx.doi.org/10.1371/journal.ppat.1000448.

53. Hadjifrangiskou M, Gu AP, Pinkner JS, Kostakioti M, Zhang EW,Greene SE, Hultgren SJ. 2012. Transposon mutagenesis identifies uro-pathogenic Escherichia coli biofilm factors. J Bacteriol 194:6195– 6205.http://dx.doi.org/10.1128/JB.01012-12.

54. Hajj Chehade M, Loiseau L, Lombard M, Pecqueur L, Ismail A, SmadjaM, Golinelli-Pimpaneau B, Mellot-Draznieks C, Hamelin O, Aussel L,Kieffer-Jaquinod S, Labessan N, Barras F, Fontecave M, Pierrel F. 2013.ubiI, a new gene in Escherichia coli coenzyme Q biosynthesis, is involved inaerobic C5-hydroxylation. J Biol Chem 288:20085–20092. http://dx.doi.org/10.1074/jbc.M113.480368.

55. Murphy KC, Campellone KG. 2003. Lambda Red-mediated recombino-genic engineering of enterohemorrhagic and enteropathogenic E. coli.BMC Mol Biol 4:11. http://dx.doi.org/10.1186/1471-2199-4-11.

56. Kostakioti M, Hadjifrangiskou M, Pinkner JS, Hultgren SJ. 2009. QseC-mediated dephosphorylation of QseB is required for expression of genesassociated with virulence in uropathogenic Escherichia coli. Mol Microbiol73:1020 –1031. http://dx.doi.org/10.1111/j.1365-2958.2009.06826.x.

57. Pinkner JS, Remaut H, Buelens F, Miller E, Aberg V, Pemberton N,Hedenstrom M, Larsson A, Seed P, Waksman G, Hultgren SJ, AlmqvistF. 2006. Rationally designed small compounds inhibit pilus biogenesis inuropathogenic bacteria. Proc Natl Acad Sci U S A 103:17897–17902. http://dx.doi.org/10.1073/pnas.0606795103.

58. O’Toole GA, Pratt LA, Watnick PI, Newman DK, Weaver VB, Kolter R.1999. Genetic approaches to study of biofilms. Methods Enzymol 310:91–109. http://dx.doi.org/10.1016/S0076-6879(99)10008-9.

59. DePas WH, Hufnagel DA, Lee JS, Blanco LP, Bernstein HC, Fisher ST,James GA, Stewart PS, Chapman MR. 2013. Iron induces bimodal pop-ulation development by Escherichia coli. Proc Natl Acad Sci U S A 110:2629 –2634. http://dx.doi.org/10.1073/pnas.1218703110.

60. Wright KJ, Seed PC, Hultgren SJ. 2005. Uropathogenic Escherichia coliflagella aid in efficient urinary tract colonization. Infect Immun 73:7657–7668. http://dx.doi.org/10.1128/IAI.73.11.7657-7668.2005.

61. Hultgren SJ, Schwan WR, Schaeffer AJ, Duncan JL. 1986. Regulation ofproduction of type 1 pili among urinary tract isolates of Escherichia coli.Infect Immun 54:613– 620.

62. Struve C, Krogfelt KA. 1999. In vivo detection of Escherichia coli type 1

fimbrial expression and phase variation during experimental urinarytract infection. Microbiology 145:2683–2690. http://dx.doi.org/10.1099/00221287-145-10-2683.

63. Pfaffl MW. 2001. A new mathematical model for relative quantification inreal-time RT-PCR. Nucleic Acids Res 29:e45. http://dx.doi.org/10.1093/nar/29.9.e45.

64. Hung CS, Dodson KW, Hultgren SJ. 2009. A murine model of urinarytract infection. Nat Protoc 4:1230 –1243. http://dx.doi.org/10.1038/nprot.2009.116.

65. Pallesen L, Madsen O, Klemm P. 1989. Regulation of the phase switchcontrolling expression of type 1 fimbriae in Escherichia coli. Mol Microbiol3:925–931. http://dx.doi.org/10.1111/j.1365-2958.1989.tb00242.x.

66. Brown GC, Brand MD. 1988. Proton/electron stoichiometry of mito-chondrial complex I estimated from the equilibrium thermodynamicforce ratio. Biochem J 252:473– 479. http://dx.doi.org/10.1042/bj2520473.

67. Pozzan T, Di Virgilio F, Bragadin M, Miconi V, Azzone GF. 1979.H�/site, charge/site, and ATP/site ratios in mitochondrial electron trans-port. Proc Natl Acad Sci U S A 76:2123–2127. http://dx.doi.org/10.1073/pnas.76.5.2123.

68. Breeuwer P, Tjakko A. 2004. Assessment of the membrane potential,intracellular pH and respiration of bacteria employing fluorescence tech-niques, 2nd ed, vol 8.01. Kluwer Academic Publishers, Dordrecht, TheNetherlands.

69. Damper PD, Epstein W. 1981. Role of the membrane potential in bacte-rial resistance to aminoglycoside antibiotics. Antimicrob Agents Che-mother 20:803– 808. http://dx.doi.org/10.1128/AAC.20.6.803.

70. Driessen AJ. 1992. Precursor protein translocation by the Escherichia colitranslocase is directed by the protonmotive force. EMBO J 11:847– 853.

71. Maurer LM, Yohannes E, Bondurant SS, Radmacher M, Slonczewski JL.2005. pH regulates genes for flagellar motility, catabolism, and oxidativestress in Escherichia coli K-12. J Bacteriol 187:304 –319. http://dx.doi.org/10.1128/JB.187.1.304-319.2005.

72. Minamino T, Namba K. 2008. Distinct roles of the FliI ATPase andproton motive force in bacterial flagellar protein export. Nature 451:485–488. http://dx.doi.org/10.1038/nature06449.

73. Paul K, Erhardt M, Hirano T, Blair DF, Hughes KT. 2008. Energy sourceof flagellar type III secretion. Nature 451:489 – 492. http://dx.doi.org/10.1038/nature06497.

74. Sowa Y, Rowe AD, Leake MC, Yakushi T, Homma M, Ishijima A, BerryRM. 2005. Direct observation of steps in rotation of the bacterial flagellarmotor. Nature 437:916 –919. http://dx.doi.org/10.1038/nature04003.

75. Lane MC, Alteri CJ, Smith SN, Mobley HL. 2007. Expression of flagellais coincident with uropathogenic Escherichia coli ascension to the upperurinary tract. Proc Natl Acad Sci U S A 104:16669 –16674. http://dx.doi.org/10.1073/pnas.0607898104.

76. Chen SL, Hung CS, Pinkner JS, Walker JN, Cusumano CK, Li Z,Bouckaert J, Gordon JI, Hultgren SJ. 2009. Positive selection identifiesan in vivo role for FimH during urinary tract infection in addition tomannose binding. Proc Natl Acad Sci U S A 106:22439 –22444. http://dx.doi.org/10.1073/pnas.0902179106.

77. Miller MJ, Gennis RB. 1983. The purification and characterization of thecytochrome d terminal oxidase complex of the Escherichia coli aerobicrespiratory chain. J Biol Chem 258:9159 –9165.

78. Bergey DH, Rooney DR. 2009. Bergey’s manual of systematic bacteriol-ogy, 2nd ed, vol 3.

79. Nobelmann B, Lengeler JW. 1996. Molecular analysis of the gat genesfrom Escherichia coli and of their roles in galactitol transport and metab-olism. J Bacteriol 178:6790 – 6795.

80. Chen SL, Hung CS, Xu J, Reigstad CS, Magrini V, Sabo A, Blasiar D, BieriT, Meyer RR, Ozersky P, Armstrong JR, Fulton RS, Latreille JP, Spieth J,Hooton TM, Mardis ER, Hultgren SJ, Gordon JI. 2006. Identification ofgenes subject to positive selection in uropathogenic strains of Escherichia coli:a comparative genomics approach. Proc Natl Acad Sci U S A 103:5977–5982.http://dx.doi.org/10.1073/pnas.0600938103.

81. Jones SA, Gibson T, Maltby RC, Chowdhury FZ, Stewart V, Cohen PS,Conway T. 2011. Anaerobic respiration of Escherichia coli in the mouseintestine. Infect Immun 79:4218 – 4226. http://dx.doi.org/10.1128/IAI.05395-11.

Floyd et al.

2672 jb.asm.org October 2016 Volume 198 Number 19Journal of Bacteriology

on October 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from