thinking about performance€¦ · “premature optimization is the root of all evil” “we...
TRANSCRIPT
![Page 1: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/1.jpg)
Thinking about performance
![Page 2: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/2.jpg)
Search: a case study
![Page 3: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/3.jpg)
Perf: speed/power/etc.
![Page 4: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/4.jpg)
Perf: why do we care?
![Page 5: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/5.jpg)
“Premature optimization is the root of all evil”
![Page 6: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/6.jpg)
“We should forget about small efficiencies, say about 97% of
the time”
![Page 7: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/7.jpg)
Different designs:100x - 1000x perf difference
![Page 8: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/8.jpg)
![Page 9: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/9.jpg)
“Coding feels like real work”
![Page 10: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/10.jpg)
Whiteboard: 1h/iterationImplementation: 2yr/iteration
![Page 11: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/11.jpg)
Scale(precursor to perf discussion)
![Page 12: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/12.jpg)
10k; 10M; 10G(5kB per doc)
![Page 13: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/13.jpg)
What’s the actual problem?
![Page 14: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/14.jpg)
AND queries
![Page 15: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/15.jpg)
10k; 10M; 10G(5kB per doc)
10k
![Page 16: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/16.jpg)
One person’s emailOne forum
10k
![Page 17: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/17.jpg)
5kB * 10k = 50MB
10k
![Page 18: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/18.jpg)
50MB is small!
10k
![Page 19: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/19.jpg)
$50 phone => 1GB RAM
10k
![Page 20: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/20.jpg)
Naive algorithm
for loop over all documents {
for loop over terms in document {
// matching logic here.
}
}
10k
![Page 21: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/21.jpg)
10k; 10M; 10G(5kB per doc)
10M
![Page 22: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/22.jpg)
~Wikipedia sized
10M
![Page 23: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/23.jpg)
5kB * 10M = 50GB
10M
![Page 24: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/24.jpg)
$2000 for 128GB server(Broadwell single socket Xeon-D)
10M
![Page 25: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/25.jpg)
25 GB/s memory bandwidth
10M
![Page 26: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/26.jpg)
50GB / 25 GB/s = 2s(½ query per sec (QPS))
10M
![Page 27: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/27.jpg)
Is 2s latency ok?
10M
![Page 28: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/28.jpg)
Is 1/2 QPS ok?
10M
![Page 29: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/29.jpg)
Larger service
Latency == $$$
10M
![Page 30: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/30.jpg)
Latency == $$$
http://assets.en.oreilly.com/1/event/29/Keynote%20Presentation%202.pdf
http://www.bizreport.com/2016/08/mobify-report-reveals-impact-of-mobile-website-speed.html
http://assets.en.oreilly.com/1/event/29/The%20User%20and%20Business%20Impact%20of%20Server%20Delays,%20Additional%20Bytes,%20and%20HTTP%20Chunking%20in%20Web%20Search%20Presentation.pptx
http://assets.en.oreilly.com/1/event/27/Varnish%20-%20A%20State%20of%20the%20Art%20High-Performance%20Reverse%20Proxy%20Presentation.pdf
10M
![Page 31: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/31.jpg)
Google: 400ms extra latency
0.44% decrease in searches per user
10M
![Page 32: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/32.jpg)
Google: 400ms extra latency
0.44% decrease in searches per user
0.76% after six weeks
10M
![Page 33: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/33.jpg)
Google: 400ms extra latency
0.44% decrease in searches per user
0.76% after six weeks
0.21% decrease after delay removed
10M
![Page 34: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/34.jpg)
Bing
10M
![Page 35: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/35.jpg)
Mobify
100ms home load => 1.11% delta in conversions
10M
![Page 36: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/36.jpg)
Mobify
100ms home load => 1.11% delta in conversions
100ms checkout page speed => 1.55% delta in
conversions
10M
![Page 37: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/37.jpg)
10M
![Page 38: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/38.jpg)
To hit 500ms round trip...
10M
![Page 39: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/39.jpg)
...budget ~10ms for search
10M
![Page 40: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/40.jpg)
Larger service
Latency == $$$
Need to handle more than ½ QPS
10M
![Page 41: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/41.jpg)
Use an index?
Salton; The SMART Retrieval System (1971); work originally done in early 60s10M
![Page 42: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/42.jpg)
30 - 30,000 QPS(we’ll talk about figuring this out later)
http://www.anandtech.com/show/9185/intel-xeon-d-review-performance-per-watt-server-soc-champion/14
Haque et al.; Few-to-Many: Incremental Parallelism for Reducing Tail Latency in Interactive Services (ASPLOS, 2015)
10M
![Page 43: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/43.jpg)
10k; 10M; 10G;(5kB per doc)
10B
![Page 44: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/44.jpg)
5kB * 10G = 50TB
10B
![Page 45: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/45.jpg)
Horizontal scaling(use more machines)
10B
![Page 46: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/46.jpg)
Easy to scale(different docuemnts on different machines)
10B
![Page 47: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/47.jpg)
Horizontal scaling
10G docs / (10M docs / machine) = 1k machines
10B
![Page 48: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/48.jpg)
Redmond-Dresden: 150ms
10B
![Page 49: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/49.jpg)
Horizontal scaling
10G docs / (10M docs / machine) = 1k machines
1k machines * 10 clusters = 10k machines
10B
![Page 50: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/50.jpg)
“[With 1800 machines, in one year], it’s typical that 1,000 individual machine failures will occur; thousands of hard drive
failures will occur; one power distribution unit will fail, bringing down 500 to 1,000 machines for about 6 hours; 20 racks will fail,
each time causing 40 to 80 machines to vanish from the network; 5 racks will “go wonky,” with half their network packets missing in action; and the cluster will have to be rewired once, affecting 5
percent of the machines at any given moment over a 2-day span”
10B
![Page 51: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/51.jpg)
Horizontal scaling
10G docs / (10M docs / machine) = 1k machines
1k machines * 10 clusters = 10k machines
10k machines * 3 redundancy = 30k machines
10B
![Page 52: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/52.jpg)
Horizontal scaling
10G docs / (10M docs / machine) = 1k machines
1k machines * 10 clusters = 10k machines
10k machines * 3 redundancy = 30k machines
30k machines * $1k/yr/machine = $30M / yr
10B
![Page 53: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/53.jpg)
2x perf: $15m/yr
10B
![Page 54: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/54.jpg)
2% perf: $600k/yr
10B
![Page 55: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/55.jpg)
Horizontal scaling
10G docs / (10M docs / machine) = 1k machines
1k machines * 10 clusters = 10k machines
10k machines * 3 redundancy = 30k machines
30k machines * $1k/yr/machine = $30M / yr
Machine time vs. dev time10B
![Page 56: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/56.jpg)
Search Algorithms
![Page 57: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/57.jpg)
What’s the problem again?
Algorithms
![Page 58: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/58.jpg)
Posting list
Algorithms: posting list
![Page 60: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/60.jpg)
HashMap[term] => list[docs]
Algorithms: posting list
![Page 61: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/61.jpg)
Bloom filter
Algorithms: bloom filter
![Page 62: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/62.jpg)
BitFunnel
Algorithms: bloom filter
![Page 63: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/63.jpg)
What about an array?
Algorithms: bloom filter
![Page 64: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/64.jpg)
![Page 65: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/65.jpg)
How many terms?
Algorithms: bloom filter
![Page 66: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/66.jpg)
Algorithms: bloom filter
![Page 67: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/67.jpg)
One site has 37B primes
Algorithms: bloom filter
![Page 68: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/68.jpg)
GUIDs, timestamps, DNA, etc.
Algorithms: bloom filter
![Page 69: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/69.jpg)
Why index that stuff?
Algorithms: bloom filter
![Page 70: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/70.jpg)
GTGACCTTGGGCAAGTTACTTAACCTCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGGGATAATA
Algorithms: bloom filter
![Page 71: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/71.jpg)
![Page 72: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/72.jpg)
Most terms aren’t in most docs => use hashing
Algorithms: bloom filter
![Page 73: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/73.jpg)
Bloom Filters
Algorithms: bloom filter
![Page 74: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/74.jpg)
![Page 75: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/75.jpg)
![Page 76: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/76.jpg)
![Page 77: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/77.jpg)
![Page 78: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/78.jpg)
Probability of false positive?
Algorithms: bloom filter
![Page 79: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/79.jpg)
(assume 10% bit density)
1 location: .1 = 10% false positive rate
Algorithms: bloom filter
![Page 80: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/80.jpg)
(assume 10% bit density)
1 location: .1 = 10% false positive rate
2 locations: .1 * .1 = 1% false positive rate
Algorithms: bloom filter
![Page 81: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/81.jpg)
(assume 10% bit density)
1 location: .1 = 10% false positive rate
2 locations: .1 * .1 = 1% false positive rate
3 locations: .1 * .1 * .1 = 0.1% false positive rate
Algorithms: bloom filter
![Page 82: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/82.jpg)
Linear costExponential benefit
Algorithms: bloom filter
![Page 83: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/83.jpg)
Multiple DocumentsMultiple Bloom Filters
Algorithms: bloom filter
![Page 84: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/84.jpg)
![Page 85: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/85.jpg)
Do comparisons in parallel!
Algorithms: bloom filter
![Page 86: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/86.jpg)
![Page 87: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/87.jpg)
Algorithms: bloom filter
![Page 88: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/88.jpg)
Algorithms: bloom filter
![Page 89: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/89.jpg)
Algorithms: bloom filter
![Page 90: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/90.jpg)
Algorithms: bloom filterAlgorithms: bloom filter
![Page 91: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/91.jpg)
Algorithms: bloom filter
![Page 92: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/92.jpg)
![Page 93: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/93.jpg)
![Page 94: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/94.jpg)
Algorithms: bloom filter
![Page 95: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/95.jpg)
Algorithms: bloom filter
![Page 96: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/96.jpg)
How do we estimate perf?
![Page 97: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/97.jpg)
Cost modelNumber of operations
Perf estimation
![Page 98: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/98.jpg)
512-bit “blocks”(pay for memory accesses)
Perf estimation
![Page 99: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/99.jpg)
How many memory accesses per block?
Perf estimation
![Page 100: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/100.jpg)
http://bitfunnel.org
Perf estimation
![Page 101: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/101.jpg)
Perf estimation
![Page 102: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/102.jpg)
![Page 103: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/103.jpg)
Why do we have so many rows?
Term rewriting
Perf estimation
![Page 104: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/104.jpg)
Term Rewriting
“Large yellow dog”
Perf estimation
![Page 105: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/105.jpg)
Term Rewriting
“Large yellow dog” ||
“Golden Retriever”
Perf estimation
![Page 106: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/106.jpg)
Term Rewriting
“Large yellow dog” ||
“Golden Retriever” ||
“Old Yeller” ||
Perf estimation
![Page 107: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/107.jpg)
![Page 108: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/108.jpg)
Expected performance?
Perf estimation
![Page 109: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/109.jpg)
10 M docs / 512 bits per block = 20k “blocks”
Perf estimation
![Page 110: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/110.jpg)
10 M docs / 512 bits per block = 20k “blocks”
20 k-blocks * 5 transfers per block = 100 kT
Perf estimation
![Page 111: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/111.jpg)
10 M docs / 512 bits per block = 20k “blocks”
20 k-blocks * 5 transfers per block = 100 kT
25 GB/s / 512 bits per transfer = 390 MT/s
Perf estimation
![Page 112: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/112.jpg)
10 M docs / 512 bits per block = 20k “blocks”
20 k-blocks * 5 transfers per block = 100 kT
25 GB/s / 512 bits per transfer = 390 MT/s
390 MT/s / 100 kT = 3900 QPS (with rounding)
Perf estimation
![Page 113: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/113.jpg)
Actual performance?
Perf estimation
![Page 114: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/114.jpg)
Actual performance ~similar
Perf estimation
![Page 115: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/115.jpg)
Small factors
Perf estimation
![Page 116: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/116.jpg)
Large factors
Perf estimation
![Page 117: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/117.jpg)
Ranking results
Perf estimation
![Page 118: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/118.jpg)
Ingestion(faster than querying)
Perf estimation
![Page 119: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/119.jpg)
Ingestion is just setting bits
Perf estimation
![Page 120: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/120.jpg)
Hierarchical bloom filters
Perf estimation
![Page 121: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/121.jpg)
Complicating issues?
Perf estimation
![Page 122: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/122.jpg)
![Page 123: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/123.jpg)
Conclusions?
![Page 124: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/124.jpg)
False conclusions
Search is simple
![Page 125: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/125.jpg)
False conclusions
Search is simple
Bloom filters are better than posting lists
Zobel et al., Inverted files versus signature files for text indexing; TODS 1998
![Page 126: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/126.jpg)
False conclusions
Search is simple
Bloom filters are better than posting lists
You can easily reason about all performance
Zobel et al., Inverted files versus signature files for text indexing; TODS 1998
![Page 127: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/127.jpg)
Conclusions!
![Page 128: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/128.jpg)
You can reason about perf
![Page 129: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/129.jpg)
It’s often just arithmetic
![Page 130: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/130.jpg)
Acknowledgements
Thanks to Leah Hanson, Mike Hopcroft, Julia Evans, Hari Angepat,
David Turner, Danielle Sucher, Ikhwan Lee, Tejas Sapre, Raul Jara,
Rich Ercolani, Bert Muthalaly, Harsha Nori, Jeshua Smith, Bill
Barnes, Gary Bernhardt, Marek Majkowski, Tom Crayford, Gina
Willard, Laura Lindzey, Larry Marbuger, Siddarth Anand, Eric
Lemmon, Tom Ballinger, and [Anonymous Reviewer] for feedback.
![Page 131: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/131.jpg)
bitfunnel.org/strangeloop
github.com/bitfunnel/bitfunnel
danluu.com
![Page 132: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/132.jpg)
Unused slides(thar be dragons)
![Page 133: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/133.jpg)
SLIDE FOR HOMEWORK. TODO: USE DIFFERENT TEMPLATE
![Page 134: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/134.jpg)
Why are posting lists standard?
![Page 135: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/135.jpg)
Literature on alternatives
“Signatures files were proposed in [23] and shown to be inferior to inverted indexing in [24]. “
“ Inverted indexes have been benchmarked as the most generalisable, and well performing structure (Zobel et al., 1998). The experiments in this
thesis are therefore conducted solely on an inverted index system.”
“While this technique provides a relatively low computation overhead, studies by Zobel et al. [1998] have shown that inverted files significantly
outperform signature files. We will now focus the analysis on inverted files as it is generally considered to be the most efficient indexing method
for most IR systems.”
“The other two mechanisms are usually adopted in certain applications even if, recently, they have been mostly abandoned in favor of inverted
indexes because some extensive experimental results [194] have shown that: Inverted indexes offer better performance than signature files and
bitmaps, in terms of both size of index and speed of query handling [188]”
“Zobel et al. [16] compared inverted files and signature files with respect to query response time and space requirements. They found that the
inverted files evaluated queries in less time than the signature files and needed less space. Their results showed that the signature files were
much larger, more expensive to construct and update, their response time was unpredictable, they support ranked queries only with difficulty,
they did not scale well and they were slow“
![Page 136: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/136.jpg)
Zobel et al., actual quotes
“Inverted file indexes with in-memory search structures require no more disk accesses to
answer a conjunctive query than do bitsliced signature files.”
“One of the difficulties in the comparison of inverted files and signature files is that many
variants of signature file techniques have been proposed, and it is possible that some
combination of parameters and variants will result in a better method.”
![Page 137: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/137.jpg)
Citations are lossy
![Page 138: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/138.jpg)
![Page 139: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/139.jpg)
![Page 140: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/140.jpg)
![Page 141: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/141.jpg)
![Page 142: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/142.jpg)
![Page 143: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/143.jpg)
![Page 144: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/144.jpg)
![Page 145: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/145.jpg)
![Page 146: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/146.jpg)
![Page 147: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/147.jpg)
![Page 148: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/148.jpg)
![Page 149: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/149.jpg)
Search: why do we care?
![Page 150: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/150.jpg)
$20M/yr * 2% savings =
$400k/yr
![Page 151: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/151.jpg)
How things fit together
![Page 152: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/152.jpg)
TODO: add diagram
![Page 153: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/153.jpg)
Posting list
![Page 154: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/154.jpg)
![Page 155: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/155.jpg)
![Page 156: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/156.jpg)
![Page 157: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/157.jpg)
How many terms?
![Page 158: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/158.jpg)
TODO: pseudo-code
TODO: diagram about how bits drop out
TODO: search is a high dynamic range problem.
TODO: higher rank rows
TODO: sharding by document length
TODO: diagram of how things fit together. Could just be concentric circles
![Page 159: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/159.jpg)
Posting lists are standard
![Page 160: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/160.jpg)
Posting list optimizations
Skip list
Delta compression
etc.
![Page 161: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/161.jpg)
Search
![Page 162: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/162.jpg)
Perf: how to think about it?
![Page 163: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/163.jpg)
Performance
![Page 164: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/164.jpg)
Search is BIG
![Page 165: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/165.jpg)
Parsing / TokenizationHarder than it sounds
![Page 166: Thinking about performance€¦ · “Premature optimization is the root of all evil” “We should forget about small efficiencies, say about 97% of the time” Different designs:](https://reader036.vdocument.in/reader036/viewer/2022081405/5f0b28ab7e708231d42f236e/html5/thumbnails/166.jpg)
Search is a big problem
Tokenization
Some languages mix alphabets, are partially left-to-right and right-to-left, etc.
Can’t drop non-alphanumeric characters (C# vs C++)
Multi-language queries
Ranking / Relevance
Distributed Systems
etc.