thyroid hormone, metabolism and the brain...pathway, is catalysed by both d1 and d3 (3). thyroidal...

Thyroid Hormone, Metabolism and the Brain

Lars P. Klieverik

proefschrift Klieverik.indb 1 4-8-2009 15:22:17

ColofonThyroid hormone, metabolism and the brain.

Proefschrift, Universiteit van Amsterdam, Nederland

ISBN: 978-90-9024541-6

© 2009, Lars Peter Klieverik, Amsterdam

Cover en lay-out: Chris Bor, Medische fotografie en illustratie,

Academisch Medisch Centrum, Amsterdam

Drukkerij: Buijten & Schipperheijn, Amsterdam

De uitgave van dit proefschrift werd mede mogelijk gemaakt door steun van:

Diabetes Fonds, Ferring pharmaceuticals, GlaxoSmithKline, Goodlife health care, Ipsen Farmaceutica,

Novartis Pharma, Novo Nordisk, Pfizer, Sandoz, Sanovi aventis en de Universiteit van Amsterdam.


Thyroid Hormone, Metabolism and the Brain

Academisch proefschrift

Ter verkrijging van de graad van doctor

aan de Universiteit van Amsterdam

op gezag van de Rector Magnificus

Prof. Dr. D.C. van den Boom

ten overstaan van een door het college voor promoties ingestelde commissie,

in het openbaar te verdedigen verdedigen in de Agnietenkapel

op 17 september 2009, te 10:00 uur

door

Lars Peter Klieverik

Geboren te Hengelo (Overijssel), Nederland


Promotiecommissie

Promotores: Prof. dr. E. Fliers

Prof. dr. H.P. Sauerwein

Co-promotores: Dr. A. Kalsbeek

Dr. ir. M.T. Ackermans

Overige leden: Prof. dr. R.M. Buijs

Prof. dr. M.M. Levi

Prof. dr. R.P.J. Oude Elferink

Prof. dr. J.A. Romijn

Prof. dr. ir. T.J.Visser

Prof. dr. W.M. Wiersinga

Faculteit der Geneeskunde


voor mijn ouders


Chapter 1 General Introduction 9

1.1 Thyroid Hormone (TH) 11

1.2 TH and the central nervous system 11

1.3 a Metabolic alterations during thyrotoxicosis 13

b Dynamic measurement of metabolic fluxes 14

1.4 Hypothalamic regulation of glucose metabolism 15

1.5 Thyronamines; metabolic effects of rapidly acting TH analogues 18

1.6 General hypothesis 18

1.7 Thesis outline 19

Chapter 2 Thyroid hormone effects on whole body energy homeostasis and tissue-specific fatty acid uptake in vivo.Submitted

27

Chapter 3 Effects of thyrotoxicosis and selective hepatic autonomic denervation on glucose metabolism in rats.American Journal of Physiology; Endocrinology and Metabolism 2008: 294, E513-520.

47

Chapter 4 Thyroid hormone modulates glucose production via a sympathetic pathway from the hypothalamic paraventricular nucleus to the liver.Proceedings of the National Academy of Sciences of the United States of America 2009: 106(14), 5966-5971.

63

Chapter 5 Effects of systemic and intracerebroventricular administration of 3-iodothyronamine (T1AM) and thyronamine (T0AM) on glucose metabolism in rats.Journal of Endocrinology 2009: 201(3), 377-386

79

Chapter 6 Endocrine determinants of changes in energy expenditure and body weight after cessation of anti-thyroid drugs in euthyroid patients treated for Graves’ hyperthyroidism.Submitted

97

Chapter 7 General discussion 109

7.1 Historical perspective

7.2 Biological relevance

7.3 A new role for the hypothalamus in sensing hormonal signals and modulating autonomic output; involvement of TH

7.4 Potential clinical relevance

Table of contents


Chapter 8 English summary 123

Nederlandse samenvatting 129

Author affiliations 133

Dankwoord 135

Biography 139


General Introduction

1


1.1 Thyroid HormoneFirst isolated in 1914 by Kendall (1), and first synthesized in 1925 by Harrington (2) thyroxine (T4)

is a classic hormone that is used worldwide to treat millions of patients with thyroid disorders.

During the past decades much progress has been made in the understanding of thyroid hormone

(TH) physiology and a substantial part of TH biology has been elucidated. T4 is the main secretory

product of the thyroid gland. In humans, it comprises ~80% of the THs secreted, the remaining

~20% being secreted as triiodothyronine (T3). T4 has only limited affinity for the nuclear thyroid

hormone receptors (TRs) as compared with T3, which is regarded the primary biologically active

form. In order to become bio-active, T4 has to be converted to T3 by outer-ring deiodination.

Furthermore, both T4 and T3 can be inactivated by inner-ring deiodination. These reactions are

catalysed by the iodothyronine deiodinases type 1, 2 and 3 (D1, D2 and D3), that are expressed

in a multitude of peripheral tissues, each deiodinase with its specific tissue distribution. Outer

ring deiodination, i.e. the activating pathway, is catalysed by D1 and D2. Inner ring deiodination

of T4 and T3 to lower iodothyronines that have no affinity for the TRs, i.e. the inactivating

pathway, is catalysed by both D1 and D3 (3).

Thyroidal TH secretion is regulated via a classical central negative feedback mechanism.

Thyrotropin-releasing hormone (TRH) is synthesized by neurons in the paraventricular nucleus

(PVN) of the hypothalamus and reaches the anterior pituitary via the median eminence and

the portal system. In the anterior pituitary TRH stimulates the secretion of thyroid stimulating

hormone (TSH or thyrotropin) from the thyrotropes. TSH is the major factor stimulating thyroid

hormone synthesis and secretion by the thyroid gland. In turn, both circulating T3 and T4 exert

an inhibitory effect on the release of TRH and TSH from the hypothalamus and the pituitary,

respectively.

The nuclear thyroid hormone receptors (TR) are products of the TRα and TRβ genes. These

receptors are members of the ligand-dependent transcription modulator family. This implies that

upon intra-nuclear binding of T3 to a TR and via interaction with several co-factors, the complex

binds to a thyroid hormone responsive element (TRE) in the promoter region of a TH-responsive

gene, ultimately affecting gene transcription (4). Many actions of TH can be explained by

this transcriptional mechanism of action. TH transport across the cell membrane is required,

since both deiodinases and TRs are located intracellularly. In recent years, several specific TH

transporters have emerged, such as the monocarboxylate transporters (MCT) and the organic

anion transporting polypeptide (OATP) family. Of the latter family, OATP1C1 appears to be

critical for transport of T4 across the blood-brain-barrier (5).

1.2 Thyroid Hormone and the central nervous system

Although a pivotal role of thyroid hormones in the developing mammalian brain has been long

established and extensively documented (for review see (6)), the adult central nervous system

(CNS) was generally assumed to be a thyroid hormone-insensitive organ until the 1980s (7). A

number of findings in more recent literature have casted doubt upon this assumption and have

gradually led to the general acceptance of the notion that the adult brain is a highly TH-sensitive


11

Chapter 1


organ. This notion is in line with the well-known psychomotor and cognitive dysfunction often

observed in adult-onset thyroid disorders, especially hypothyroidism (8).

By use of radio-labeled iodothyronines, the group of dr. M.B. Dratman showed for the first time

that THs can be transported across the blood-brain-barrier and choroid plexus in rats (9;10). Further

studies showed uptake and concentration of radio-labeled T3 in nerve terminals (11-13), pointing

to a new role for THs as (precursors for) amino-acid neurotransmitters or neuro-modulators

(13;14). A molecular basis for an active transport mechanism for THs in the brain was provided

by the identification of TH-specific transporters both in neurons and in capillaries of the choroid

plexus (15;16). The existence of active thyroid hormone transport in the human brain may explain

why concentrations of free T4 (FT4) and free T3 (FT3) are within the same range, or even higher,

in the cerebrospinal fluid (CSF) as compared with plasma (17). THs and several TH derivatives are

widely distributed in the CNS. For instance, both T4 and T3 concentrations have been reported in

the pmol/g range in rat hypothalamus (18). These tissue concentrations are similar to T4 and T3

concentrations in rat liver, which is considered to be a major TH target tissue.

Importantly, also the thyroid hormone receptors TRα and TRβ, as well as the deiodinating enzymes

D2 and D3, are widely distributed both in the rat and human CNS, including the hypothalamus

(19-23). It has been estimated that more than 75% of neuronal T3 is derived from conversion of T4

to T3 by D2, underlining the importance of D2 in regulating T3 bio-availability in the CNS (24).

A phenomenon pointing to an important functional role of T3 in the CNS is the efficient homeostatic

mechanism in the brain ensuring notably stable local T3 -tissue concentrations in the face of

pathological changes in systemic TH status. For example, when rats are rendered hypothyroid by

thyroidectomy, D2 activity in the cerebral cortex rapidly increases, promoting the local conversion

of T4 into T3, and this can be prevented by the administration of systemic TH replacement at the

same time (25). Similar adaptive mechanisms have been reported in the hypothalamus, where

hypothyroidism elevates D2 mRNA expression and activity, whereas thyrotoxicosis decreases

local D2 levels (26). In addition, the TH inactivating enzyme D3 is highly T3-responsive throughout

the CNS, as evidenced by a dose-dependent induction during thyrotoxicosis (27;28). These TH

dependent adaptations in local deiodinase enzyme expression result in remarkably stable tissue

T3 concentrations in the CNS over a wide range of systemic TH conditions (29).

Furthermore, under non-pathological conditions, hypothalamic deiodinase levels also show

marked fluctuations in association with physiologic processes and stimuli such as day-night

rhythmicity (30), seasonal (i.e. photoperiod) changes (31) and food availability (32). However,

in most of these processes it remains unclear if deiodinase regulated TH bio-availability in the

hypothalamus may play a regulatory role in the (metabolic) adaptation of the organism to these

conditions, or if these represent epiphenomena (for review see (33)).

Recently, with the advances in functional neuro-imaging techniques, there have been several

clinical reports describing metabolic changes in the CNS associated with altered TH status in

patients (34-36), possibly explaining the neuro-cognitive symptoms in these patients. Interestingly,

even in subclinical hypothyroidism, which may be regarded as a subtle thyroid hormone deficit,

fMRI revealed malfunction of brain areas critical for working memory, which could be ameliorated

by thyroxine supplementation (37).

12


1.3a Metabolic alterations during thyrotoxicosisThe role of TH in the regulation of lipid and glucose metabolism has been the subject of study

ever since the recognition of the link between thyroid function and body weight. The effects of

TH on metabolism are among the foremost actions of TH in vertebrates. This is illustrated by

the profound alterations in (energy) metabolism during hyper- and hypothyroidism, and also by

the metabolic adaptations of the HPT-axis to physiologic stressors such as food deprivation and

critical illness (38).

Hypermetabolism is one of the hallmarks of thyrotoxicosis, reflected in an increase of resting

energy expenditure (REE). This increased REE can be measured in humans by indirect calorimetry,

assessing whole body O2 consumption and CO2 production. In fact, this was an important tool

in the diagnosis of thyrotoxicosis before the development of sensitive radioimmunoassays for T4

and TSH (39;40).

To ensure replenishment of macronutrients, appetite is simultaneously stimulated during

thyrotoxicosis, which is obviously advantageous. There are recent data to suggest that this

hyperphagia represents a direct TH effect in the hypothalamic ventromedial nucleus, which

is involved in appetite regulation (41). In addition, TH may affect appetite indirectly via the

hypothalamic neuropeptide Y (NPY)/ Agouti related peptide (AGRP) system that is critical for

appetite regulation (42).

The alterations in glucose metabolism during thyrotoxicosis have been extensively studied.

Whole body glucose utilization is increased during chronic human thyrotoxicosis (43). To provide

the substrates needed, endogenous glucose production (EGP) is increased, paralleled by a mild

increase of plasma glucose concentration (44). The EGP increase during thyrotoxicosis is facilitated

by the increased activity of relevant hepatic gluconeogenic enzymes such as phosphoenolpyruvate

carboxykinase (PEPCK) and pyruvate carboxylase (45;46) and by increased hepatic expression of

the glucose transporter GLUT2 (47;48). The mechanism by which T3 stimulates of these genes

is complex as illustrated by T3-mediated modulation of PEPCK expression. T3 directly modulates

transcription of these genes via he nuclear TRs binding to their thyroid hormone responsive

elements. In addition, T3 appears to act on a pre-translational level, amplifying cyclic-AMP-

mediated induction of transcription. Thereby, it induces the sensitivity to other (cyclic-AMP

regulated) hormones such as catecholamines and glucagon (49).

Although evidence is scarce, thyroid hormone also seems to interfere with hepatic sensitivity to

insulin in humans, the most important hormone inhibiting EGP (50). This may explain the often

reported glucose intolerance in hyperthyroid patients (44;51;52), and is likely to contribute to

the T3-induced EGP increase during thyrotoxicosis. Data on insulin sensitivity on the level of

peripheral glucose uptake during thyrotoxicosis are conflicting as decreased as well as unaltered

insulin sensitivities have been reported (44).

Fatty acids (FA) are an additional important substrate fuelling the increase in REE during thyrotoxicosis

(53). In the acute phase, i.e. in the first days after the development of thyrotoxicosis, increased fat

oxidation appears to be the sole mechanism by which the increase in energy demand is fulfilled

(54). The FAs needed for this, can be provided by several mechanisms. First, lipolysis, i.e. hydrolysis

of triglycerides into FAs and glycerol, is stimulated. Increased sensitivity to catecholamines, as


13

Chapter 1


mentioned above, seems to be a principal mechanism by which THs promote lipolysis. Second,

hepatic de novo lipogenesis is promoted by T3 via induction of lipogenic enzymes such as fatty

acid synthase (55). Third, TH increases the amount of available nutrients by increasing food intake,

including FAs, which are to be absorbed from the gastrointestinal tract.

Finally, increased quantities of amino acids, provided by an increase in muscle proteolysis during

thyrotoxicosis, are available to enter the pathway of gluconeogenesis (56;57). Increased striated

muscle proteolysis may well be responsible for muscle wasting and myopathies associated with

severe thyrotoxicosis (57).

In summary, thyrotoxicosis is characterized by complex metabolic alterations that point to a

generalized catabolic state. Both glucose, lipid as well as protein metabolism are involved in the

hypermetabolism of thyrotoxicosis (43).

1.3b Dynamic measurement of metabolic fluxesPlasma concentrations of metabolically relevant substances represent the final result of (often

reciprocal) metabolic fluxes of the respective substance and therefore provide very limited

information about kinetics. For example, plasma glucose concentration is determined by glucose

production, in non-fasting conditions mainly accounted for by the liver, as well as glucose

disposal by tissues such as muscle, white adipose tissue and the brain. In order to quantify

these processes, the technique of stable isotope dilution is the tool of choice. This technique

permits dynamic measurement of metabolic fluxes in vivo. For the experiments described in

chapters 3, 4 and 5 of this thesis, we adapted the stable isotope (6,6-2H2-glucose) dilution

technique, previously used in our department for measuring glucose fluxes in patients, for use

in laboratory rats. Similarly, to permit measurement of tissue-specific fatty acid (FA) uptake, and

more specifically to differentiate between uptake of FAs from different sources, we adapted a

dual-isotope technique originally developed in mice (58) for use in rats, as described in chapter

2 of the present thesis.

The principle of the stable isotope dilution technique used in this thesis to dynamically measure

EGP in vivo can be summarized as follows. In the fasted state, when the amount of nutrients

entering the circulation from the gastro-intestinal tract is negligible, a continuous intravenous

infusion of 6,6-2H2-glucose (i.e. the glucose tracer) is started. After equilibration time (which is

shortened by applying a prime bolus), steady state will ensue. This means that if metabolic fluxes

involved in glucose homeostasis remain constant, an equilibrium will be reached between the

glucose tracer and unlabelled (endogenously produced) glucose. This is reflected in a constant

ratio of 6,6-2H2-glucose to unlabelled glucose in plasma, termed 6,6-2H2-glucose enrichment,

which can be accurately measured by gas chromatography coupled to mass spectrometry (GC/

MS). Endogenous glucose production (EGP) can now be calculated from plasma 6,6-2H2-glucose

enrichment by using Steele’s equation for steady state conditions (59). Measuring EGP by

using the isotope dilution technique is based on the principle that whereas 6,6-2H2-glucose

enrichment is not affected by glucose disposal (i.e. uptake), the 6,6-2H2-glucose pool is diluted

by the production of endogenous (unlabelled) glucose. Evidently, an important assumption is

that metabolic processing of labelled and unlabelled glucose is identical, i.e. the process of

14


glucose uptake does not discriminate between labelled and unlabelled glucose, which appears

reasonable (60).

1.4 Hypothalamic regulation of glucose metabolism

The brain is a major energy consuming organ, and depends almost entirely on glucose as a

substrate. It is therefore not surprising that the plasma glucose concentration is tightly controlled

and that evolution has provided us with an efficient but complex system for maintenance of energy

and glucose homeostasis. This regulatory system is concentrated in the hypothalamus, and there

is substantial evidence pointing to the arcuate nucleus (ARC) as one of the main hypothalamic

nuclei involved. The ARC is localized at the base of the hypothalamus/third ventricle where the

blood-brain-barrier for large molecules is absent. It expresses a variety of hormone receptors,

including TRs. This makes sense, as in order to respond adequately to circulating nutrient and

hormonal signals conveying peripheral information regarding the energy status of the body,

neurons should ideally be in direct contact with these signals. After sensing these nutrient and

hormonal signals in the ARC, the information is conveyed to a number of nuclei including the

hypothalamic paraventricular nucleus (PVN) via well established neural circuits (61). The PVN

subsequently integrates this information with signals from other brain regions, and in turn uses

several output pathways for the regulation of peripheral metabolism. One of these pathways is

the neuro-endocrine system sending humoral signals via the median eminence to the anterior

pituitary gland, in turn regulating a variety of endocrine glands like the adrenal or thyroid gland

(hypothalamus-pituitary-adrenal (HPA) and hypothalamus-pituitary-thyroid (HPT) axis, respectively).

Another pathway arising from the PVN sends neural information from its pre-autonomic neurons

to the autonomic nervous system (ANS). PVN pre-autonomic neurons project to motor-neurons

of both branches of the ANS, i.e. the sympathetic and the parasympathetic nervous system.

Motorneurons of the sympathetic nervous system are located in the intermediolateral column

in the spinal cord (IML), whereas the parasympathetic motorneurons can be found in the

dorsal motor nucleus of the vagus nerve (DMV) in the brainstem. From the DMV, pre-synaptic

parasympathetic projections run with the vagus nerve, synapsing with postsynaptic neurons in

ganglions close to the organs or tissues of projection. Pre-synaptic projections of the sympathetic

motorneurons are generally much shorter, synapsing in ganglia closer to the spinal cord. From

there onwards, post-synaptic fibers (forming the cervical sympathetic chain) run to their target

tissues (62-64) (Fig 1).

Via these ANS pathways, the hypothalamus can modulate metabolism in organs like the liver,

heart and adipose tissue. In addition, it can affect hormone secretion via autonomic innervation of

endocrine glands, for example glucagon and insulin secretion by the pancreas. In a similar way, the

hypothalamus may affect TH secretion via autonomic innervation of the thyroid gland (65;66).

The classical view on the brain’s involvement in the hormonal regulation of metabolism was

dominated by two one-way roads. Hormones were thought to be the main factor via which the

brain could control metabolic organs such as the liver. On the other hand, feedback information

from the periphery was thought to be conveyed to the brain mainly via the sensory, i.e. afferent,


15

Chapter 1


fibers of the ANS. However, this view has recently been extended by the concept that a multitude

of hormonal signals are sensed directly by the brain within the hypothalamus (ARC), and that

the hypothalamus in turn regulates metabolism in peripheral tissues via its connections with the

ANS, independently of its neuro-endocrine output. Thus, hormones not only affect metabolic

processes directly by hormone receptor-mediated actions in target tissues, but also indirectly by

actions in hypothalamic nuclei. The hypothalamus in turn uses effector-pathways such as the

ANS to control metabolic processes in target tissues. This can be accomplished by “direct” ANS-

mediated modulation of metabolism in target tissues, but also by ANS mediated modulation of

the sensitivity to hormones in these target tissues (67;68).

This concept is nicely illustrated by insulin, which has among other important anabolic effects, a

major plasma glucose-lowering influence, when secreted by the pancreas in response to a meal.

This plasma glucose-lowering effect is accomplished by facilitating glucose uptake in muscle and

adipose tissue, as well as by inhibiting glucose production by the liver. The latter effect is mediated

by insulin actions on several levels of hepatic glucose metabolism (i.e. both glycogenolysis and

Figure 1 Schematic representation of the autonomic projections from the hypothalamus that regulate hepatic metabolism. Circulating hormones and nutrients, providing information regarding the metabolic status of the body, are sensed within the hypothalamic arcuate nucleus (ARC), where the blood-brain-barrier (BBB) is largely absent. The information is then is conveyed to pre-autonomic neurons in the paraventricular nucleus (PVN) where it is integrated with information from other brain regions. The autonomic nervous system is used as an efferent pathway to regulate hepatic metabolism. Pre-autonomic neurons project to the intermediolateral column (IML) of the spinal cord and the dorsomedial nucleus (DMV) of the brain stem, where they synapse with sympathetic an parasympathetic efferent neurons, respectively, projecting to the liver.

16


gluconeogenesis) and is well established (69). Recently, it has become clear that in rodents, EGP

can also be inhibited by low dose intracerebroventricular (icv) infusion of insulin, independently

of circulating insulin concentrations. The pathways that are responsible for this central effect of

insulin on hepatic glucose metabolism have been unravelled to a large extent, and involve insulin

receptors in the ARC, hypothalamic potassium-dependent ATP channels, NPY projections from

the ARC and autonomic output from the hypothalamus to the liver (70;71). In addition, insulin

modulates the release of neuropeptide Y (NPY), agouti related peptide (AGRP) and α-melanocyte-

stimulating hormone (αMSH), which are among the main hypothalamic neuropeptides involved

in the regulation of energy and glucose homeostasis (72;73).

There are convincing data that underline the physiological relevance of these central insulin

actions. First, a reduction of ~50% in the expression insulin receptors in the ARC, local

obstruction of insulin binding to its receptor or pharmacological blockade of downstream insulin

signalling (PI3K) in the ARC all markedly decrease the ability of insulin to inhibit EGP (70;74). In

addition, selective hepatic parasympathectomy leads to a ~50% loss of the inhibitory effect of

hyperinsulinemia on EGP, as measured under hyperinsulinemic clamp conditions (75). Overall,

these data strongly support the notion that under physiological conditions, insulin’s actions in

the hypothalamus transmitted to the liver via the autonomic nervous system, are responsible for

a significant part of its EGP-lowering effects.

There are convincing data showing that besides suppressing EGP via parasympathetic signalling,

the hypothalamus can also stimulate sympathetic projections to the liver in order to increase

EGP (76). Thus, the hypothalamus can reciprocally modulate EGP by using its sympathetic and

parasympathetic autonomic outputs to the liver. Other hormones/nutrients that are sensed

within the hypothalamus and in turn evoke regulatory metabolic responses in peripheral organs

include leptin (73), glucocorticoids (77), estrogen (78) and fatty acids (79).

Figure 2 Structural formulas of the iodothyronines thyroxine (T4), 3-iodothyronine (T3) and 3-iodothyronamine (T1AM). T1AM, like other thyronamines, is a structural homologue of T3 and T4. Note that a molecule of T1AM can be obtained by decarboxylation (removal of CO2H group), and deiodination of T3 or T4.


17

Chapter 1


1.5 Thyronamines; metabolic effects of rapid acting Thyroid Hormone analogues

The recently discovered thyronamines, such as 3-iodothyronamine (T1AM) and the fully deiodinated

thyronamine (T0AM) are decarboxylated and (to a certain extent) deiodinated analogues of TH

(fig 2). These compounds are agonists of the G-protein coupled trace amino acid associated

receptor 1 (TAAR1), a member of a large family of (former) orphan receptors. T1AM and T0AM

have been reported to occur in a multitude of rodent tissues among which liver, brain and

blood (80). Interestingly, the TAAR1 is expressed in the ARC (81). Upon systemic administration

to rodents, thyronamines induce profound physiological effects. These effects occur on a very

rapid timescale (seconds to minutes), and interestingly, many of them are opposite in direction

to the effects of THs. For example, thyronamines induce profound hypothermia, bradycardia

and a decrease of cardiac output. In addition, a number of marked metabolic effects have

been described. The metabolic phenotype that follows systemic thyronamine infusion resembles

metabolic adaptations to fasting in several ways, i.e. ketogenesis, hypoinsulinemia and a shift

to fat oxidation at the cost of glucose oxidation. In addition, thyronamines induce marked

hyperglycemia. The rapid timescale on which these effects occur, may be in line with a neural

mechanism of action. At present it is unknown if thyronamines act in the CNS to modulate

metabolism in peripheral organs like the liver.

1.6 General hypothesisIt has been long noted that there is a striking similarity between many of the symptoms of

thyrotoxicosis on the one hand and the effects of sympathetic nervous system (SNS) stimulation

on the other. This holds true for, e.g., tachycardia, tremor, increased perspiration and nervousness.

Already by the end of the 19th century this led to the surgical treatment of thyrotoxicosis by

resection of the cervical sympathetic chain (82) and later by high spinal anaesthesia or adrenal

denervation. The latter procedures were reported in 135 thyrotoxic patients with a contra-

indication for thyroidectomy by Dr. George Crile in Cleveland (US), one of the pioneers in the field

(83). Although these practices were gradually abandoned, it is still common practice nowadays

to start treatment of severe thyrotoxicosis with beta-adrenergic blockers. These drugs may induce

a rapid symptomatic relief enabling anti-thyroid drugs such as methimazole to gradually reduce

thyroid hormone synthesis. Interestingly, also many of the metabolic consequences of thyrotoxicosis

as outlined above (i.e. increased EGP, lipolysis, decreased insulin sensitivity) are similar to effects of

increased sympathetic tone. Along these lines, a study in hyperthyroid patients showed enhanced

noradrenalin (NE) secretion in subcutaneous white adipose tissue (WAT) without changes in

circulating catecholamines, probably causing higher rates of WAT lipolysis in these patients (84).

In addition, during thyrotoxicosis autonomic input to the heart shifts to increased sympathetic

and decreased parasympathetic tone (85-87). Collectively, these data raise the notion of increased

sympathetic tone during thyrotoxicosis.

Our group has reported the functional neuro-anatomy of sympathetic and parasymathetic output

from the hypothalamic PVN to the liver in rats (64) and more recently a major role for this autonomic

output in the regulation of hepatic glucose metabolism has emerged (70;71;76). Interestingly, in

18


the PVN and ARC, as well as additional hypothalamic nuclei, abundant expression of all major

thyroid hormone receptor isoforms has been reported in both humans and rodents (19;22).

In the present thesis we explore the hypothesis that a significant part of the metabolic alterations

during thyrotoxicosis are mediated via effects of thyroid hormones in the central nervous system.

More specifically, we hypothesize that the effects of thyroid hormone on hepatic glucose

metabolism in vivo are mediated to a significant extent via (pre-autonomic) neurons in the

hypothalamus that contact the liver via autonomic projections.

1.7 Thesis outlineIn this thesis, we describe our efforts to test the hypothesis that thyroid hormones (or TH

derivatives) modulate metabolism on the level of peripheral organs (i.e. the liver) via actions in

the brain, and more specifically, the hypothalamus.

First, we studied the effects of thyroid status on whole body energy metabolism and tissue-

specific metabolism, in particular on fatty acid kinetics. For this, we performed experiments with

hypothyroid, euthyroid and thyrotoxic rats using metabolic cages and a dual isotope infusion

technique. The results are described in chapter 2.

In chapter 3, we aimed to elucidate a possible role of the ANS projections to the liver in the

alterations of hepatic glucose metabolism induced by thyrotoxicosis. In order to do this, we

assessed hepatic glucose production and its sensitivity to insulin by combining stable isotope

dilution and hyperinsulinemic euglycemic clamping in euthyroid and thyrotoxic rats that

underwent selective hepatic autonomic (i.e. either sympathetic or parasympathetic) denervation

or a sham operation.

As a next step, we administered T3 both intracerebroventricularly and selectively to the PVN

by microdialysis in euthyroid rats, while assessing EGP with stable isotope infusion. Moreover,

we combined hypothalamic T3 administration with selective sympathetic denervation of the

liver to study the involvement of the sympathetic hepatic projections in the effects on hepatic

glucose production induced by hypothalamic T3. These experiments are described and discussed

in chapter 4.

The thyronamines T1AM and T0AM, analogues of TH, exhibit neurotransmitter-like properties,

and the physiologic profile that evolves upon administration of these compounds in rodents may

well fit with involvement of the hypothalamus in these actions. In the experiments described

in chapter 5, we studied for the first time if the effects of T1AM and T0AM on hepatic glucose

metabolism and glucoregulatory hormones can be explained by actions of thyronamines in the

CNS.

Finally, to explore the interrelationship between THs and energy metabolism in the clinical setting,

we performed a study in patients with Graves disease rendered euthyroid by pharmacotherapy

aimed at blocking thyroid hormone synthesis by an antithyroid drug and restoring plasma

thyroid hormone concentrations by exogenous substitution of thyroxine (so called ‘block and

replacement therapy” or BRT). We studied these patients on 2 occasions, i.e. during BRT and 12


19

Chapter 1


weeks after BRT cessation, providing circumstances with subtle differences in plasma free (F)T4

and FT3 concentrations. The data are described and discussed in chapter 6.

In chapter 7, we aim to place our findings into a wider perspective, with a special emphasis on

biological as well as potential clinical relevance.

Reference List 1. Kendall EC 1919 Isolation of the Iodine Compound Which Occurs in the Thyroid . J.Biol.Chem. 39,

125-147

2. Harington CR 1926 Chemistry of Thyroxine: Constitution and Synthesis of Desiodo-Thyroxine. Biochem J 20:300-313

3. Bianco AC, Salvatore D, Gereben B, Berry MJ, Larsen PR 2002 Biochemistry, cellular and molecular biology, and physiological roles of the iodothyronine selenodeiodinases. Endocr Rev 23:38-89

4. Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:1097-1142

5. Visser WE, Friesema EC, Jansen J, Visser TJ 2008 Thyroid hormone transport in and out of cells. Trends Endocrinol Metab 19:50-56

6. Bernal J 2007 Thyroid hormone receptors in brain development and function. Nat Clin Pract Endocrinol Metab 3:249-259

7. Sourkes T. In: Basic Neurochemistry, Siegel GJ, Alberts RW, Katzman R, Agranoff BW (Eds.) 1976, p728 Little Brown, Boston.

8. Dugbartey AT 1998 Neurocognitive aspects of hypothyroidism. Arch Intern Med 158:1413-1418

9. Cheng LY, Outterbridge LV, Covatta ND, Martens DA, Gordon JT, Dratman MB 1994 Film autoradiography identifies unique features of [125I]3,3’5’-(reverse) triiodothyronine transport from blood to brain. J Neurophysiol 72:380-391

10. Dratman MB, Crutchfield FL, Schoenhoff MB 1991 Transport of iodothyronines from bloodstream to brain: contributions by blood:brain and choroid plexus:cerebrospinal fluid barriers. Brain Res 554:229-236

11. Dratman MB, Crutchfield FL, Axelrod J, Colburn RW, Thoa N 1976 Localization of triiodothyronine in nerve ending fractions of rat brain. Proc Natl Acad Sci U S A 73:941-944

12. Dratman MB, Crutchfield FL 1978 Synaptosomal [125I]triiodothyronine after intravenous [125I]thyroxine. Am J Physiol 235:E638-E647

13. Dratman MB, Futaesaku Y, Crutchfield FL, Berman N, Payne B, Sar M, Stumpf WE 1982 Iodine-125-labeled triiodothyronine in rat brain: evidence for localization in discrete neural systems. Science 215:309-312

14. Dratman MB, Gordon JT 1996 Thyroid hormones as neurotransmitters. Thyroid 6:639-647

15. Friesema EC, Ganguly S, Abdalla A, Manning Fox JE, Halestrap AP, Visser TJ 2003 Identification of monocarboxylate transporter 8 as a specific thyroid hormone transporter. J Biol Chem 278:40128-40135

16. Pizzagalli F, Hagenbuch B, Stieger B, Klenk U, Folkers G, Meier PJ 2002 Identification of a novel human organic anion transporting polypeptide as a high affinity thyroxine transporter. Mol Endocrinol 16:2283-2296

17. Kirkegaard C, Faber J 1991 Free thyroxine and 3,3’,5’-triiodothyronine levels in cerebrospinal fluid in patients with endogenous depression. Acta Endocrinol (Copenh) 124:166-172

18. Pinna G, Brodel O, Visser T, Jeitner A, Grau H, Eravci M, Meinhold H, Baumgartner A 2002 Concentrations of seven iodothyronine metabolites in brain regions and the liver of the adult rat. Endocrinology 143:1789-1800

20


19. Alkemade A, Vuijst CL, Unmehopa UA, Bakker O, Vennstrom B, Wiersinga WM, Swaab DF, Fliers E 2005 Thyroid hormone receptor expression in the human hypothalamus and anterior pituitary. J Clin Endocrinol Metab 90:904-912

20. Lechan RM, Qi Y, Jackson IM, Mahdavi V 1994 Identification of thyroid hormone receptor isoforms in thyrotropin-releasing hormone neurons of the hypothalamic paraventricular nucleus. Endocrinology 135:92-100

21. Alkemade A, Friesema EC, Unmehopa UA, Fabriek BO, Kuiper GG, Leonard JL, Wiersinga WM, Swaab DF, Visser TJ, Fliers E 2005 Neuroanatomical pathways for thyroid hormone feedback in the human hypothalamus. J Clin Endocrinol Metab 90(7):4322-4334

22. Lechan RM, Qi Y, Berrodin TJ, Davis KD, Schwartz HL, Strait KA, Oppenheimer JH, Lazar MA 1993 Immunocytochemical delineation of thyroid hormone receptor beta 2-like immunoreactivity in the rat central nervous system. Endocrinology 132:2461-2469

23. Fliers E, Alkemade A, Wiersinga WM, Swaab DF 2006 Hypothalamic thyroid hormone feedback in health and disease. Prog Brain Res 153:189-207

24. Crantz FR, Silva JE, Larsen PR 1982 An analysis of the sources and quantity of 3,5,3’-triiodothyronine specifically bound to nuclear receptors in rat cerebral cortex and cerebellum. Endocrinology 110:367-375

25. Leonard JL, Kaplan MM, Visser TJ, Silva JE, Larsen PR 1981 Cerebral cortex responds rapidly to thyroid hormones. Science 214:571-573

26. Tu HM, Kim SW, Salvatore D, Bartha T, Legradi G, Larsen PR, Lechan RM 1997 Regional distribution of type 2 thyroxine deiodinase messenger ribonucleic acid in rat hypothalamus and pituitary and its regulation by thyroid hormone. Endocrinology 138:3359-3368

27. Tu HM, Legradi G, Bartha T, Salvatore D, Lechan RM, Larsen PR 1999 Regional expression of the type 3 iodothyronine deiodinase messenger ribonucleic acid in the rat central nervous system and its regulation by thyroid hormone. Endocrinology 140:784-790

28. Escobar-Morreale HF, Obregon MJ, Hernandez A, Escobar dR, Morreale dE 1997 Regulation of iodothyronine deiodinase activity as studied in thyroidectomized rats infused with thyroxine or triiodothyronine. Endocrinology 138:2559-2568

29. Escobar-Morreale HF, Obregon MJ, Escobar del RF, Morreale de EG 1995 Replacement therapy for hypothyroidism with thyroxine alone does not ensure euthyroidism in all tissues, as studied in thyroidectomized rats. J Clin Invest 96:2828-2838

30. Kalsbeek A, Buijs RM, van SR, Kaptein E, Visser TJ, Doulabi BZ, Fliers E 2005 Daily variations in type II iodothyronine deiodinase activity in the rat brain as controlled by the biological clock. Endocrinology 146:1418-1427

31. Yoshimura T, Yasuo S, Watanabe M, Iigo M, Yamamura T, Hirunagi K, Ebihara S 2003 Light-induced hormone conversion of T4 to T3 regulates photoperiodic response of gonads in birds. Nature 426:178-181

32. Diano S, Naftolin F, Goglia F, Horvath TL 1998 Fasting-induced increase in type II iodothyronine deiodinase activity and messenger ribonucleic acid levels is not reversed by thyroxine in the rat hypothalamus. Endocrinology 139:2879-2884

33. Lechan RM, Fekete C 2005 Role of thyroid hormone deiodination in the hypothalamus. Thyroid 15:883-897

34. Constant EL, de Volder AG, Ivanoiu A, Bol A, Labar D, Seghers A, Cosnard G, Melin J, Daumerie C 2001 Cerebral blood flow and glucose metabolism in hypothyroidism: a positron emission tomography study. J Clin Endocrinol Metab 86:3864-3870

35. Schreckenberger MF, Egle UT, Drecker S, Buchholz HG, Weber MM, Bartenstein P, Kahaly GJ 2006 Positron emission tomography reveals correlations between brain metabolism and mood changes in hyperthyroidism. J Clin Endocrinol Metab 91:4786-4791


21

Chapter 1


36. Smith CD, Ain KB 1995 Brain metabolism in hypothyroidism studied with 31P magnetic-resonance spectroscopy. Lancet 345:619-620

37. Zhu DF, Wang ZX, Zhang DR, Pan ZL, He S, Hu XP, Chen XC, Zhou JN 2006 fMRI revealed neural substrate for reversible working memory dysfunction in subclinical hypothyroidism. Brain 129:2923-2930

38. Lechan RM, Fekete C 2006 The TRH neuron: a hypothalamic integrator of energy metabolism. Prog Brain Res 153:209-235

39. Wiersinga WM, Chopra IJ 1982 Radioimmunoassay of thyroxine (T4), 3,5,3’-triiodothyronine (T3), 3,3’,5’-triiodothyronine (reverse T3, rT3), and 3,3’-diiodothyronine (T2). Methods Enzymol 84:272-303

40. Baron DN 1959 Estimation of the basal metabolic rate in the diagnosis of thyroid disease. Proc R Soc Med 52:523-525

41. Kong WM, Martin NM, Smith KL, Gardiner JV, Connoley IP, Stephens DA, Dhillo WS, Ghatei MA, Small CJ, Bloom SR 2004 Triiodothyronine stimulates food intake via the hypothalamic ventromedial nucleus independent of changes in energy expenditure. Endocrinology 145:5252-5258

42. Ishii S, Kamegai J, Tamura H, Shimizu T, Sugihara H, Oikawa S 2003 Hypothalamic neuropeptide Y/Y1 receptor pathway activated by a reduction in circulating leptin, but not by an increase in circulating ghrelin, contributes to hyperphagia associated with triiodothyronine-induced thyrotoxicosis. Neuroendocrinology 78:321-330

43. Moller N, Nielsen S, Nyholm B, Porksen N, Alberti KG, Weeke J 1996 Glucose turnover, fuel oxidation and forearm substrate exchange in patients with thyrotoxicosis before and after medical treatment. Clin Endocrinol (Oxf) 44:453-459

44. Dimitriadis GD, Raptis SA 2001 Thyroid hormone excess and glucose intolerance. Exp Clin Endocrinol Diabetes 109 Suppl 2:S225-S239

45. Loose DS, Cameron DK, Short HP, Hanson RW 1985 Thyroid hormone regulates transcription of the gene for cytosolic phosphoenolpyruvate carboxykinase (GTP) in rat liver. Biochemistry 24:4509-4512

46. Weinberg MB, Utter MF 1979 Effect of thyroid hormone on the turnover of rat liver pyruvate carboxylase and pyruvate dehydrogenase. J Biol Chem 254:9492-9499

47. Mokuno T, Uchimura K, Hayashi R, Hayakawa N, Makino M, Nagata M, Kakizawa H, Sawai Y, Kotake M, Oda N, Nakai A, Nagasaka A, Itoh M 1999 Glucose transporter 2 concentrations in hyper- and hypothyroid rat livers. J Endocrinol 160:285-289

48. Weinstein SP, O’Boyle E, Fisher M, Haber RS 1994 Regulation of GLUT2 glucose transporter expression in liver by thyroid hormone: evidence for hormonal regulation of the hepatic glucose transport system. Endocrinology 135:649-654

49. Hoppner W, Sussmuth W, Seitz HJ 1985 Effect of thyroid state on cyclic AMP-mediated induction of hepatic phosphoenolpyruvate carboxykinase. Biochem J 226:67-73

50. Cavallo-Perin P, Bruno A, Boine L, Cassader M, Lenti G, Pagano G 1988 Insulin resistance in Graves’ disease: a quantitative in-vivo evaluation. Eur J Clin Invest 18:607-613

51. Holness MJ, Sugden MC 1987 Hepatic carbon flux after re-feeding. Hyperthyroidism blocks glycogen synthesis and the suppression of glucose output observed in response to carbohydrate re-feeding. Biochem J 247:627-634

52. Holness MJ, Sugden MC 1987 Continued glucose output after re-feeding contributes to glucose intolerance in hyperthyroidism. Biochem J 247:801-804

53. Bech K, Damsbo P, Eldrup E, Beck-Nielsen H, Roder ME, Hartling SG, Volund A, Madsbad S 1996 beta-cell function and glucose and lipid oxidation in Graves’ disease. Clin Endocrinol (Oxf) 44:59-66

54. Oppenheimer JH, Schwartz HL, Lane JT, Thompson MP 1991 Functional relationship of thyroid hormone-induced lipogenesis, lipolysis, and thermogenesis in the rat. J Clin Invest 87:125-132

22


55. Radenne A, Akpa M, Martel C, Sawadogo S, Mauvoisin D, Mounier C 2008 Hepatic regulation of fatty acid synthase by insulin and T3: evidence for T3 genomic and nongenomic actions. Am J Physiol Endocrinol Metab 295:E884-E894

56. Carter WJ, Van Der Weijden Benjamin WS, Faas FH 1981 Effect of experimental hyperthyroidism on skeletal-muscle proteolysis. Biochem J 194:685-690

57. Riis AL, Jorgensen JO, Gjedde S, Norrelund H, Jurik AG, Nair KS, Ivarsen P, Weeke J, Moller N 2005 Whole body and forearm substrate metabolism in hyperthyroidism: evidence of increased basal muscle protein breakdown. Am J Physiol Endocrinol Metab 288:E1067-E1073

58. Teusink B, Voshol PJ, Dahlmans VE, Rensen PC, Pijl H, Romijn JA, Havekes LM 2003 Contribution of fatty acids released from lipolysis of plasma triglycerides to total plasma fatty acid flux and tissue-specific fatty acid uptake. Diabetes 52:614-620

59. Steele R 1959 Influences of glucose loading and of injected insulin on hepatic glucose output. Ann N Y Acad Sci 82:420-430

60. Wolfe RR. Calculations of substrate kinetics: single pool model. Radioactive and stable isotope tracers in biomedicine. Principles and practice of kinetic analysis. 2004: 215-258. Wiley-Liss, New York.

61. Seeley RJ, Drazen DL, Clegg DJ 2004 The critical role of the melanocortin system in the control of energy balance. Annu Rev Nutr 24:133-149

62. Kreier F, Fliers E, Voshol PJ, van Eden CG, Havekes LM, Kalsbeek A, Van Heijningen CL, Sluiter AA, Mettenleiter TC, Romijn JA, Sauerwein HP, Buijs RM 2002 Selective parasympathetic innervation of subcutaneous and intra-abdominal fat--functional implications. J Clin Invest 110:1243-1250

63. Kreier F, Kap YS, Mettenleiter TC, van Heijningen C, van d, V, Kalsbeek A, Sauerwein HP, Fliers E, Romijn JA, Buijs RM 2005 Tracing from fat tissue, liver and pancreas: A neuroanatomical framework for the role of the brain in type 2 diabetes. Endocrinology 147(3):1140-1147

64. La Fleur SE, Kalsbeek A, Wortel J, Buijs RM 2000 Polysynaptic neural pathways between the hypothalamus, including the suprachiasmatic nucleus, and the liver. Brain Res 871:50-56

65. Kalsbeek A, Fliers E, Franke AN, Wortel J, Buijs RM 2000 Functional connections between the suprachiasmatic nucleus and the thyroid gland as revealed by lesioning and viral tracing techniques in the rat. Endocrinology 141:3832-3841

66. Klieverik LP, Kalsbeek A, Fliers E. Autonomic innervation of the thyroid gland and it’s functional implications. www.hotthyroidology.com (online-journal of the European Thyroid Association) issue dec 2005.

67. Buijs RM, Wortel J, Van Heerikhuize JJ, Feenstra MG, Ter Horst GJ, Romijn HJ, Kalsbeek A 1999 Anatomical and functional demonstration of a multisynaptic suprachiasmatic nucleus adrenal (cortex) pathway. Eur J Neurosci 11:1535-1544

68. Buijs RM, Kalsbeek A 2001 Hypothalamic integration of central and peripheral clocks. Nat Rev Neurosci 2:521-526

69. Barthel A, Schmoll D 2003 Novel concepts in insulin regulation of hepatic gluconeogenesis. Am J Physiol Endocrinol Metab 285:E685-E692

70. Obici S, Zhang BB, Karkanias G, Rossetti L 2002 Hypothalamic insulin signaling is required for inhibition of glucose production. Nat Med 8:1376-1382

71. van den Hoek AM, van Heijningen C, Schroder-van der Elst JP, Ouwens DM, Havekes LM, Romijn JA, Kalsbeek A, Pijl H 2008 Intracerebroventricular administration of neuropeptide Y induces hepatic insulin resistance via sympathetic innervation. Diabetes 57:2304-2310

72. Seeley RJ, Drazen DL, Clegg DJ 2004 The critical role of the melanocortin system in the control of energy balance. Annu Rev Nutr 24:133-149

73. Sandoval D, Cota D, Seeley RJ 2008 The integrative role of CNS fuel-sensing mechanisms in energy balance and glucose regulation. Annu Rev Physiol 70:513-535


23

Chapter 1


74. Obici S, Feng Z, Karkanias G, Baskin DG, Rossetti L 2002 Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats. Nat Neurosci 5:566-572

75. Pocai A, Lam TK, Gutierrez-Juarez R, Obici S, Schwartz GJ, Bryan J, guilar-Bryan L, Rossetti L 2005 Hypothalamic K(ATP) channels control hepatic glucose production. Nature 434:1026-1031

76. Kalsbeek A, La FS, Van HC, Buijs RM 2004 Suprachiasmatic GABAergic inputs to the paraventricular nucleus control plasma glucose concentrations in the rat via sympathetic innervation of the liver. J Neurosci 24:7604-7613

77. Cusin I, Rouru J, Rohner-Jeanrenaud F 2001 Intracerebroventricular glucocorticoid infusion in normal rats: induction of parasympathetic-mediated obesity and insulin resistance. Obes Res 9:401-406

78. Clegg DJ, Brown LM, Woods SC, Benoit SC 2006 Gonadal hormones determine sensitivity to central leptin and insulin. Diabetes 55:978-987

79. Lam TK, Pocai A, Gutierrez-Juarez R, Obici S, Bryan J, Aguilar-Bryan L, Schwartz GJ, Rossetti L 2005 Hypothalamic sensing of circulating fatty acids is required for glucose homeostasis. Nat Med 11:320-327

80. Scanlan TS, Suchland KL, Hart ME, Chiellini G, Huang Y, Kruzich PJ, Frascarelli S, Crossley DA, Bunzow JR, Ronca-Testoni S, Lin ET, Hatton D, Zucchi R, Grandy DK 2004 3-Iodothyronamine is an endogenous and rapid-acting derivative of thyroid hormone. Nat Med 10:638-642

81. Borowsky B, Adham N, Jones KA, Raddatz R, Artymyshyn R, Ogozalek KL, Durkin MM, Lakhlani PP, Bonini JA, Pathirana S, Boyle N, Pu X, Kouranova E, Lichtblau H, Ochoa FY, Branchek TA, Gerald C 2001 Trace amines: identification of a family of mammalian G protein-coupled receptors. Proc Natl Acad Sci U S A 98:8966-8971

82. Poncet MA 1897 Le traitement chirurgical des goitre exophthalmique par la section ou la résection due sympathique cervical. Bull Acad Med 38:121

83. Crile GW 1929 The interdependence of the thyroid, adrenals and nervous system. Amer.J.Surg. 6:616

84. Haluzik M, Nedvidkova J, Bartak V, Dostalova I, Vlcek P, Racek P, Taus M, Svacina S, Alesci S, Pacak K 2003 Effects of hypo- and hyperthyroidism on noradrenergic activity and glycerol concentrations in human subcutaneous abdominal adipose tissue assessed with microdialysis. J Clin Endocrinol Metab 88:5605-5608

85. Burggraaf J, Tulen JH, Lalezari S, Schoemaker RC, De Meyer PH, Meinders AE, Cohen AF, Pijl H 2001 Sympathovagal imbalance in hyperthyroidism. Am J Physiol Endocrinol Metab 281:E190-E195

86. Cacciatori V, Bellavere F, Pezzarossa A, Dellera A, Gemma ML, Thomaseth K, Castello R, Moghetti P, Muggeo M 1996 Power spectral analysis of heart rate in hyperthyroidism. J Clin Endocrinol Metab 81:2828-2835

87. Chen JL, Chiu HW, Tseng YJ, Chu WC 2006 Hyperthyroidism is characterized by both increased sympathetic and decreased vagal modulation of heart rate: evidence from spectral analysis of heart rate variability. Clin Endocrinol (Oxf) 64:611-616

24


Thyroid hormone effects on whole body energy homeostasis and tissue-specific fatty acid uptake in vivo

Lars P. KlieverikClaudia P. CoomansErik EndertHans P. Sauerwein Louis M. HavekesPeter J. VosholPatrick C.N. RensenJohannes A. Romijn Andries KalsbeekEric Fliers

2


AbstractThe effects of thyroid hormone (TH) status on energy metabolism and tissue-specific substrate

supply in vivo are incompletely understood at present. To study the effects of TH status on

energy metabolism and tissue-specific fatty acid (FA) fluxes, we used metabolic cages as well as 14C-labelled FA and 3H-labeled triglyceride (TG) infusion in rats treated with methimazole and

either 0 (hypothyroidism), 1.5 (euthyroidism) or 16.0 (thyrotoxicosis) μg/100g*day of thyroxine

for 11 days.

Thyrotoxicosis increased total energy expenditure (TEE) by 38% (p=0.02), resting energy

expenditure (REE) by 61% (p=0.002) and food intake by 18% (p=0.004). Hypothyroidism

tended to decrease TEE (10%; p=0.064), and REE (12%; p=0.025), but did not affect food

intake. TH status did not affect spontaneous physical activity (SPA). Thyrotoxicosis increased fat

oxidation (p=0.006), whereas hypothyroidism decreased glucose oxidation (p=0.035). Plasma FA

concentration was increased in thyrotoxic, but not in hypothyroid rats. Thyrotoxicosis increased

albumin-bound FA uptake in muscle and white adipose tissue (WAT), whereas hypothyroidism

had no effect in any tissue studied, suggesting mass-driven albumin-bound FA uptake. During

thyrotoxicosis, TG-derived FA uptake was increased in muscle and heart, unaffected in WAT, and

decreased in brown adipose tissue. Conversely, during hypothyroidism TG-derived FA uptake

was increased in WAT in association with increased lipoprotein lipase activity, but unaffected in

oxidative tissues and decreased in liver.

In conclusion, TH status determines EE independently of SPA. The changes in whole body lipid

metabolism are accompanied by tissue-specific changes in TG-derived FA uptake in accordance with

hyper- and hypometabolic states induced by thyrotoxicosis and hypothyroidism, respectively.

28


IntroductionThyroid hormone (TH) is a primary denominator of energy homeostasis, reflected by the strong

association between hyperthyroidism and increased energy expenditure (EE) in man. This

is exemplified by the widespread clinical use of calorimetry in addition to the determination

of protein bound iodine in diagnosing thyrotoxicosis (1;2) before sensitive thyroxine (T4) and

triiodothyronine (T3) RIAs became available in the 1970s (3). Whereas modulation of resting

EE by thyroid hormone status is well established in humans and rodents, it has been difficult

to assess TH effects on total EE (TEE) in vivo. In addition, the mechanism of the increased

EE induced by THs has remained incompletely understood (4). For example, few studies have

addressed how THs influence spontaneous physical activity (SPA) and if changes in SPA may

contribute to the alterations in EE associated with thyrotoxicosis and hypothyroidism in freely

moving organisms (5;6).

We have previously studied glucose metabolism during thyrotoxicosis in rats and found increased

endogenous glucose production and hepatic insulin resistance (7). Furthermore, thyrotoxicosis is

associated with major changes in lipid metabolism. Fatty acids (FA) are a preferential fuel source

during thyrotoxicosis (8;9), especially during the first days after the induction of thyrotoxicosis

(10). These FAs are provided to tissues mostly by hydrolysis (i.e. lipolysis) of circulating triglyceride

(TG)-rich lipoprotein particles by the enzyme lipoprotein lipase (LPL), located in the capillary

lumen. In addition, albumin-bound FAs are provided to the tissues from he plasma, a process

which is independent of LPL. Although there is evidence suggesting that LPL is regulated by TH

(11), it is unknown at present how FA fluxes via these two pathways are modulated by TH in

metabolically relevant tissues in vivo .

The aim of the present study was to examine the effects of thyrotoxicosis and hypothyroidism on

whole body energy metabolism and SPA in rats. To delineate how the effects of thyroid status

on whole body energy homeostasis are reflected in substrate (i.e. lipid) supply on the tissue level

in vivo, we additionally studied the rates of disappearance and tissue-specific partitioning of both

TG-derived and albumin-bound FAs. We report effects of thyroid hormone status on total energy

expenditure (TEE), resting energy expenditure (REE), SPA and substrate (i.e. glucose and lipid)

oxidation, that are paralleled by complex and tissue-specific effects of TH on FA uptake.

Materials and Methods Two separate experiments were performed

In experiment #1, 3 groups of rats were studied, i.e. hypothyroid (Hypo, n=7), euthyroid (Eu,

n=7) and thyrotoxic rats (Tox, n=7). All groups were treated with methimazol (MMI) in drinking

water. After 7 days, all groups were implanted with subcutaneous osmotic mini-pumps (day (D)

0), delivering either vehicle (Hypo group), or thyroxine (T4) at a dose of 1.5 (Eu group) or 16.0

μg/100g*day (Tox group) (7). Rats were subsequently placed in metabolic cages for determining

TEE, food intake, respiratory exchange ratio (RER), and fat and glucose oxidation during a 48h

period (D9 and D10).

In experiment #2 (D11), hypothyroid (Hypo, n=9), euthyroid (Eu, n=8) and thyrotoxic rats (Tox,

n=7) were i.v. infused with albumin-bound 14C-oleate (FA) and VLDL-like emulsion-incorporated

Effects of thyroid status on energy homeostasis and fatty acid uptake

29

Chapter 2


glycerol tri[3H]oleate (TG). This method enables measurement of FA turnover, tissue-specific FA

partitioning and differentiation between albumin-bound and TG-derived FA uptake on the tissue

level (12).

AnimalsTwenty-nine male Wistar rats (Harlan, Horst, the Netherlands) were submitted to both

experimental procedures described below (exp #1 and exp #2). Animals were housed under

constant conditions of temperature (21±1 °C) and humidity (60±2%) with a 12-h light, 12-h

dark (L/D) schedule (lights on 7.00 h am). Animals were allowed to adapt for 6 d before the

first experimental manipulations. During adaptation, animals were housed in groups of 8 per

cage. Body weight (BW) was between 320 and 360 g. Food and drinking water was available ad

libitum. All of the following experiments were conducted with the approval of the Animal Care

Committee of the Leiden University Medical Center.

Hormonal treatment; Block and ReplacementAt D0 of the protocol animals were placed in individual cages and treated with methimazole

0.025% (MMI, Sigma, the Netherlands) in drinking water containing 0.3% saccharin. At D7,

osmotic minipumps (OMP, Alzet 2ml2, Durect Corp., Cupertino, USA) loaded with L-thyroxine

(T4, Sigma, the Netherlands) solved in 6.5 mM NaOH and 50% propylene glycol, were implanted

under the dorsal skin during the surgical procedure. OMPs delivered either vehicle (hypothyroid

rats), or T4 at a dose of 1.5 μg (replacement dose; euthyroid group) or 16.0 μg (thyrotoxic group)

/100 g BW*day, as described previously (7).

SurgeryAt D7, animals were anaesthetized using a mixture of Hypnorm (Janssen; 0.05 mL/100 g BW,

i.m.) and Dormicum (Roche, the Netherlands; 0.04 mL/100 g BW, s.c.).

In all animals an intra-atrial silicone cannula was implanted through the right jugular vein for

infusion and sampling (13). The cannula was tunnelled to the head subcutaneously, fixed with

dental cement to 4 stainless-steel screws inserted into the skull. A mixture of 60% Amoxicillin,

20% heparin and 20% saline in polyvinylpyruvidon (Sigma, the Netherlands) was used to fill the

cannula and prevent inflammation and occlusion.

Experiment #1Energy expenditure, fat oxidation, spontaneous physical activity and food intake At D7,

animals were placed into an 8-cage combined, open circuit indirect calorimetry system (LabMaster

system, TSE Systems, Bad Homburg, Germany, for the remainder of this manuscript referred to

as “metabolic cages”), measuring food and water intake, O2 uptake and CO2 production, as

well as SPA. Although the cages including bedding were identical to the cages in which the

rats were housed the first 7 days (only the cover of the metabolic cage differs), animals were

adapted to this environment before the start of the actual measuring periods (D9 and D10)

for approximately 48 h. EE, RER and fat oxidation were calculated from the O2 uptake and

CO2 production relative to individual body weights (14). O2 uptake and CO2 production were

measured with 10 min intervals. Food and water intake and physical activity were measured

continuously. Activity monitoring and detection of animal location was performed with infrared

30


sensor pairs arranged in strips for horizontal (X level) and vertical (Z level) activity, detecting every

ambulatory movement. Spontaneous physical activity (SPA or XA), high-frequent activity (XF;

equivalent of breathing activity), total activity (XT=XA+XF) and rearing (Z) were monitored. The

infrared sensors for detection of movement allowed continuous recording in both light and dark

phases. In experiment #1, data from 21 rats were analyzed. Eight rats had to be excluded from

the final analysis due to incomplete calorimetry measurements.

Experiment #2Radiolabeled FA infusion At D11, rats were restrained from access to food from 5h prior to

the labeled lipid infusion (i.e. from 9.00 am onwards). Rats were connected to a metal collar

attached to polyethylene tubing (for blood-sampling and isotope infusion) which was kept out of

reach of the animals by a counterbalanced beam. This allowed all subsequent manipulations to

be performed outside the cages without handling the freely moving animals. After obtaining a

blood sample for measurement of plasma TH, FA, and TG concentrations (800 μL), rats received

a primed (500 μl in 5 min), continuous (500 μl/h) infusion of albumin-bound 14C-oleate (FA)

and VLDL-like emulsion-incorporated glycerol tri[3H]oleate (TG) i.v. for 2h. At the end of the 2-h

infusion period we obtained another blood sample (800 μL) for measurement of plasma [3H]-FA

and [14C]-FA radioactivity. Rats were sacrificed and striated muscle (M triceps brachii), heart,

liver, three white adipose tissue (WAT) depots (gonadal (epididymal), subcutaneous, visceral)

and infra-scapular brown adipose tissue (BAT) were harvested, snap frozen and stored at -20°C

for subsequent analysis. In experiment #2, data from 24 rats were analyzed. Five rats had to be

excluded from the final analysis due to jugular catheter occlusion.

Preparation of radiolabeled emulsion particles Protein-free VLDL-like TG-rich emulsion

particles were prepared from 100 mg total lipid at a weight ratio of triolein (Sigma, St. Louis, MA,

US): egg yolk phosphatidylcholine (Lipoid, Ludwigshafen, Germany): lyso phosphatidylcholine

(Sigma, St. Louis, MA, US): cholesteryl oleate (Janssen, Beersse, Belgium): cholesterol (Sigma,

St. Louis, MA, US) of 70: 22.7: 2.3: 3.0: 2.0 in the presence of 800 μCi of glycerol tri[9, 10(n)-3H]oleate ([3H]TG) (Amersham, Little Chalfont, UK), as reported previously (15). Lipids were

hydrated in 10 mL of 2.4M NaCl, 10 mM Hepes, 1 mM EDTA, pH 7.4, and sonicated for 30

min at 10 μm output using a Soniprep 150 (MSE Scientific Instruments, UK) equipped with a

water bath for temperature (54°C) maintenance. The emulsion was separated into fractions with

a different average size by density gradient ultracentrifugation. Intermediate (80 nm) [3H]-TG

particles were mixed with a trace amount of [14C]-oleic acid (Amersham, Little Chalfont, UK)

complexed to bovine serum albumin (BSA).

Tissue uptake analysis Tissues were dissolved in 5 mol/L KOH in 50% (vol/vol) ethanol. After

overnight saponification, protein content was determined in the various organs using BCA kit

(BCA Protein Assay Kit, Thermo Scientific). Radioactivity was measured in the saponified organs

and corrected for the corresponding protein concentration and plasma specific activities of [3H]-

FA and [14C]-FA. Calculations of tissue FA uptake and rate of disappearance were performed as

described previously (12).

Analysis of lipoprotein lipase (LPL) and hepatic lipase (HL) activity Striated muscle, heart,

liver and three WAT depots were cut into small pieces and put in 1 mL 2% BSA-containing DMEM


31

Chapter 2


medium. Heparin (2 units) was added and samples were incubated at 37°C for 60 minutes.

After centrifugation (10 min at 13.000 rpm), the supernatants were taken and snap-frozen

until analysis. Total LPL and HL activity was determined as modified from Zechner et al. (16).

In short, the lipolytic activity of tissue supernatant was assessed by determination of [3H]oleate

production upon incubation of tissue supernatant with a mix containing an excess of both [3H]

triolein, heat-inactivated human plasma as sources of the LPL coactivator apoC2 and FA-free BSA

as FFA acceptor.

Plasma analysisPlasma concentrations of the thyroid hormones T3 and T4 were determined by an in-house RIA, with

inter- and intra-assay CV of 7–8% and 3–4% (T3), and 3–6 and 2–4% (T4), respectively. Detection

limits for T3 and T4 were 0.3 nmol/L and 5 nmol/L, respectively. Plasma TSH concentrations

were determined by a chemiluminescent immunoassay (Immulite 2000, Diagnostic Products

Corp., Los Angeles, CA), using a rat-specific standard (17). The inter- and intra-assay CV for

TSH were less than 4% and 2% at ±3.5 mU/L, respectively, and the detection limit was 0.2

mU/L. Blood samples were kept in chilled paraoxon-coated Eppendorf tubes to prevent ex vivo

lipolysis. The tubes were placed on ice and immediately centrifuged at 4ºC. Plasma levels of

TG and FA were determined using commercially available kits and standards according to the

manufacturers instructions (Instruchemie, Delfzijl, The Netherlands). Lipids were extracted from

plasma according to Bligh and Dyer (18). The lipid fraction was dried under nitrogen, dissolved

into chloroform/methanol (5:1 [vol/vol]) and subjected to TLC (LK5D gel 150; Whatman) using

hexane:diethylether:acetic acid (83:16:1) [vol/vol/vol]) as mobile phase. Standards for FA and

TG were included during the TLC procedure to locate spots of these lipids. Spots were scraped,

lipids dissolved in hexane and radioactivity measured.

StatisticsBoth energy homeostasis and FA uptake data were analyzed by non-parametric Kruskall-Wallis

(KW) test, and a Mann Whitney U post hoc test was performed if KW revealed significance to

determine which experimental groups differed from each other. Cosinor analysis was performed

on the metabolic cage data of individual animals (48h). Curve fitting was performed using

constrained nonlinear regression analysis (SPSS 16.0). Subsequently, only if the significance level

(P value) of the fitted curve was less than 0.05, data were used to calculate mesor, amplitude

and acrophase of the individual curve. Significance was defined at p≤0.05. Data are presented

as mean ± SEM.

Results Experiment #1: Effects of thyroid status on energy homeostasisBody weight and eating behaviour At the time of starting hormonal (T4) treatment (osmotic

mini-pump implantation; D0), there were no differences in bodyweight (BW) between groups

(Hypo 339±13, Eu 340±5, Tox 345±4 g, p=0.63). At the time of placement in the metabolic cages

(D7), BW was decreased by 13±3 g in thyrotoxic rats, compared with an increase of 2±5 and 13±9

g in euthyroid and hypothyroid rats, respectively (Hypo vs Eu p=0.383, Eu vs Tox p=0.017, Hypo

32


vs Tox p=0.053). However, during the whole period in the metabolic cages (D7-10), BW increased

to a similar extent in all groups (Hypo 12±1, Eu 14±3, Tox 12±1 g, p=0.194).

After placement in the metabolic cages animals were allowed to adapt to this new environment

for 48h (D7-8). Subsequently, we gathered energy homeostasis data for 48h (D9-10). During this

time period, thyrotoxic rats showed increased cumulative food intake by 18% as compared with

euthyroid rats. Hypothyroid rats ate less than euthyroid rats, although this did not reach statistical

significance (Hypo 44±2 g, Eu 48±2 g, Tox 57±2 g, Eu vs Tox p=0.004, Hypo vs Eu p=0.128).

Plasma thyroid hormones Plasma concentrations of T3, T4 and TSH following the 48 h

measurement of energy homeostasis in experiment #1 are given in Table 1. Plasma T3 and

T4 concentrations were 163% and 30% higher, respectively, in thyrotoxic rats as compared

with euthyroid rats. In hypothyroid rats, plasma T3 and T4 concentrations were decreased to

44% and 15%, respectively, of euthyroid levels. Plasma TSH was 12.9±2.2 mU/L in hypothyroid

rats, and showed similar values in euthyroid and thyrotoxic rats (0.3±0.1 and 0.2±0.0 mU/L,

respectively).

Total EE, physical activity and resting EE Total EE (TEE) showed a clear diurnal rhythm in

all treatment groups, with a rise in the dark (i.e. active) period (fig 1a). As expected, this was

paralleled by a similar rhythm in SPA in all groups (fig 1b). There was a marked, 37% increase

in mean TEE/kg in thyrotoxic relative to euthyroid rats (p=0.02). This increase persisted when

mean TEE was not corrected for BW (p=0.04, data not shown). Hypothyroid rats showed a

trend (p=0.064) towards decreased (-10%) mean TEE relative to euthyroid rats. Cosinor analysis

revealed similar changes in the mesor of the fitted curves. In addition, there was a decrease in

the amplitude of the rhythm in EE by 46% in hypothyroid relative to euthyroid rats (p=0.017)

as well as a ~1 h phase-advance of the acrophase relative to Eu and Tox rats (p=0.017). There

were no differences in the mean levels of SPA between groups (Kruskall-Wallis p=0.901). Also

mesor, amplitude and acrophase of the fitted curves of SPA exhibited no differences between

Tox, Hypo and Eu groups (Table 2). Likewise, there were no differences in high-frequency activity

(equivalent of breathing; XF), rearing (Z) or total activity (XT) between groups, nor in mesor,

amplitude or acrophase of the fitted curves (data not shown).

In each animal we determined the total number of 10 min intervals in which the activity sensors

did not detect any activity (activity units (AU) =0). Hypothyroid rats tended to spend more time

inactive than euthyroid rats (533±72 vs 359±40 min, p=0.064), whereas thyrotoxic rats showed

a trend towards less inactivity time compared to euthyroid rats (256±33 min, p=0.073). During

these periods of inactivity, mean EE, termed resting EE (REE), was markedly higher in thyrotoxic

Table 1: Experiment #1: plasma thyroid hormone concentrations after 48h measurement of energy homeostasis (day 11) in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats.

Hypo n = 7 Eu n = 7 Tox n = 7

T3 (nmol/L) 0.50 ± 0.11 * 1.14 ± 0.07 3.00± 0.27 *

T4 (nmol/L) 20 ± 2 * 136 ± 8 177± 8 *

TSH (mU/L) 12.9 ± 2.2 * 0.3 ± 0.1 0.2± 0.0

* p≤0.01 vs Eu


33

Chapter 2


Fig 1a Forty-eight-hour total energy expenditure (TEE) in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats entrained to a regular 12/12 L/D cycle. Horizontal black bars indicate the dark phase of the L/D cycle. Data are mean of 7 animals per group at each time point and the interval between time points was 10 min. Cosinor data and statistical analysis are given in table 2. b Forty-eight-hour spontaneous physical activity (SPA) in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats entrained to a regular 12/12 L/D cycle. Horizontal black bars indicate the dark phase of the L/D cycle. Data are mean of 7 animals per group at each time point and the interval between time points was 10 min. Cosinor data and statistical analysis are given in table 2.c Resting energy expenditure (REE, defined as the mean energy expenditure during 10 min intervals of inactivity (see text) in each individual animal) in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats. Note the increase of REE in Tox vs Eu rats (**p<0.01) that was more pronounced than the decrease of REE in Hypo vs Eu rats (*p<0.05). Data are mean ± SEM of 7 animals per group.

34


as compared with euthyroid rats (p=0.002), and lower in hypothyroid rats (p=0.025 vs Eu, fig

1c). REE/TEE ratios showed no differences between groups (Hypo 0.83±0.02, Eu 0.85±0.02, Tox

0.82±0.01, KW p=0.657).

RER and substrate oxidation Euthyroid rats showed a diurnal rhythm in RER (fig 2a), although

less evident than the rhythm in TEE and SPA. The nocturnal acrophase fits with a relative increase

in glucose oxidation in the dark (i.e. feeding) period. Both Tox and -although to a lesser extent-

Hypo rats showed a decrease in mean RER levels relative to euthyroid rats (Tox: 94% of Eu

levels, p=0.006, Hypo: 96% of Eu levels, p=0.041). In addition, cosinor analysis revealed that the

amplitude of the day-night rhythm in RER was markedly increased in Tox rats (155%, p=0.007).

Although the RER phase difference between the Eu and Tox groups did not reach statistical

Table 2: Data derived from cosinor curve-fit of all individual animals with statistical analysis.

Energy Expenditure (kcal/h*kg)

Mesor Amplitude Acrophase (h) n

Hypo 6.52 ± 0.26 “ ^ 0.64 ± 0.15 * ^ 23.15 ± 0.16 * ^ 7

Eu 7.24 ± 0.21 1.19 ± 0.09 00.23 ± 0.18 7

Tox 10.46 ± 0.67 * 1.70 ± 0.32 00.39 ± 0.22 7

p=0.001 p=0.009 p = 0.015

Spontaneous Physical Activity (AU)


Hypo 63 ± 6 37 ± 8 00.26 ± 0.15 7

Eu 62 ± 5 38 ± 5 01.09 ± 0.35 7

Tox 60 ± 7 33 ± 6 00.13 ± 2.25 7

p = 0.901 p = 0.780 p = 0.248

Respiratory Exchange Ratio


Hypo 0.94 ± 0.01 * 0.0123 ± 0.0014 ^ 20.44 ± 0.30 * ^ 7

Eu 0.97 ± 0.01 0.0120 ± 0.0010 22.27 ± 0.24 7

Tox 0.91 ± 0.01 * 0.0306 ± 0.0110 * 03.35 ± 2.48 7

p = 0.014 p = 0.032 p = 0.018

* p≤0.05 vs Eu, “ p=0.073 vs Eu, ^p<0.05 vs Tox

significance (p=0.128), there appeared to be an inverse rhythm in Tox relative to hypothyroid

rats (p=0.017). Hypothyroid animals showed a RER increase in the early part of the dark period,

whereas Tox rats showed a pronounced trough in RER during the feeding periods at the beginning

and end of the dark period. Cosinor analysis confirmed that hypothyroid rats exhibit a decrease

(p=0.053) in the mesor of their RER day-night rhythm relative to Eu rats, but less pronounced

than in Tox animals (p=0.008). The acrophase of the RER rhythm in hypothyroid animals was ~2-h

phase-advanced relative to Eu (p=0.037), and almost 7-h relative to Tox animals (p=0.017).


35

Chapter 2


Substrate oxidation is depicted in figs 2b and 2c. In euthyroid animals, mean levels of glucose

oxidation were ~30-fold higher than fat oxidation, in line with ad libitum access to carbohydrate-

rich chow. Tox animals showed no difference in glucose oxidation relative to euthyroid rats,

Fig 2a Forty-eight-hour respiratory exchange ratio (RER) in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats entrained to a regular 12/12 L/D cycle. Horizontal black bars indicate the dark phase of the L/D cycle. Data are mean of 7 animals per group at each time point, and the interval between time points was 10 min. Cosinor data and statistical analysis are given in table 2. b Mean 48 h glucose oxidation in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats. Note that Hypo rats exhibit decreased glucose oxidation as compared with Eu animals (*p<0.05). c Mean 48 h fat oxidation in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats. Note that Tox rats exhibit increased fat oxidation as compared with Eu animals (**p<0.01).

36


whereas Hypo rats showed a mild decrease in mean level of glucose oxidation relative to Eu

(19%, p=0.035) and Tox animals (23%, p=0.026, fig 2b). Mean levels of fat oxidation were

markedly (479%) increased in Tox relative to Eu rats (p=0.006), but there was no difference in

fat oxidation between Hypo and Eu rats (p=0.110, fig 2c). Thus, RER showed a decrease in both

Tox and -to a lesser extent- Hypo animals relative to Eu rats. However, the mechanism of this

decrease was different between groups, i.e. a decrease of glucose oxidation in Hypo animals,

and a pronounced increase in fat oxidation in Tox animals.

Experiment #2: Effects of thyroid status on lipid turnover, uptake and partitioning

In order to determine how whole body alterations in fat oxidation induced by thyrotoxicosis

and hypothyroidism translated into substrate (i.e. FA) uptake at the tissue level, we applied a

dual FA-isotope infusion technique that permits differentiation between plasma TG-derived and

plasma albumin-bound FA uptake.

Plasma thyroid hormones Plasma T3, T4 and TSH concentrations (table 3) showed differences

between groups very similar to the T3, T4 and TSH differences in experiment #1.

FA and TG plasma concentrations and rate of disappearance Plasma FA concentrations

were 118% higher in thyrotoxic relative to euthyroid rats (p=0.004). Plasma TG concentrations

tended to increase in thyrotoxic (p=0.059) rats, and showed a significant decrease in hypothyroid

(p=0.046) compared with euthyroid rats (Table 4).

Rate of disappearance (Rd) of 14C-FA was 59% increased in thyrotoxic relative to euthyroid rats

(p=0.054). There were no differences in Rd of 3H-TG between groups (Table 4).

Tissue-specific TG-derived FA uptake, lipoprotein lipase (LPL), hepatic lipase (HL) activity

and albumin-bound FA uptake Thyrotoxicosis induced an increase of TG-derived FA uptake

Table 3: Experiment #2: plasma thyroid hormone concentrations before radio-labeled FA infusion (day 11) in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats.

Hypo n = 9 Eu n = 8 Tox n = 7

T3 (nmol/L) 0.41 ± 0.08 ** 1.21 ± 0.09 2.78 ± 0.27 **

T4 (nmol/L) 19 ± 2 ** 139 ± 7 187 ± 5 **

TSH (mU/L) 10.9 ± 1.8 ** 0.2 ± 0.0 0.2 ± 0.0

**p<0.0001 vs Eu

in striated muscle (58%, p=0.040, fig 3a), and tended to increase TG-derived FA uptake in

heart (78%, p=0.059) relative to euthyroid rats, but did not induce alterations in muscle or

heart LPL activity (fig 3b). Thyrotoxicosis induced a pronounced decrease in TG-derived FA

uptake to 21% of euthyroid levels in BAT (p<0.0001). It should be noted that FA uptake was

approximately 30-fold higher in BAT as compared to oxidative striated muscle, in line with the

high mitochondrial density and high FA oxidative capacity of brown adipocytes. Thyrotoxicosis

had no effect on TG-derived FA uptake in any of the WAT depots, although it induced a modest

decrease in LPL activity in gonadal WAT (48%, p=0.043). In contrast, hypothyroid rats showed a

pronounced increase of TG-derived FA uptake in gonadal and visceral WAT (184%, p=0.002 and

75%, p=0.036, respectively, fig 3a), associated with an increase in LPL activity both in gonadal


37

Chapter 2


and visceral WAT (234%, p=0.001 and 306%, p=0.012, respectively, fig 3b). In liver, hypothyroid

rats showed decreased TG-derived FA uptake relative to euthyroid rats (37%, p=0.046) but no

change in HL activity. Conversely, thyrotoxic rats showed no effect on TG-derived FA uptake but

an increase in HL activity (52%, p=0.009).

Thyrotoxicosis induced an increase in albumin-bound FA uptake in striated muscle (71%,

p=0.054, fig 3c), a 97% increase of albumin-bound FA uptake in gonadal WAT (p=0.043), and it

similarly tended to increase albumin-bound FA uptake in subcutaneous and visceral WAT (71%,

p=0.059 and 129%, p=0.059, respectively). There was no difference in albumin-bound FA uptake

between hypothyroid and euthyroid rats in any of the tissues studied.

DiscussionWe studied the changes in whole body energy metabolism associated with thyroid hormone

status and we delineated how these changes translate into substrate (i.e. FA) uptake at the

tissue level. Our main findings are that thyrotoxicosis induces a hypermetabolic phenotype

(increased TEE, REE, and fat oxidation) as well as increased food intake favouring substrate

replenishment. Interestingly, thyrotoxicosis did not increase SPA, indicating that changes in SPA

do not contribute to increased TEE. Moreover, hypermetabolism was associated with increased

TG-derived FA uptake in most oxidative tissues, whereas TG-derived FA uptake was unaltered in

WAT. Conversely, hypothyroidism induced a hypometabolic phenotype with a mild decrease in

REE, a trend towards decreased TEE, and a decrease of glucose oxidation. In addition, TG-derived

FA uptake was increased in lipid storing WAT, concomitantly with increased LPL activity. However,

during hypothyroidism TG-derived FA uptake in oxidative tissues was unaltered. These alterations

in TG-derived FA uptake during thyrotoxicosis and hypothyroidism indicate that FA uptake from

TG-rich lipoproteins is differentially regulated by thyroid hormones in a tissue-specific manner.

The mechanism of the increase of TEE induced by thyrotoxicosis is incompletely understood. It

has been known for many years that REE is highly responsive to thyroid hormones (1). In addition,

many thyrotoxic patients show a characteristic resting tremor and self-reported increased physical

activity. Conversely, many hypothyroid patients complain of slowness (19). However, there is

little experimental evidence indicating that thyroid status modulates locomotor behaviour or

Table 4: Experiment #2: plasma fatty acids (FA) and triglycerides (TG) before radio-labeled FA infusion (day 11) and Rate of disappearance (Rd) of labeled FA and TG in hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats.

Hypo n = 9 Eu n=8 Tox n=7

Plasma concentration

FA (mmol/L) 0.50 ± 0.10 0.44 ± 0.03 0.96 ± 0.33 *

TG (mmol/L) 0.45 ± 0.08 * 0.71 ± 0.07 1.30 ± 0.31 ^ “

Rd (μmol/kg*min)

[14C]-FA 6.95 ± 1,75 6,64 ± 1,69 10,56 ± 1,19 *

[3H]-TG 6,89 ± 2,67 7,05 ± 2,63 6,48 ± 0,76

* p≤0.05, ^ p=0.059 vs Eu, “ p<0.05 vs Hypo

38


a Triglyceride (TG)-derived fatty acid (FA) uptake in striated muscle, heart, liver, three white adipose tissue (WAT) depots (gonadal, subcutaneous, visceral) and infra-scapular brown adipose tissue (BAT) of hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats. b Lipoprotein lipase activity in striated muscle, heart, and three white adipose tissue (WAT) depots (gonadal, subcutaneous, visceral) and hepatic lipase activity in liver of hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats. c Albumin-bound FA uptake in striated muscle, heart, liver, three WAT depots (gonadal, subcutaneous, visceral) and BAT of hypothyroid (Hypo), euthyroid (Eu) and thyrotoxic (Tox) rats.. 0.05<p<0.10, *p≤0.05, **p<0.01 vs Eu.


39

Chapter 2


SPA, and it is unclear how this relates to the alterations in energy homeostasis induced by

hypothyroidism and thyrotoxicosis. This is of particular interest, since accumulating evidence

suggests that EE associated with SPA, termed non-exercise activity thermogenesis (NEAT), is an

independent (negative) determinant of (development of) obesity in humans and rodents. As

thyroid hormone is a principal regulator of energy metabolism, it may also be involved in the

regulation of NEAT. The present study shows that although moderate hyperthyroidism increases

TEE by 37%, it induces no alterations in SPA. In contrast, resting energy expenditure (REE),

defined as the energy expended during time periods when no activity was detected, is increased

by 61% in thyrotoxic rats. Moreover, hypothyroidism induces a significant 12% decrease of REE,

but it does not affect SPA either, and REE/TEE ratios are unaffected by both hypothyroidism and

thyrotoxicosis. Together, our data strongly suggest that the increased energy requirements of

SPA are not determined by thyroid hormone status and do not explain increased TEE associated

with thyrotoxicosis.

Our data are in contrast with those of Levine et al. (5) who reported increased SPA during

thyrotoxicosis in rats, suggesting that NEAT was a significant component of the increase in TEE.

This discrepancy is most likely explained by the pharmacological dose of T3 used by Levine et al.

to induce thyrotoxicosis, resulting in a ~13-fold increase in plasma T3. In the present study serum

T3 was increased only 2.5-fold, in keeping with the range of plasma T3 often found in patients

with thyrotoxicosis. Interestingly, this was paralleled by a relatively mild, 30% increase in plasma

T4 concentrations. In thyrotoxic patients, a relative overproduction of T3 giving rise to increased

plasma T3/T4 ratios may be observed (20). Deiodinase type 1 (D1), which is mainly expressed

in liver and kidney, is positively regulated by T3 (21). Therefore, D1-mediated T3 production is

thought to be a major source of extra-thyroidal T3 during hyperthyroidism (22). Indeed, the

increased T3/T4 ratio in our rat model of thyrotoxicosis is paralleled by an induction of hepatic D1

expression (7), which may underlie the relatively mild increase of plasma T4 relative to T3.

Our experimental approach does not allow for measurement of other components of TEE, such

as diet-induced thermogenesis (absorption, digestion and metabolism of food) and facultative

thermogenesis (energy expended to maintain body temperature during cold exposure in

homeothermic species). However, it is reasonable to assume that the 18% increase in 48 h

cumulative food intake led to an increase of diet induced thermogenesis in thyrotoxic rats,

although this component generally comprises only a minor part (~10-15%) of TEE. Facultative

thermogenesis is unlikely to have played a role in our study, as it is generally negligible under

thermo-neutral circumstances.

TH is known to play a role in regulating seasonal adaptations in several species, for example

reproduction and maintenance of body weight (23;24), but its possible involvement in modulating

rhythms of shorter phase, i.e. circadian rhythms, has received less attention. This possibility is

theoretically supported by thyroid hormone receptor α1 mRNA expression in the region of

the main circadian oscillator, i.e. the suprachiasmatic nuclei (SCN) (25), although this has not

been confirmed at the protein-level (26;27). Previous studies have shown lack of an effect of

hypothyroidism on rhythms of locomotor (wheel running) activity (28). Therefore, the subtle

effects of hypothyroidism on the acrophase of the daily TEE and RER rhythms we did observe,

are most likely occurring downstream of the SCN. Euthyroid rats exhibited a through in RER

40


during the light period, fitting with relatively high fat oxidation during the inactive period when

little food is consumed. The shift in acrophase of RER in thyrotoxic rats appears to be mainly due

to increased fat oxidation during the nightly feeding periods (data not shown), suggesting that

during thyrotoxicosis, high energy demands require mobilization of energy stores on top of the

nutrients supplied by increased food intake during the active period.

Lipoprotein lipase (LPL) is the key enzyme regulating tissue-specific FA disposal by hydrolyzing

triglycerides (TG) in circulating TG-rich lipoprotein particles. LPL has been proposed as a metabolic

“gatekeeper” (29), directing substrate to tissues dependent on the body’s metabolic status

(30;31). In the present study, we explored TH effects on tissue FA uptake, and we were able to

differentiate between TH effects on TG-derived (i.e. LPL-dependent) and albumin-bound (i.e. LPL-

independent) FA uptake on the tissue level. In addition, we measured tissue-specific LPL activity.

In keeping with the observed hypermetabolic state associated with thyrotoxicosis, we found that

thyrotoxicosis increases TG-derived FA uptake in major oxidative tissues such as striated muscle

and the heart, without affecting TG-derived FA uptake in lipid-storing WAT depots. This increase

in TG-derived FA uptake in oxidative tissues was not paralleled by increased local LPL activity. It

has been previously reported that the linear relationship between muscle TG-derived FA uptake

and LPL activity in euthyroid animals is lost after experimental alterations in thyroid status (32).

This may be explained by TH effects on additional determinants of the process of TG-derived

FA-uptake. In addition, TH induced stimulation of local blood flow (33;34) may have interfered

with FA-uptake, independently of LPL activity.

Conversely, hypothyroidism increased TG-derived FA uptake in WAT. Indeed, earlier studies in

rats have also reported increased LPL activity in WAT during hypothyroidism (35) that could

be reversed by tri-iodothyronine (T3) administration (36;37). However, hypothyroidism had

no effect on TG-derived FA uptake in oxidative tissues. In the liver, hypothyroidism decreased

TG-derived FA uptake but not hepatic lipase (HL) activity, whereas thyrotoxicosis increased HL

activity, but not TG-derived FA uptake. Taken together, the present evidence suggests that

during thyrotoxicosis, hypermetabolism and increased FA oxidation are facilitated by preferential

shuttling of TG-derived FA’s to oxidative tissues. Conversely, during hypothyroidism TG-derived

FA’s are shuttled to lipid storing WAT, away from the liver and oxidative tissues, via increased

tissue-specific LPL activity.

Circulating FAs that are not incorporated in TG-rich lipoprotein particles are bound to albumin

in plasma. We found that thyrotoxicosis increases albumin-bound FA uptake in muscle as well

as in the WAT depots, whereas hypothyroidism had no effect on albumin-bound FA uptake

in any of the tissues studied. Plasma FA concentration were increased in thyrotoxic, but not

in hypothyroid relative to euthyroid animals. This is in line with the notion that tissue uptake

of albumin-bound FA is mainly driven by the concentration gradient between the capillary

lumen and the intracellular space (30). Interestingly, in contrast to the increase in FA-uptake in

oxidative tissues like striated muscle and heart, thyrotoxicosis induced a pronounced decrease of

TG-derived FA uptake in BAT. BAT is the main site for adaptive thermogenesis in rodents. During

cold exposure, sympathetic stimulation of BAT induces local conversion of T4 to T3, thereby

generating heat via induction of mitochondrial uncoupling (38). Simultaneously, LPL is markedly

induced via a β-adrenergic mechanism, enabling replenishment of the FA used for mitochondrial


41

Chapter 2


oxidation (39). During thyrotoxicosis, increased thermogenesis has been proposed to evoke a

compensatory decrease in sympathetic tone to BAT (40;41). We now speculate that such a

decrease in sympathetic tone may explain the marked decrease in TG-derived FA uptake in the

present study, possibly via decreased LPL activity.

In conclusion, our data indicate that FA uptake from TG-rich lipoproteins is regulated by TH in

a tissue-specific manner. Thyrotoxicosis increases TG-derived FA uptake in all oxidative tissues

except BAT, whereas hypothyroidism increases TG-derived FA uptake in lipid storing WAT via

increased LPL activity, and decreases uptake in liver. In contrast, albumin bound FA uptake

during hypothyroidism and thyrotoxicosis appears to be merely mass, i.e. concentration gradient,

driven.

AcknowledgementsThe Ludgardine Bouwman-foundation and T.I. Pharma are kindly acknowledged for financial

support. We thank E. Johannesma-Brian and M.J. Geerlings for analytical support, and S.A.A. van

den Berg for excellent technical assistance.

Reference List 1. Baron DN 1959 Estimation of the basal metabolic rate in the diagnosis of thyroid disease. Proc R Soc

Med 52:523-525

2. Luddecke HF 1958 Basal metabolic rate, protein-bound iodine and radioactive iodine uptake: a comparative study. Ann Intern Med 49:305-309

3. Wiersinga WM, Chopra IJ 1982 Radioimmunoassay of thyroxine (T4), 3,5,3’-triiodothyronine (T3), 3,3’,5’-triiodothyronine (reverse T3, rT3), and 3,3’-diiodothyronine (T2). Methods Enzymol 84:272-303

4. Kim B 2008 Thyroid hormone as a determinant of energy expenditure and the basal metabolic rate. Thyroid 18:141-144

5. Levine JA, Nygren J, Short KR, Nair KS 2003 Effect of hyperthyroidism on spontaneous physical activity and energy expenditure in rats. J Appl Physiol 94:165-170

6. Jacobsen R, Lundsgaard C, Lorenzen J, Toubro S, Perrild H, Krog-Mikkelsen I, Astrup A 2006 Subnormal energy expenditure: a putative causal factor in the weight gain induced by treatment of hyperthyroidism. Diabetes Obes Metab 8:220-227

7. Klieverik LP, Sauerwein HP, Ackermans MT, Boelen A, Kalsbeek A, Fliers E 2008 Effects of thyrotoxicosis and selective hepatic autonomic denervation on hepatic glucose metabolism in rats. Am J Physiol Endocrinol Metab 294:E513-E520

8. Moller N, Nielsen S, Nyholm B, Porksen N, Alberti KG, Weeke J 1996 Glucose turnover, fuel oxidation and forearm substrate exchange in patients with thyrotoxicosis before and after medical treatment. Clin Endocrinol (Oxf) 44:453-459

9. Randin JP, Scazziga B, Jequier E, Felber JP 1985 Study of glucose and lipid metabolism by continuous indirect calorimetry in Graves’ disease: effect of an oral glucose load. J Clin Endocrinol Metab 61:1165-1171

10. Oppenheimer JH, Schwartz HL, Lane JT, Thompson MP 1991 Functional relationship of thyroid hormone-induced lipogenesis, lipolysis, and thermogenesis in the rat. J Clin Invest 87:125-132

11. Saffari B, Ong JM, Kern PA 1992 Regulation of adipose tissue lipoprotein lipase gene expression by thyroid hormone in rats. J Lipid Res 33:241-249

42


12. Teusink B, Voshol PJ, Dahlmans VE, Rensen PC, Pijl H, Romijn JA, Havekes LM 2003 Contribution of fatty acids released from lipolysis of plasma triglycerides to total plasma fatty acid flux and tissue-specific fatty acid uptake. Diabetes 52:614-620

13. Steffens AB. 1955 A method for frequent sampling blood and continuous infusion of fluids in the rat without disturbing the animal. Physiol Behav 4, 833-836.

14. McLean JA, Tobin G 1987 In: Animal and Human Calorimetry. Cambridge University Press; 100-112.

15. Rensen PC, Herijgers N, Netscher MH, Meskers SC, van Eck M, van Berkel TJ 1997 Particle size determines the specificity of apolipoprotein E-containing triglyceride-rich emulsions for the LDL receptor versus hepatic remnant receptor in vivo. J Lipid Res 38:1070-1084

16. Zechner R 1990 Rapid and simple isolation procedure for lipoprotein lipase from human milk. Biochim Biophys Acta 1044:20-25


18. Bligh EG, Dyer WJ 1959 A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37:911-917

19. Braverman LE, Utiger RD. Introduction to hypothyroidism. The Thyroid, A Fundamental and Clinical Text [9th edition], 679-700. 1-1-2009. Lippincott Williams & Wilkins.

20. Abuid J, Larsen PR 1974 Triiodothyronine and thyroxine in hyperthyroidism. Comparison of the acute changes during therapy with antithyroid agents. J Clin Invest 54:201-208

21. Zavacki AM, Ying H, Christoffolete MA, Aerts G, So E, Harney JW, Cheng SY, Larsen PR, Bianco AC 2005 Type 1 iodothyronine deiodinase is a sensitive marker of peripheral thyroid status in the mouse. Endocrinology 146:1568-1575

22. Bianco AC, Kim BW 2006 Deiodinases: implications of the local control of thyroid hormone action. J Clin Invest 116:2571-2579

23. Barrett P, Ebling FJ, Schuhler S, Wilson D, Ross AW, Warner A, Jethwa P, Boelen A, Visser TJ, Ozanne DM, Archer ZA, Mercer JG, Morgan PJ 2007 Hypothalamic thyroid hormone catabolism acts as a gatekeeper for the seasonal control of body weight and reproduction. Endocrinology 148:3608-3617


25. Bradley DJ, Young WS, III, Weinberger C 1989 Differential expression of alpha and beta thyroid hormone receptor genes in rat brain and pituitary. Proc Natl Acad Sci U S A 86:7250-7254



28. Morin LP 1988 Propylthiouracil, but not other antithyroid treatments, lengthens hamster circadian period. Am J Physiol 255:R1-R5

29. Greenwood MR 1985 The relationship of enzyme activity to feeding behavior in rats: lipoprotein lipase as the metabolic gatekeeper. Int J Obes 9 Suppl 1:67-70

30. Frayn KN, Arner P, Yki-Jarvinen H 2006 Fatty acid metabolism in adipose tissue, muscle and liver in health and disease. Essays Biochem 42:89-103


43

Chapter 2


31. Goldberg IG, Eckel RH, Abumrad NA 2008 Regulation of fatty acid uptake into tissues: lipoprotein lipase- and CD36-mediated pathways. J Lipid Res

32. Kaciuba-Uscilko H, Dudley GA, Terjung RL 1980 Influence of thyroid status on skeletal muscle LPL activity and TG uptake. Am J Physiol 238:E518-E523

33. Dimitriadis G, Mitrou P, Lambadiari V, Boutati E, Maratou E, Koukkou E, Panagiotakos D, Tountas N, Economopoulos T, Raptis SA 2008 Insulin-stimulated rates of glucose uptake in muscle in hyperthyroidism: the importance of blood flow. J Clin Endocrinol Metab 93:2413-2415

34. McAllister RM, Sansone JC, Jr., Laughlin MH 1995 Effects of hyperthyroidism on muscle blood flow during exercise in rats. Am J Physiol 268:H330-H335

35. Gavin LA, McMahon F, Moeller M 1985 Modulation of adipose lipoprotein lipase by thyroid hormone and diabetes. The significance of the low T3 state. Diabetes 34:1266-1271

36. Saffari B, Ong JM, Kern PA 1992 Regulation of adipose tissue lipoprotein lipase gene expression by thyroid hormone in rats. J Lipid Res 33:241-249

37. Gavin LA, Cavalieri RR, Moeller M, McMahon FA, Castle JN, Gulli R 1987 Brain lipoprotein lipase is responsive to nutritional and hormonal modulation. Metabolism 36:919-924

38. Silva JE 2006 Thermogenic mechanisms and their hormonal regulation. Physiol Rev 86:435-464

39. Carneheim C, Nedergaard J, Cannon B 1984 Beta-adrenergic stimulation of lipoprotein lipase in rat brown adipose tissue during acclimation to cold. Am J Physiol 246:E327-E333

40. Silva JE 2003 The thermogenic effect of thyroid hormone and its clinical implications. Ann Intern Med 139:205-213

41. Silva JE. 2005 Thermogenesis and the sympathoadrenal system in thyrotoxicosis. In: The Thyroid, A Fundamental and Clinical Text [9th edition], 607-620. Lippincott Wiliiams &Wilkins.

44


Effects of thyrotoxicosis and selective hepatic autonomic denervation on hepatic glucose metabolism in rats

Lars P. KlieverikHans P. SauerweinMariëtte T. AckermansAnita BoelenAndries KalsbeekEric Fliers

American Journal of Physiology: Endocrinology and Metabolism 2008:294, E513-520

3


AbstractThyrotoxicosis is known to induce a broad range of changes in carbohydrate metabolism. Recent

studies have identified the sympathetic and parasympathetic nervous system as major regulators

of hepatic glucose metabolism.

The present study aimed to investigate the pathogenesis of altered endogenous glucose

production (EGP) in rats with mild thyrotoxicosis. Rats were treated with methimazole in drinking

water and L-thyroxine (T4) from osmotic minipumps to either reinstate euthyroidism or induce

thyrotoxicosis. Euthyroid and thyrotoxic rats underwent either a sham operation, or a selective

hepatic sympathetic (Sx) or parasympathetic denervation (Px). After 10 days of T4 administration,

all animals were submitted to a hyperinsulinemic euglycemic clamp combined with stable isotope

dilution, to measure EGP.

Plasma tri-iodothyronine (T3) showed a fourfold increase in thyrotoxic as compared with euthyroid

animals. EGP was increased by 45% in thyrotoxic as compared with euthyroid rats and correlated

significantly with plasma T3. In thyrotoxic rats, hepatic PEPCK mRNA expression was increased

3,5-fold. Relative suppression of EGP during hyperinsulinemia was 34% less in thyrotoxic than

in euthyroid rats, indicating hepatic insulin resistance. During thyrotoxicosis, Sx attenuated the

increase in EGP, while Px resulted in increased plasma insulin with unaltered EGP as compared

with intact animals, compatible with a further decrease in hepatic insulin sensitivity.

We conclude that chronic, mild thyrotoxicosis in rats increases EGP, while it decreases hepatic

insulin sensitivity. Sympathetic hepatic innervation contributes only to a limited extent to increased

EGP during thyrotoxicosis, while parasympathetic hepatic innervation may function to restrain

EGP in this condition.

48


IntroductionThyrotoxicosis is associated with a broad range of alterations in metabolism and energy

homeostasis. Endogenous glucose production (EGP), lipolysis and proteolysis are increased

during thyrotoxicosis, providing the substrates needed for the concomitant increase in energy

expenditure (1). Thyrotoxic patients exhibit increased EGP and hepatic insulin resistance, i.e.,

hampered suppressive action of insulin on EGP (1;2). It is widely assumed that the metabolic

alterations during thyrotoxicosis represent direct effects of thyroid hormone (TH) on the

expression of TH-responsive genes, mediated by binding of tri-iodothyronine (T3) to thyroid

hormone receptors in peripheral organs (3). Indeed, one of the main target organs for metabolic

effects of TH is the liver, which has a key role in maintaining glucose homeostasis.

Until quite recently, the role of the central nervous system (CNS) as a focus of TH action was

thought to be largely confined to development. However, evidence is accumulating that TH has

many functions in the adult CNS as well, explaining for example the neuro-cognitive symptoms

of hypothyroidism and thyrotoxicosis (4-6). Recent studies have identified the autonomic

nervous system (ANS), controlled by hypothalamic centers, as a key player in the regulation

of glucose metabolism (7). We have previously demonstrated polysynaptic sympathetic and

parasympathetic pathways between the hypothalamic paraventricular nucleus (PVN), known to

control the autonomic efferent nerves, and the liver (8). Furthermore, we have shown that the

hypothalamus can stimulate EGP via sympathetic input to the liver (9). The functional relevance

of the parasympathetic input for hepatic glucose metabolism is evident from central effects

of insulin and fatty acids on EGP that could be completely abolished by transection of the

hepatic branch of the vagal nerve (10;11). Collectively, these observations indicate an important

physiological role for both sympathetic and parasympathetic efferent branches of the ANS in

regulating EGP.

It is unknown at present if indirect effects of TH via the efferent branches of the ANS contribute

to the changes in metabolism during thyrotoxicosis. We hypothesized that part of the changes

in glucose metabolism during thyrotoxicosis are mediated via sympathetic or parasympathetic

input to the liver. To test this hypothesis, we examined the effects of chronic, mild thyrotoxicosis

on EGP, as well as hepatic insulin sensitivity, using euglycemic hyperinsulinemic clamps and

stable isotope dilution in rats. We combined this with selective microsurgical sympathetic and

parasympathetic hepatic denervations to study the role of these efferent ANS branches in the

pathogenesis of thyrotoxicosis–induced changes in hepatic glucose metabolism.

Materials and Methods AnimalsMale Wistar rats (Harlan, Horst, the Netherlands), housed under constant conditions of

temperature (21 ± 1 °C) and humidity (60 ± 2%) with a 12-h light, 12-h dark (L/D) schedule

(lights on at 7.00 h am), were used for all experiments. Animals were allowed to adapt to

the new environment for at least 6 days before the first experimental manipulations. During

adaptation, animals were housed in groups of 4 per cage. Bodyweight (BW) was between 325

and 375 g. Food and drinking water were available ad libitum. All of the following experiments

Effects of thyrotoxicosis and selective hepatic autonomic denervation on hepatic glucose m

etabolism in rats

49

Chapter 3


were conducted with the approval of the Animal Care Committee of the Royal Netherlands

Academy of Art and Sciences.

Hormonal treatment; Block and ReplacementAt day 0 of the protocol animals were placed in individual cages (25 x 25 x 35 cm) and treated

with methimazole 0.025% (MMI, Sigma, the Netherlands) in drinking water containing 0.3%

saccharin. At day 7, osmotic minipumps (OMP, flow rate 5 μl/hr, Alzet 2ml2, Durect Corp.,

Cupertino, USA) loaded with L-thyroxine (T4, Sigma, the Netherlands) solved in NaOH 6.5 mM

and propylene glycol 50%, were implanted under the dorsal skin during the surgical procedure

(see below). OMPs delivered either 1.75 μg (replacement dose; euthyroid groups) or 16 μg

(thyrotoxic groups) T4/ 100 g BW per day.

SurgeryGeneral procedure At day 7, animals were anaesthetized using a mixture of Hypnorm (Janssen;

0.05 mL/100 g BW, i.m.) and Dormicum (Roche, the Netherlands; 0.04 mL/100 g BW, s.c.). During

abdominal surgery, the abdominal cavity was bathed regularly with saline to prevent drying of

the viscera. The abdominal wall and skin were closed separately with sutures (5–0 Perma-Hand

Said Ethicon). After surgery the animals were placed in an incubator (temperature 30 °C) until

awakening and saline (10 mL) was injected subcutaneously to compensate for deficient fluid

intake during recovery. Post-operative care was provided by subcutaneous injection of Temgesic

(Schering-Plough; Utrecht importer), 0.01 mL/100 g BW on the morning after surgery.

Jugular vein and carotid artery cannulation In all animals an intra-atrial silicone cannula

was implanted through the right jugular vein for infusion (12), and a second silicone cannula

was placed in the left carotid artery for blood sampling. Both cannulas were tunnelled to the

head subcutaneously, fixed with dental cement to 4 stainless-steel screws insered into the skull.

A mixture of Amoxicillin 60%, heparin 20% and saline 20% in polyvinylpyruvidon (Sigma, the

Netherlands) was used to fill the cannulas and prevent inflammation and occlusion. In the 10 days

between surgery and the hyperinsulinemic clamps, this mixture was replaced at least 3 times.

Hepatic denervations A laparotomy was performed in the midline. The liver lobes were gently

pushed up and the ligaments around the liver lobes severed. For hepatic sympathectomy (Sx),

the bile duct and the portal vein complex were visualized using an operating microscope (25×

magnification). The bile duct was isolated from the portal vein complex and all tissue running

allong the bile duct was transected using microsurgical instruments. At the level of the hepatic

portal vein, the hepatic artery devides into the hepatic artery proper and the gastro-duodenal

artery. This division occurs on the ventral surface of the portal vein. At this point, the arteries

were separated via blunt dissection from the portal vein. All nerve bundles running along the

hepatic artery proper were removed. Any connective tissue attachments between the hepatic

artery and the portal vein were cut, eliminating any possible nerve crossings. The sympathetic

denervation involves an impairment of both efferent and afferent nerves, but this procedure

does not impair the parasympathetic vagal input to the liver, as shown previously (9).

For hepatic parasympathectomy (Px), the fascia containing the common hepatic vagal branch

(HV) was stretched by gently moving the stomach, revealing the HV as it separates from the

left vagal trunk. The neural tissue was transected between the ventral vagal trunk and the liver.

50


The fascia between the stomach/esophagus and the liver were also transected to remove any

additional small branches (9).

Sham-operated rats, also referred to as intact (Int) rats underwent all procedures as described

above, except for transection of the neural tissue.

Hyperinsulinemic euglycemic clamp and stable isotope dilutionAt day 17, a hyperinsulinemic euglycemic clamp combined with stable isotope dilution was

performed in all animals. Each experiment consisted of a tracer equilibration period (t=-75 to

t=-15 min), a basal period (t=-15 to t=0 min) and a hyperinsulinemic period (t=0 to t=160 min).

The protocol was based on a validated hyperinsulinemic euglycemic clamping protocol for mice

(13), adjusted for the use of stable isotope tracers and for BW.

In the afternoon on the day before the hyperinsulinemic clamp, rats were connected to a metal

collar attached to polyethylene tubing (for blood-sampling and infusion) which was kept out of

reach of the animals by a counterbalanced beam. This allowed all subsequent manipulations

to be performed outside the cages without handling the animals. At 16.00 pm a venous blood

sample was obtained for determination of plasma concentrations of thyroid stimulating hormone

(TSH), T3 and T4.

On the hyperinsulinemic clamp day, food was removed from the cages 5 h before the first

basal measurements. At 11.00 am, a primed (8.0 μmol in 5 min) continuous (16.6 μmol/h)

infusion of the stable isotope tracer [6,6-2H2]-glucose (>99% enriched; Cambridge Isotope

Laboratories, Cambridge, USA) was started using an infusion pump (Harvard Apparatus,

Holliston, Massachusetts, USA). Before this, a blood sample for determination of background

isotopic enrichment was taken (200 μL, t=-75 min). After 60 min of equilibration time, blood

samples (200 μL) were obtained for measurement of glucose concentration, isotopic enrichment

(t=-15, -5 and 0 min), and plasma insulin concentration (t= -15 min).

Subsequently, a primed (10 mU in 4 min) followed by continuous (62.5 mU/h) infusion of human

recombinant insulin (Actrapid 100 IU/mL, Novo Nordisk, Alphen aan de Rijn, the Netherlands)

was started. To maintain euglycemia at 5.5 mmol/L (clamping period), glucose 25% was infused

at a variable rate. Blood glucose concentrations were measured every 10 min and consequently

glucose infusion rate was adjusted if needed. The 25% glucose solution was 1% enriched with

[6,6-2H2]-glucose to approximate the values for enrichment reached in plasma, thereby minimizing

changes in isotopic enrichment due to variable infusion rates of exogenous glucose. At t=100

min, blood samples (200 μL) were obtained for measurement of plasma glucose concentration,

isotope enrichment (t=100, 115, 130, 145 and 160 min) and plasma insulin concentration (t=100

min). After the clamp, rats were sacrificed and liver tissue was snap frozen and stored at -80°C

for subsequent analysis. Endogenous glucose production (EGP) and rate of disappearance (Rd)

were calculated using modified forms of Steele equations (14;15).

Plasma measurements Plasma glucose concentrations were determined in blood spots (<5 μL) using a glucose meter

(FreestyleTM, Abbott, the Netherlands) with inter- and intra-assay coefficients of variation (CV) of

less than 6% and 4%, respectively. Plasma concentrations of the thyroid hormones T3 and T4 were

determined by an in-house RIA (16), with inter- and intra-assay CV of 7–8% and 3–4% (T3), and


etabolism in rats

51

Chapter 3


3–6 and 2–4% (T4), respectively. Detection limits for T3 and T4 were 0.3 nmol/L and 5 nmol/L,

respectively. Plasma TSH concentrations were determined by a chemiluminescent immunoassay

(Immulite 2000, Diagnostic Products Corp., Los Angeles, CA), using a rat-specific standard. The

inter- and intra-assay CV for TSH were less than 4% and 2% at ±3.5 mU/L, respectively, and

the detection limit was 0.60 mU/L. Plasma insulin was measured by a commercially available

Elisa (Mercodia, Uppsala, Sweden). The inter and intra-assay CV were 4% and 2%, detection

limit 13 pmol/L. Glucose enrichment was measured as described earlier (17). The [6,6-2H2]-

glucose enrichment (tracer/ tracee ratio) inter-assay CV was 1%, the intra-assay CV 1%, and the

detection limit 0.04%.

High performance liquid chromatography electrochemical measurements To check the effectiveness of the hepatic sympathectomy, norepinephrine (NE) content in the

liver was measured. Liver tissue samples of 50 mg were homogenized in 1 ml ice-cold NH4Cl

buffer (0.2 M, containing 12 nmol/L α-methylnorepinephrine and 1 g/L EDTA, pH 7.0), and

centrifuged twice (14000 rpm) for 15 min at 4°C. NE was determined with an in-house HPLC

method. Essentially, NE was selectively isolated by liquid-liquid extraction (18) and derivatized with

the fluorescent 1,2-diphenylethylenediamine (19). The fluorescent derivatives were separated by

reversed phase liquid chromatography and detected by scanning fluorescence detection (510

pump, 717plus auto-sampler, 474 Scanning fluorescence detector, Waters Chromatography, the

Netherlands). Separation of NE from other endogenous compounds was achieved with a Waters

Xterra RP18 column (5 μm 3.9 x 150 mm). As an internal standard, α-methylnorepinephrine was

used. Intra and inter-assay CV were 3% and 20%, respectively. The detection limit for NE was

0.05 nmol/L.

We have previously evidenced the effectiveness of our method for selective hepatic

parasympathectomy by using retrograde viral tracing (9). In these studies, the success rate of

hepatic parasympathectomy was over 90%.

RNA isolation and Real Time PCRmRNA was isolated from 10 mg liver tissue using a Magna Pure apparatus and a Magna Pure LC

mRNA isolation kit II (tissue) (Roche Molecular Biochemicals, Mannheim, Germany) according to

the manufacturer’s protocol. cDNA synthesis was performed with the 1st Strand cDNA synthesis

kit for RT-PCR (AMV) (Roche Molecular Biochemicals). Previously published primer pairs were

used to amplify HPRT (hypoxanthine phosphoribosyl transferase, a housekeeping gene) (20). We

designed primer pairs for phosphoenolpyruvate carboxikinase (PEPCK) and type 1 iodothyronine

deiodinase (D1) with the following sequences; PEPCK forward TGCCCTCTCCCCTTAAAAAAG

and reverse CGCTTCCGAAGGAGATGATCT, D1 forward GAAGTGCAACGTCTGGGATT and

reverse CTGCCGAAGTTCAACACCA. Real Time PCR was performed using the LightCycler (Roche

Molecular Biochemicals, Mannheim, Germany) as described earlier (21). PCR programs were as

follows: pre-denaturation 10 min 95°C, amplification for 45 cycles which consists of denaturation

for 10 sec 95°C, annealing at various temperatures for 10 sec and elongation for 15 sec at 72°C

(annealing temperature: HPRT 54°C, PEPCK 55°C and D1 55°C). For quantification, standard

curves were generated of a sequence-specific PCR product ranging from 0.01 fg/μL until 100 fg/

μL. Samples were corrected as to their mRNA content using HPRT mRNA and plotted as relative

52


expression. Samples were individually checked for their PCR-efficiency (22). The median of the

efficiency was calculated for each assay and samples with a greater than 0.05 difference of the

efficiency median value were excluded from the analysis.

StatisticsData were analyzed by mixed model analysis of variance (ANOVA), with nature of denervation

(Int, Sx, Px) and thyroid hormonal status (euthyroid, thyrotoxic) as fixed effects. Significance

was defined at p<0.05. A LSD post hoc test was performed if ANOVA revealed significance to

determine which experimental groups differed from each other. Student one sample t-test was

used to determine statistical differences from zero. Mann Whitney U test was used to analyse

the PCR data. Pearson correlation was used to test for associations between factors. Data are

presented as mean ± SE.

Results Six groups of rats were studied, i.e. 3 euthyroid and 3 thyrotoxic groups. Euthyroid rats were

either sham operated (Eu Int, n=10), or underwent a selective hepatic sympathetic (Eu Sx, n=7)

or parasympathetic denervation (Eu Px, n=9). The same applied to thyrotoxic rats (Tox Int, n=10;

Tox Sx, n=7; Tox Px, n=10). Selective denervation of the sympathetic input to the liver resulted in

a significant 72% reduction in hepatic NE content (13.6 ± 2.3 vs. 49.1 ± 4.5 ng/g liver, p< 0.01,

Sx (n=14) vs. Int (n=20), respectively). On the other hand, the hepatic NE content of animals

with a selective parasympathetic denervation did not differ from intact animals (47.1 ± 8.6 ng/g

liver, Px (n=19)).

Body weight and eating behaviourAt the time of surgery, there was no difference in bodyweight (BW) between groups (Eu Int

348±5, Eu Sx 344±4, Eu Px 358±4, Tox Int 353±8, Tox Sx 350±7; Tox Px 362±5 g, ns).

The changes in BW after surgery and the overnight food intake before the clamp for each

experimental group are depicted in Fig 1. As expected, all thyrotoxic groups lost weight between

surgery and the hyperinsulinemic clamp, in contrast to euthyroid groups. Nevertheless, food

intake was higher (p< 0.01) in all thyrotoxic groups as compared with Eu Int rats, which is in

accordance with increased energy expenditure during thyrotoxicosis. It is important to note that

BW increased in all groups during the 3 days preceding the clamp, indicating full recovery from

surgery and a positive energy balance.

Plasma thyroid hormonesPlasma thyroid hormone concentrations at the time of the hyperinsulinemic clamps after 10

days of T4 treatment are depicted in Table 1.

In Eu Int rats, biochemical euthyroidism was evidenced by similar TSH concentrations as reported

earlier in control rats without hormonal treatment (16;23). Plasma TSH concentrations were

between 2.00 and 3.00 mU/L in all euthyroid groups. TSH was suppressed to levels below the limit

of detection in all thyrotoxic animals. Plasma T3 and T4 concentrations were significantly higher

in Tox Int as compared with Eu Int rats (4.3-fold, p< 0.01 and 2.0-fold, p< 0.01, respectively).

In euthyroid rats hepatic autonomic denervation did not affect plasma T3 and T4. However, in


etabolism in rats

53

Chapter 3


thyrotoxic rats both sympathetic and parasympathetic hepatic denervation lowered plasma T3

and T4, but not the T3/ T4 ratio, as compared with intact animals. In Tox Int rats, the T3/ T4 ratio

was significantly increased as compared with Eu Int animals.

Glucose, insulin, glucose kinetics and hepatic mRNA expressionBasal state Tox Int rats exhibited increased basal plasma glucose concentration as compared

with Eu Int rats (Fig 2a). Basal insulin concentration was not affected by thyrotoxicosis per

se (Fig 2b). In accordance with the increase in basal plasma glucose concentration, basal EGP

was increased by 45% in Tox Int as compared with Eu Int rats (Fig 2c). In line with this, mRNA

expression of PEPCK, the rate limiting enzyme of gluconeogenesis, was increased 3,5-fold in

thyrotoxic animals (Fig 3a). In addition, mRNA expression of the T3 responsive gene deiodinase

type 1 was upregulated 4-fold in the liver of thyrotoxic animals supporting the thyrotoxic state on

the level of the hepatocyte (Fig 3b).

Table 1 T3, T4 and TSH plasma concentration at time of the hyperinsulinemic clamps in experimental animals.

Eu Intn = 10

Eu Sxn = 7

Eu Pxn = 9

Tox Intn = 10

Tox Sxn = 7

Tox Pxn = 10

T3 (nmol/L) 0.86 ± 0.08 0.88 ± 0.05 0.73 ± 0.04 3.66 ± 0.31 ^^2.78 ± 0.33 ^^* 2.81 ± 0.18 ^^*

T4 (nmol/L) 130 ± 6 111 ± 9 135 ± 5 255 ± 18 ^^ 169 ± 15 ^* 209 ± 17 ^^*

TSH (mU/L) 2.53 ± 0.94 2.13 ± 1.02 2.85 ± 0.83 < 0.60 ^ < 0.60 ^ < 0.60 ^

Eu Int = euthyroid sham liver denervated, Eu Sx = euthyroid hepatic sympatectomized, Eu Px = euthyroid hepatic parasympatectomized, Tox Int = thyrotoxic sham liver denervated, Tox Sx = thyrotoxic hepatic sympatectomized, Tox Px = thyrotoxic hepatic parasympatectomized. Data are mean ± SE. ^ p< 0.05, ^^ p< 0.01 vs. Eu Int, * p< 0.01 vs. Tox Int as revealed by post hoc LSD, only when ANOVA indicated p< 0.05 for the respective factor.

0

10

20

30

^ ̂^ ̂

^ ̂

n= 10 7 9 10 7 10

Food

(g)

1b

Eu In

t

Eu S

x

Eu P

x

Tox

Int

Tox

Sx

Tox

Px

- 40

-30

-20

-10

0

#

#

#

∆ BW

(g)

1a

Fig 1 a Food consumed by euthyroid (left) and thyrotoxic (right) groups in the night before the hyperinsulinemic clamp. ANOVA was significant (p< 0.0001) for factor thyroid hormone status. ^^ p< 0.01 vs. Eu Int as revealed by post hoc LSD. b BW difference (ΔBW) between time of surgery and time of the hyperinsulinemic clamp in experimental groups. Note that despite the increase in food consumption (1a), none of the thyrotoxic groups regained their time of surgery BW at time of the hyperinsulinemic clamps. # p< 0.01; H0: ΔBW=0, as revealed by student one sample t-test. Data are mean ± SE. The number of animals per experimental group is depicted under the bars of figure 1a. See legend with table 1 for definition of group abbreviations.

54


In euthyroid rats, selective hepatic sympathetic

or parasympathetic denervation did not affect

glucose concentration, insulin concentration

or EGP. In thyrotoxic rats, there was no

statistically significant effect of sympathetic

denervation on basal EGP in thyrotoxic

animals. However, the relative increase of

EGP in Tox Sx rats as compared with Eu Int

rats was smaller than in the other thyrotoxic

groups (Fig 2c). In line with this, Tox Sx animals

exhibited unaltered glucose concentration as

compared with Eu Int rats, in contrast to the

increased glucose concentration in Tox Int

and Tox Px rats (Fig 2a). During thyrotoxicosis,

selective hepatic parasympatectomy induced a

marked increase in basal insulin concentration

(Fig 2b). This increase in insulin concentration

was accompanied by unaltered glucose

concentration and EGP in Tox Px as compared

with Tox Int animals, indicating hepatic insulin

resistance. There was no effect of hepatic

denervation in both euthyroid and thyrotoxic

rats on hepatic mRNA expression of PEPCK

and D1 (data not shown).

Hyperinsulinemic state After 100 min

of insulin infusion, insulin concentrations

increased in all groups (p<0.05) as compared

to the basal state (mean increment 229±25

pmol/L). There was no difference in plasma

insulin concentration between groups.

As expected, EGP decreased in all groups

in response to hyperinsulinemia. During

the clamp, EGP was 122% higher in Tox

Int as compared with Eu Int rats. There

was no effect of sympathetic denervation

on hyperinsulinemic EGP in euthyroid or

thyrotoxic rats. Parasympathetic denervation

slightly increased hyperinsulinemic EGP in

euthyroid and thyrotoxic rats, although this

effect missed statistical significance (Fig 4a).

In Tox Int rats, the relative suppression of

EGP in the hyperinsulinemic as compared

Fig 2 a Mean basal plasma glucose concentrations. ANOVA indicated p< 0.003 for factor thyroid hormonal status. ^ p< 0.05 vs. Eu Int as revealed by post hoc LSD. b Basal plasma insulin concentrations. Note the elevated insulin concentration in thyrotoxic parasym-pathectomized rats. ANOVA indicated p< 0.001 for factor denervation status and p< 0.05 for interaction. * p≤ 0.01 vs. Tox Int as revealed by post hoc LSD. c Endogenous glucose production (EGP) in the basal condition of experimental groups. Note increased EGP all thyrotoxic groups relative to euthyroid intact rats, except for Tox Sx animals, in which the relative increase in EGP is lower. ANOVA was significant (p< 0.0001) for factor thyroid hormonal status. ^ p≤ 0.05, ^^ p≤ 0.01 vs. Eu Int as revealed by post hoc LSD. Data are mean ± SE. The number of animals per experimental group is depicted under the bars of figure 2a. See legend with table 1 for definition of group abbreviations.

2a

3

4

5

6

7

^ ^

n= 10 7 9 10 7 10

Glu

cose

(m

mol

/L)

2b

0

100

200

300

400

500

600

*

Insu

lin (

pmol

/L)

2c

Eu In

t

Eu S

x

Eu P

x

Tox

Int

Tox

Sx

Tox

Px 0

25

50

75

100^^ ^^

^

EG

P Ba

sal(µ

mol

/kg*

min

)


etabolism in rats

55

Chapter 3


with the basal state (% suppression of EGP) was decreased relative to Eu Int rats (Fig 4b). There

was a highly significant positive correlation between plasma T3 concentration and EGP both

in the basal and hyperinsulinemic state (Fig 5). Rd was similar between the groups (data not

shown).

3a

0

1

2

3

4

5^

Eu Tox n=9 n=9

Rela

tive

PEPC

K m

RNA

exp

ress

ion

3b

0

1

2

3

4

5 ^^

Eu Tox n=8 n=9

Rela

tive

D1

mRN

A e

xpre

ssio

n

Fig 3 Hepatic mRNA expression of PEPCK (a) and D1 (b), relative to HPRT, a housekeeping gene. Note the 3,5-fold increase in hepatic PEPCK and the 4-fold increase in D1 expression in thyrotoxic intact relative to euthyroid intact rats. Statistical differences are depicted by symbols; ^ p< 0.05, ^^ p< 0.01 vs. Eu. Data are mean ± SE. Number of animals per experimental group is depicted under the bars of both figures. Eu = euthyroid intact animals, Tox = thyrotoxic intact animals.

4a

0

25

50

75

100

^^ ^^^^

n= 10 7 9 10 7 10

EG

P Cl

amp(µ m

ol/k

g*m

in)

4bEu

Int

Eu S

x

Eu P

x

Tox

Int

Tox

Sx

Tox

Px 0

25

50

75

^^

^

Supp

ress

ion

EGP

(%)

Fig 4 a Endogenous glucose production (EGP) during the hyperinsulinemic clamp of experimental groups. Note increased EGP in all thyrotoxic groups relative to euthyroid intact rats. ANOVA was significant (p< 0.0001) for factor thyroid hormonal status. ^^ p≤ 0.01 vs. Eu Int as revealed by post hoc LSD. b Percent suppression of EGP in the hyperinsulinemic state relative to the basal state of experimental groups. Note that all thyrotoxic groups exhibit decreased % suppression of EGP as compared with euthyroid intact rats, indicating hepatic insulin resistance during thyrotoxicosis. ANOVA indicated p< 0.009 for factor thyroid hormonal status, p= 0.216 for factor denervation. ^ p≤ 0.05 vs. Eu Int as revealed by post hoc LSD. Data are mean ± SE. Number of animals per experimental group is depicted under the bars of figure 3a. See legend with table 1 for definition of group abbreviations.

56


DiscussionThe primary findings of this study are that chronic, mild thyrotoxicosis in rats increases EGP, while

it decreases relative suppression of EGP during hyperinsulinemic clamps, indicating hepatic insulin

resistance. This is supported by a highly significant, positive correlation between plasma T3 and

EGP. The increased EGP during thyrotoxicosis can be attenuated by selective hepatic Sx. Selective

hepatic Px increases plasma insulin in thyrotoxic rats without a change in EGP, indicating hepatic

insulin resistance. These combined findings indicate that T3 is an important direct determinant of

EGP in thyrotoxicosis with a small contribution via the sympathetic nervous system. Furthermore,

parasympathetic innervation of the liver may function to restrain EGP during mild thyrotoxicosis,

as after Px more insulin is needed to keep EGP at the level found in mild thyrotoxicosis.

The striking resemblance between many of the effects of thyrotoxicosis and sympathetic nervous

stimulation has been long noted. Because of this similarity, the syndrome of goiter, exophthalmus

and tachycardia as described by Von Basedow (i.e. the Merseberg triad), has been regarded a

disease of the sympathetic nervous system by physiologists at the time (24). By the end of the

19th century, this led to the surgical treatment of severe thyrotoxicosis by cervical sympathetic

chain resection (25) and later by high spinal anaesthesia or adrenal denervation (26). These

practices were gradually abandoned with increasing knowledge of the thyroid gland and of TH.

However, it is still common practice nowadays to start treatment of severe thyrotoxicosis with

beta-adrenergic blockers until a clinical effect of anti-thyroid drugs is reached.

In literature, the idea of increased sympathetic tone during hyperthyroidism has gradually moved

to the background. However, as more accurate techniques for measuring sympathetic tone

have become available, evidence is building up for increased sympathetic neural output to white

adipose tissue in hyperthyroid patients (27). In addition, hyperthyroid patients exhibit increased

sympathetic and decreased parasympathetic output to the heart as revealed by heart rate

spectral analysis (28;29).

To discriminate between peripheral and central effects of TH, an experimental model is needed

in which central and peripheral manipulations can be performed without interfering with the

systemic thyroid hormone milieu. For this, we have used “block and replacement” treatment in

5a

0 1 2 3 4 5 60

25

50

75

100

125 p< 0.0001r2= 0.41

T3 (nmol/L)

EGP

Basa

l (µ m

ol/k

g*m

in)

5b

0 1 2 3 4 5 60

25

50

75

100

125 p< 0.0001r2= 0.27 Tox Int

Eu IntEu SxEu Px

Tox SxTox Px

T3 (nmol/L)

EGP

Clam

p(µ

mol

/kg*

min

)

Fig 5 Relation between basal EGP (a) or hyperinsulinemic EGP (b) and plasma T3 concentration in all experimental animals. Pearson correlation coefficient and p values are depicted in the lower right corner of both figures.


etabolism in rats

57

Chapter 3


rats. This means that rats are treated with the thyreostatic MMI in drinking water to inhibit TH

synthesis and simultaneously, T4 is administered by use of osmotic minipumps. In this way, T4

is released continuously, mimicking the release of TH by the thyroid gland. We used two doses

of T4, i.e., a replacement dose giving rise to sustained euthyroidism and an 8-fold higher dose

inducing mild thyrotoxicosis. The duration of T4 administration was 10 days, resulting in a chronic

state of mild thyrotoxicosis in rats treated with the highest T4 dose, as evidenced by a 4.3-fold

and 2.0-fold increase in plasma T3 and T4, respectively, and a decrease of plasma TSH. In line with

this, the hepatic mRNA expression of the D1, a T3 responsive gene which is a sensitive marker of

peripheral thyroid status (30), showed a 4-fold increase in thyrotoxic animals.

In the present study, we have shown for the first time that mild thyrotoxicosis induces hepatic

insulin resistance in freely moving, conscious rats. A hyperinsulinemic euglycemic clamp combined

with isotope dilution is the gold standard for measuring hepatic insulin sensitivity (31). Although

there have been reports of altered EGP during thyroid hormone excess in vivo (32;33), to our

knowledge up until now hyperinsulinemic euglycemic clamps combined with isotope dilution

have never been used to study alterations in EGP and its sensitivity to insulin in thyrotoxic rats.

In the literature, data on the effect of hepatic Px on EGP and hepatic insulin resistance are

discordant. Studies combining manipulation of fatty acid metabolism and hepatic vagal

denervation in rats, point to an important role of the hepatic vagal nerve in mediating the effects

of central lipid sensing on EGP (10;34). Likewise, the repressive effect of icv infused insulin on

EGP can be completely abolished by hepatic vagal denervation (11). In these and other studies

(35), hepatic Px in itself does not affect EGP. In the present study, during thyrotoxicosis but

not during euthyroidism, selective hepatic Px induced insulin resistance. The notion arises that

a consistent effect of vagal hepatic denervation becomes manifest only in combination with an

additional stimulus such as manipulation of central lipid sensing, icv insulin infusion or systemic

thyroid hormone excess.

We observed a decrease in plasma concentrations of T3 and T4 by both Sx and Px in thyrotoxic

rats, although equal doses of T4 were administered via osmotic minipumps in thyrotoxic intact

and thyrotoxic denervated animals. Hepatic denervation did not result in significant changes

in hepatic D1 mRNA expression, in accordance with the unaffected T3/ T4 ratio. Thus, altered

synthesis or clearance of TH binding proteins such as transthyretin in the liver, or altered hepatic

clearance of TH resulting from hepatic autonomic denervation during thyrotoxicosis are more

plausible explanations.

The present study shows that the alterations in glucose metabolism induced by thyrotoxicosis

are slightly modulated by selective hepatic autonomic denervation. Thus, the efferent autonomic

nerves may be responsible for part of these changes. At this stage, it remains unknown which CNS

areas control the ANS efferent nerves affecting hepatic glucose metabolism during thyrotoxicosis.

The hypothalamus is a key central site of thyroid hormone action, and both the human (36) and

rat (37) hypothalamus abundantly express thyroid hormone receptors. This specifically applies to

the paraventricular nucleus, where the (pre-) autonomic neurons that control sympathetic and

parasympathetic motor-neurons are located, and the arcuate nucleus, where the blood brain

barrier is absent. This suggests that the hypothalamus is perfectly equipped to sense and process

TH signals, not only via the neuro-endocrine route but also via its connections with the ANS, and

58


to regulate hepatic glucose metabolism. The observations that other hormones such as insulin

(11), estrogen (38) and glucocorticoids (39) affect metabolism via central (hypothalamic) sites of

action independently of the peripheral hormonal milieu support the possibility that TH may affect

autonomic outflow from the hypothalamus to the liver. However, we are aware of only one

study addressing peripheral physiological effects of centrally administered TH. In this study (40),

an intracerebroventricular (icv) bolus infusion of T3 in surgically thyroidectomized, hypothyroid

rats increased heart rate. The same dose showed no effect after intravenous infusion, suggesting

T3-responsive central nervous system regulation of heart rate. Taken together, these data support

the notion that TH may affect hepatic glucose metabolism via central (hypothalamic) actions,

which will be the subject of further studies.

In conclusion, we have shown that chronic, mild thyrotoxicosis in rats increases EGP and induces

hepatic insulin resistance. The increase in EGP is slightly attenuated by selective sympathetic liver

denervation. T3 is an important direct determinant of EGP in thyrotoxicosis with a small indirect

contribution via the sympathetic nervous system. Selective parasympathetic denervation during

thyrotoxicosis aggravates hepatic insulin resistance. By inference, parasympathetic innervation of

the liver may function to restrain EGP during mild thyrotoxicosis. During systemic thyrotoxicosis,

the peripheral effects of TH on EGP apparently outweigh the hypothesized central effects. This

does not exclude a role for central TH action in fine-tuning of EGP. Further studies will be needed

to reveal if thyroid hormone affects EGP upon central administration in physiological, euthyroid

conditions.

AcknowledgementsWe wish to thank Mr. J. van der Vliet for his excellent help with animal surgery, and we are

indebted to Ms. E.M. Johannesma, Ms. B.C.E. Voermans and Ms. A.F.C. Ruiter for performing

the hormone and isotope analyses, and Ms. R. van der Spek for performing RNA isolation and

real time PCR.

Reference List 1. Dimitriadis GD, Raptis SA 2001 Thyroid hormone excess and glucose intolerance. Exp Clin Endocrinol

Diabetes 109 Suppl 2:S225-S239

2. Cavallo-Perin P, Bruno A, Boine L, Cassader M, Lenti G, Pagano G 1988 Insulin resistance in Graves’ disease: a quantitative in-vivo evaluation. Eur J Clin Invest 18:607-613


4. Constant EL, de Volder AG, Ivanoiu A, Bol A, Labar D, Seghers A, Cosnard G, Melin J, Daumerie C 2001 Cerebral blood flow and glucose metabolism in hypothyroidism: a positron emission tomography study. J Clin Endocrinol Metab 86:3864-3870

5. Schreckenberger MF, Egle UT, Drecker S, Buchholz HG, Weber MM, Bartenstein P, Kahaly GJ 2006 Positron emission tomography reveals correlations between brain metabolism and mood changes in hyperthyroidism. J Clin Endocrinol Metab 91:4786-4791

6. Smith CD, Ain KB 1995 Brain metabolism in hypothyroidism studied with 31P magnetic-resonance spectroscopy. Lancet 345:619-620

7. Schwartz MW, Porte D, Jr. 2005 Diabetes, obesity, and the brain. Science 307:375-379


etabolism in rats

59

Chapter 3




10. Lam TK, Pocai A, Gutierrez-Juarez R, Obici S, Bryan J, Aguilar-Bryan L, Schwartz GJ, Rossetti L 2005 Hypothalamic sensing of circulating fatty acids is required for glucose homeostasis. Nat Med 11:320-327


12. Steffens AB 1959 A method for frequent sampling blood and continuous infusion of fluids in the rat without disturbing the animal. Physiol Behav 4, 833-836

13. Van den Hoek AM, Heijboer AC, Corssmit EP, Voshol PJ, Romijn JA, Havekes LM, Pijl H 2004 PYY3-36 reinforces insulin action on glucose disposal in mice fed a high-fat diet. Diabetes 53:1949-1952

14. Finegood DT, Bergman RN, Vranic M 1987 Estimation of endogenous glucose production during hyperinsulinemic-euglycemic glucose clamps. Comparison of unlabeled and labeled exogenous glucose infusates. Diabetes 36:914-924



17. Ackermans MT, Pereira Arias AM, Bisschop PH, Endert E, Sauerwein HP, Romijn JA 2001 The quantification of gluconeogenesis in healthy men by (2)H2O and [2-(13)C]glycerol yields different results: rates of gluconeogenesis in healthy men measured with (2)H2O are higher than those measured with [2-(13)C]glycerol. J Clin Endocrinol Metab 86:2220-2226

18. Smedes F, Kraak JC, Poppe H 1982 Simple and fast solvent extraction system for selective and quantitative isolation of adrenaline, noradrenaline and dopamine from plasma and urine. J Chromatogr 231:25-39

19. van der Hoorn FA, Boomsma F, Man in ‘t Veld AJ, Schalekamp MA 1989 Determination of catecholamines in human plasma by high-performance liquid chromatography: comparison between a new method with fluorescence detection and an established method with electrochemical detection. J Chromatogr 487:17-28

20. Sweet MJ, Leung BP, Kang D, Sogaard M, Schulz K, Trajkovic V, Campbell CC, Xu D, Liew FY 2001 A novel pathway regulating lipopolysaccharide-induced shock by ST2/T1 via inhibition of Toll-like receptor 4 expression. J Immunol 166:6633-6639

21. Boelen A, Kwakkel J, Thijssen-Timmer DC, Alkemade A, Fliers E, Wiersinga WM 2004 Simultaneous changes in central and peripheral components of the hypothalamus-pituitary-thyroid axis in lipopolysaccharide-induced acute illness in mice. J Endocrinol 182:315-323

22. Ramakers C, Ruijter JM, Deprez RH, Moorman AF 2003 Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 339:62-66

23. Kalsbeek A, Buijs RM, van SR, Kaptein E, Visser TJ, Doulabi BZ, Fliers E 2005 Daily variations in type II iodothyronine deiodinase activity in the rat brain as controlled by the biological clock. Endocrinology 146:1418-1427

24. Leak D 1970 The thyroid and the autonomic nervous system. 1-5. William Heinemann Medical Books, London.


60


26. Crile GW 1929 The interdependence of the thyroid, adrenals and nervous system. Amer.J.Surg. 6:616.




30. Zavacki AM, Ying H, Christoffolete MA, Aerts G, So E, Harney JW, Cheng SY, Larsen PR, Bianco AC 2005 Type 1 iodothyronine deiodinase is a sensitive marker of peripheral thyroid status in the mouse. Endocrinology 146:1568-1575

31. Ferrannini E, Mari A 1998 How to measure insulin sensitivity. J Hypertens 16:895-906

32. Jin ES, Burgess SC, Merritt ME, Sherry AD, Malloy CR 2005 Differing mechanisms of hepatic glucose overproduction in triiodothyronine-treated rats vs. Zucker diabetic fatty rats by NMR analysis of plasma glucose. Am J Physiol Endocrinol Metab 288:E654-E662

33. Okajima F, Ui M 1979 Metabolism of glucose in hyper- and hypo-thyroid rats in vivo. Glucose-turnover values and futile-cycle activities obtained with 14C- and 3H-labelled glucose. Biochem J 182:565-575

34. Pocai A, Lam TK, Gutierrez-Juarez R, Obici S, Schwartz GJ, Bryan J, guilar-Bryan L, Rossetti L 2005 Hypothalamic K(ATP) channels control hepatic glucose production. Nature 434:1026-1031

35. Bernal-Mizrachi C, Xiaozhong L, Yin L, Knutsen RH, Howard MJ, Arends JJ, Desantis P, Coleman T, Semenkovich CF 2007 An afferent vagal nerve pathway links hepatic PPARalpha activation to glucocorticoid-induced insulin resistance and hypertension. Cell Metab 5:91-102





40. Goldman M, Dratman MB, Crutchfield FL, Jennings AS, Maruniak JA, Gibbons R 1985 Intrathecal triiodothyronine administration causes greater heart rate stimulation in hypothyroid rats than intravenously delivered hormone. Evidence for a central nervous system site of thyroid hormone action. J Clin Invest 76:1622-1625


etabolism in rats

61

Chapter 3


Thyroid hormone modulates glucose production via a sympathetic pathway from the hypothalamic paraventricular nucleus to the liver

Lars P. KlieverikSarah F. JanssenAnnelieke van RielEwout FoppenPeter H. BisschopMireille J. SerlieAnita BoelenMariëtte AckermansHans P. SauerweinEric FliersAndries Kalsbeek

Proceedings of the National Academy of Sciences of the United States of America 2009: 106(14), 5966-5971.

4


AbstractThyrotoxicosis increases endogenous glucose production (EGP) and induces hepatic insulin

resistance. We have recently shown that these alterations can be modulated by selective hepatic

sympathetic and parasympathetic denervation, pointing to neurally mediated effects of thyroid

hormone on glucose metabolism. Here, we investigated the effects of central triiodothyronine

(T3) administration on EGP.

We used stable isotope dilution to measure EGP before and after intracerebroventricular (icv)

bolus infusion of T3 or vehicle in euthyroid rats. To study the role of hypothalamic pre-autonomic

neurons, bilateral T3 microdialysis in the paraventricular nucleus (PVN) was performed during 2 h.

Finally, we combined T3 microdialysis in the PVN with selective hepatic sympathetic denervation

to delineate the involvement of the sympathetic nervous system in the observed metabolic

alterations.

T3 microdialysis in the PVN increased EGP by 11±4% (p=0.020) while EGP decreased by 5±8%

(ns) in vehicle treated rats (T3 vs Veh p=0.030). Plasma glucose increased by 29±5% (p=0.0001)

after T3 microdialysis versus 8±3% in vehicle treated rats (T3 vs Veh p=0.003). Similar effects

were observed after icv T3 administration. Effects of PVN T3 microdialysis were independent

of plasma T3, insulin, glucagon and corticosterone. However, selective hepatic sympathectomy

completely prevented the effect of T3 microdialysis on EGP.

We conclude that stimulation of T3-sensitive neurons in the PVN of euthyroid rats increases EGP

via sympathetic projections to the liver, independently of circulating glucoregulatory hormones.

This represents a novel central pathway for modulation of hepatic glucose metabolism by thyroid

hormone.

64


IntroductionThyroid hormones are crucial regulators of metabolism, as illustrated by the profound metabolic

derangements in patients with thyrotoxicosis or hypothyroidism (1). Thyrotoxicosis is associated

with an increase in endogenous glucose production (EGP), hepatic insulin resistance and

concomitant hyperglycemia (1;2). We have recently shown that selective hepatic sympathetic

denervation attenuates the hyperglycemia and increased EGP during thyrotoxicosis, while selective

hepatic parasympathetic denervation aggravates hepatic insulin resistance in thyrotoxic rats. By

inference, the increase in EGP during thyrotoxicosis may be mediated in part by sympathetic

input to the liver, while parasympathetic hepatic input may function to restrain insulin resistance

during thyrotoxicosis (3).

The central nervous system is emerging as an important target for several endocrine and humoral

factors in regulating metabolism. Hormones like insulin (4), estrogen (5) and corticosteroids (6)

appear to use dual mechanisms to affect metabolism, i.e. by direct actions in the respective target

tissue and by indirect actions via the hypothalamus, in turn affecting target tissues via autonomic

nervous system (ANS) projections. For example, it has been convincingly shown that the

suppression of EGP by central, i.e., hypothalamic, insulin administration can be largely abolished

by selective hepatic vagal denervation (7;8). The hypothalamus also can stimulate sympathetic

efferent nerves in order to increase hepatic glucose production (9). Thyroid hormone receptors

(TR) are expressed in both the human and rat hypothalamus, showing abundant expression in

the paraventricular (PVN) and arcuate nuclei (10;11) These nuclei are both key players in the

regulation of glucose metabolism via ANS connections with the liver.

We hypothesized that T3 may increase EGP via a neural route from the hypothalamus to the

liver. To explore this hypothesis we investigated whether the increased EGP and hyperglycemia

observed earlier during systemic thyrotoxicosis could be established by inducing “central

thyrotoxicosis” in peripherally euthyroid animals. In addition, we studied the possible involvement

of the hypothalamic PVN and the sympathetic outflow to the liver in the metabolic effects of

central T3. We demonstrate for the first time that upon selective administration to the PVN, T3

increases EGP and plasma glucose, and that these hypothalamic T3 effects are mediated via

sympathetic projections to the liver.

Materials and Methods AnimalsMale Wistar rats (Harlan, Horst, the Netherlands), housed under constant conditions of

temperature (21 ± 1 °C) and humidity (60 ± 2%) with a 12-h light, 12-h dark schedule (lights on

at 7.00 h am) were used for all experiments. Body weight was between 350 and 375 g. Food

and drinking water were available ad libitum. All of the following experiments were conducted

with the approval of the Royal Netherlands Academy of Arts and Sciences.

Experimental groupsExperiment #1 In the first experiment rats treated with methimazole and thyroxine were equipped

with unilateral cannulas aimed at the left lateral cerebral ventricle to receive an icv bolus infusion

Hypothalam

ic T3 m

odulates hepatic glucose production

65

Chapter 4


of T3 or vehicle. At t=0 and at t=24h isotope dilution and blood sampling were performed for

measurement of EGP, plasma glucose and (glucoregulatory) hormone concentrations.

Experiment #2 In the second experiment, rats were equipped with bilateral microdialysis (MD)

probes aimed at the hypothalamic PVN. After a basal EGP measurement at t=0, isotope infusion

was continued and continuous T3 or vehicle MD was started. After 90 min, blood samples

were obtained for measurement of EGP, plasma glucose and (glucoregulatory) hormone

concentrations.

Experiment #3 In the third experiment, T3 MD in the PVN (see experiment-2) was performed

in surgically hepatic sympatectomized animals (T3 MD HSx, n=8) and sham denervated animals

(T3 MD Sham, n=6). In all PVN MD experiments, to avoid inclusion of animals that were not

systemically euthyroid after 2h of MD (see results experiment 1), we excluded rats with plasma T3

levels above the upper limit of the reference range (1.8 nmol/L) from the final analysis. In order

to minimize bias, we excluded rats with basal insulin concentrations above the upper limit of the

reference range (>655 pmol/L) from the final analysis. Reference ranges were determined as

mean ± 2 SD from basal samples of 26 intact rats of the same age with no hormonal treatment.

Moreover, we carefully checked MD probe placement. Only animals with bilateral probes that

were positioned within or at the border of the PVN were included in the final analysis.

Hormonal treatmentIn experiment #1 we pre-treated rats with methimazole 0.025% and 0.3% saccharin in drinking

water starting 7 days prior to surgery, and administered T4 (1.75 μg/100 g/day) using osmotic

minipumps starting at time of surgery to reinstate euthyroidism (block and replacement), as

reported previously (3).

SurgeryAnimals were anaesthetized using Hypnorm (Janssen; 0.05 mL/100 g BW, i.m.) and Dormicum

(Roche, the Netherlands; 0.04 mL/100 g BW, s.c.). In all animals an intra-atrial silicone cannula

was implanted through the right jugular vein and a second silicone cannula was placed in the

left carotid artery for isotope infusion and blood sampling. Both cannulas were tunnelled to the

head subcutaneously (9). Stainless steel icv probes were implanted in the left cerebral ventricle

using the following stereotaxic coordinates: anteroposterior: -0.8 mm, lateral: +2.0 mm, ventral:

-3.2 mm, with the toothbar set at -3.4 mm. The U-shaped tip of the MD probe was 1.5 mm long,

0.7 mm wide, and 0.2 mm thick (9). Bilateral MD probes were stereotaxically implanted, directly

lateral to the PVN, using the following stereotaxic coordinates: anteroposterior: -1.8 mm, lateral:

2.0 mm, ventral: -8.1 mm, with the toothbar set at -3.4 mm. Hepatic sympathetic denervation

(HSx) was performed as described previously (3;9). It involves an impairment of both efferent

and afferent nerves, but this procedure does not impair the parasympathetic vagal input to the

liver (9). Sham-operated rats underwent the same surgical procedures as HSx animals, except

for transection of the neural tissue. To confirm succesfull sympathetic denervation, HPLC for

noradrenaline (NA) was performed on liver homogenates, as described earlier (3).

Stable isotope dilution and central T3 administrationGeneral procedure 10 days after surgery, stable isotope dilution was performed combined with

central administration of T3. In the afternoon on the day before the central T3 experiments,

66


rats were connected to a metal collar attached to polyethylene tubing (for blood sampling and

infusion) which was kept out of reach of the animals by a counterbalanced beam. This allowed

all subsequent manipulations to be performed outside the cages without handling the animals.

At 14.00 pm a blood sample was obtained for determination of basal plasma thyroid hormones

concentrations. On the day of the central T3 experiments, (basal) EGP was determined using the

stable isotope tracer [6,6-2H2]-glucose, as described previously (3).

Experiment #1: bolus T3 infusion After the last basal blood sample, the isotope infusion

pump was stopped. Animals received an icv bolus infusion of either 1,5 nmol/100 g BW T3

(Sigma, the Netherlands) in 0,05 M NaOH (T3 icv group) or 0,05 M NaOH (Vehicle group) in 4 μL

over 160 sec. This dose and the 24h time-interval were adopted from Goldman et al, showing

positive chronotropic effects of icv T3 in hypothyroid rats (12). After the bolus infusion, food was

placed back in the cages. Five h after the icv bolus infusion, a blood sample was obtained for

measurement of plasma T3. The next day, the infusion of [6,6-2H2]-glucose was started again

with subsequent blood sampling for measurement of glucose concentration, hormones and

isotopic enrichment. All experimental manipulations on the second day were performed in the

same way and at the same time points as on the day before.

Experiment #2 and #3: T3 MD in the hypothalamic PVN Recovery of the MD probes for T3

was 0.24%, as established by in vitro experiments. A solution of 155 μg/ml T3 dissolved in 2 mM

NaOH in PBS (pH 9), was infused through the MD probe-inlet equivalent to 100 pmol/h T3 (T3

MD group). Vehicle MD rats were microdialysed with 2 mM NaOH in PBS (pH 9). The dose of 100

pmol/h T3 was chosen based on the study by Kong et al (26), which is - to our knowledge - the

only study to date reporting local brain infusion of T3. Ringer dialysis (3 μL/min) was performed

from 60 min before the start of isotope infusion and continued until after the last basal blood

sample (t=0 min), when the Ringer was replaced by either T3 or vehicle. Ninety min after the start

of the T3 vehicle administration (with continued isotope infusion) blood samples (200 μL) were

obtained for measurement of glucose concentration, glucoregulatory hormones (t= 90 min), T3

and T4 (t= 120 min) and isotopic enrichment (t=90, 100, 110 and 120 min).

After the central infusion experiments, rats were sacrificed and whole brains were frozen for

subsequent analysis of MD probe placement. Hypothalamic (PVN) placement of bilateral probes

was evaluated blindly in each experimental animal by an experienced neuro-anatomist and scored

on the basis of anteroposteriority, laterality and dorsoventrality. Endogenous glucose production

(EGP) was calculated from isotope enrichment using adapted Steele equations (13).

Plasma analyses Plasma glucose concentrations were determined in blood spots using a glucose meter (FreestyleTM,

Abbott, the Netherlands) with inter- and intra-assay coefficients of variation (CV) of less than 6%

and 4%, respectively. Plasma concentrations of the thyroid hormones T3 and T4 were determined

by in-house RIA (14). Plasma TSH concentrations were determined by a chemiluminescent

immunoassay, using a rat-specific standard and plasma insulin, glucagon and corticosterone

concentrations were measured using commercially available kits (see supplementary information).

[6,6-2H2]-glucose enrichment was measured as described earlier (15).

Hypothalam

ic T3 m


67

Chapter 4


StatisticsData were analyzed by analysis of variance (ANOVA) with repeated measures, with treatment

group (T3 or Veh) as between-animal factor and time (basal or after) as within-animal factor.

Paired sample and two-sample Student’s t-test were used as post hoc tests to determine where

time points within treatment groups and between treatment groups differed from each other,

respectively. Post hoc tests were performed if ANOVA revealed significance. Mann Whitney U

tests were used for analysis of Δ in time (before–after intervention) between groups. Spearman

correlation was used to test for associations between factors. Significance was defined at p≤0.05.

Data are presented as mean ± SEM.

ResultsIn Experiment #1, we infused euthyroid rats treated with methimazole and T4 from an osmotic

minipump (so-called block and replacement treatment) with either icv T3 (n=8) or vehicle (Veh,

n=7). In Experiment #2, we administered T3 or vehicle in the hypothalamic PVN via bilateral

microdialysis (MD, i.e. retro-dialysis) (Veh MD, n=7 vs T3 MD, n=9). In Experiment #3 we

performed PVN T3 MD in surgically hepatic sympatectomized animals (T3 MD HSx, n=8) and

sham-denervated animals (T3 MD Sham, n=6).

At time of central T3 administration, animals weighed between 320-360 g. In all experimental

groups, body weight increased during the last 3 days preceding central T3 administration,

indicating adequate recovery from surgery and a positive energy balance. There was no difference

in mean body weight of the treatment groups at time of central T3 administration in any of the

experiments described.

Experiment #1: icv T3 infusionIcv T3 infused animals consumed an equal amount of food as compared with icv Veh infused rats

during the 24h following icv infusion (14.0±1.8 vs 13.6±1.2 g, respectively). Nevertheless, icv T3

infused animals lost weight in this time period as compared with icv Veh treated rats (-3.0±0.6

vs -1.1±0.4 % of body weight, respectively, p= 0.028).

Glucose, glucose kinetics, glucoregulatory hormones Mean basal glucose concentrations

were not significantly different between Veh icv and T3 icv groups (p=0.148, fig 1a). Basal EGP

was also similar between Veh and T3 icv treated groups (p=0.301, fig 1b). At t=24h after icv T3

infusion, there was a significant (p=0.027) increase in plasma glucose (28±8%), compared with a

non-significant 5±4% increase in Veh icv treated rats (Fig 1a). ANOVA revealed a trend (p=0.062)

for an increase in EGP in time, but no time*group effect. When analyzed separately, the EGP

increase 24h after an T3 icv bolus infusion almost reached significance as compared to the basal

state (p=0.057), but not so in Veh icv treated rats (p=0.482, fig 1b).

There were no differences in basal plasma insulin and corticosterone between the groups. In

both groups, plasma insulin and corticosterone 24h after icv infusion were not different from

the basal values.

68


Plasma thyroid hormones Basal plasma T3, thyroxine (T4), T3/T4 ratios and TSH concentrations

did not differ between the two treatment groups (Table 1). Surprisingly, the plasma T3

concentration in animals treated with methimazole and T4 was 18±5% higher 24h after icv

T3 infusion as compared with basal values (p=0.005). Vehicle treated animals showed a non-

significant decrease in plasma T3. By contrast, plasma T4 concentrations showed a significant

28±5% decrease in icv T3 treated rats (p=0.002), and a non-significant 15±9% decrease in vehicle

treated animals. The plasma T3/T4 ratio increased by 65±7% 24h after icv T3 whereas it did not

change in Veh-treated rats (icv T3 vs Veh p=0.008). Plasma TSH did not differ between groups

and did not change in time. Five hours after the icv T3 infusion, there was an increase in plasma

T3 to values above the reference range for euthyroid animals (icv T3 4.45±0.48 nmol/L vs icv Veh

4.5

5.0

5.5

6.0

6.5

7.0

(n=7) (n=8)Veh icv T3 icv

Bas 24h Bas 24h

*

Glu

cose

(m

mol

/L)

a

40

50

60

70

80

(n=7) (n=8)Veh icv T3 icv

Bas 24h Bas 24h

^

EGP

(mm

ol/k

g*m

in)

b

Figure 1 a Mean plasma glucose concentration in icv vehicle (Veh) and T3 treated animals, before (basal) and after (24h) bolus icv infusion. Note the marked, 22% plasma glucose increase in icv T3 treated rats, whereas in Veh treated rats there was no significant effect on plasma glucose. ANOVA indicated p=0.003 for factor time and p= 0.032 for factor time*group. *p< 0.01. b Endogenous glucose production (EGP) before (Bas) and after (24h) icv T3 or Veh bolus infusion. EGP tended to increase after icv T3 bolus infusion treated rats (^p=0.057), but not in icv Veh treated animals (p=0.482). ANOVA indicated p= 0.062 for factor time.

Table 1: Plasma hormone concentrations before (Basal) and after (24h) icv vehicle and T3 infusion

Veh icv n = 7 T3 icv n=8

Basal 24h Basal 24h

T3 (nmol/L) 1,25 ± 0,19 0,92 ± 0,04 1,21 ± 0,12 1,40 ± 0.12 *

T4 (nmol/L) 154 ± 13 128 ± 12 149 ± 11 106 ± 8 *

T3/T4 (%) 0,87 ± 0,18 0,77 ± 0,10 0,82 ± 0,07 1,35 ± 0,12 *

TSH (mU/L) 0,37 ± 0,10 0,26 ± 0,02 0,29 ± 0,06 0,24 ± 0,03

Insulin (pmol/L) 290 ± 47 351 ± 55 295 ± 46 392 ± 67

Corticosterone (ng/mL) 78 ± 39 150 ± 60 181 ± 45 162 ± 49

* p< 0.05 vs Basal value within the same group

Hypothalam

ic T3 m


69

Chapter 4


1.32±0.36 nmol/L, p< 0.0001). In order to replicate the effects of centrally administered T3 on

glucose metabolism using a refined approach and to identify the brain area where T3 exerts its

effect on glucose metabolism we applied T3 locally in the hypothalamus by MD in Experiment #2.

Experiment #2: T3 MD in the hypothalamic PVNGlucose, glucose kinetics and glucoregulatory hormones Mean basal glucose was 5.5±0.2

mmol/L in Veh MD and 5.0±0.1 mmol/L in T3 MD groups (p=0.030). Mean basal EGP was not

different between Veh and T3 MD groups. T3 MD induced a pronounced increase in plasma

glucose concentration (fig 2a), which was significantly larger than that in Veh MD rats (p=0.004,

fig 3a). After 2h of Veh MD, there was a 5.1±7.7% decrease in EGP. In contrast, after 2h

a b

4.5

5.0

5.5

6.0

6.5

7.0

(n=7) (n=9)Veh MD T3 MD

Bas 2h Bas 2h

**

*

*

Glu

cose

(m

mol

/L)

40

45

50

55

60

(n=7) (n=9)Veh MD T3 MD

Bas 2h Bas 2h

"

*

EGP

(mm

ol/k

g*m

in)

Figure 2a Mean plasma glucose concentration in intra-hypothalamic vehicle (Veh MD) and T3 microdialysis (T3 MD) treated rats, before (Bas) and after (2h) microdialysis. Note the pronounced increase in T3 MD treated rats, as compared to the mild increase in Veh MD treated rats. ANOVA indicated p<0.0001 for factor time and p=0.005 for factor time*group. *p<0.05, **p<0.0001.

b Endogenous glucose production (EGP) before (Bas) and after (2h) T3 or vehicle microdialysis in the hypothalamic PVN. Note the EGP increase after 2h of T3 microdialysis, in contrast to the EGP decrease in Veh microdialysis treated animals, with no difference in basal EGP between groups. ANOVA revealed p= 0.029 for factor time*group. “p<0.01, *p< 0.05.

of T3 MD there was a significant 10.7±3.7% increase in EGP relative to basal values (ANOVA

(Time*Group) p=0.029, fig 2b). The basal glucose concentration was no determinant of the

plasma glucose or EGP response to T3 MD (Spearman correlation p=0.546 and p=0.406 for basal

glucose concentration vs relative plasma glucose and EGP increase, respectively). In addition,

when the animals in the T3 MD group that had lower basal glucose concentrations than the Veh-

treated animal with the lowest basal glucose value were excluded from the analysis, the relative

increase in plasma glucose was still significantly higher in T3 MD as compared with Veh MD

animals (n=5 vs n=7,respectively, p=0.004). Plasma glucagon showed a trend towards a decrease

in veh treated rats (Veh basal vs after -13±5%, p=0.058), whereas it showed a non-significant

9±6% increase in veh T3 treated rats (ANOVA (Time*Group) p=0.023). However, the glucagon

70


changes were not a determinant of EGP changes in either group (Veh MD r=-0.39, p=0.40, T3 MD

r=0.37, p=0.34). There were no differences in basal plasma glucagon, insulin and corticosterone

between groups. In both groups, plasma insulin and corticosterone after 2h of MD did not differ

from the basal values (table 2).

Plasma thyroid hormones Plasma T3 and T4 concentrations and T3/T4 ratios are depicted in

table 2. There were no differences in basal plasma T3 concentrations between Veh and T3 MD

groups, and T3 concentrations did not change after MD. Of note, there was no increase in

plasma T3 concentration after 2h of T3 MD. Plasma T4 was lower in T3 treated rats as compared

with vehicle after 2h of MD. Basal plasma T4 concentrations were not significantly different

between T3 MD and Veh MD rats. The plasma T3/T4 ratio increased after 2h of T3 MD (p=0.021),

but did not alter after Veh MD.

Experiment #3: PVN T3 MD in selective hepatic sympathectomized and sham-denervated ratsTo study the role of sympathetic projections from the hypothalamus to the liver in the observed

effects on EGP, we performed T3 PVN MD in animals that had undergone either a selective

surgical sympathetic denervation (T3 MD HSx, n=8) or a sham denervation (T3 MD Sham, n=6)

of the liver. Hepatically sympatectomized animals showed a significant 85.5% reduction in NA

content as compared to sham denervated rats, with no overlap between the groups (T3 MD

Sham 38.9±5.9 ng/g, T3 MD HSx 5.6±0.9 ng/g, p=0.002). This decrease in NA content was

similar in previous reports by our group involving selective hepatic sympathectomy (3).

Glucose, glucose kinetics, plasma thyroid hormones and glucoregulatory hormones Basal

plasma glucose and basal EGP were not different between both groups, which is in line with

our previous data showing no effect of sympathectomy on (basal) EGP in euthyroid rats (3). In

sham-denervated rats, T3 MD induced a 19±3% (p<0.0001) increase in plasma glucose. In HSx

rats, plasma glucose increased by 18±3% (p=0.002) after 2h of T3 MD (ANOVA (Time) p<0,0001,

(Time*Group) p=0,889, fig 4a). EGP increased by 9,9±5,0% in sham-denervated rats after 2h

T3 MD, very similar to earlier results in intact hypothalamic T3-treated animals in Experiment #2

(Fig 3b). In contrast, HSx animals showed an EGP decrease of 5,6±7,2% upon hypothalamic T3

Hypothalam

ic T3 m


71

Chapter 4

Table 2: Plasma hormone concentrations before (Basal) and after (2h) vehicle and T3 microdialysis (MD)

Veh MD n = 7 T3 MD n=9

Basal 2h Basal 2h

T3 (nmol/L) 1,11 ± 0,05 1,01 ± 0,10 1,13 ± 0,06 1,14 ± 0,14

T4 (nmol/L) 74 ± 6 54 ± 6 * 60 ± 4 35 ± 4 * “

T3/T4 (%) 1,60 ± 0,20 2,17 ± 0,49 1,92 ± 0,13 3,35 ± 0,50 *

Insulin (pmol/L) 291 ± 70 271 ± 65 247 ± 19 277 ± 28

Glucagon (pg/mL) 97 ± 7 85 ± 9 ^ 92 ± 7 99 ± 8

Corticosterone (ng/mL) 126 ± 71 120 ± 29 174 ± 46 107 ± 18

* p<0.05 vs Basal value within the same group, “ p<0.05 vs Veh 2h,^ p=0.058 vs Bas (ANOVA factor Time*Group p=0.023).


MD, similar to the EGP decrease following vehicle MD in Experiment #2. The increase in the

T3-treated intact (Exp 2) or T3-treated sham-denervated (Exp 3) animals differed significantly

from the decrease seen in the vehicle-treated intact (Exp 2) or T3-treated HSx (Exp 3) animals,

respectively ( p≤0.05, fig 3b).

There were no differences in basal plasma insulin and glucagon between the Sham-denervated

and HSx groups, and plasma insulin and glucagon did not change after 2h of T3 MD (table 3).

Plasma thyroid hormones Plasma T3 decreased significantly by 31±3% in HSx animals after

T3 MD (p<0.0001), while T3 MD had no effect on plasma T3 in Sham denervated rats (table 3).

Plasma T4 decreased to a similar extent in both groups after T3 MD (-36.4±4.7% T3 MD Sham vs

-45.9±4.2% T3 MD HSx). The T3/T4 ratio was higher after T3 MD compared with basal values in

Sham-denervated (p=0.012), but not in HSx animals (table 3).

0

5

10

15

20

25

30

35

40

* *

Veh T3 Veh T3 HSx Sham

ICV MD T3 MD

∆ G

luco

se (

%)

-20

-15

-10

-5

0

5

10

15

20

25

30

35

40

45

50

55

* *

Veh T3 Veh T3 HSx Sham

ICV MD T3 MD

∆ E

GP

(%)

a

b

Figure 3a Relative difference between basal plasma glucose and plasma glucose after (Δ Glucose (%)) (i) in icv Veh or T3 treated rats, (ii) in rats treated with vehicle (Veh MD) or T3 microdialysis (T3 MD) in the hypothalamic PVN, (iii) hypothalamic T3 microdialysis in selective hepatic sympathectomized (T3 MD HSx) or Sham-denervated (T3 MD Sham) rats. Note the significant increase of plasma glucose in icv T3 and T3 microdialysis treated rats relative to their respective Veh controls. Hepatic sympathectomy did not abolish the plasma glucose increase upon T3 microdialysis. *p<0.05 vs vehicle control group.

b Relative difference between basal EGP and EGP after (Δ EGP (%)) (i) in icv Veh or T3 treated rats, (ii) in rats treated with vehicle (Veh MD) or T3 microdialysis (T3 MD) in the hypothalamic PVN, (iii) hypothalamic T3 microdialysis in selective hepatic sympathectomized (T3 MD HSx) or Sham-denervated (T3 MD Sham) rats. Note that the increase of EGP in response to T3 microdialysis relative to Veh treated rats, replicated by T3 microdialysis in Sham-denervated animals, is totally prevented by selective hepatic sympathectomy. *p≤0.05 Veh MD vs T3 MD and T3 MD Sham vs T3 MD HSx.

72

chapter 4 nieuw.indd 72 6-8-2009 11:05:48

DiscussionThe principal finding of this study is that T3 administered to the hypothalamic PVN in euthyroid

rats rapidly increases EGP, with a concomitant increase in plasma glucose concentration. An

intact sympathetic input to the liver is essential for the hypothalamic effect of T3 on EGP to

occur. Moreover, the T3-induced effects occur independently of plasma glucoregulatory hormone

concentrations.

The first indication that the thyrotoxicosis-associated increase in EGP and concomitant

hyperglycemia can be mimicked by central T3 administration in euthyroid rats came from our

experiments involving icv T3 infusion. However, these data were not conclusive as 5 h after

central T3 infusion plasma T3 concentrations increased above the euthyroid reference range.

Thus, a causal relation between the plasma T3 increase after 5 h and the metabolic alterations

after 24 h could not be excluded, in spite of the fact that plasma T3 had almost returned to basal

values after 24 hours. We decided to use bilateral microdialysis (MD), which enables precise

local administration within the hypothalamus and thereby offers detailed neuro-anatomical

information, to confirm our hypothesis that T3 can modulate hepatic glucose production via

actions in the hypothalamic PVN. The hypothalamic PVN not only harbours hypophysiotropic

neurons projecting to the median eminence, but also contains pre-autonomic neurons

controlling autonomic projections to the liver (16). The increase in EGP and plasma glucose

upon administration of T3 in the PVN was independent of plasma T3, insulin and corticosterone

concentrations. Plasma glucagon showed a small increase in response to hypothalamic T3 relative

to vehicle treatment. This effect on plasma glucagon may point to an effect of hypothalamic T3

on the endocrine pancreas. However, its small magnitude and the lack of correlation between

the glucagon and EGP changes exclude that the glucagon changes are responsible to a significant

extent for the observed EGP increase. Taken together, the observations are compatible with a

neural (autonomic) modulation of hepatic glucose metabolism by hypothalamic T3. Indeed, we

confirmed our hypothesis that hypothalamic T3 modulates EGP via sympathetic projections to the

liver by demonstrating that the hypothalamic T3-induced EGP increase can be totally prevented by

prior surgical selective hepatic sympathetic denervation. In addition, this denervation experiment

confirmed that the T3-induced changes in glucagon release are not the main determinant of the

changes in EGP.

Hypothalam

ic T3 m


73

Chapter 4

Table 3: Plasma hormone concentrations before (Basal) and after (2h) T3 microdialysis in sham-denervated (T3 MD Sham) and hepatic sympathectomized rats (T3 MD HSx)

T3 MD Sham n = 8 T3 MD HSx n=6

Basal 2h Basal 2h

T3 (nmol/L) 1,17 ± 0,08 1,08 ± 0,1 1,25 ± 0,04 0,87 ± 0,08 *

T4 (nmol/L) 79 ± 5 50 ± 4 * 76 ± 6 41 ± 4 *

T3/T4 (%) 1,48 ± 0,07 2,24 ± 0,26 * 1,71 ± 0,12 2,26 ± 0,31

Insulin (pmol/L) 181 ± 20 211 ± 40 203 ± 31 189 ± 37

Glucagon (pg/mL) 60 ± 5 70 ± 8 69 ± 9 57 ± 9

* p<0.05 vs Basal value within the same group


The hypothalamic PVN contains many hypophysiotropic TRH neurons, projecting to the median

eminence and regulating the hypothalamo-pituitary-thyroid (HPT) axis. Hypothalamic T3 treatment

may cause a down-regulation of TRH gene expression in these neurons, in turn inducing decreased

thyroidal T4 and T3 secretion as a reflection of central hypothyroidism (17). Our MD experiments

lasted for 2h, which may be too rapid for modulation of TRH gene transcription, pituitary TSH

release, and thyroid hormone secretion. In addition, central hypothyroidism induced by central

T3 administration would be expected to cause opposite changes in glucose metabolism, i.e.

decreased EGP and glucose concentration (18).

It has been documented extensively that during cold stress, sympathetic stimulation of brown

adipose tissue increases local T3 availability via activation of deiodinase type 2 (D2) (19).

Deiodinase type 1 (D1) is the principal hepatic thyroid hormone deiodinating enzyme and is a

major contributor to T3 production in the rat (20). β-adrenergic blockers such as propanolol are

widely used in the initial clinical management of hyperthyroid patients, in part because these drugs

inhibit T4 to T3 conversion on the hepatic level (21). However, it is unknown if hepatic D1 activity

is neurally regulated. Interestingly, in the present study icv T3 administration decreased plasma

T4, whereas plasma T3 was elevated after 24h. Given that these experiments were performed

in rats treated with methimazole and thyroxine, these changes occurred independently from

thyroidal TH secretion. This raises the interesting possibility of a central T3 effect on hepatic

deiodinating activity. Moreover, hypothalamic T3 administration for 2h increased the plasma T3/

T4 ratio as compared with Veh treatment, which was also the case after hypothalamic T3 in sham-

denervated rats, but not in rats that underwent prior selective hepatic sympathetic denervation.

Collectively, these findings are compatible with the concept of sympathetic stimulation of T4

to T3 conversion by hepatic D1. By inference, we might speculate that sympathetic stimulation

of hepatic T4 to T3 conversion could be partly responsible for the increase in EGP following

hypothalamic T3 administration, which will be the subject of further study.

Although the observed weight loss in icv T3 treated rats in the 24h following icv infusion may

be compatible with increased energy expenditure by T3, we were surprised to find that icv

T3 administration did not affect food intake in the 24h following icv infusion as compared

with vehicle treated rats. Recent studies by Kong et al. (22) involving local intrahypothalamic

T3 administration provided evidence that the hypothalamic ventromedial nucleus (VMN) is a

key nucleus for the orexigenic effects of T3. Although it is known that thyroid hormone bio-

availability in the CNS is strongly regulated by deiodinases (in particular D2) (23), little is known

about thyroid hormone transport mechanisms between the ventricular system and specific

hypothalamic nuclei (24). Consequently, the effect of icv T3 bolus infusion on local T3 tissue

concentrations in the VMN or in other hypothalamic nuclei (and, thereby, on eating behavior) is

very difficult to predict at present.

The rapid time scale of the effects of intra-hypothalamic T3 administration on glucose metabolism

in itself fits with neural signalling from the hypothalamus to the liver via autonomic (sympathetic)

efferents, whereas at first sight it may be hard to reconcile with thyroid hormone receptor (TR)-

mediated effects on gene transcription and translation (25). Recently, an increasing number

of rapid, so called “non genomic” thyroid hormone effects have been reported. These may be

mediated by TRs, for example via interaction of TR subtype α1 (TRα1) with the phosphatidylinositol

74


3-kinase/protein kinase Akt (PI3K/Akt) pathway (26), which is a critical downstream target

of insulin signal-transduction in hypothalamic neurons regulating EGP (7;27). Alternatively,

membrane-bound receptors have emerged as high-affinity T3 binding sites that could mediate

these rapid effects via non-transcriptional mechanisms (28).

In the present study, we demonstrate that the EGP increase induced by hypothalamic T3

administration is mediated via altered sympathetic outflow to the liver. Recent studies in mice

have shown that suppression of TRα1 signalling via a mutation causing a 10-fold lower affinity for

T3 enhances basal metabolism. This appeared to be mediated via increased sympathetic tone to

brown adipose tissue, overriding the peripheral actions of the receptor (29). These observations

suggested an important role for TRα1 in regulating sympathetic outflow from the hypothalamus.

In contrast, the notion of increased sympathetic tone during thyrotoxicosis is not supported by

experiments in β-adrenergic knockout mice focussing on cardiac physiology and metabolic rate

(30). However, recent studies in patients with hyperthyroidism did show increased sympathetic

tone in subcutaneous adipose tissue (31), increased sympathetic and decreased parasympathetic

tone to the heart (32;33) as well as increased urinary catecholamine excretion (32;34), pointing

to increased sympathetic activity during thyrotoxicosis in humans. Finally, the present findings

are in line with previously reported observations from our group that the thyrotoxicosis-induced

changes in (hepatic) glucose metabolism can be differentially modulated by either selective

sympathetic or parasympathetic denervation of the liver (3).

Our finding that hepatic sympathectomy prevents the EGP increase, but not the plasma glucose

increase induced by hypothalamic T3 points to effects on glucose metabolism other than via EGP

in sympathectomized animals. Decreased peripheral glucose uptake is one of the possibilities,

perhaps mediated via autonomic input to major glucose disposing tissues like striated muscle and

white adipose tissue (35).

We conclude that stimulation of T3-sensitive neurons in the PVN of euthyroid rats increases EGP

via sympathetic projections to the liver, independently of circulating glucoregulatory hormone

concentrations. Thus, we report a novel central pathway for modulation of hepatic glucose

production by T3 involving the hypothalamic PVN and the sympathetic nervous system.

AcknowledgementsWe wish to thank E.M. Johannesma-Brian and A.F.C. Ruiter for performing the hormone and

isotope analyses. The Ludgardine Bouwman-foundation is kindly acknowledged for financial

support.

Reference List 1. Franklyn JA. 2000 Metabolic changes in thyrotoxicosis. In: The Thyroid, a clinical and fundamental text.

8:667-672. Lippincott Williams & Wilkins, Philadelphia.

2. Dimitriadis GD, Raptis SA 2001 Thyroid hormone excess and glucose intolerance. Exp Clin Endocrinol Diabetes 109 Suppl 2:S225-S239

3. Klieverik L, Sauerwein HP, Ackermans M, Boelen A, Kalsbeek A, Fliers E 2008 Effects of Thyrotoxicosis and Selective Hepatic Autonomic Denervation on Hepatic Glucose Metabolism in Rats. Am J Physiol Endocrinol Metab 294:E513-520

Hypothalam

ic T3 m


75

Chapter 4


4. Prodi E, Obici S 2006 Minireview: the brain as a molecular target for diabetic therapy. Endocrinology 147:2664-2669





9. Kalsbeek A, la Fleur FS, van Heijningen HC, Buijs RM 2004 Suprachiasmatic GABAergic inputs to the paraventricular nucleus control plasma glucose concentrations in the rat via sympathetic innervation of the liver. J Neurosci 24:7604-7613



12. Goldman M, Dratman MB, Crutchfield FL, Jennings AS, Maruniak JA, Gibbons R 1985 Intrathecal triiodothyronine administration causes greater heart rate stimulation in hypothyroid rats than intravenously delivered hormone. Evidence for a central nervous system site of thyroid hormone action. J Clin Invest 76:1622-1625





17. Segerson TP, Kauer J, Wolfe HC, Mobtaker H, Wu P, Jackson IM, Lechan RM 1987 Thyroid hormone regulates TRH biosynthesis in the paraventricular nucleus of the rat hypothalamus. Science 238:78-80

18. Okajima F, Ui M 1979 Metabolism of glucose in hyper- and hypo-thyroid rats in vivo. Glucose-turnover values and futile-cycle activities obtained with 14C- and 3H-labelled glucose. Biochem J 182:565-575


20. Nguyen TT, Chapa F, DiStefano JJ, III 1998 Direct measurement of the contributions of type I and type II 5’-deiodinases to whole body steady state 3,5,3’-triiodothyronine production from thyroxine in the rat. Endocrinology 139:4626-4633

21. Wiersinga WM 1991 Propranolol and thyroid hormone metabolism. Thyroid 1:273-277

22. Kong WM, Martin NM, Smith KL, Gardiner JV, Connoley IP, Stephens DA, Dhillo WS, Ghatei MA, Small CJ, Bloom SR 2004 Triiodothyronine stimulates food intake via the hypothalamic ventromedial nucleus independent of changes in energy expenditure. Endocrinology 145:5252-5258

76


23. Bernal J 2002 Action of thyroid hormone in brain. J Endocrinol Invest 25:268-288

24. Alkemade A, Friesema EC, Unmehopa UA, Fabriek BO, Kuiper GG, Leonard JL, Wiersinga WM, Swaab DF, Visser TJ, Fliers E 2005 Neuroanatomical pathways for thyroid hormone feedback in the human hypothalamus. J Clin Endocrinol Metab 90:4322-4334


26. Hiroi Y, Kim HH, Ying H, Furuya F, Huang Z, Simoncini T, Noma K, Ueki K, Nguyen NH, Scanlan TS, Moskowitz MA, Cheng SY, Liao JK 2006 Rapid nongenomic actions of thyroid hormone. Proc Natl Acad Sci USA 103:14104-14109

27. Niswender KD, Morrison CD, Clegg DJ, Olson R, Baskin DG, Myers MG, Jr., Seeley RJ, Schwartz MW 2003 Insulin activation of phosphatidylinositol 3-kinase in the hypothalamic arcuate nucleus: a key mediator of insulin-induced anorexia. Diabetes 52:227-231

28. Davis PJ, Leonard JL, Davis FB 2008 Mechanisms of nongenomic actions of thyroid hormone. Front Neuroendocrinol 29:211-218

29. Sjogren M, Alkemade A, Mittag J, Nordstrom K, Katz A, Rozell B, Westerblad H, Arner A, Vennstrom B 2007 Hypermetabolism in mice caused by the central action of an unliganded thyroid hormone receptor alpha1. EMBO J 145:2767-2774

30. Bachman ES, Hampton TG, Dhillon H, Amende I, Wang J, Morgan JP, Hollenberg AN 2004 The metabolic and cardiovascular effects of hyperthyroidism are largely independent of beta-adrenergic stimulation. Endocrinology 145:2767-2774




34. Eustatia-Rutten CF, Corssmit EP, Heemstra KA, Smit JW, Schoemaker RC, Romijn JA, Burggraaf J 2008 Autonomic nervous system function in chronic exogenous subclinical thyrotoxicosis and the effect of restoring euthyroidism. J Clin Endocrinol Metab 93:2835-2841

35. Kreier F, Kap YS, Mettenleiter TC, van Heijningen C, van d, V, Kalsbeek A, Sauerwein HP, Fliers E, Romijn JA, Buijs RM 2005 Tracing from fat tissue, liver and pancreas: A neuroanatomical framework for the role of the brain in type 2 diabetes. Endocrinology 147:1140-1147

Hypothalam

ic T3 m


77

Chapter 4


Central effects of thyronamines on glucose metabolism in rats

Lars P. KlieverikEwout FoppenMariëtte T. AckermansMireille J. SerlieHans P. SauerweinThomas S. ScanlanDavid K. GrandyEric FliersAndries Kalsbeek

Journal of Endocrinology 2009: 201(3), 377-386

5


AbstractThyronamines are naturally occurring, chemical relatives of thyroid hormone. Systemic

administration of synthetic 3-iodothyronamine (T1AM) and - to a lesser extent - thyronamine

(T0AM), leads to acute bradycardia, hypothermia, decreased metabolic rate and hyperglycemia.

This profile led us to hypothesize that the central nervous system is among the principal targets

of thyronamines.

We investigated whether a low dose intracerebroventricular (icv) infusion of synthetic thyronamines

recapitulates the changes in glucose metabolism that occur following intraperitoneal (ip)

thyronamine administration.

Plasma glucose, glucoregulatory hormones and endogenous glucose production (EGP) using

stable isotope dilution were monitored in rats before and 120 min after an ip (50 mg/kg) or icv

(0.5 mg/kg) bolus infusion of T1AM, T0AM, or vehicle. To identify peripheral effects of centrally

administered thyronamines, drug-naïve rats were also infused intravenously with low dose (0.5

mg/kg) thyronamines.

Systemic T1AM rapidly increased EGP and plasma glucose, increased plasma glucagon, and

corticosterone, but failed to change plasma insulin. Compared to ip-administered T1AM, a

100-fold lower dose administered centrally induced a more pronounced acute EGP increase

and hyperglucagonemia while plasma insulin tended to decrease. Both systemic and central

infusions of T0AM caused smaller increases in EGP, plasma glucose and glucagon compared with

T1AM. Neither T1AM nor T0AM influenced any of these parameters upon low dose intravenous

administration.

We conclude that central administration of low dose thyronamines suffices to induce the

acute alterations in glucoregulatory hormones and glucose metabolism following systemic

thyronamine infusion. Our data indicate that thyronamines can act centrally to modulate glucose

metabolism.

80


IntroductionThyronamines are a group of naturally occurring, chemical relatives of thyroid hormone (TH)

with pronounced and rapid physiologic effects (1). Two representatives of the thyronamines,

3-iodothyronamine (T1AM) and thyronamine (T0AM) have been extracted from rat and mouse

brain, heart, liver and blood. T1AM and T0AM can theoretically be derived from iodothyronines

thyroxine (T4), 3,3’,5-triiodothyronine (T3) and/or 3,3’,5’-triiodothyronine (reverse T3) by removal

of the carboxylate group on the β-alanine side chain in addition to deiodination. Indeed,

thyronamines have recently been identified as iso-enzyme specific substrates of the iodothyronine

deiodinases type 1, 2 and 3 (2). T1AM and, to a lesser extent, T0AM are potent in vitro agonists

of the trace amine associated receptor type 1 (TAAR1) (1;3), a Gs protein-coupled membrane

receptor with a broad expression profile (4). In rodents and humans, high levels of TAAR1

expression are found in liver, kidney, gastrointestinal tract, pancreas, heart and many areas of

the brain (5;6). Moreover, T1AM has the potential to act as an adrenergic receptor α2 (ARα2)

agonist in the mouse, explaining in part the decrease in insulin secretion by pancreatic beta cells

exposed to thyronamines (7).

When administered to rodents, T1AM and T0AM have striking effects on physiology. Within

minutes after systemic administration, profound hypothermia, bradycardia and decreased cardiac

output occur. In addition, thyronamines rapidly induce metabolic alterations such as decreased

metabolic rate and a dramatic shift to preferential lipid fuelling at the cost of carbohydrate

oxidation (1;8). These apparently non-genomic effects are thought to occur via binding to and

activating membrane-bound G protein-coupled receptors (GPCRs) such as TAAR1 and ARα2

(1;9). Furthermore, it has been proposed but not yet demonstrated THs can be converted to

thyronamines by enzymatic deiodination and decarboxylation. Since most actions of T1AM

and T0AM are opposite in direction to the bio-active thyroid hormone T3, thyronamines have

been hypothesized to play a role in fine-tuning and/or antagonizing T3 actions on a moment-to-

moment timescale (9;10).

The brain, in particular the hypothalamus, regulates most of the processes affected by

thyronamines (body temperature, cardiac function, energy metabolism). Moreover, a principal

role in regulating hepatic glucose metabolism has recently emerged for the hypothalamus (11-

13). As T1AM and T0AM are present in rat brain, we hypothesized these novel compounds could

affect glucose metabolism via actions in the central nervous system (CNS).

In the present study we tested the hypothesis that thyronamines act centrally to induce changes

in glucose metabolism using stable isotope dilution and 3 different routes of administration:

systemic (ip), central (intracerebroventricular; icv), and intravenous (iv) in rats. Our results are

consistent with the interpretation T1AM and T0AM can act centrally to recapitulate the changes

in glucose metabolism that occur following systemic thyronamine administration.

Materials and Methods AnimalsMale Wistar rats (Harlan, Horst, the Netherlands) between 350 and 400 g bodyweight (BW),

housed under constant conditions of temperature (21 ± 1 °C) and humidity (60 ± 2%) with a

Central thyronam

ines and glucose metabolism

81

Chapter 5


12-h light, 12-h dark (L/D) schedule (lights on at 7.00 h am), were used in all experiments. Food

and drinking water were available ad libitum. All of the following experiments were conducted

with the approval of the Animal Care Committee of the Royal Netherlands Academy of Arts and

Sciences.

T1AM and T0AM T1AM-HCl (391 g/mol) and T0AM-HCl (264 g/mol) were synthesized as previously reported (3)

and dissolved in 20% DMSO and 80% saline (vehicle) at a concentration of 40 mg/mL.

Experimental groupsTwo independent studies were performed For the first study, permanent jugular vein and

carotid artery cannulae were placed in rats (n=22) under anesthesia (see below). Animals were

allowed to recover from the surgery for 8 days prior to any further manipulations. Each rat

thus cannulated received an intraperitoneal (ip) bolus infusion of 50 mg/kg of T1AM (n=7),

50 mg/kg of T0AM (n=8), or an equal volume (500 μL) of vehicle (n=7). For the second study

rats (n=31) were equipped with a guide cannula placed into the left lateral cerebral ventricle

in addition to the carotid artery and jugular vein cannulae. Rats thus cannulated received an

intracerebroventricular (icv) 100-fold lower dose (0.5 mg/kg) of either T1AM (n=9), T0AM (n=8),

or DMSO-saline vehicle (n=8) in a volume of 4 μL. To control for the possibility any observed effect

of the icv-infused thyronamines was somehow due to spill-over into the circulation an additional

group of cannulated rats was infused intravenously (iv) with 0.5 mg/kg T1AM (n=3) and T0AM

(n=3) in a volume of 500 μL. In both of these experiments, before and 120 min after ip or icv

bolus infusion, isotope dilution and blood sampling were conducted to permit measurement

of endogenous glucose production (EGP), and the concentration of plasma glucose, insulin,

glucagon, corticosterone, thyroid stimulating hormone (TSH), T3 and T4 concentrations.

SurgeryJugular, Carotid and icv cannulae Animals were anaesthetized using a mixture of Hypnorm

(Janssen; 0.05 mL/100 g BW, i.m.) and Dormicum (Roche, the Netherlands; 0.04 mL/100 g BW,

s.c.). Vascular and icv cannulae were fixed with dental cement to 4 stainless-steel screws inserted

into the skull. Post-operative care was provided by subcutaneous injection of 0.01 mL/100 g BW

of Temgesic (Schering-Plough; Utrecht, the Netherlands). In all animals an intra-atrial silicone

cannula was implanted through the right jugular vein and a second silicone cannula was placed

in the left carotid artery for isotope infusion and blood sampling as described previously (14). For

the second study, stainless steel icv cannulae were implanted into the left cerebral ventricle using

the following stereotaxic coordinates: anteroposterior: -0,8 mm, lateral: +2,0 mm, ventral: -3,2

mm, with the toothbar set at -3,4 mm. Guide cannula placement was confirmed by dye (4 μL of

ethylene blue) injection and inspection post-mortem. Only animals that showed staining of the

left lateral cerebral ventricle and third cerebral ventricle were included in the final analysis.

Stable isotope dilution and systemic vs central thyronamine administrationGeneral procedure Eight days post-surgery, stable isotope dilution was performed in combination

with the administration of synthetic thyronamines. Animals weighed between 335-380 g. Body

82


weight (BW) increased in all groups during the 3 days preceding the experimental infusions,

indicating recovery from surgery and a positive energy balance. One day before the experimental

infusions, rats were connected to a metal collar to which polyethylene tubing (for blood-sampling

and infusion) was attached and kept out of reach of the animals by a counterbalanced beam. This

permitted all subsequent manipulations to be performed outside the cages without handling the

animals (14). For determining basal plasma concentrations of TSH, T3 and T4 a blood sample was

obtained at 14.00 PM. On the day of thyronamine administration, food was removed from the

cages 4 h (~8.30 AM) before the first basal measurements. At ~11.00 AM a blood sample was

taken (200 μL, t=-110 min) for determination of background isotopic enrichment. Subsequently,

a primed (8.0 μmol in 5 min) continuous (16.6 μmol/h) infusion of the stable isotope tracer

[6,6-2H2]-glucose (>99% enriched; Cambridge Isotope Laboratories, Cambridge, MA) was started

using an infusion pump (Harvard Apparatus, Holliston, MA). After an equilibration period of 90

min additional blood samples (200 μL) were obtained for the determination of basal plasma

glucose, isotopic enrichment (t= -20, -10 and 0 min), plasma corticosterone (t= -20 and 0 min),

insulin, and glucagon (t= 0 min) concentrations.

Bolus infusion of synthetic thyronaminesAfter the t=0 bloodsample, in study 1, animals received an ip bolus of either T1AM, T0AM (50

mg/kg in 500 μL) or vehicle. In study 2, again after the t=0 bloodsample, animals received an

icv bolus infusion of either T1AM, T0AM (0.5 mg/kg in 4 μL) or vehicle delivered through the icv

cannula in 105 sec using a Hamilton syringe. After ip or icv bolus infusion, blood samples were

obtained for measurement of glucose concentration, isotopic enrichment (5, 10, 20, 30, 45,

60, 75, 90 and 120 min), plasma corticosterone (t=10, 20, 30, 60 and 120 min), plasma insulin,

glucagon (t= 10, 60 and 120 min) and plasma TSH, T3 and T4 concentrations (t= 120 min).

Plasma hormone and isotope analyses Plasma glucose concentration was determined in triplicate by a glucose oxidase method

(Boehringer Mannheim, Germany). Plasma glucagon and corticosterone were measured using

a commercially available radioimmunoassay (RIA, LINCO research, st.Charles, MO and ICN

biomedicals, Costa Mesa, CA, respectively). Plasma concentrations of T3 and T4 were determined

by an in-house RIA (15), with inter- and intra-assay variation coefficient (CV) of 7–8% and 3–4%

(T3), and 3–6 and 2–4% (T4), respectively. Detection limits for T3 and T4 were 0.3 nmol/L and

5 nmol/L, respectively. Plasma TSH concentrations were determined by a chemiluminescent

immunoassay (Immulite 2000, Diagnostic Products Corp., Los Angeles, CA) using a rat-specific

standard. The inter- and intra-assay CV’s for TSH were less than 4% and 2% at ±3.5 mU/L,

respectively, with a detection limit of 0.40 mU/L. Plasma insulin was measured by a commercially

available Elisa (Mercodia, Uppsala, Sweden) (16). The inter- and intra-assay CV’s were 4% and

2%, detection limit 13 pmol/L. All samples were measured in duplicate, e.g. 2 tubes were

analysed per plasma sample. Glucose enrichment was measured as previously described (17).

The [6,6-2H2]-glucose enrichment (tracer/ tracee ratio) inter-assay CV was 1%, the intra-assay CV

1%, and the detection limit 0.04%.

Central thyronam


83

Chapter 5


Calculations and statistical analysisEGP was calculated from isotope enrichment and plasma glucose concentration using modified

forms of steady state (basal) and non-steady state (after thyronamine infusion) Steele equations

(18). Data were analyzed by two-way analysis of variance (ANOVA) with repeated measurements,

with treatment group (T1AM, T0AM or Veh) and time as dependent factors. Significance was

defined at p<0.05 using paired t-tests (i.e. within treatment groups) and independent t-tests (i.e.

between treatment groups) to identify experimental groups that differed significantly. The SPSS

statistical software program version 16.0 (SPSS Inc., Chicago, Illnois) was used for statistical

analysis. Data are presented as mean ± standard error of the mean (SEM).

Results In two independent studies, 8 groups of rats were investigated. In the first study rats received an

intraperitoneal (ip) bolus infusion of either T1AM (50 mg/kg, n=7), T0AM (50 mg/kg, n=8) or vehicle

(n=7). In the second study, rats were intracerebroventricularly (icv) infused with a 100-fold lower

dose (i.e. 0.5 mg/kg) of either T1AM (n=9), T0AM (n=8) or vehicle (n=8). To address the possibility

that any physiologic response observed following icv-infusion of the thyronamines was due to the

peripheral action of drug that spilled over into the circulation, two additional groups of animals were

intravenously (iv) infused with 0.5 mg/kg of T1AM (n=3) or 0.5 mg/kg of T0AM (n=3).

Study #1: Systemic thyronamine infusion Rats injected ip with 50 mg/kg T1AM or 50 mg/kg T0AM exhibited a behavioral phenotype as

described previously (1). Interestingly, the animals injected with T1AM displayed the more robust

phenotype even though the dose (on a per mole basis) was approximately half that of T0AM.

Glucose homeostasis – plasma concentration and endogenous production Systemic

infusion of either T1AM or T0AM by the ip route of administration induced a rapid and significant

increase in plasma glucose concentration (fig 1a). The onset and magnitude of this effect was

Fig 1a Plasma glucose concentrations before and after ip bolus infusion of T1AM, T0AM or vehicle. Note that from t=10 min, glucose concentration is higher in T1AM and T0AM treated animals as compared with vehicle rats (p<0.05). From t=60, glucose concentration is higher in T1AM as compared with T0AM treated rats (p<0.05). ANOVA RM factor time p<0.0001, time*group p<0.0001, group p<0.0001.b Endogenous glucose production (EGP) before and after ip bolus infusion of T1AM, T0AM or vehicle. From t=10 and t=20, EGP is higher in T1AM and T0AM infused rats, respectively, as compared with vehicle (p<0.05). From t=60, EGP is lower in T0AM relative to T1AM treated animals (p<0.05). From t=90, EGP in T0AM treated rats is not different from vehicle rats. ANOVA RM factor time p<0.0001, time*group p<0.0001, group p=0.001.

-20 -10 0 10 20 30 45 60 75 90 105 1200.0

2.5

5.0

7.5

10.0

12.5

15.0

17.5

20.0

22.5

25.0

ANOVA p< 0.0001

Bolus ip

Glu

cose

(m

mol

/L)

-10 0 10 20 30 45 60 75 90 105 12030

40

50

60

70

80

90

100

110Bolus ip

T0 AM 50 mg/kg ip (n=8)T1 AM 50 mg/kg ip (n=7)

Vehicle ip (n=7)

ANOVA p< 0.001

Time (min)

EGP

(um

ol/k

g*m

in)

a b

Time (min)

84


similar for the two compounds until 45 min post infusion when the effect of T0AM apparently

plateaued while the T1AM-induced hyperglycemia continued to develop eventually reaching a

maximum 371±27% of basal values 120 min after infusion.

Within 10 minutes of receiving an ip bolus of T1AM the EGP increased to 143±3% of basal

values (p=0.001 vs Veh, fig 1b), that was sustained for the duration of the experiment. Similarly,

ip administration of T0AM rapidly increased EGP, reaching a maximum of 158±16% of basal

values after 20 min (p=0.032 vs Veh). Forty-five minutes after injection with T0AM EGP gradually

returned to basal values by t=120 minutes.

Glucoregulatory Hormones Given the profound effect of T1AM and T0AM on plasma glucose

and EGP we characterized the status of three glucoregulatory hormones: insulin, glucagon,

and corticosterone (fig 2). Surprisingly, even though T1AM and T0AM (50 mg/kg, ip) produced

Fig 2a Plasma insulin concentration before (t=0) and after intraperitoneal (ip) injection of T1AM, T0AM or vehicle. ANOVA indicates no effects of time and no differences in insulin concentration between groups (ANOVA RM factor time p=0.556, time*group p=0.735, group p=0.213).b Plasma glucagon concentration before (t=0) and after ip injection of T1AM, T0AM or vehicle. From t=10, glucagon is higher in both T1AM and T0AM treated rats relative to vehicle rats (*p<0.05 vs Veh). At t=60, glucagon concentration is higher in T1AM as compared with T0AM treated rats (^p=0.05 T0AM vs T1AM). ANOVA RM factor time p<0.0001, time*group p<0.0001, group p=0.001.c Plasma corticosterone concentration before (t=-20 and t=0 min) and after (t=5 – t=120 min) ip injection of T1AM, T0AM or vehicle. T0AM treated animals have higher plasma corticosterone from t=30 and T1AM treated animals only on t=60 as compared with vehicle (*p<0.05 vs Veh). Note that at no time-point plasma corticosterone between T1AM and T0AM injected animals differs. ANOVA RM factor time p<0.0001, time*group p=0.050, group p=0.030.

0 10 60 1200

100

200

300

400 Bolus ip

ANOVA ns

Insu

lin (

pmol

/L)

0 10 60 1200

50

100

150

200

250

300

Bolus ip

*

**

^

Glu

cago

n (p

g/m

L)

-20 0 102030 60 1200

100

200

300

400

500Bolus ip

Time (min)

T1AM 50 mg/kg ip (n=7)

T0AM 50 mg/kg ip (n=8)

Vehicle ip (n=7)

*

**

*

Cor

tico

ster

one

(ng/

mL)

a

b

c

Central thyronam


85

Chapter 5


hyperglycemia and elevated EGP, plasma insulin concentrations were unchanged relative to

plasma from vehicle-injected rats (fig 2a). In contrast, plasma glucagon concentrations were

significantly increased within 10 minutes of either T1AM or T0AM administration (fig 2b).

However, by 60 minutes post injection, the time-effect profiles of the two compounds had begun

to diverge with T0AM’s effect reaching a plateau at 240% (p=0.007, T0AM vs Veh, t=60) of basal

levels while T1AM’s effect continued to develop for the duration of the experiment (447±44%

of basal values at 120 min, p<0.0001 T1AM vs Veh, fig 2b). Of note, the time-course profiles of

plasma glucagon (fig 2b) and plasma glucose (fig 1a) in response to ip T1AM and T0AM, were

essentially superimposable.

Plasma corticosterone displayed a significant increase in response to both T1AM and T0AM

injected ip, compared to vehicle-injected rats (fig 2c). T1AM infusion induced a maximal increase

at t=60 min (482±106% vs 179±71% of basal levels at t=60 min, T1AM vs Veh, p=0.022). T0AM

infusion increased plasma corticosterone to a similar extent (393±59% vs 172±102% of basal

levels at t=120 min, T0AM vs Veh, p=0.022). At no time point was there a difference in the

corticosterone response between T1AM and T0AM infused groups.

Plasma T3, T4 and TSH concentrations before and 120 min after ip T1AM, T0AM and vehicle infusion

are depicted in table 1. Within 120 min both T4 and TSH levels were significantly decreased in

response to ip T1AM or, to a larger extent, ip T0AM (50 mg/kg). Intriguingly, T3 levels were also

decreased 120 min after ip T0AM (50 mg/kg) as compared with vehicle injected rats.

Study #2: Central thyronamine infusionIcv infusion of 0.5 mg/kg T1AM or T0AM did not induce any of the phenotypical alterations

observed after systemic thyronamine administration.

Glucose homeostasis – plasma concentration and endogenous production With an icv

bolus infusion of 0.5 mg/kg T1AM plasma glucose concentration began to increase immediately

(fig 3a) until it reached a maximum 199±13% of basal levels 30 min after infusion (p<0.0001 vs

Veh). During the next 90 min plasma glucose decreased slightly stabilizing at approximately 163%

of basal values. T0AM (0.5 mg/kg, icv) significantly elevated plasma glucose as well, but to a lesser

degree than T1AM (maximum 134±6% at t=45, p<0.0001 vs Veh, fig 3a).

T1AM (0.5 mg/kg, icv) induced a rapid and significant increase in EGP (fig 3b) by 10 minutes

post infusion reaching a maximum 178±16% of basal values at 30 min (p<0.0001 vs Veh) that

gradually decreased with time to 113±5% when the experiment was terminated at t=120 min.

Table 1: Plasma thyroid hormone concentrations before (Basal) and after (2h) intraperitoneal (ip) vehicle, T1AM and T0AM infusion

Veh ip n = 7 T1AM ip n=7 T0AM ip n=8 ANOVA RM

Basal 2h Basal 2h Basal 2h Time Time*Group Group

p p p

T3 (nmol/L) 0,82 ± 0,05 0,78 ± 0,05 0,88 ± 0,04 0,83 ± 0,05 1,12 ± 0.07** 0,64 ± 0.07* ^ 0,000 0,000 0,515

T4 (nmol/L) 86 ± 3 70 ± 4* 91 ± 4 48 ± 3* “ 80 ± 3 42 ± 2* “ 0,000 0,002 0,000

TSH (mU/L) 1,46 ± 0,27 2,03 ± 0,31 1,79 ± 0,25 1,09 ± 0.29” 1,68 ± 0,16 0,40 ± 0.04* “ ^ 0,028 0,004 0,014

* p<0.05 vs Basal value within the same group, ** p<0.05 vs Veh Basal, “ p<0.05 vs Veh 2h, ^ p<0.05 vs T1AM 2h

86


Table 1: Plasma thyroid hormone concentrations before (Basal) and after (2h) intraperitoneal (ip) vehicle, T1AM and T0AM infusion

Veh ip n = 7 T1AM ip n=7 T0AM ip n=8 ANOVA RM


p p p

T3 (nmol/L) 0,82 ± 0,05 0,78 ± 0,05 0,88 ± 0,04 0,83 ± 0,05 1,12 ± 0.07** 0,64 ± 0.07* ^ 0,000 0,000 0,515

T4 (nmol/L) 86 ± 3 70 ± 4* 91 ± 4 48 ± 3* “ 80 ± 3 42 ± 2* “ 0,000 0,002 0,000

TSH (mU/L) 1,46 ± 0,27 2,03 ± 0,31 1,79 ± 0,25 1,09 ± 0.29” 1,68 ± 0,16 0,40 ± 0.04* “ ^ 0,028 0,004 0,014

* p<0.05 vs Basal value within the same group, ** p<0.05 vs Veh Basal, “ p<0.05 vs Veh 2h, ^ p<0.05 vs T1AM 2h

Although T0AM (0.5 mg/kg, icv) significantly increased EGP above basal levels (p<0.0001 t=0

vs t=10), its maximum effect (20±9% increase at t=20, p=0.069 vs Veh) was approximately one

third of T1AM’s maximal effect (fig 3b).

Importantly, when T1AM or T0AM were infused intravenously (iv) at the dose that was used in

the icv infusion experiments (0.5 mg/kg, T1AM n=3, T0AM n=3)) neither thyronamine had any

effect on plasma glucose concentrations, EGP, plasma insulin or glucagon at any time point as

compared to basal values (data not shown).

When the absolute changes in plasma glucose concentration produced by 0.5 mg/kg T1AM, icv

and 50 mg/kg T1AM ip are compared over time, their profiles are practically super-imposable for

the first 30 min of exposure (fig 4a). Thereafter they diverged as the systemic effect of T1AM

continued to develop. Plotting the absolute values for EGP in response to 0.5 mg/kg T1AM icv

and 50 mg/kg T1AM ip revealed both routes of administration produced identical profiles during

Fig 3a Plasma glucose concentration before and after intracerebroventricular (icv) bolus infusion of T1AM, T0AM or vehicle. From t=5 and t=10, glucose concentration in T1AM and T0AM infused rats, respectively, is higher compared with vehicle rats (p<0.05). From t=10, glucose concentration in T1AM infused rats is higher relative to T0AM infused rats (p<0.05). ANOVA RM factor time p<0.0001, time*group p<0.0001, group p<0.0001.b Endogenous glucose production (EGP) before and after icv bolus infusion of T1AM, T0AM or vehicle. There is no significant difference between basal samples of any group. From t=10, EGP in T1AM infused rats is higher compared with vehicle rats (p<0.05). In T0AM rats, EGP at t=30, 45, 90, 105 and 120 min is higher relative to vehicle infused rats (p<0.05). From t=20 to t=90, EGP is higher in T1AM relative to T0AM infused rats (p<0.05). ANOVA RM factor time p<0.0001, time*group p<0.0001, group p=0.006.

Time (min)Time (min)-20 -10 0 10 20 30 45 60 75 90 105 120

2

4

6

8

10

12

14

Bolus icv

ANOVA p<0.0001

Glu

cose

(m

mol

/L)

-20 -10 0 10 20 30 45 60 75 90 105 12030

40

50

60

70

80

90

100

110

Bolus icv

ANOVA p<0.0001

T0AM 0.5 mg/kg icv

T1AM 0.5 mg/kg icv

Vehicle icv

EGP

(um

ol/k

g*m

in)

a b

Central thyronam


87

Chapter 5


the initial 20 min post exposure (fig 4b). However, at 30 min thereafter the magnitude of the

EGP effect elicited by T1AM icv was significantly greater than the effect of T1AM ip.(fig 4b).

Glucoregulatory Hormones Similar to T1AM ip (fig 2a), neither T1AM or T0AM administered

icv induced a significant change in plasma insulin content (fig 5a). Although there was a trend

for insulin to decrease 10 min after icv infusion of T1AM this response failed to achieve statistical

significance (p=0.063, fig 5a).

Plasma glucagon increased by 155% (from 69±10 to 176±20 pg/mL) 10 min after icv T1AM

infusion (p<0.0001 vs Veh). During the same time period T0AM icv also significantly increased

plasma glucagon but only by 58% (p=0.004 vs Veh). Interestingly the magnitude of T1AM ‘s

impact on circulating glucagon levels was dependent on the route of administration with icv

infusion producing a greater effect in the first 10 min than ip administration (108±21 vs 50±11

pg/mL, respectively, p=0.044). Unlike the sustained elevation that followed ip administration of

Fig 4a Changes in plasma glucose concentration (delta) before and after intraperitoneal (ip) vs intra cerebroventricular (icv) bolus infusion of T1AM (T1AM ip, T1AM icv) or vehicle (Veh ip, Veh icv). From t=5, glucose concentration in T1AM ip and T1AM icv groups is increased relative to the respective vehicle group. Note that on t=20, 30 and 45 min, glucose concentration in T1AM ip and T1AM icv rats is not different. The changes in plasma glucose concentration are expressed as the difference compared to the plasma glucose concentration at t=0 min for each individual animal. ANOVA RM factor time p<0.0001, time*group p<0.0001, group p<0.0001. *p<0.05; T1AM ip vs T1AM icv.b Changes in endogenous glucose production (EGP) before and after intraperitoneal (ip) vs intracerebroven-tricular (icv) bolus infusion of T1AM (T1AM ip, T1AM icv) or vehicle (Veh ip, Veh icv). From t=5 and t=10 min, EGP in T1AM icv and T1AM ip infused rats, respectively, is increased as compared with respective vehicle groups (p<0.05). Note that on t=30, EGP is higher in T1AM icv than in T1AM ip treated rats (*p<0.05). The changes in EGP are expressed as the difference compared to EGP at t=0 min for each individual animal. ANOVA RM factor time p<0.0001, time*group p<0.0001, group p<0.0001.

-20 -10 0 10 20 30 45 60 75 90 105 120-5

0

5

10

15

20

Bolus

*

* **

*

*

*

∆ G

luco

se (

mm

ol/L

)

-20 -10 0 10 20 30 45 60 75 90 105 120-30

-20

-10

0

10

20

30

40

50

60

Time (min)

Vehicle icv (n=8)

T1AM 0.50 mg/kg icv (n=9)

Vehicle ip (n=7)T1AM 50 mg/kg ip (n=7)

Bolus

*

* ** *

∆ EG

P (µ

mol

/kg*

min

)

a b

Time (min)

Table 2: Plasma thyroid hormone concentrations before (Basal) and after (2h) intracerebroventricular (icv) vehicle, T1AM and T0AM infusion

Veh icv n = 8 T1AM icv n=9 T0AM icv n=8 ANOVA RM


p p p

T3 (nmol/L) 1,27 ± 0,08 0,77 ± 0,05* 1,39 ± 0,15 0,86 ± 0,09* 1,00 ± 0,05 0,73 ± 0,05* 0,000 0,198 0,056

T4 (nmol/L) 81 ± 7 53 ± 4* 79 ± 7 64 ± 7* 87 ± 4 62 ± 4* 0,000 0,184 0.578

TSH (mU/L) 1,64 ± 0,33 0,77 ± 0,16* 1,36 ± 0,26 0,64 ± 0,19 1,65 ± 0,25 0,58 ± 0,10 * 0,000 0,665 0,734

* p≤0.05 vs Basal value within the same group

88


Table 2: Plasma thyroid hormone concentrations before (Basal) and after (2h) intracerebroventricular (icv) vehicle, T1AM and T0AM infusion

Veh icv n = 8 T1AM icv n=9 T0AM icv n=8 ANOVA RM


p p p

T3 (nmol/L) 1,27 ± 0,08 0,77 ± 0,05* 1,39 ± 0,15 0,86 ± 0,09* 1,00 ± 0,05 0,73 ± 0,05* 0,000 0,198 0,056

T4 (nmol/L) 81 ± 7 53 ± 4* 79 ± 7 64 ± 7* 87 ± 4 62 ± 4* 0,000 0,184 0.578

TSH (mU/L) 1,64 ± 0,33 0,77 ± 0,16* 1,36 ± 0,26 0,64 ± 0,19 1,65 ± 0,25 0,58 ± 0,10 * 0,000 0,665 0,734

* p≤0.05 vs Basal value within the same group

either T1AM or T0AM, plasma glucagon returned to basal levels within 60 min of infusing either

compound icv (fig 5b).

Plasma corticosterone concentrations were significantly increased following icv infusion of either

0.5 mg/kg T1AM or T0AM (fig 5c) with both treatments producing nearly equivalent maximum

0 10 60 1200

100

200

300

400

500 Bolus icv

"

ANOVA ns

Insu

lin (

pmol

/L)

0 10 60 1200

50

100

150

200

250

300Bolus icv

*

*^

Glu

cago

n (p

g/m

L)

-20 0 102030 60 1200

100

200

300

400

500 Bolus icv

Vehicle icv (n=8)

T1AM 0.5 mg/kg icv (n=9)T0AM 0.5 mg/kg icv (n=8)

Time (min)

*

**** **

**^

Cor

tico

ster

on (

ng/m

L)a

b

c

Fig 5a Plasma insulin concentrations before (t=0) and after icv bolus infusion of T1AM, T0AM or vehicle. Note that at t=10 min, there is a trend for insulin concentrations to be depressed in animals receiving 0.5 mg/kg T1AM icv compared to vehicle treated rats (“p=0.063). ANOVA RM factor time p=0.01, time*group p=0.161, group p=0.758.b Plasma glucagon concentrations before (t=0) and after icv bolus infusion of T1AM, T0AM or vehicle. At t=10 min glucagon is significantly higher in T1AM icv and, to a lesser extent, T0AM icv as compared with vehicle icv treated rats. * p<0.01 vs vehicle icv, ^ p<0.01 T1AM vs T0AM icv. ANOVA RM factor time p<0.0001, time*group p<0.0001, group p<0.0001.c Plasma corticosterone concentration before (t= -20 and 0 min) and after (t=5 to t=120 min) icv bolus infusion of T1AM, T0AM or vehicle. Circulating corticosterone levels rapidly increase following infusion of T1AM or T0AM at t=20 and t=10 min as compared with vehicle, respectively. Note that T1AM and T0AM icv infused groups do not differ at any time point, except for t=5 min.*p<0.05 vs vehicle icv, ^ p<0.01 T1AM vs T0AM icv. ANOVA RM factor time p<0.0001, time*group p=0.002, group p=0.001.

Central thyronam


89

Chapter 5


effects by t=20 min post injection (delta corticosterone t=20 vs t=0; 6±44 ng/mL Veh icv, 206±58

ng/mL T1AM icv , 296±49 ng/mL T0AM icv, p=0.02 T1AM vs Veh, p<0.0001 T0AM vs Veh).

Plasma T3, T4 and TSH concentrations before and after central (icv) infusion of either T1AM, T0AM,

or vehicle (saline-DMSO) infusion are shown in table 2. Although plasma T3, T4 and TSH were found

to decrease in all treatment groups by 120 min post icv bolus infusion, neither icv T1AM nor T0AM

had a statistically significant effect on plasma T3, T4 or TSH compared to vehicle icv.

DiscussionIn an effort to determine if the thyronamines T1AM and T0AM can affect glucose homeostasis by

acting directly on the brain we compared their physiologic consequences following systemic and

central administration. The major finding of our study is that central administration of low dose

(i.e. 1% of the systemic dose) T1AM acutely increases EGP and plasma glucose concentration to

a similar -or even greater- extent compared with systemic T1AM, concomitant with an increase

of plasma glucagon and corticosterone concentrations. Similar effects were observed following

central T0AM infusion, albeit to a lesser extent. When administered intravenously, the same low

dose of T1AM and T0AM that was effective centrally had no detectable effect on plasma glucose

or EGP, thus excluding the possibility that the observed responses were the result of leakage of

the centrally administered compound into the circulation and acting peripherally.

Rats infused intraperitoneally with T1AM, and to a lesser extent T0AM, exhibited a behavioural

phenotype within minutes of administration, which was remarkably similar to the fully reversible

behavioural changes reported earlier in mice (1;19). In short, animals exhibited a decrease in

overall locomotor activity and responsiveness to external stimuli (visual, auditory) while reflexes

were preserved. Furthermore, the hyperglycemia that develops in mice (7) following thyronamine

exposure also is seen in rats (fig 1a). Moreover, we show for the first time that the hyperglycemia

induced by the thyronamines T1AM and (to a lesser extent) T0AM occurs simultaneously with

a rapid (i.e. within 10 min), approximately 50% increase in EGP, that was maintained for the

duration of the experiment (fig 1b).

With respect to the systemic administration of thyronamines there are several mechanisms that

may contribute to the alterations in glucose metabolism we observed. First, plasma glucagon

increases rapidly in response to systemic T1AM and T0AM administration, concomitant with the

increase in plasma glucose and EGP. It was expected that the thyronamine-induced hyperglycemia

(up to 22 mmol/L; fig 1a) would provoke a considerable insulin response. However, plasma

insulin did not change in spite of the overt hyperglycemia produced by either thyronamine. The

plasma glucagon increase together with this inadequate insulin response are likely to be causal

factors in the increase in plasma glucose and EGP induced by thyronamines. These effects on

plasma glucagon and insulin might be explained by direct actions of T1AM and T0AM on the

pancreatic alpha and beta cells, supposedly by binding to GPCRs such as TAAR1 or ARα2 (1;9).

Indeed, pharmacological stimulation of ARα2 has been shown to induce hyperglycemia and

inhibit insulin release (20). Secondly, given the rapid onset of thyronamine-induced changes it

is well possible that T1AM and T0AM activation of GPCRs expressed in hepatocytes underlies

90


the stimulation of EGP we observed, analogous to the stimulation of β-adrenergic receptors by

norepinephrine.

With regard to the possible mechanisms underlying the effects of centrally administered

thyronamines on glucose metabolism it is interesting that concomitant with the rapid increase

of EGP (fig 3b), plasma insulin levels tended to decrease acutely after central administration of

0.5 mg/kg T1AM (fig 5a) in contrast to systemically (i.e. ip) administered drug. In addition, after

icv infusion of 0.5 mg/kg T1AM there was a rapid increase of plasma glucagon (fig 5b), which

was more pronounced than the early glucagon increase after systemic thyronamine infusion. No

change in EGP, plasma insulin, and glucagon levels was observed after intravenous infusion of 0.5

mg/kg T1AM, confirming that T1AM-imposed actions on the CNS are causal to these phenomena.

This dependence of thyronamine effects on the route of administration point to neural or (neuro)

transmitter-type, rather than humoral-type of actions. Indeed, it has been demonstrated that T1AM

modulates synaptosomal transport of neurotransmitters such as dopamine and noradrenalin (21),

supposedly by behaving as endogenous monoamine re-uptake inhibitors (10). In addition, low

dose T1AM administration in the lateral cerebral ventricles and in the arcuate nucleus was recently

reported to rapidly increase food intake (22). The effects of thyronamines on plasma insulin and

glucagon in the present study may be explained by increased sympathetic tone in the pancreas,

mediated via central thyronamine actions. In addition, centrally administered thyronamines might

stimulate autonomic outflow from the hypothalamus to the liver thereby elevating EGP. In support

of this conjecture is accumulating evidence demonstrating the brain’s important role, particularly

the hypothalamus, in regulating hepatic glucose metabolism via sympathetic and parasympathetic

projections to the liver (12-15).

As thyronamines have been hypothesized to constitute a novel aspect of thyroid hormone biology

(1;9), it was of interest to assess how thyroid-related parameters in euthyroid animals responded

to synthetic thyronamines. Systemic infusion of these compounds, in particular T0AM, depressed

plasma TSH, T4 and T3 levels whereas central administration had no such effect. These responses

could represent a state reminiscent of the non-thyroidal illness syndrome (23-25). Although it is

conceivable the thyronamines altered TH secretion by decreasing TSH release from the pituitary,

the observation that central thyronamine administration does not induce plasma thyroid hormone

alterations relative to vehicle, argues against this possibility. Finally, an effect of thyronamines on

plasma concentrations of iodothyronines via interaction with the deiodinase enzymes seems less

likely as T1AM does not interfere with D1-mediated iodothyronine deiodination in vitro (2).

Systemic thyronamine administration produced a significant increases in plasma corticosterone

levels that were similar in T1AM and T0AM infused rats (fig 2c), and could be recapitulated by

low dose (0.5 mg/kg) icv infusion of synthetic T1AM or T0AM (fig 5c), suggesting that these

represent central effects of thyronamines on the hypothalamus-pituitary-adrenal (HPA)-axis. The

elevated corticosterone could contribute in a limited way to the hyperglycaemic state but, more

importantly, because in both experiments the hyperglycemia was much more pronounced in

T1AM as compared to T0AM infused animals, it is unlikely to account for the major glucose

increase induced by systemic and central T1AM.

There are several mechanisms by which circulating thyronamines might exert their actions in the

CNS. First, there could be passive or active transport of circulating thyronamines across the blood

Central thyronam


91

Chapter 5


brain barrier, the latter analogous to iodothyronines (26). Second, circulating thyronamines might

bind cell-surface receptors in the plasma membrane of neurons located in circumventricular nuclei

such as the arcuate nucleus where the blood brain barrier is absent. The arcuate nucleus is known

to mediate central actions of the peptide hormones like insulin and leptin via locally expressed

leptin and insulin receptors (27) and TAAR1 is expressed in the arcuate nucleus (5). However, our

finding that the EGP increase is not as robust following central administration of thyronamines

as it is after systemic administration suggests their central actions alone are insufficient to

account for the persistent EGP increase and hyperglycemia. Consistent with this interpretation

are the results from a recent study in which mice pre-treatment with 6-hydroxydopamine still

developed hyperglycemia and hypoinsulinemia following ip administration of T1AM, suggesting

that these T1AM-induced alterations can occur in the absence of sympathetic signalling (7).

Another possibility is that thyronamines impose both peripheral and central actions on glucose

metabolism, occurring independently. In this intriguing scenario, central actions could be

mediated by thyronamines formed locally in the brain, by conversion from iodothyronines such

as T4, T3 and/or rT3.

The rapid and pronounced metabolic effects produced by central administration T1AM and

T0AM suggest that one or more receptors mediate their actions. Indeed T1AM and T0AM dose-

dependently activate the Gs protein–coupled TAAR1 receptor (4-6;28). TAAR1 belongs to a

large family of related receptors (4;5) and this receptor’s mRNA is expressed in a wide variety

of tissues including many areas of the brain (5;6). The fact that the rank-order of potency as a

TAAR1 agonist in vitro, T1AM being more potent that T0AM (1), is also reflected in the metabolic

responses described in the present study, fits with the notion that TAAR1 may mediate some

actions of T1AM and T0AM. In addition, Regard and colleagues (7) recently showed that whereas

T1AM induces hyperglycemia after systemic administration in wild-type mice, this effect is lost

in adrenergic receptor alpha 2 (ARα2) deficient mice as well as mice pre-treated with the ARα2

antagonist yohimbine. Moreover, by using a transgenic approach, they provided strong evidence

that the hyperglycemia and concurrent hypoinsulinemia following T1AM infusion in mice was

dependent upon pancreatic Gi protein coupled receptor expression. Collectively, these data

suggest that, at least for the effects of systemically administered T1AM on glucose metabolism,

ARα2 is important. Interestingly, ARα2 are highly expressed in the hypothalamus as well and

contribute to the hypothalamic regulation of sympathetic outflow (29), supporting their possible

involvement in mediating effects of centrally administered thyronamines .

To date every published metabolic and physiologic study involving thyronamines, including this

one, has relied on the administration of synthetic material (7;8;19;30). Therefore, the biological

significance of endogenous thyronamines remains to be addressed. In this context it will be

important to establish how and where these compounds are synthesized. Although there is

currently no direct evidence in the literature for in vivo conversion of thyronamines from precursor

iodothyronines (i.e. T3, T4, rT3), the enzymes indispensable for such conversion such as aromatic

amino adic decarboxylase (AADC) for decarboxylation and iodothyronine deiodinases type 2

an 3 for deiodination are widely distributed in the CNS, and indeed within the hypothalamus

(31-34). An important remaining question is whether the metabolic effects in the present and

other studies represent physiological or pharmacological effects of thyronamines. The systemic

92


dose of T1AM used in our study has been shown to induce a 10-fold increase in plasma T1AM

concentration within 3 h after infusion in Siberian hamsters (8). However, there are currently no

data on the pharmacokinetic characteristics (distribution volume, clearance, binding to plasma

proteins) of thyronamines, and at present it is unknown how thyronamine tissue concentrations

during experimental manipulations compare to their concentrations under more physiologic

conditions.

We conclude that central administration of a low dose of either T1AM or T0AM can acutely induce

increased EGP and hyperglycemia, concomitant with increased plasma glucagon, corticosterone

and a deficient insulin response. These changes are very similar to the acute changes observed

after systemic T1AM and T0AM administration. Our data indicate that thyronamines can act

centrally in order to modulate glucose metabolism.

AcknowledgementsWe wish to thank A. van Riel, E.M. Johannesma-Brian and A.F.C. Ruiter for excellent technical

assistance.

Reference List 1. Scanlan TS, Suchland KL, Hart ME, Chiellini G, Huang Y, Kruzich PJ, Frascarelli S, Crossley DA, Bunzow

JR, Ronca-Testoni S, Lin ET, Hatton D, Zucchi R, Grandy DK 2004 3-Iodothyronamine is an endogenous and rapid-acting derivative of thyroid hormone. Nat Med 10:638-642

2. Piehl S, Heberer T, Balizs G, Scanlan TS, Smits R, Koksch B, Kohrle J 2008 Thyronamines are isozyme-specific substrates of deiodinases. Endocrinology 149:3037-3045

3. Hart ME, Suchland KL, Miyakawa M, Bunzow JR, Grandy DK, Scanlan TS 2006 Trace amine-associated receptor agonists: synthesis and evaluation of thyronamines and related analogues. J Med Chem 49:1101-1112

4. Grandy DK 2007 Trace amine-associated receptor 1-Family archetype or iconoclast? Pharmacol Ther 116:355-390


6. Bunzow JR, Sonders MS, Arttamangkul S, Harrison LM, Zhang G, Quigley DI, Darland T, Suchland KL, Pasumamula S, Kennedy JL, Olson SB, Magenis RE, Amara SG, Grandy DK 2001 Amphetamine, 3,4-methylenedioxymethamphetamine, lysergic acid diethylamide, and metabolites of the catecholamine neurotransmitters are agonists of a rat trace amine receptor. Mol Pharmacol 60:1181-1188

7. Regard JB, Kataoka H, Cano DA, Camerer E, Yin L, Zheng YW, Scanlan TS, Hebrok M, Coughlin SR 2007 Probing cell type-specific functions of Gi in vivo identifies GPCR regulators of insulin secretion. J Clin Invest 117:4034-4043

8. Braulke LJ, Klingenspor M, DeBarber A, Tobias SC, Grandy DK, Scanlan TS, Heldmaier G 2008 3-Iodothyronamine: a novel hormone controlling the balance between glucose and lipid utilisation. J Comp Physiol B 178:167-177

9. Liggett SB 2004 The two-timing thyroid. Nat Med 10:582-583

10. Weatherman RV 2007 A triple play for thyroid hormone. ACS Chem Biol 2:377-379

Central thyronam


93

Chapter 5


11. Kalsbeek A, La Fleur S, Van Heijningen C, Buijs RM 2004 Suprachiasmatic GABAergic inputs to the paraventricular nucleus control plasma glucose concentrations in the rat via sympathetic innervation of the liver. J Neurosci 24:7604-7613


13. Pocai A, Lam TK, Gutierrez-Juarez R, Obici S, Schwartz GJ, Bryan J, Aguilar-Bryan L, Rossetti L 2005 Hypothalamic K(ATP) channels control hepatic glucose production. Nature 434:1026-1031

14. Klieverik LP, Sauerwein HP, Ackermans MT, Boelen A, Kalsbeek A, Fliers E 2008 Effects of thyrotoxicosis and selective hepatic autonomic denervation on hepatic glucose metabolism in rats. Am J Physiol Endocrinol Metab 294:E513-E520


16. Ackermans MT, Klieverik LP, Endert E, Sauerwein HP, Kalsbeek A, Fliers E 2008 Plasma insulin concentrations during a hyperinsulinaemic clamp: what do we measure? Ann Clin Biochem 45:429-430



19. Doyle KP, Suchland KL, Ciesielski TM, Lessov NS, Grandy DK, Scanlan TS, Stenzel-Poore MP 2007 Novel thyroxine derivatives, thyronamine and 3-iodothyronamine, induce transient hypothermia and marked neuroprotection against stroke injury. Stroke 38:2569-2576

20. Angel I, Niddam R, Langer SZ 1990 Involvement of alpha-2 adrenergic receptor subtypes in hyperglycemia. J Pharmacol Exp Ther 254:877-882

21. Snead AN, Santos MS, Seal RP, Miyakawa M, Edwards RH, Scanlan TS 2007 Thyronamines inhibit plasma membrane and vesicular monoamine transport. ACS Chem Biol 2:390-398

22. Dhillo WS, Bewick GA, White NE, Gardiner JV, Thompson EL, Bataveljic A, Murphy KG, Roy D, Patel NA, Scutt JN, Armstrong A, Ghatei MA, Bloom SR 2009 The thyroid hormone derivative 3-iodothyronamine increases food intake in rodents. Diabetes Obes Metab 11:251-260

23. Adler SM, Wartofsky L 2007 The nonthyroidal illness syndrome. Endocrinol Metab Clin North Am 36:657-72

24. Boelen A, Kwakkel J, Thijssen-Timmer DC, Alkemade A, Fliers E, Wiersinga WM 2004 Simultaneous changes in central and peripheral components of the hypothalamus-pituitary-thyroid axis in lipopolysaccharide-induced acute illness in mice. J Endocrinol 182:315-323

25. Fliers E, Guldenaar SE, Wiersinga WM, Swaab DF 1997 Decreased hypothalamic thyrotropin-releasing hormone gene expression in patients with nonthyroidal illness. J Clin Endocrinol Metab 82:4032-4036

26. Dratman MB, Crutchfield FL, Schoenhoff MB 1991 Transport of iodothyronines from bloodstream to brain: contributions by blood:brain and choroid plexus:cerebrospinal fluid barriers. Brain Res 554:229-236

27. Niswender KD, Schwartz MW 2003 Insulin and leptin revisited: adiposity signals with overlapping physiological and intracellular signaling capabilities. Front Neuroendocrinol 24:1-10

28. Wainscott DB, Little SP, Yin T, Tu Y, Rocco VP, He JX, Nelson DL 2007 Pharmacologic characterization of the cloned human trace amine-associated receptor1 (TAAR1) and evidence for species differences with the rat TAAR1. J Pharmacol Exp Ther 320:475-485

94


29. Li DP, Atnip LM, Chen SR, Pan HL 2005 Regulation of synaptic inputs to paraventricular-spinal output neurons by alpha2 adrenergic receptors. J Neurophysiol 93:393-402

30. Chiellini G, Frascarelli S, Ghelardoni S, Carnicelli V, Tobias SC, DeBarber A, Brogioni S, Ronca-Testoni S, Cerbai E, Grandy DK, Scanlan TS, Zucchi R 2007 Cardiac effects of 3-iodothyronamine: a new aminergic system modulating cardiac function. FASEB J 21:1597-1608

31. Alkemade A, Friesema EC, Unmehopa UA, Fabriek BO, Kuiper GG, Leonard JL, Wiersinga WM, Swaab DF, Visser TJ, Fliers E 2005 Neuroanatomical pathways for thyroid hormone feedback in the human hypothalamus. J Clin Endocrinol Metab 90:4322-4334

32. Lechan RM, Fekete C 2005 Role of thyroid hormone deiodination in the hypothalamus. Thyroid 15:883-897

33. Tu HM, Kim SW, Salvatore D, Bartha T, Legradi G, Larsen PR, Lechan RM 1997 Regional distribution of type 2 thyroxine deiodinase messenger ribonucleic acid in rat hypothalamus and pituitary and its regulation by thyroid hormone. Endocrinology 138:3359-3368

34. Zhu MY, Juorio AV 1995 Aromatic L-amino acid decarboxylase: biological characterization and functional role. Gen Pharmacol 26:681-696

Central thyronam


95

Chapter 5


Energy homeostasis before and after cessation of block and replacement therapy in euthyroid patients with Graves’ disease

Lars P. KlieverikAndries KalsbeekMariëtte T. AckermansHans P. SauerweinWilmar M. WiersingaEric Fliers1

6


AbstractContext: Patients with Graves’ hyperthyroidism who are treated with a combination of a

thyrostatic drugs and thyroxine (T4), i.e., block and replacement therapy (BRT), often report

excessive body weight (BW) gain.

Objective: The aim of the present study was to investigate changes in BW and resting energy

expenditure (REE) upon cessation of BRT in euthyroid patients with Graves disease, and to identify

determinants of BW and energy metabolism in this setting.

Design and patients: We studied 22 euthyroid patients with Graves disease who had been

treated with BRT for 13.5 [9.5 – 48.0] months on two separate occasions, i.e. (i) during BRT, and

(ii) 12 weeks after cessation of BRT. Patients were biochemically euthyroid on both occasions. At

both visits, we assessed BW and body composition, energy metabolism using indirect calorimetry,

and serum hormone concentrations.

Results: There were no differences in BW or REE between the two visits. At visit 1, serum FT4

correlated positively with resting energy expenditure (REE, r=0.433, p=0.044) and negatively

with body fat % (r=-0.450, p=0.035), while serum free triiodothyronine (FT3) tended to correlate

with REE (r=0.390, p=0.066). Plasma FT3 as well as the FT3/FT4 ratio showed an increase 12 w

after cessation of BRT (by 20%, p<0.0001 and by 16%, p=0.007, respectively). Moreover, the %

change in FT3/FT4 ratio showed a significant and positive correlation with the % change in REE

between the 2 visits (r=0.465, p=0.029).

Conclusions: We conclude that serum FT4 is a determinant of REE in euthyroid patients treated

with BRT for Graves’ hyperthyroidism. Twelve weeks after cessation of BRT, BW and energy

homeostasis are unaltered. However, as the serum FT3/FT4 ratio increases after cessation of BRT

and as this change in FT3/FT4 ratio is a positive determinant of changes in REE, a longer term

decrease in BW is likely to occur.

98


IntroductionPatients with a first episode of Graves’ hyperthyroidism are often treated initially with

pharmacological therapy. Many clinicians use a therapeutic regimen commonly referred to as

“block and replacement therapy” (BRT) to attain biochemical euthyroidism. This involves the

administration of a thyroid hormone (TH) synthesis-blocking agent such as methimazole (MMI)

or propylthiouracil (PTU) to which L-thyroxine (T4) is added once serum TH concentrations reach

the euthyroid range.

Hyperthyroidism is associated with profound changes in energy homeostasis that usually resolve

upon treatment with BRT. As a result, the weight loss experienced during hyperthyroidism is

usually regained during treatment. Some older studies have reported no difference between

premorbid body weight (BW) and BW after one year of BRT (1;2), fitting with the notion of tight

BW set-point regulation. However, a more recent study in 162 patients reported a continuing BW

gain after treatment for hyperthyroidism. BW had increased by ~4 kg after 1 year, and increased

by ~10 kg after four years after of treatment (3). In line with this observation, 79% of patients

report weight gain exceeding their pre-morbid BW following treatment of hyperthyroidism (4).

Although the etiology of this excessive weight gain is incompletely understood at present, some

authors have proposed that it may result from subnormal energy expenditure due to iatrogenic

suppression of TH concentrations to the lower end of the normal range (5;6).

It is remarkable that studies addressing this issue to date have focussed on the comparison

between BW and energy homeostasis in untreated hyperthyroid patients with the euthyroid

situation during BRT. Approximately 50% of patients with Graves hyperthyroidism remain

euthyroid following cessation of BRT after at least one year of treatment, reflecting the

remission rate of autoimmune hyperthyroidism (7). In our Outpatient Clinic of Endocrinology,

BRT is discontinued in patients with Graves hyperthyroidism after approximately one year of

treatment. This regimen offers a good opportunity to investigate changes in BW upon cessation

of BRT in euthyroid patients with Graves disease and to identify determinants of BW and energy

metabolism in this setting.

Subjects and Methods Subjects Patients were recruited from the Outpatient Clinics of Endocrinology and Metabolism at

the Academic Medical Center of the University of Amsterdam. Inclusion criteria were: (i) a

minimum of six months of MMI or PTU in combination with T4 pharmacotherapy for Graves’

hyperthyroidism, diagnosed on the basis of standard biochemical and scintigraphic criteria (8), (ii)

biochemical euthyroidism (defined as serum FT4 between 9 – 23 pmol/L, serum T3 between 1.3-

2.7 nmol/L and serum TSH<5 mU/L) on both study occasions, and (iii) age between 20 and 60

years. As low or even suppressed serum TSH values can be found in euthyroid patients treated

for Graves hyperthyroidism, probably resulting from binding of circulating TSH receptor (TSH-R)

auto-antibodies (TBII) to the TSH-R on the thyrotrophs (9), patients with serum TSH values below

the lower limit of the reference range could participate in the study.

Energy homeostasis and block and replacem

ent therapy

99

Chapter 6


Exclusion criteria were (i) pregnancy (ii) abnormal liver function as apparent from serum alanin-

aminotransferase >45 U/L, aspartate-aminotransferase > 40 U/L or gamma-glutamyl-transferase

>60 U/L, and (iii) abnormal kidney function (serum kreatinine>95 μmol/L) at inclusion.

The study was approved by the Medical Ethical Committee of the Academic Medical Center of

the University of Amsterdam and accordingly, written informed consent was obtained from all

subjects prior to inclusion.

ProtocolIn this observational study, the participants were studied in the morning after an overnight fast

on two occasions, i.e. (i) during biochemical euthyroidism while on BRT (visit 1) and (ii) during

biochemical euthyroidism12 w after discontinuation of BRT (indicating remission of Graves’

hyperthyroidism) (visit 2). At visit 1, a medical history was obtained regarding premorbid BW,

initial presentation of Graves hyperthyroidism. Data on BW progression during the course of

treatment was obtained from clinic records for every individual patient. On both occasions,

BW, resting energy expenditure (REE), body composition and serum T3, T4, FT3, FT4, rT3, TSH,

insulin, glucose, adrenalin and noradrenalin were assessed. All measurements were performed

in the morning between 8.00 and 12.00 AM . Twenty-seven patients used no medication other

than BRT. One patient used a β-adrenergic blocker (metoprolol), and another patient used a

benzodiazepine (diazepam). Both patients were instructed not to take any co-medication within

at least 24h prior to study measurements. All patients were instructed not to take thyroxine in

the morning of visit 1, and smoking was not allowed within 12 h prior to measurements. Patients

were instructed to prevent physical exercise at least 3 days before both study visits, to eat 3

meals per day and not to change their eating habits between the visits.

Body composition and indirect calorimetry

Body composition was measured using bioelectrical impedance analysis (Maltron BF-906,

Rayleigh, UK). Oxygen consumption (VO2) and CO2 production (VCO2) were measured with 20

sec intervals for a total time of 30 min by indirect calorimetry using a ventilated hood system

(Sensormedicsmodel 2900; Sensormedics, Anaheim, USA). Patients were studied in the morning

after an overnight fast. During and 30 min prior to the calorimetry measurements, subject were

instructed to rest in the supine position in a temperature-controlled room (23°C). REE, lipid

and glucose oxidation were calculated from VO2 and VCO2 values using algorhythms previously

reported by Frayn et al (10). Respiratory quotient was calculated as VCO2 / VO2. The final 25 min

of each calorimetry measurement, during which stable VO2 and VCO2 values are reached, were

averaged for further analysis in every individual patient.

HormonesSerum (total) T3 and (total) T4 and rT3 were measured with in-house radioimmunoassay’s (RIA)

(11). Serum FT4 , FT3 and TSH were measured by time-resolved fluoroimmunoassay (Delfia

,Wallac Oy, Turku, Finland). For FT4 the intra-assay variation was 4-5%, the inter-assay variation

6-7%, and the detection limit 2 pmol/L. For FT3 the intra-assay variation was ±6%, the inter-assay

variation ±9%, and the detection limit 1 pmol/L. For TSH the intra-assay variation was 3-4%,

the inter-assay variation 4-5%, and the detection limit 0.01 mU/L. Insulin was measured with a

chemiluminescent immunometric assay (Immulite 2000 system, Diagnostic Products Corporation,

100


Los Angeles, USA) with an intra-assay variation of 3-6%, an inter-assay variation of 4-6%, and a

detection limit of 15 pmol/L. Serum TBII was quantitatively determined by a second generation

luminescence receptor assay (DYNOtest TRAK human assay, B.R.A.H.M.S.). Noradrenalin and

adrenalin were determined with an in-house HPLC method. Intra-assay variation noradrenalin:

2%; adrenalin 9%; inter-assay variation noradrenalin: 10%; adrenalin: 14-18%; detection limit:

0.05 nmol/L for both hormones.

StatisticsAll data were analyzed using non-parametric tests. We performed comparisons between study

occasions with the Wilcoxon Signed Rank test, and expressed correlations as Spearman’s rank

correlation coefficient (r). SPSS statistical software version 12.0.1 (SPSS Inc, Chicago, IL) was

used for statistical analysis. Data are presented as median [minimum-maximum].

Results Thirty-nine biochemically euthyroid patients were initially included and studied before cessation

of BRT. Of these patients, nine had developed a relapse of hyperthyroidism while two patients

who had undergone radio-iodine (I131) ablative therapy had developed hypothyroidism at visit 2.

Six patients were excluded from the final analysis on the basis of serum FT4 or T3 values outside

the reference range, or serum TSH values above the upper limit of the reference range. Thus, the

final analysis was performed in 22 patients who were biochemically euthyroid at both visits.

Anthropometric characteristicsAt visit 1, the patients (18 women and 4 men) were 45.5 [24–56] years of age. Body mass index

was 23.8 [19.9–35.8] kg/m2, body height 168 [158–182] cm, and BW was 67.5 [49.4–106.6]

kg. Lean body mass and fat mass were 69.6 [52.0–80.7]%, and 30.4 [19.3–48.0] % of total

body weight, respectively.

Body weight and energy homeostasisPatients reported that before the onset of the symptoms -later attributed to hyperthyroidism-

that had urged them to seek medical advice, BW, i.e., premorbid BW, was 64.0 [47.5 – 97.0] kg.

Table 1 Body weight (BW)

median min - max p

kg kg

Pre-morbid BW (self reported) 64.0 a 47.5 - 97.0

BW at diagnosis GD 62.0 b 45.0 - 92.0 <0.0001 (a vs b)

BW visit 1 (during BRT) 68.1 c 49.4 - 106.6 <0.0001 (b vs c)

BW visit 2 (12w after BRT cessation) 67.1 d 48.0 - 106.5 0.889 (c vs d)

median

kg %

Δ BW (visit 1 - pre-morbid) 2.4 3.7 -17.1 - 14.6

Δ BW (visit 1 - visit 2) 0.0 0.0 -5.4 - 3.2


ent therapy

101

Chapter 6


Eighty-two percent (18/22) of patients reported that decreased BW was among the symptoms

of hyperthyroidism. At the time of diagnosis of hyperthyroidism, the patients had lost 4.8 [0.0 –

25.0] kg of self-reported premorbid BW. Nineteen patients were started on methimazole and 3

patients were started on PTU, to which thyroxine was added as soon as biochemical euthyroidism

was reached. At visit 1, when BRT was discontinued, patients had been treated with BRT for

13.5 [9.5 – 48.0] months. During BRT patients gained 6.9 [-0.1 – 14.6] kg. The difference

between premorbid BW and BW at visit 1 (i.e., presumed weight gain) was 2.4 [-17.1 – 14.6] kg

(premorbid BW vs visit 1 BW, p=0.001).

There was no significant difference in median BW between visit 1 and visit 2, 12 w after cessation

of BRT (table 1, p=0.899). The median difference in BW between visit 1 and visit 2 calculated per

individual patient was 0.0 [-5.4 – 3.2] kg. Furthermore, there was no difference in REE, fat and

glucose oxidation, RQ or body fat mass between visit 1 and visit 2 (table 2).

HormonesSerum T4 and FT4 were not different between visit 1 and 2 (p=0.362 and p=0.676, respectively,

table 3). Serum T3 tended to increase at visit 2 as compared with visit 1 (3%, p=0.069), whereas

FT3 showed a statistically significant increase at visit 2 (20%, p=0.005). Serum TSH levels decreased

by 59% and serum TBII concentrations by 15% at visit 2 compared with visit 1 (p=0.001 and

p=0.007, respectively). Accordingly, the serum T3/T4 ratio increased by 10% from 1.79% (visit 1)

to 1.97% (visit 2, p=0.033), and the serum FT3/FT4 ratio increased by 16% from 31.8% (visit 1)

to 37.0% (visit 2, p=0.007, see fig 1).

At visit 1, there was a positive correlation between serum FT4 and REE (p=0.044, fig 2a), and

a negative correlation between serum FT4 and % body fat mass (p=0.035, fig 2b). In addition,

Table 2 REE, substrate oxidation and body composition

Visit 1 Visit 2 p

median min - max median min - max

REE (kCal/kg*24h) 19.7 14.3 - 24.3 20.3 13.2 - 26.2 0.249

Body fat mass (% of total BW) 30.4 19.3 - 48.0 29.1 19.6 - 49.8 0.102

RQ 0.81 0.74 - 0.92 0.81 0.72 - 0.91 0.910

Glucose oxidation (mg/min*kg) 1.12 0.17 - 2.23 1.26 0.00 - 2.22 0.745

Lipid oxidation (mg/min*kg) 0.75 0.15 - 1.23 0.71 0.20 - 1.11 0.858

Visit 1 Visit 20.0

0.1

0.2

0.3

0.4

0.5

0.6 *

FT3

/ FT

4 rat

io

*p=0.007

Fig 1 Serum FT3/FT4 ratios of 22 euthyroid Graves patients during BRT (visit 1; grey boxplots) and 12 weeks after cessation of BRT (visit 2, open boxplots). *p=0.007 visit 1 vs visit 2.

102


Fig 2 Correlations of serum FT4 with body fat % (fig 2a) and resting energy expenditure (REE, fig 2b), and serum FT3 with body fat % (fig 2c) and REE (fig 2d). Spearman’s correlation coefficients (r) and p values are plotted under the horizontal axis of each graph.

8 10 12 14 16 18 20 22 05

10 1520253035404550 55

r= -0.450 p=0.035

Body

fat

mas

s (%

)

8 10 12 14 16 18 20 2212.5

15.0

17.5

20.0

22.5

25.0

27.5

r=0.433 p=0.044

FT4(pmol/L)

2 3 4 5 6 7

r= -0.237 p=0.288

2 3 4 5 6 7

r=0.390 p=0.066

FT 3 (pmol/L)

REE

(kC

al/k

g*24

u)

a b

c d

Body

fat

mas

s (%

)

REE

(kC

al/k

g*24

h)

12.5

15.0

17.5

20.0

22.5

25.0

27.5

05

10152025303540455055

FT 3 (pmol/L)

FT4(pmol/L)

Table 3 Plasma hormone concentrations at visit 1 and visit 2

Visit 1 Visit 2 p Reference range

median min - max median min - max

T4 (nmol/L) 95 60 - 170 90 70 - 130 0.362 70 - 150

FT4 (pmol/L) 13.7 10.0 - 19.3 14.0 10.5 - 21.3 0.676 10.0 - 23.0

T3 (nmol/L) 1.68 1.2 - 2.3 1.73 1.3 - 2.7 0.069 1.3 - 2.7

FT3 (pmol/L) 4.4 3.0 - 6.2 5.3 3.9 - 9.3 0.005 3.3 - 8.2

TSH (mU/L) 1.70 0.04 - 4.50 0.70 0.01 - 2.03 0.001 0.5 - 5.00

TBII (U/L) 1.3 0.5 - 8.9 1.1 0.5 - 7.6 0.007

Insulin (pmol/L) 30 15 - 131 32 15 - 136 0.695 34 - 172

Adrenalin (nmol/L) 0.08 0.05 - 0.48 0.09 0.05 - 0.51 0.872 0.00 - 0.55

Noradrenalin (nmol/l) 1.05 0.43 - 3.69 1.38 0.53 - 4.18 0.833 0.00 - 3.25


ent therapy

103

Chapter 6


there was a highly significant negative correlation between REE and % body fat mass (r= -0.549,

p=0.008). Serum FT3 tended to correlate positively with REE (p=0.066, fig 2c), but showed no

correlation with % body fat mass (p=0.288, fig 2d).

However, at visit 2, these significant correlations were absent (FT4 vs body fat % r=-0.247,

p=0.270, FT4 vs REE r=0.320, p=0.172, FT3 vs body fat % r=-0.109, p=0.630, FT3 vs REE r=0.135,

p=0.550). Intriguingly, the difference in (Δ) FT3/FT4 ratio and ΔREE between visit 1 and visit 2

showed a positive correlation (R=-0.465, p=0.029, see Fig 3).

There were no differences in serum glucose, insulin, adrenalin or noradrenalin between the two

visits (table 3).

DiscussionPatients with Graves disease who are treated with a combination of a thyreostatic drug and

thyroxine replacement, i.e. block and replacement therapy (BRT), often experience a marked

gain in body weight (BW) (3), that has been reported to exceed self-reported premorbid BW

(4). However, there are some inconsistencies in the published data on this issue. In the present

study, we found a median weight excess of 2.4 kg compared with self-reported premorbid BW

in a group of 22 euthyroid patients with Graves hyperthyroidism who had been treated with

BRT for a median of 13.5 months. To further investigate this phenomenon we assessed energy

homeostasis and serum hormone concentrations in these patients both before and 12w after

cessation of BRT. Somewhat unexpectedly, patients showed no change in BW or REE at 12 w

after BRT cessation.

With respect to the 2.4 kg BW excess we are aware of the uncertainty regarding the reliability

of self-reported premorbid BW (12). Symptoms such as a decrease in BW are slowly progressive

and patients may find it hard to remember the precise onset of symptoms. Therefore, we

cannot exclude that underestimation of the self-reported premorbid BWs may have led to an

overestimation of the BW excess during BRT in our patients. In any case, the present study does

not support the clinical impression of a marked and excessive BW increase after ~1 year of BRT

following hyperthyroidism.

Hyperthyroidism is associated with a marked increase in REE (13;14). The simultaneous increase

in appetite and caloric intake does not completely prevent weight loss in most hyperthyroid

patients (15). By inference, BW changes appear to be primarily determined by EE in these

-50 -25 0 25 50 75 100 125-20

-15

-10

-5

0

5

10

15

20

∆ FT3 / FT4 (%)

∆ R

EE (

%)

Fig 3 Correlation of the difference in REE corrected for BW between visit 1 and visit 2 (Δ REE (%)) and the difference in serum FT3/FT4 ratios between visit 1 and visit 2 (Δ FT3/FT4 (%)). Spearman’s correlation coefficient (r)= 0.465, p= 0.029.

104


patients. In addition, it has been shown previously that caloric intake decreases rapidly to

normal within 3 months of initiation of anti-thyroid treatment, whereas in the same period BW

increases to premorbid levels (1). Therefore, increased caloric intake is not a likely candidate to

explain the BW gain after initiation of thyreostatic treatment. Our finding that REE and BW are

similar during treatment with BRT compared with 12 weeks after BRT cessation, suggests that

BRT does not induce a major change in energy homeostasis and, in turn, BW gain in excess of

the premorbid situation.

The patients in our study were euthyroid on both occasions, following the design of the study.

This enabled us to investigate the relationship between subtle changes in serum TH values within

the euthyroid range on the one hand, and measures of energy homeostasis on the other hand.

As anticipated, serum FT3/FT4 ratios significantly (16%) increased after cessation of BRT. This

can probably be attributed to reinstated thyroidal T3 secretion, whereas enzymatic conversion

from exogenous T4 is probably the major source of serum T3 during BRT. Interestingly, there

was a significant and positive correlation between the difference in serum FT3/FT4 ratio and the

difference in REE between the 2 study occasions, suggesting that the serum FT3/FT4 ratio is a

positive determinant of REE under these circumstances (fig 3). In addition, serum FT4 levels within

the euthyroid range were a positive determinant of REE. Also FT3 tended to positively determine

REE. This illustrates the sensitivity of REE to even small fluctuations in circulating thyroid hormone

concentrations, which is supported by previous reports (16;17). As anticipated, REE and % body

fat mass showed a highly significant negative correlation. Therefore, it is likely that the negative

correlation between serum FT4 and % body fat mass can be explained by the observation that

FT4 positively determines REE. It appears remarkable that these correlations reached statistical

significance despite the relatively small number and heterogeneity (i.e. regarding age, sex, BMI,

FFM) of patients. Why this was only evident during BRT treatment and not at visit 2 remains

unclear. It may be that after cessation of BRT, the pathophysiological changes in the HPT-axis

associated with Graves disease (e.g., by circulating TBII) prevent the detection of clear-cut

associations between circulating thyroid hormones and REE. Another explanation may be that

a period of 12 weeks is not sufficient to reinstate physiological thyroid hormone synthesis and

release from the thyroid gland.

Although REE and BW were unaltered 12 w after BRT cessation, the data presented do raise a

number of interesting possibilities. Our finding that changes in serum FT3/FT4 ratios positively

determine REE in euthyroid patients (fig 3), suggests that tissues capable of modulating energy

metabolism sense even small changes in circulating THs and alter REE accordingly. Candidates

include tissues significantly contributing to REE and expressing TH receptors such as the heart

and CNS, while striated muscle and adipose tissue may contribute to a lesser extent (18).

Another possibility to explain these findings may be TH-dependent regulation of REE via the

brain, as the hypothalamus plays a major role in the regulation of energy metabolism (19;20).

Interestingly, there is a high density of TH receptors in the rat and human hypothalamic arcuate

and paraventricular nuclei (21;22), and these nuclei are both key players in BW regulation

(16). Recently, we have shown that hypothalamic T3 administration stimulates hepatic glucose

production via a neural pathway involving the hypothalamic paraventricular nucleus and the

sympathetic nervous system (23). Thus, the hypothalamus is able to sense THs and in turn


ent therapy

105

Chapter 6


modulate hepatic glucose metabolism by means of altered sympathetic outflow to the liver. This

raises the possibility that it may similarly modulate energy metabolism by autonomic projections

to other target tissues such as skeletal muscle and adipose tissue in response to TH (24;25).

Serum TSH concentration was lower at visit 2 as compared with visit 1, although it remained

within reference intervals. This may be explained either by subtle T4 under-treatment during BRT

despite serum T4 and FT4 levels within the reference range . Alternatively, the decrease in serum

TSH may point to a tendency to develop a relapse of hyperthyroidism in some patients. However,

this latter possibility appears to be less likely given the decrease of serum TBII, 12 w after BRT

cessation.

In conclusion, we observed no changes in BW and resting energy metabolism 12 weeks after

cessation of BRT in euthyroid Graves patients, so the present findings do not support the notion

that BRT per se induces excessive BW gain. However, patients who stopped BRT showed an

increase in the serum FT3/FT4 ratio and these changes in FT3/FT4 ratio were a positive determinant

of changes in REE. Hence, it is well possible that the changes in circulating thyroid hormones

after cessation of BRT require a longer observational period in order to translate into clear-cut

alterations in BW.

AcknowledgementsWe wish to thank E.M. Johannesma-Brian for excellent analytical assistance.

Reference List 1. Abid M, Billington CJ, Nuttall FQ. Thyroid function and energy intake during weight gain following

treatment of hyperthyroidism. J Am Coll Nutr 1999; 18(2):189-193.

2. Lonn L, Stenlof K, Ottosson M, Lindroos AK, Nystrom E, Sjostrom L. Body weight and body composition changes after treatment of hyperthyroidism. J Clin Endocrinol Metab 1998; 83(12):4269-4273.

3. Dale J, Daykin J, Holder R, Sheppard MC, Franklyn JA. Weight gain following treatment of hyperthyroidism. Clin Endocrinol (Oxf) 2001; 55(2):233-239.

4. Jansson S, Berg G, Lindstedt G, Michanek A, Nystrom E. Overweight--a common problem among women treated for hyperthyroidism. Postgrad Med J 1993; 69(808):107-111.

5. Jacobsen R, Lundsgaard C, Lorenzen J et al. Subnormal energy expenditure: a putative causal factor in the weight gain induced by treatment of hyperthyroidism. Diabetes Obes Metab 2006; 8(2):220-227.

6. Abid M, Billington CJ, Nuttall FQ. Thyroid function and energy intake during weight gain following treatment of hyperthyroidism. J Am Coll Nutr 1999; 18(2):189-193.

7. Abraham P, Avenell A, Watson WA, Park CM, Bevan JS. Antithyroid drug regimen for treating Graves’ hyperthyroidism. Cochrane Database Syst Rev 2005;(2):CD003420.

8. Vos XG, Smit N, Endert E, Tijssen JG, Wiersinga WM. Frequency and characteristics of TBII-seronegative patients in a population with untreated Graves‘ hyperthyroidism: a prospective study. Clin Endocrinol (Oxf) 2008; 69(2):311-317.

9. Brokken LJ, Wiersinga WM, Prummel MF. Thyrotropin receptor autoantibodies are associated with continued thyrotropin suppression in treated euthyroid Graves‘ disease patients. J Clin Endocrinol Metab 2003; 88(9):4135-4138.

10. Frayn KN. Calculation of substrate oxidation rates in vivo from gaseous exchange. J Appl Physiol 1983; 55(2):628-634.

106


11. Wiersinga WM, Chopra IJ. Radioimmunoassay of thyroxine (T4), 3,5,3‘-triiodothyronine (T3), 3,3‘,5‘-triiodothyronine (reverse T3, rT3), and 3,3‘-diiodothyronine (T2). Methods Enzymol 1982; 84:272-303.

12. Gorber SC, Tremblay M, Moher D, Gorber B. A comparison of direct vs. self-report measures for assessing height, weight and body mass index: a systematic review. Obes Rev 2007; 8(4):307-326.

13. Bech K, Damsbo P, Eldrup E et al. beta-cell function and glucose and lipid oxidation in Graves‘ disease. Clin Endocrinol (Oxf) 1996; 44(1):59-66.

14. Moller N, Nielsen S, Nyholm B, Porksen N, Alberti KG, Weeke J. Glucose turnover, fuel oxidation and forearm substrate exchange in patients with thyrotoxicosis before and after medical treatment. Clin Endocrinol (Oxf) 1996; 44(4):453-459.

15. Hoogwerf BJ, Nuttall FQ. Long-term weight regulation in treated hyperthyroid and hypothyroid subjects. Am J Med 1984; 76(6):963-970.

16. al Adsani H, Hoffer LJ, Silva JE. Resting energy expenditure is sensitive to small dose changes in patients on chronic thyroid hormone replacement. J Clin Endocrinol Metab 1997; 82(4):1118-1125.

17. Ortega E, Pannacciulli N, Bogardus C, Krakoff J. Plasma concentrations of free triiodothyronine predict weight change in euthyroid persons. Am J Clin Nutr 2007; 85(2):440-445.

18. Muller MJ, Bosy-Westphal A, Kutzner D, Heller M. Metabolically active components of fat-free mass and resting energy expenditure in humans: recent lessons from imaging technologies. Obes Rev 2002; 3(2):113-122.

19. Sandoval D, Cota D, Seeley RJ. The integrative role of CNS fuel-sensing mechanisms in energy balance and glucose regulation. Annu Rev Physiol 2008; 70:513-535.

20. Seeley RJ, Drazen DL, Clegg DJ. The critical role of the melanocortin system in the control of energy balance. Annu Rev Nutr 2004; 24:133-149.

21. Alkemade A, Vuijst CL, Unmehopa UA et al. Thyroid hormone receptor expression in the human hypothalamus and anterior pituitary. J Clin Endocrinol Metab 2005; 90(2):904-912.

22. Lechan RM, Fekete C. The TRH neuron: a hypothalamic integrator of energy metabolism. Prog Brain Res 2006; 153:209-235.

23. Klieverik LP, Janssen SF, van Riel A et al. Thyroid hormone modulates glucose production via a sympathetic pathway from the hypothalamic paraventricular nucleus to the liver. Proc Natl Acad Sci U S A 2009; 106(14):5966-5971.

24. Kreier F, Fliers E, Voshol PJ et al. Selective parasympathetic innervation of subcutaneous and intra-abdominal fat--functional implications. J Clin Invest 2002; 110(9):1243-1250.

25. Kalsbeek A, La FS, Van HC, Buijs RM. Suprachiasmatic GABAergic inputs to the paraventricular nucleus control plasma glucose concentrations in the rat via sympathetic innervation of the liver. J Neurosci 2004; 24(35):7604-7613.


ent therapy

107

Chapter 6


General discussion

7


7.1 Historical perspectiveAlready by the end of the 19th century the similarity between the syndrome characterized by

goiter, exophthalmos and palpitations (i.e., the so-called “Merseburger triad”) that we now

know as Graves’ disease, and the effects of activation of the sympathetic nervous system

(SNS) was recognized. This led to the widespread theory - decades before the discovery and

isolation thyroxine (T4)- that increased SNS activity played an important pathophysiological

role in this syndrome (1). Clinical application of this notion came with the treatment of severe

thyrotoxicosis by resection of the cervical sympathetic chain in the late 19th century (2), and by

high spinal anaesthesia or adrenal demedullation (3) as a surgical alternative to thyroidectomy

up until the 1930s. After the successful isolation and synthesis of thyroid hormone (TH) and the

subsequent development of antithyroid drugs, these practices were gradually abandoned. Later

on, β-adrenergic blockers came in use for the initial management of severe thyrotoxicosis, a

practice that is still successfully employed today. When it appeared that plasma catecholamine

concentrations during thyrotoxicosis are typically low to normal (4;5), the theory of increased

SNS activity during thyrotoxicosis moved to the background.

With the technical advances in biomedical science from the 1960s onwards, much knowledge

was gathered concerning the link between TH and the SNS. A considerable amount of evidence

was obtained supporting the concept of increased

sensitivity to catecholamines during thyrotoxicosis. Both on the receptor level (β-adrenergic

receptor expression) and on the post-receptor level (i.e., expression of G-proteins, adenylate

cyclase), β-adrenergic signal transduction turned out to be more responsive during thyrotoxicosis

and, conversely, less responsive during hypothyroidism. Many of these studies focussed on the

effects of THs in white adipose tissue (WAT), e.g., lipolysis, the heart and in brown adipose tissue

(BAT). BAT, which is critical for non-shivering thermogenesis in rodents and other small mammals,

even became exemplary for the synergism between TH and the SNS. In response to cold, increased

sympathetic input from the hypothalamic “thermostat” on the one hand, and increased local T3

tissue concentrations -by catecholamine mediated stimulation of local deiodinase type 2 (D2)

activity- on the other, appeared to act synergistically to stimulate thermogenesis (6). Collectively,

these data provided a theoretical explanation for some of the so-called “hyperadrenergic”

symptoms of thyrotoxicosis, although increased β-adrenergic responsiveness at the molecular

level does not always translate into increased physiological sensitivity to catecholamines in vivo

(7;8).

On closer examination, data on alterations of SNS activity during thyrotoxicosis in vivo are often

conflicting. One plausible explanation for this phenomenon may be that adequately measuring

sympathetic neural activity in vivo is notoriously difficult. Over the years, several techniques have

been in use. Plasma catecholamine concentrations appeared to be a poor measure of sympathetic

activity, as it shows considerable fluctuation and mainly provides information regarding

catecholamine secretion in the body compartment from which the plasma sample was obtained.

The 24h urinary excretion of catecholamines, that has been reported to be increased during

hyperthyroidism (9;10), reflects total catecholamine production over 24h. However, it still offers

no differentiation between catecholamines produced by the adrenal medulla and catecholamines

General discussion

111

Chapter 7


produced by sympathetic nerve endings. In addition, it does not distinguish between sympathetic

activity in specific tissues. For many years, tissue efflux rate of tritiated noradrenaline (3H-NA)

after systemic 3H-NA infusion in experimental animals was regarded the best available method for

measuring tissue-specific SNS activity. This technique somewhat unexpectedly showed increased 3H-NA efflux from the heart and adrenal glands of hypothyroid instead of hyperthyroid rats (11).

Finally, muscle neurography was used to record tibial nerve sympathetic activity, and pointed to

increased activity in hypothyroid, and decreased activity in thyrotoxic patients (12). Although

these techniques potentially provide more accurate information on tissue-specific sympathetic

tone, the data are in conflict with more recent data demonstrating alterations in heart rate

variability in thyrotoxic patients indicating a shift to increased sympathetic and decreased vagal

input to the heart (13-15). Additionally, microdialysis techniques have become available for in

vivo measurement of compounds such as NA in the interstitial space in human subcutaneous

adipose tissue. This technique revealed that in hyperthyroid patients glycerol –reflecting the rate

of lipolysis- and NA concentrations in subcutaneous WAT are increased whereas the opposite

is the case in hypothyroid patients (16). This suggests increased WAT lipolysis due to increased

sympathetic tone in hyperthyroid, and the opposite in hypothyroid patients.

As can be concluded from the various studies mentioned, different techniques have been used

to estimate sympathetic activity, focussing either on whole body sympathetic activity, or more

selectively on SNS activity in specific organs or tissues. From a neuro-anatomical perspective,

autonomic projections to different body compartments and organs show a distinct differentiation

up to the level of the hypothalamus. For example, different sets of hypothalamic pre-autonomic

neurons project to intra-abdominal organs and subcutaneous WAT (17). This suggests that

the neural activity of sympathetic outflow to several body compartments can be differentially

regulated by the hypothalamus. It may well be that there is no such thing as a generalized

change in sympathetic tone during thyrotoxicosis, but rather that the effect of thyrotoxicosis on

sympathetic signalling differs between tissues. This, in turn, may partly explain the inconsistency

of data regarding SNS activity during thyrotoxicosis.

7.2 Biological relevanceThe data mentioned above on “peripheral” sympathetic tone during thyrotoxicosis share the

limitation that they provide very limited mechanistic information. It has remained unclear what the

functional meaning of the supposed alterations in autonomic tonus might be. These alterations

may be viewed as adaptive, i.e. secondary, as proposed by some authors (18;19), or rather

causal to the physiological changes during thyrotoxicosis or hypothyroidism. The recent discovery

that hormones (e.g., insulin (20), glucocorticoids (21), estrogens (22)) can modulate peripheral

metabolism by neural actions mediated via the brain, provides a new perspective for a causal link

between alterations in autonomic output and metabolic alterations during thyrotoxicosis.

Along these lines, we hypothesized that part of the metabolic alterations during thyrotoxicosis

are mediated by TH actions in the hypothalamus and the ANS.

Indeed, in chapter 3 we showed that hyperglycemia and increased glucose production during

thyrotoxicosis can be attenuated by selective hepatic sympathectomy, and that the hepatic insulin

112


resistance during thyrotoxicosis can be aggravated by selective hepatic parasympathectomy.

In other words, the changes in hepatic glucose metabolism during thyrotoxicosis can be

differentially modulated by either sympathetic or parasympathetic selective denervation of

the liver. In addition, our findings presented in chapter 4 show that T3 administered locally

in the hypothalamic PVN, which harbours the pre-autonomic neurons that control the ANS,

stimulates hepatic glucose production via sympathetic projections to the liver on a relatively

short timescale. Needless to say, while these data provide strong evidence for the involvement

of the hypothalamus in the changes in hepatic glucose metabolism during thyrotoxicosis, they

cannot be easily extrapolated to alterations in other metabolic processes in the liver, e.g., lipid

metabolism. Neither can they be extrapolated to metabolic processes in other peripheral organs

such as lipolysis in adipose tissue during thyrotoxicosis. On the other hand, this latter possibility

is supported by the earlier observation of autonomic connections between the hypothalamus

and WAT (23) and of ANS-mediated modulation of WAT lipolysis (24;25). These interesting

possibilities remain to be investigated.

Our data show that the changes in hepatic glucose metabolism during thyrotoxicosis can be

partly explained by “indirect” effects of TH via the hypothalamus and sympathetic projections to

the liver, in addition to “direct” TH effects on the level of the hepatocytes.

Figure 1 Schematic representation of “direct” (hepatic) and “indirect” (central) effects of thyroid hormones (TH) on the liver. Circulating THs can bind to thyroid hormone receptors (TRs) in hepatocytes, directly affecting hepatocyte function. In addition, THs may bind to TRs in the hypothalamus. TH may act via TRs in the paraventricular nucleus (PVN). TH may also act via TRs in the arcuate nucleus (ARC), where the blood-brain-barrier is largely absent, from where information is then conveyed to the PVN. In turn, THs may modulate hepatic metabolism by altering autonomic signalling from the hypothalamus to the liver. This pathway involves pre-autonomic neurons in the PVN, sympathetic efferent neurons in the intermediolateral column (IML) and/or parasympathetic efferent neurons in the dorsomedial nucleus (DMV).

General discussion

113

Chapter 7


An important question is what could be the purpose of this dual mechanism of TH action.

As outlined in the classical concept of endocrinology, proposed by Starling in 1915, hormones

are produced by endocrine glands and transported via the circulation to their target organs and

target tissues. Hence, all tissues would be expected to “see” similar concentrations of circulating

hormones. For thyroid hormone, the existence of tissue-specific expressions and activities of

deiodinase enzymes and TH receptor (TR) isoforms offers a certain degree of tissue specific

modulation of TH availability and action. Our finding that the hypothalamus is responsive to T3

and accordingly modulates its sympathetic signalling to the liver, appears to add an additional

level of complexity to this picture. The brain, and more specifically the hypothalamus, has a

unique feature in that it is capable of altering metabolism in virtually all peripheral tissues

and organs differentially via its connections with the ANS. It follows that the hypothalamus

would be an excellent candidate to orchestrate fine-tuning of TH action in peripheral tissues

differentially via its ANS projections, potentially adding a new level of complexity to the tissue

specific regulation of TH action. We may speculate that this differential sympathetic regulation

of tissue-specific metabolism is mediated by differential expression of TR (isoforms) on distinct

sets of pre-autonomic neurons in the hypothalamus projecting to specific organs/tissues. In other

words, the TR-isoform expression profile on pre-autonomic neurons projecting to, e.g., striated

muscle may be different from pre-autonomic neurons projecting to liver or WAT, giving rise to

differential autonomic (sympathetic) output upon binding of T3. This exciting possibility will be

the subject of further studies.

Another factor that may be relevant for the question as to what may be the purpose of the dual

mechanism of TH action, is the factor time. TH is known to elicit a wide variety of physiological

actions of miscellaneous nature. Many of these TH actions can be explained by transcriptional

effects, mediated via interaction with nuclear TRs. In short, TH enters the cell and binds to the

ligand-binding domain of a TR in the nucleus. The receptor then undergoes major conformational

changes that ultimately cause binding of the TR to a thyroid responsive element (TRE) in the

promoter region of a TH responsive gene. Binding to these TREs can induce either positive

or negative regulation of gene transcription, which is ultimately reflected in the translation of

mRNA into protein (26). Examples of such transcriptional effects include many of TH actions in

the highly coordinated and programmed process of human brain development, or the striking

TH effects on amphibian metamorphosis, exemplifying the wide variety of morphological and

biochemical changes in response to TH (27). As mentioned in the introduction (section 1.3a),

many of the metabolic effects of TH are mediated via TR-mediated transcriptional regulation

of TH-responsive genes. A common denominator of these “transcriptional” TH actions is that

they occur on a relatively long timescale (i.e., hours), which seems logical given the many steps

involved in the complex transcriptional mechanism. However, a growing number of TH effects

have been reported that occur at a much shorter timescale (i.e., within minutes), and are therefore

hard to reconcile with a transcriptional mechanism (28;29). Indeed, a molecular basis for these

“non-transcriptional” TH effects is emerging, e.g., by the recent discovery that the membrane

bound receptor intergrin αVβ3 has high affinity for THs (30;31). Upon binding to this receptor,

several intracellular signalling pathways such as the mitogen-activated protein kinase (MAPK-

ERK) pathway can be initiated to elicit a variety of molecular effects including modulation of

114


Na/H proton exchangers in the plasma membrane (for review see (32)). In addition, TRs located

in the cytoplasm have been shown to signal rapidly via non-transcriptional mechanisms, for

example by interaction with the phosphatidylinositol 3-kinase (PI3K) (33) and the downstream

Akt kinase (Akt) / mammalian target of rapamycin (mTOR) signalling cascade (34).

Hypothalamic actions of TH conveyed to peripheral organs by autonomic nerves as described in

this thesis appear to occur within the timeframe of these “non-transcriptional” TH actions. We

have not investigated in the present thesis if the metabolic effects of autonomic stimulation of the

liver occur via transcriptional or non-transcriptional mechanisms, or both. One could, however,

image that it might be efficient for TH to dispose of multiple mechanisms of action covering a

(time) spectrum from fast to relatively slow. This may help the organism to adequately respond

to physiological stressors that require metabolic adaptation both acutely and more chronically.

7.2 A new role for the hypothalamus in sensing hormonal signals and modulating autonomic output; involvement of Thyroid Hormone

We chose the pathological condition of thyrotoxicosis to study hypothalamic TH effects on

metabolism, but the finding that hypothalamic T3 is able to modulate hepatic glucose metabolism

via sympathetic projections to the liver may also prove to have physiological implications. It

has become clear that the hypothalamus is able to directly sense circulating hormones and

nutrients that provide the brain with information regarding the metabolic status of the body,

i.e., the status of peripheral tissues like the liver and adipose tissue. A well recognized example

is the hormone leptin, which is secreted by adipose tissue (i.e. high after a meal, suppressed

during starvation) and binds to specific leptin receptors in the hypothalamic arcuate nucleus

(ARC). This provides the hypothalamus with valuable information regarding the nutritional status

of the body. This information is then conveyed to the PVN via a set of functionally reciprocal

neurons containing either alpha melamocotin-stimulating hormone (αMSH) or co-expressing

neuropeptide Y and agouti-related peptide (NPY/AGRP) where it is integrated with other

information. This information may consist of other hormonal (nutritional) signals sensed via the

ARC (e.g., insulin, gut hormones like ghrelin or glugagon-like-peptide-1 (35)), but it also includes

neural inputs from other brain regions such as the brain stem and the limbic system. In the case

of food deprivation, the PVN coordinates several regulatory actions in response to these signals,

adjusting (i) appetite (stimulating food intake), (ii) the HPT-axis (decreasing TRH expression in

hypophysiotropic neurons, contributing to decreased circulating thyroid hormone levels (36))

and (iii) EGP (changing autonomic signalling to the liver to increase EGP (37)). All of these appear

to be useful adaptive responses to reduced food availability.

In addition, during starvation expression of D2 by glial cells in the ARC increases, thereby

increasing local T3 production (38). Interestingly, elevated hypothalamic T3 appears to contribute

to the decreased expression of TRH and thereby decreased circulating TH concentrations during

starvation, and this phenomenon is not secondary to the decreased circulating TH levels (39). The

fasting-induced increase of D2-derived T3 in the ARC also appears to be critical for an appropriate

General discussion

115

Chapter 7


orexigenic (appetite stimulating) response of NPY neurons, via a mechanism involving uncoupling

protein type 2 and increased mitochondrial density in these neurons (40). Finally, light induced

hypothalamic D2-mediated T4 to T3 conversion is critical for the timing of reproduction in

response to seasonal (photo-period) changes in birds (41), involving a neuro-endocrine response

in the hypothalamus-pituitary-gonadal axis.

Collectively, these data show that under physiological conditions, hypothalamic T3 levels are

subject to extensive regulation and play an important role in eliciting adequate adaptive

responses. Our data show that upon stimulation by T3, the hypothalamus modulates sympathetic

input to the liver to alter local glucose metabolism. This may provide another pathway by which

physiological alterations in hypothalamic T3 induced by a variety of physiological stimuli may

mediate regulatory actions on the level of peripheral organs.

The exact mechanism by which T3 stimulates PVN neurons to elicit sympathetic signals to the liver

remains to be established. One of the interesting questions is if the PVN pre-autonomic express

TRs, and -along the same lines- if T3 has a direct stimulating effect on these pre-autonomic

neurons. An alternative possibility is that not T3 itself, but rather TH-derivatives are responsible

for the hypothalamic actions of T3 on these neurons. Candidates for this role include the

thyronamines, which are TH-derivatives that can be formed by deiodination and decarboxilation

of TH. In this scenario, T3 would have to be converted to, e.g., 3-iodothyronamine (T1AM) in the

hypothalamus. Although there is no direct evidence for in vivo conversion of iodothyronines into

thyronamines at present, the enzymes indispensable for such conversion (i.e. deiodinases and

decarboxylating enzymes such as amino acid decarboxylase) are abundantly expressed in the

hypothalamus (42). Furthermore, the trace amine associated receptor type 1 (TAAR1), a G-protein

coupled membrane receptor that is activated by T1AM, is expressed in the hypothalamic ARC

(43). In addition, we have shown that T1AM and thyronamine (T0AM) modulate hepatic glucose

production upon central administration (chapter 5).

7.4 Potential clinical relevanceBoth hypo- and hyperthyroidism are associated with mood disorders such as anxiety and

depression as well as with mild cognitive impairment, mainly in the domains of working memory

and executive function (44). In addition, even subclinical hypothyroidism, which is regarded as

a mild form of hypothyroidism, has been shown to impair short term working memory (45),

reflected in altered neuronal activity in brain areas crucial for these functions as shown by

functional MRI (fMRI) (46).

Hypothyroidism has been treated with T4 replacement therapy ever since the isolation of T4 and

its production in pharmacological quantities. The clinical impression that a substantial number

of patients with adequately treated hypothyroidism (i.e., serum TSH within the reference range)

keep having mild impairments has been confirmed by studies showing reduced psychological

well-being and neuro-cognitive functioning in these patients (47;48). Rat studies have shown that

it is impossible to normalize T3 and T4 levels in all tissues at the same time by any replacement

dose of T4 alone (49). This raises the theoretical possibility that a subtle dysbalance in TH

homeostasis occurs in certain tissues during T4 replacement therapy in patients as well and

116


that a complete restoration of thyroid hormone homeostasis in all tissues cannot be reached

(50). It should be noted, however, that in the animal experimental studies cerebral cortex T3

content was shown to remain within normal limits over a relatively wide range of plasma T4

concentrations. This observation supports the efficiency of auto-regulation of T3 bio-avalability

involving local deiodinase expression in cerebral cortex. Although no human data are available to

confirm these animal data, the supposed dysbalance in TH homeostasis in certain tissues during

T4 replacement therapy may relate to the impaired well-being in T4-treated patients. Additional

factors have been reported that could be causally related to the impaired well-being in T4-treated

patients. For example, we have shown earlier that polymorphisms in the T4 transporter organic

anion transporting polypeptide 1C1 (OATP1C1), which is expressed at the bloodbrain-barrier,

are associated with symptoms of fatigue and depression in patients with adequately treated

hypothyroidism (51). This may imply that suboptimal TH transport to the brain relates to the

impaired wellbeing in these patients.

Our finding that the hypothalamic–ANS–liver pathway is sensitive to TH may add another level of

complexity to this issue. In chapter 6, we have shown that in patients with Graves disease treated

with the thyrostatic methimazole and T4 replacement, i.e., block and replacement therapy or

BRT, plasma FT3/FT4 ratios are ~20% lower as compared to FT3/FT4 ratios in he same patients

in the untreated situation. This probably relates to the fact that in the treated situation, these

patients lack thyroidal T3 production, and T3 is derived from on peripheral enzymatic conversion

of exogenous T4.

Systemic treatment of rats with a dose of T4 inducing a 115% and 210% increase of circulating

T4 and T3 concentrations, respectively, was shown to translate into ~330% and 140% increases

in hypothalamic T4 and T3 content, respectively (52). Of note, these hypothalamic alterations

occurred in spite of local auto-regulation involving local D2 and D3. However, it is impossible at

this stage to infer from these data how the alterations in plasma TH concentrations in patients

on BRT are translated into hypothalamic bioavailability of TH at the level of the PVN or ARC.

Although this remains uncertain, the possibility exists that subtle alterations in circulating THs are

sensed within the hypothalamus, resulting in altered ANS output to peripheral organs such as

the liver, and possibly to other organs as well. One might think of alterations in heart rate, sleep-

wake rhythm, or temperature regulation. Whether a TH–driven hypothalamus-ANS response

plays a role in the impairment of well being in these patients, will be a fascinating subject of

further research.

A first step to explore this issue will be to analyze untreated and treated patients with overt or

subclinical thyroid function disorders using functional imaging. Imaging techniques like functional

MRI, SPECT and PET have shown spectacular technical advances in recent years. It is now possible

to analyze brain metabolism in, e.g., hypothalamic and brain stem areas.

In clinical thyroidology, the hypothalamus is mainly known for its well established role in feedback

regulation of the HPTaxis. In this thesis, we report metabolic effects of thyroid hormone elicited

by TH actions in the hypothalamus and mediated via the autonomic nervous system. Hopefully,

this may mark the beginning of further exploring this new role for THs in the regulation of

hypothalamic neural output to peripheral organs and, in more general terms, add to our

understanding of the neural actions of thyroid hormone.

General discussion

117

Chapter 7


Reference List 1. Leak D. 1970 The thyroid and the autonomic nervous system. William Heinemann Medical Books,

London.


3. Crile GW 1929 The interdependence of the thyroid, adrenals and nervous system. Amer.J.Surg. 6:616

4. Coulombe P, Dussault JH, Walker P 1976 Plasma catecholamine concentrations in hyperthyroidism and hypothyroidism. Metabolism 25:973-979

5. Coulombe P, Dussault JH, Letarte J, Simmard SJ 1976 Catecholamines metabolism in thyroid diseases. I. Epinephrine secretion rate in hyperthyroidism and hypothyroidism. J Clin Endocrinol Metab 42:125-131


7. Liggett SB, Shah SD, Cryer PE 1989 Increased fat and skeletal muscle beta-adrenergic receptors but unaltered metabolic and hemodynamic sensitivity to epinephrine in vivo in experimental human thyrotoxicosis. J Clin Invest 83:803-809

8. Levey GS, Klein I 1990 Catecholamine-thyroid hormone interactions and the cardiovascular manifestations of hyperthyroidism. Am J Med 88:642-646

9. Pijl H, de Meijer PH, Langius J, Coenegracht CI, van den Berk AH, Chandie Shaw PK, Boom H, Schoemaker RC, Cohen AF, Burggraaf J, Meinders AE 2001 Food choice in hyperthyroidism: potential influence of the autonomic nervous system and brain serotonin precursor availability. J Clin Endocrinol Metab 86:5848-5853

10. Eustatia-Rutten CF, Corssmit EP, Heemstra KA, Smit JW, Schoemaker RC, Romijn JA, Burggraaf J 2008 Autonomic nervous system function in chronic exogenous subclinical thyrotoxicosis and the effect of restoring euthyroidism. J Clin Endocrinol Metab 93(7):2835-2841

11. Tu T, Nash CW 1975 The influence of prolonged hyper- and hypothyroid states on the noradrenaline content of rat tissues and on the accumulation and efflux rates of tritiated noradrenaline. Can J Physiol Pharmacol 53:74-80

12. Matsukawa T, Mano T, Gotoh E, Minamisawa K, Ishii M 1993 Altered muscle sympathetic nerve activity in hyperthyroidism and hypothyroidism. J Auton Nerv Syst 42:171-175





17. Kreier F, Kap YS, Mettenleiter TC, van Heijningen C, van d, V, Kalsbeek A, Sauerwein HP, Fliers E, Romijn JA, Buijs RM 2006 Tracing from fat tissue, liver, and pancreas: a neuroanatomical framework for the role of the brain in type 2 diabetes. Endocrinology 147:1140-1147

18. Silva JE. 2005 Thermogenesis and the sympathoadrenal system in thyrotoxicosis. In: The Thyroid, A Fundamental and Clinical Text, 9th edition: 607-620. Lippincott Williams &Wilkins.

118


19. Silva JE 2003 The thermogenic effect of thyroid hormone and its clinical implications. Ann Intern Med 139:205-213




23. Kreier F, Fliers E, Voshol PJ, van Eden CG, Havekes LM, Kalsbeek A, Van Heijningen CL, Sluiter AA, Mettenleiter TC, Romijn JA, Sauerwein HP, Buijs RM 2002 Selective parasympathetic innervation of subcutaneous and intra-abdominal fat--functional implications. J Clin Invest 110:1243-1250

24. Fliers E, Kreier F, Voshol PJ, Havekes LM, Sauerwein HP, Kalsbeek A, Buijs RM, Romijn JA 2003 White adipose tissue: getting nervous. J Neuroendocrinol 15:1005-1010

25. Romijn JA, Fliers E 2005 Sympathetic and parasympathetic innervation of adipose tissue: metabolic implications. Curr Opin Clin Nutr Metab Care 8:440-444


27. Tata JR 2006 Amphibian metamorphosis as a model for the developmental actions of thyroid hormone. Mol Cell Endocrinol 246:10-20


29. Wu SY, Green WL, Huang WS, Hays MT, Chopra IJ 2005 Alternate pathways of thyroid hormone metabolism. Thyroid 15:943-958

30. Bergh JJ, Lin HY, Lansing L, Mohamed SN, Davis FB, Mousa S, Davis PJ 2005 Integrin alphaVbeta3 contains a cell surface receptor site for thyroid hormone that is linked to activation of mitogen-activated protein kinase and induction of angiogenesis. Endocrinology 146:2864-2871

31. Davis PJ, Davis FB, Cody V 2005 Membrane receptors mediating thyroid hormone action. Trends Endocrinol Metab 16:429-435


33. Storey NM, Gentile S, Ullah H, Russo A, Muessel M, Erxleben C, Armstrong DL 2006 Rapid signaling at the plasma membrane by a nuclear receptor for thyroid hormone. Proc Natl Acad Sci U S A 103:5197-5201

34. Kenessey A, Ojamaa K 2006 Thyroid hormone stimulates protein synthesis in the cardiomyocyte by activating the Akt-mTOR and p70S6K pathways. J Biol Chem 281:20666-20672

35. Murphy KG, Bloom SR 2006 Gut hormones and the regulation of energy homeostasis. Nature 444:854-859

36. Lechan RM, Fekete C 2006 The TRH neuron: a hypothalamic integrator of energy metabolism. Prog Brain Res 153:209-235


38. Diano S, Naftolin F, Goglia F, Horvath TL 1998 Fasting-induced increase in type II iodothyronine deiodinase activity and messenger ribonucleic acid levels is not reversed by thyroxine in the rat hypothalamus. Endocrinology 139:2879-2884

General discussion

119

Chapter 7


39. Coppola A, Hughes J, Esposito E, Schiavo L, Meli R, Diano S 2005 Suppression of hypothalamic deiodinase type II activity blunts TRH mRNA decline during fasting. FEBS Lett 579:4654-4658

40. Coppola A, Liu ZW, Andrews ZB, Paradis E, Roy MC, Friedman JM, Ricquier D, Richard D, Horvath TL, Gao XB, Diano S 2007 A central thermogenic-like mechanism in feeding regulation: an interplay between arcuate nucleus T3 and UCP2. Cell Metab 5:21-33


42. Zhu MY, Juorio AV 1995 Aromatic L-amino acid decarboxylase: biological characterization and functional role. Gen Pharmacol 26:681-696


44. Samuels MH 2008 Cognitive function in untreated hypothyroidism and hyperthyroidism. Curr Opin Endocrinol Diabetes Obes 15:429-433

45. Samuels MH, Schuff KG, Carlson NE, Carello P, Janowsky JS 2007 Health status, mood, and cognition in experimentally induced subclinical hypothyroidism. J Clin Endocrinol Metab 92:2545-2551

46. Zhu DF, Wang ZX, Zhang DR, Pan ZL, He S, Hu XP, Chen XC, Zhou JN 2006 fMRI revealed neural substrate for reversible working memory dysfunction in subclinical hypothyroidism. Brain 129:2923-2930

47. Saravanan P, Chau WF, Roberts N, Vedhara K, Greenwood R, Dayan CM 2002 Psychological well-being in patients on ‘adequate’ doses of l-thyroxine: results of a large, controlled community-based questionnaire study. Clin Endocrinol (Oxf) 57:577-585

48. Wekking EM, Appelhof BC, Fliers E, Schene AH, Huyser J, Tijssen JG, Wiersinga WM 2005 Cognitive functioning and well-being in euthyroid patients on thyroxine replacement therapy for primary hypothyroidism. Eur J Endocrinol 153:747-753

49. Escobar-Morreale HF, Obregon MJ, Escobar del RF, Morreale de EG 1995 Replacement therapy for hypothyroidism with thyroxine alone does not ensure euthyroidism in all tissues, as studied in thyroidectomized rats. J Clin Invest 96:2828-2838

50. Romijn JA, Smit JW, Lamberts SW 2003 Intrinsic imperfections of endocrine replacement therapy. Eur J Endocrinol 149:91-97

51. van der Deure WM, Appelhof BC, Peeters RP, Wiersinga WM, Wekking EM, Huyser J, Schene AH, Tijssen JG, Hoogendijk WJ, Visser TJ, Fliers E 2008 Polymorphisms in the brain-specific thyroid hormone transporter OATP1C1 are associated with fatigue and depression in hypothyroid patients. Clin Endocrinol (Oxf) 69:804-811

52. Broedel O, Eravci M, Fuxius S, Smolarz T, Jeitner A, Grau H, Stoltenburg-Didinger G, Plueckhan H, Meinhold H, Baumgartner A 2003 Effects of hyper- and hypothyroidism on thyroid hormone concentrations in regions of the rat brain. Am J Physiol Endocrinol Metab 285:E470-E480

120


SummaryNederlandse samenvattingAuthor AffiliationsDankwoord Biografie

8


SummaryThyrotoxicosis is associated with a broad spectrum of clinical symptoms and metabolic alterations.

Many of these symptoms including the metabolic changes show a remarkable similarity with the

effects of sympathetic nervous system stimulation. This similarity was noted by physiologists

long before the discovery and isolation of thyroid hormone (TH), and is still reflected in the initial

treatment of severe thyrotoxicosis with β-adrenergic blockers. In recent years, it has become

increasingly clear that peripheral energy metabolism is controlled not only locally via hormonal

actions, but also by the central nervous system (CNS) via its autonomic projections to a multitude

of peripheral organs, such as the liver. The most important brain area in the CNS for the control

of energy homeostasis is the hypothalamus, i.e., the neuroendocrine center of the brain.

In this thesis, we studied the metabolic alterations during thyrotoxicosis, and the possible

involvement of TH actions at the level of the hypothalamus and the autonomic nervous system

(ANS) in these metabolic alterations. We hypothesised that THs (and TH derivatives) alter

autonomic signalling via actions in the brain, or more specifically, in the hypothalamus, and

thereby modulate metabolism at the level of peripheral organs such as the liver.

Chapter 1 provides an introduction to thyroid hormone metabolism and the interplay between

thyroid hormone and the brain. Furthermore, the metabolic alterations induced by thyrotoxicosis

are reviewed with a special emphasis on the isotope techniques used in the present thesis to

assess metabolic fluxes. The hypothalamus is a major regulator of metabolism via its connections

with the autonomic nervous system (ANS). The functional anatomy of the hypothalamus and

its autonomic outflow, as well as the role of the hypothalamus in the regulation of glucose

metabolism, are discussed. Chapter 1 includes an introduction to the thyronamines, which are

recently reported thyroid hormone analogues that evoke a broad range of rapid metabolic

actions in vivo. Finally, the general hypothesis and thesis outline are presented.

In chapter 2, we studied the effects of thyroid status on whole body energy metabolism. We

found reciprocal alterations in thyrotoxic and hypothyroid rats. Thyrotoxic rats exhibit markedly

increased energy expenditure (EE) and lipid oxidation without alterations in spontaneous physical

activity. Hypothyroid rats show a mild decrease in EE and glucose oxidation. In addition, we

studied how the marked alterations in lipid oxidation are associated with tissue-specific fatty

acid (FA) uptake. The data show that the hypermetabolic phenotype during thyrotoxicosis is

facilitated by increased uptake of fatty acids derived from triglycerides (TG-FA) in oxidative

tissues, but that TG-FA uptake is unaltered in lipid-storing white adipose tissue (WAT). Conversely,

during hypothyroidism TG-FA uptake is unaltered in oxidative tissues, but increased in WAT. This

upregulation in WAT is associated with increased activity of the enzyme lipoprotein lipase, which

regulates tissue-specific FA disposal by hydrolizing TGs. Albumin-bound FA uptake, which is

quantitatively less important, appears to be mainly determined by the plasma FA concentration,

and is apparently not regulated in a tissue-specific manner.

125

Chapter 8

Summ

ary


In chapter 3, we studied the role of the ANS projections to the liver in the alterations of hepatic

glucose metabolism induced by thyrotoxicosis. We assessed endogenous glucose production

(EGP) and its sensitivity to insulin by combining stable isotope dilution and hyperinsulinemic

euglycemic clamping in euthyroid and thyrotoxic rats that underwent prior selective hepatic

autonomic (i.e., either sympathetic or parasympathetic) denervation or a sham denervation. The

data show that the alterations in hepatic glucose metabolism can be differentially modulated

by either selective sympathetic or parasympathetic hepatic denervation. More specifically, the

increase in plasma glucose concentration and, to a lesser extent, EGP induced by thyrotoxicosis

can be partly prevented by prior hepatic sympathetic denervation. This suggests that sympathetic

innervation contributes to the increased plasma glucose concentration and higher EGP during

thyrotoxicosis. Parasympathetic denervation of the liver increases plasma insulin concentration

but not EGP during thyrotoxicosis. Hence, thyrotoxicosis-induced hepatic insulin resistance is

aggravated by selective parasympathetic denervation. By inference, parasympathetic hepatic

innervation may function to restrain EGP during thyrotoxicosis.

As a next step, in chapter 4 we hypothesized that the thyrotoxicosis-induced increase in EGP

can be mimicked by infusing TH directly into the hypothalamus of euthyroid rats. To address this

hypothesis we infused the bio-active thyroid hormone triiodothyronine (T3) into the hypothalamus

of euthyroid rats, while assessing EGP with stable isotope infusion. We administered T3 selectively

to the hypothalamic paraventricular nucleus (PVN), where “pre-autonomic” neurons regulating the

autonomic projections to the liver are localized. The data show that T3 in the hypothalamic PVN

increases EGP on a short timescale, independently of plasma thyroid hormone and glucoregulatory

hormone concentrations. Moreover, we combined hypothalamic T3 administration with selective

sympathetic denervation of the liver showing that intact sympathetic projections to the liver are

crucial for the rapid EGP-stimulating effects of hypothalamic T3. Together, these data reveal a

novel central pathway for modulation of EGP by T3 involving the hypothalamic PVN and the

sympathetic nervous system.

Thyronamines are TH derivatives that exhibit neurotransmitter-like properties, and the pheno-

type that evolves upon administration of thyronamines in rodents points to involvement

of the hypothalamus in these actions. This is supported by hypothalamic expression of trace

amino associated receptors (TAAR), that selectively bind thyronamines. In chapter 5, we

hypothesized that the effects of 3-iodothyronamine (T1AM) and thyronamine (T0AM) on hepatic

glucose metabolism and circulating glucoregulatory hormones can be explained by actions of

thyronamines in the CNS. We show that systemic T1AM infusion rapidly increases EGP and

plasma glucose, plasma glucagon and corticosterone, while it does not change plasma insulin

concentrations. Compared to systemic administered T1AM, a 100-fold lower dose administered

centrally induces a more pronounced acute EGP increase and hyperglucagonemia with a trend

towards lower plasma insulin. Both systemic and central infusions of T0AM cause similar, but

smaller alterations compared with T1AM. Neither T1AM nor T0AM influences any of these

parameters upon low dose systemic administration. These data show that central administration

of low dose thyronamines suffices to induce the acute alterations in glucose metabolism and

126


glucoregulatory hormones following systemic thyronamine infusion. Thus, thyronamines can act

centrally to modulate glucose metabolism.

In chapter 6, we explored the interrelationship between THs and energy metabolism in the

clinical setting. We performed a study in patients with Graves disease rendered euthyroid by

blocking thyroid hormone synthesis with an anti-thyroid drug while restoring plasma thyroid

hormone concentrations by exogenous substitution of thyroxine (the so called “block and

replacement therapy” or BRT). We studied these patients on 2 occasions, i.e., after ~13.5

months of BRT and 12 weeks after BRT cessation. We show that circulating free thyroxine (FT4)

is a determinant of resting energy expenditure (REE) in euthyroid patients treated with BRT for

Graves’ hyperthyroidism. A majority of patients report weight gain compared to their supposed

pre-morbid body weight (BW) following treatment of hyperthyroidism, which was also the

case in our study. We anticipated that if this weight gain was due to BRT, weight loss should

occur after cessation of BRT. However, 12 weeks after cessation of BRT, body weight (BW) and

energy homeostasis were unaltered. Nevertheless, there were subtle differences in serum TH

concentrations, albeit in the euthyroid range, between the 2 study occasions, i.e., serum FT3 as

well as the FT3/FT4 ratio showed an increase 12 w after cessation of BRT. As the serum FT3/

FT4 ratio is a positive determinant of changes in REE, a longer term decrease in BW is likely to

occur.

In chapter 7 we aim to place our findings into a wider perspective. We describe the views on the

interrelationship between thyroid hormone and the sympathetic nervous system in a historical

context. Subsequently, we try and adapt these views, fitting in our findings of hypothalamic

thyroid hormone modulation of hepatic glucose metabolism via sympathetic hepatic projections.

We discuss the potential biological relevance of these novel hypothalamic thyroid hormone

actions in terms of both thyrotoxicosis and more physiological conditions. We propose that

modulation of autonomic signalling by hypothalamic T3 may provide a new level of complexity

in the (rapid) regulation of peripheral metabolism by thyroid hormone. Finally, potential clinical

implications and future directions of research are discussed.

127

Chapter 8

Summ

ary


Nederlandse samenvattingHyperthyreoïdie wordt gekenmerkt door een breed spectrum van klinische symptomen

en metabole veranderingen. Veel van deze symptomen en veranderingen tonen een

grote overeenkomst met veranderingen die optreden als gevolg van activatie van het

sympathische zenuwstelstel. Deze overeenkomst werd al lang voor de ontdekking en isolatie

van schildklierhormoon opgemerkt, en wordt ook tegenwoordig nog gereflecteerd in de

behandeling van ernstige hyperthyreoïdie met medicamenteuze remming van de sympatische

signaaloverdracht door middel van β-blokkers. De laatste jaren is steeds meer duidelijk geworden

dat de hypothalamus in belangrijke mate bijdraagt aan de regulatie van de stofwisseling via

autonome projecties naar een groot aantal perifere organen, zoals de lever.

In dit proefschrift hebben we de metabole veranderingen tijdens hyperthyreoïdie bestudeerd en

daarnaast bekeken in hoeverre schildklierhormoon effecten op het niveau van de hypothalamus

en het autonome zenuwstelsel betrokken zijn in deze metabole veranderingen. Onze hypothese

was dat schildklierhormoon (en schildklierhormoon-derivaten) de activiteit van het autonome

zenuwstelsel beïnvloeden via effecten in het brein, of meer specifiek via effecten in de hypothalamus,

en zodoende de stofwisseling moduleren op het niveau van perifere organen zoals de lever.

Hoofdstuk 1 geeft een overzicht van het schildklierhormoon metabolisme en de wisselwerking

tussen schildklierhormoon en het brein. Tevens worden huidige inzichten over de metabole

veranderingen tijdens hyperthyreoïdie besproken, met nadruk op isotooptechnieken die we in

dit proefschrift gebruikten om deze metabole veranderingen te bestuderen. De hypothalamus

is een belangrijke regulator van het metabolisme via verbindingen met het autonome

zenuwstelsel. De functionele anatomie van de hypothalamus en het autonome zenuwstelsel

en hun rol in de regulatie van het glucose metabolisme worden uiteengezet. Verder bevat

hoofdstuk 1 een korte introductie over thyronamines, schildklierhormoon-analogen met snelle

metabole effecten in vivo en ten slotte worden de algemene hypothese en inhoud van het

proefschrift gepresenteerd.

In hoofdstuk 2 bestudeerden we de effecten van hyper- en hypothyreoïdie op de energiestof-

wisseling. We vonden reciproke veranderingen in hyperthyreote en hypothyreote, vergeleken

met euthyreote ratten. Hyperthyreote ratten tonen een verhoogd energieverbruik en vet

oxidatie zonder veranderingen in spontane fysieke activiteit. Hypothyreote ratten tonen een

geringe afname in energieverbruik en glucose oxidatie. Daarnaast hebben we bestudeerd

hoe de veranderingen in vet oxidatie gepaard gaan met weefsel-specifieke vet opname. De

resultaten tonen dat het hypermetabole fenotype tijdens hyperthyreoïdie gefaciliteerd wordt

door een toegenomen opname van vetzuren afkomstig uit triglyceriden in oxidatieve weefsels,

terwijl de opname van dezelfde vetzuren in vetweefsel onveranderd is. Omgekeerd is tijdens

hypothyreoïdie de opname van vetzuren afkomstig van triglyceriden onveranderd in oxidatieve

weefsels, maar juist toegenomen in vetweefsel. Daarbij is er een lokaal toegenomen activiteit

van het enzym lipoproteïne lipase, dat het vrijmaken van vetzuren uit triglyceriden reguleert.

Opname van albumine-gebonden vetzuren lijkt niet onderhevig aan weefsel-specifieke regulatie,

129

Chapter 8

Nederlandse sam

envatting


maar voornamelijk bepaald door de concentratie van vetzuren in het plasma, welke verhoogd

is tijdens hyperthyreoïdie.

In hoofdstuk 3, hebben we de rol van de autonome projecties naar de lever in veranderingen

van het hepatische glucose metabolisme tijdens hyperthyreoïdie bestudeerd. We bepaalden de

endogene glucose productie en gevoeligheid voor onderdrukking door insuline (hepatische insuline

gevoeligheid) in euthyreote en hyperthyreote ratten die selectieve autonome (sympathische of

parasympathische) lever-denervatie of een sham-operatie ondergingen. De resultaten tonen dat

de veranderingen in het hepatische glucose metabolisme tijdens hyperthyreoidie differentieel

gemoduleerd kunnen worden door sympathische dan wel parasympatische lever-denervatie.

Meer specifiek kunnen de toename in plasma glucose concentratie en (in mindere mate) de

toename in endogene glucose productie geïnduceerd door hyperthyreoïdie, deels worden

voorkomen door voorafgaande sympathische lever denervatie. Dit suggereert dat sympathische

innervatie bijdraagt aan de toegenomen plasma glucose concentratie en endogene glucose

productie tijdens hyperthyreoïdie. Parasympathische lever denervatie verhoogt de plasma

insuline concentratie, maar niet de endogene glucose productie tijdens hyperthyreoïdie. De door

hyperthyreoïdie geïnduceerde hepatische insuline-resistentie wordt dus verergerd door selectie

parasympathische denervatie. Dit suggereert dat parasympathische innervatie van de lever de

endogene glucose productie tijdens hyperthyreoïdie beteugelt.

Als volgende stap, was in hoofdstuk 4 onze hypothese dat de door hyperthyreoïdie

geïnduceerde toename van endogene glucose productie kan worden gereproduceerd

door schildklierhormoon toe te dienen in de hypothalamus van euthyreote ratten. Om deze

hypothese te testen dienden we het bio-actieve schildklierhormoon triiodothyronine (T3) toe

in de hypothalamus van euthyreote ratten, terwijl we de endogene glucose productie maten

met behulp van stabiele isotoop dilutie. We dienden T3 selectief toe in de paraventriculaire

nucleus (PVN) in de hypothalamus. Deze kern herbergt de “pre-autonome” neuronen die de

sympatische en parasympatische projecties naar de lever aansturen. De resultaten tonen dat T3

in de PVN de endogene glucose productie in korte tijd doet toenemen, onafhankelijk van plasma

concentraties van schildklierhormonen en andere glucoregulatoire hormonen. Daarnaast blijkt

uit experimenten met hypothalame T3 toediening in combinatie met selectieve sympathische

lever denervatie dat intacte sympathische projecties naar de lever essentieel zijn voor de snelle

stimulatie van endogene glucose productie door hypothalaam T3. Concluderend onthullen deze

data een nieuw centraal mechanisme voor modulatie van de endogene glucose productie door T3,

waarbij de hypothalame paraventriculaire kern en het sympathische zenuwstelsel betrokken zijn.

Thyronamines zijn schildklierhormoon-derivaten met neurotransmitter-achtige eigenschappen en

het fenotype dat snel na toediening van thyronamines ontstaat, wijst op mogelijke betrokkenheid

van de hypothalamus in deze effecten. In hoofdstuk 5 testten we onze hypothese dat de

effecten van 3-iodothyronamine (T1AM) en thyronamine (T0AM) op het hepatisch glucose

metabolisme en circulerende glucoregulatoire hormonen kunnen worden verklaard door

werking van thyronamines in het centraal zenuwstelsel. We tonen dat systemische toediening

130


van T1AM wordt gevolgd door een snelle toename in endogene glucose productie, plasma

glucose, glucagon en corticosteron concentraties, zonder veranderingen in plasma insuline

concentratie. Vergeleken met systemische toediening van T1AM, induceert een honderd maal

lagere dosis intracerebroventriculair T1AM een meer uitgesproken stijging van de endogene

glucose productie en een toename in plasma glucagon, terwijl de insuline concentratie in het

plasma neigt te dalen. Zowel systemische als centrale infusie van T0AM induceert dezelfde

veranderingen als T1AM, zij het in mindere mate. Systemische toediening van T1AM noch T0AM

in lage dosering sorteert verandering in de genoemde parameters. Deze data tonen dat centrale

toediening van thryonamines in lage dosis volstaat om de acute veranderingen in het glucose

metabolisme en glucoregulatoire hormonen die het gevolg zijn van systemische thyronamine

infusie, te repliceren. Thyronamines zijn dus in staat het glucose metabolisme te beïnvloeden via

effecten in het centraal zenuwstelsel.

In hoofdstuk 6 hebben we de relatie tussen schildklierhormoon en het energie-metabolisme

uitgediept in de klinische setting. We hebben een studie verricht in patiënten met de ziekte van

Graves die euthyreoot zijn na behandeling met zogenaamde ‘block and replacement therapie’

(BRT). Dit betekent dat de schilklierhormoon productie medicamenteus geblokkeerd wordt, en

tegelijkertijd suppletie van schildklierhormoon tot euthyreote concentraties plaatsvindt door

middel van exogene toediening van thyroxine. We hebben deze patiënten op 2 gelegenheden

onderzocht: na ~13,5 maand BRT, en 12 weken na stoppen van deze behandeling. We tonen

dat de serum concentratie ongebonden thyroxine (“vrij” T4 ofwel FT4) een determinant is van het

energieverbruik in rust in met BRT behandelde, en hierdoor euthyreote Graves patiënten. Een

meerderheid van de patiënten rapporteert een toename in lichaamsgewicht na het starten met

de behandeling van hyperthyreoïdie (met BRT) tot boven het lichaamsgewicht van voor de ziekte.

Dit bleek ook het geval in onze studie. We veronderstelden dat indien deze gewichtstoename

het gevolg zou zijn van (factoren gerelateerd aan) BRT, afname van lichaamsgewicht op zou

moeten treden na stoppen van BRT. Tegen de verwachting in waren er 12 weken na het stoppen

van BRT geen veranderingen in de energie stofwisseling of het lichaamsgewicht waarneembaar

bij onze patiënten. Wel waren er subtiele verschillen in schildklierhormoonconcentraties in serum

tussen de twee studiegelegenheden binnen het euthyreote spectrum, i.e. zowel het serum vrij

T3 (FT3) als de serum FT3/FT4 ratio namen toe 12 weken na het stoppen van BRT. Omdat de

serum FT3/FT4 ratio een positieve determinant is van veranderingen in energieverbruik in rust, is

te verwachten dat een gewichtsafname op langere termijn op zal treden.

In hoofdstuk 7 plaatsen we onze bevindingen in een breder perspectief. We beschrijven

verschillende ideeën over de relatie tussen schildklierhormoon en het sympathische zenuwstelsel

in historische context. We beschrijven hoe deze ideeën op basis van onze bevindingen over

modulatie van hepatisch glucose metabolisme door hypothalaam T3 met betrokkenheid van

sympathische projecties zouden moeten worden aangepast. Verder gaan we in op de mogelijke

biologische relevantie van de beschreven schildklierhormoon effecten op hypothalaam niveau met

betrekking tot hyperthyreoïdie en andere, meer fysiologische condities. Modulatie van autonome

activiteit door hypothalaam T3 zou een nieuw niveau van complexiteit kunnen betekenen in de

131

Chapter 8

Nederlandse sam

envatting


(snelle) regulatie van het metabolisme in perifere organen. Tenslotte worden mogelijke klinische

implicaties en richtingen voor toekomstig onderzoek besproken.

132


Author affiliationsMariëtte T. AckermansDepartment of Clinical Chemistry, Laboratory of Endocrinology and Radiochemistry,Academic medical center, University of Amsterdam, the [email protected]

Peter H. BisschopDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Anita BoelenDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Claudia P. CoomansDepartment of Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, the [email protected]

Erik EndertDepartment of Clinical Chemistry, Laboratory of Endocrinology and Radiochemistry,Academic medical center, University of Amsterdam, the [email protected]

Eric FliersDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Ewout FoppenNetherlands Institute for Neuroscience, Amsterdam, the [email protected]

David K. GrandyDepartment of Physiology and Pharmacology, School of MedicineOregon Health and Science University, Portland, Oregon, [email protected]

Louis M. HavekesDepartment of Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, the [email protected]

Sarah F. JanssenDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Author A

ffiliations

133

Chapter 8


Andries KalsbeekDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the NetherlandsandNetherlands Institute for Neuroscience, Amsterdam, the [email protected]

Lars P. KlieverikDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Patrick C.N. RensenDepartment of Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, the [email protected]

Annelieke van RielDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Johannes A. RomijnDepartment of Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, the [email protected]

Hans P. SauerweinDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Thomas S. ScanlanDepartment of Physiology and Pharmacology, School of MedicineOregon Health and Science University, Portland, Oregon, [email protected]

Mireille J. SerlieDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

Peter J. VosholDepartment of Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, the [email protected]

Wilmar M. WiersingaDepartment of Endocrinology and MetabolismAcademic medical center, University of Amsterdam, the [email protected]

134


Dankwoord Een goede vriend vroeg me het laatste jaar regelmatig “wanneer dat opstel nou eens klaar zou

zijn..”. Niet helemaal uit de lucht gegrepen, want zonder de hulp van een groot aantal collega’s

en vrienden was dit boekje het predikaat “opstel” waarschijnlijk nooit ontstegen. En wanneer

krijg je nou de kans om in het openbaar deze mensen te bedanken, je bewondering uit te

spreken en te benoemen waarom ze zo belangrijk waren? Daarom hier mijn woord van dank

aan allen die zo betrokken waren.

Mijn promotores en co-promotoresProf. dr. E. Fliers. Beste Eric, toen ik als co-assistent voor het eerst bij je langs kwam om te

praten over het onderzoeksvoorstel dat uiteindelijk mijn promotietraject zou worden, wist ik

eigenlijk onmiddelijk dat het goed zat. Enerzijds door het onderwerp, maar zeker ook door de

enorme bevlogenheid waarmee je me meteen wist in te pakken. Hoewel ik toen niet goed kon

weten wat er komen zou, heb ik er nooit spijt van gekregen. Mijn project was tot het laatst

een “rollercoaster” waarbij de inzichten in korte tijd 180 graden konden keren. Regelmatig

was ik ook wanhopig of ronduit gefrustreerd na het mislukken van weer een eindeloze proef.

Maar je wist me te overtuigen dat ook uit een “mislukte” proef veel waardevolle informatie te

halen was. Zonder jouw optimisme, vastberadenheid en betrokkenheid was het voltooien van

dit proefschrift voor mij onmogelijk geweest. Je gaf me steeds het gevoel dat het niet “mijn”,

maar “ons” project was, bijvoorbeeld als je in witte jas, tijdens een proef mijn dierverblijf binnen

kwam rennen met de vraag “..of ik al iets wist?”. Daarnaast zijn jouw nuance, fijnzinnigheid en

overtuigingskracht voor mij echt een voorbeeld. Ik heb het enorm gewaardeerd dat ik altijd bij je

kon binnenlopen voor het bespreken van persoonlijke beslommeringen, recente ontwikkelingen

en data, die we meestal ook in die volgorde bespraken. Dank voor deze mooie tijd. Ik kan me

geen betere mentor wensen, en hoop dat we in de toekomst nog veel samen mogen doen!

Dr. A. Kalsbeek. Beste Dries, hoewel het begin niet zonder problemen was, heb je me altijd met

engelengeduld bijgestaan en gesteund. Je bent betrokken, recht-door-zee, nuchter (iets wat

Friezen en Tukkers gemeen schijnen te hebben..), en bij jou volgt op een oprechte vraag altijd

een eerlijk antwoord. Ik heb enorme bewondering voor je vasthoudendheid in het stap voor stap

ontrafelen van extreem ingewikkelde neurobiologische processen, en voor je vermogen uit een

ogenschijnlijk onsamenhangende berg data een logisch verhaal te destilleren. De combinatie van

jou en Eric is voor mij een heel goede geweest, en ik ben blijkbaar niet de enige, getuige je komst

naar het AMC. Jij hebt een heel groot aandeel gehad in dit boekje. Dank voor alles, ik ben heel

trots dat je mijn co-promotor bent!

Prof. dr. H.P. Sauerwein. Beste Hans, als AIO op een project dat zich uitstrekt over meerdere

onderzoeksgebieden, heb ik mogen putten uit de expertise van 3 onderzoeksgroepen. Ik heb me,

hoewel ergens toch een buitenstaander, vanaf het begin deel gevoeld van de “metabole groep”.

Mijn manuscripten hebben zeer geprofiteerd van jouw frisse commentaar en aanvullingen,

waarvoor ik je erg dankbaar ben. Je bent scherp en stellig, maar staat altijd open voor goede

tegenargumenten (hoewel ze heel goed moeten zijn..). Jij bent iemand waarover iedereen een

135

Chapter 8

Dankw

oord


mening lijkt te hebben, en dat tekent je persoonlijkheid. Eigenzinnig, aanwezig en bevlogen.

Weet dat je gemist wordt.

Dr. ir. M.T. Ackermans. Beste Mariëtte, jij bent de absolute spil geweest in het analytische deel

van dit project, maar niet alleen daarom onmisbaar. De manier waarop je mij en andere AIO’s

steeds weer (de beginselen van) de isotopenleer en andere assays uitlegde, is lovenswaardig.

Ondanks dat we de champagne niet hebben kunnen ontkurken (doen we de 17e september

alsnog!), vond ik het mooi en spannend betrokken te zijn bij het opzetten van de thyronamine-

MS. Ik heb je tot wanhoop gedreven met mijn on(na)volgbare samplecoderingen. Dank voor je

geduld en tolerantie. Nu er enkel nog ordelijke vrouwen op het endolab werken, kan het alleen

maar beter worden!

Hoofdstuk 6 was er nooit gekomen zonder de vrijwillige deelname van de betrokken patiënten

die geheel onbaatzuchtig hun tijd en moeite gaven, waarvoor ik hen erg dankbaar ben.

Graag dank ik prof. dr. R.M. Buijs, prof. dr. M.M. Levi, prof. dr. R.P.J. Oude Elferink, prof. dr. J.A.

Romijn, prof. dr. ir. T.J. Visser en prof. dr. W.M. Wiersinga voor het kritisch beoordelen van mijn

manuscript en hun bereidheid zitting te nemen in mijn promotiecommissie.

Fijne collega’sOndanks het feit dat ik lange tijd eigenlijk part-time bewoner was, heb ik me op afdeling F5

altijd erg thuis gevoeld. Marga, Marlies en Birgit, hartelijk dank voor alle steun, vooral ook bij de

laatste loodjes, en alle gezelligheid!

Peter en Mireille, veel dank voor jullie steun en kritische blik bij mijn stukken in wording. Peter,

jij bent de onbetwiste winnaar van het BRS inclusie classement; erg bedankt! Anke, Nadia,

Maarten, Regje, Saskia, Hidde, Mirjam, Gabor, Martine, Nicolette en Myrte; met jullie heb ik de

afgelopen jaren heel veel mogen delen. Dank voor alle gezelligheid, het lotgenotencontact, het

aanhoren van mijn verhalen en beleefd lachen om mijn slechte grappen!

Xander Vos. Beste Xander, mijn eerste herinnering aan jou is een bankje in de broeierige

binnenstad van Napoli waar we de Napolitaanse cultuur, flora en fauna opsnoven. Sindsdien is er

extreem veel gebeurd. Wij zijn in korte tijd goede vrienden geworden en ik hoop dat dit, ondanks

jouw verhuizing naar de Zaanse steppes, zo mag blijven. Leve de Polderbeukers!

Prof. W.M. Wiersinga. Beste Wilmar, het is uniek om als AIO te beginnen in een groep geleid

door een mondiaal endocrinologisch zwaargewicht. Ik herinner me Graves ophthalmopathie

sessies op de Endocrine Society congressen in Amerika waar vragenstellers vertwijfeld rondkeken

als ze eens iemand anders dan jij op de voorzittersstoel troffen, om vervolgens de werkelijke

voorzitter volledig te negeren en gewoon met jou, de èchte expert, in discussie te gaan. Enorm

bedankt voor alle steun en warme belangstelling. Het is een eer dat je zitting gaat nemen in mijn

promotiecommissie.

136

Chapter 8.indd 136 6-8-2009 11:07:23

Collega’s in het Nederlands instituut voor neurowetenschappen:

Beste Ewout, als dit boekje een tweede auteur mocht hebben, was jij dat. Hoe vaak hebben wij

samen geopereerd, ben je even ingesprongen voor een “paar” monsters, en heb je glucose en

corticosteron voor me gemeten. Ik ben je hiervoor enorm dankbaar. Temeer omdat je me altijd

hebt ontzien in je voorkeur voor snoeiharde Oostblok punk!

Superstudenten: Sarah, Annelieke en Rianne: Wat hebben jullie een monnikenwerk verricht voor

de experimenten in hoofdstuk 3 en 4. Jullie drive en doorzettingsvermogen zijn indrukwekkend.

Het was mooi, ik ben heel blij dat ik jullie getroffen heb!

Chun Xia, Marieke, Cathy, Corbert, Ajda, Valerie and Evelien, fellow-slaves of neuroscience! Your

presence has been essential for me to complete this project. Many times, especially in the first

years, I was desperate after another experiment gone bad, but a cup of tea while hearing I was

not the only one with such misery always did the job. Thank you for that, I hope to raise a glass

with you all on the 17th of September!

Felix, het waren jouw mooie stukken waardoor ik enthousiast werd voor dit onderwerp, en

uiteindelijk bij Eric aanklopte. Ik hoop dat ik ooit, op een mooie dag, de meester tijdens een

retro-peritoneale vet denervatie mag aanschouwen! Jan en Carolien, dank voor jullie analytische

hulp in de eerste jaren. Jillis, Chris en Nanneke: veel dank voor het scheppen van optimale

omstandigheden voor het doen van goede dierexperimenten.

Collega’s van het laboratorium voor Endocrinologie op F2:

Mieke, Ivo, Clementine, Marianne, Anneke en Joan; dank voor alle plezier en gezelligheid. Maar

wanneer mag die poster nou weg? Anneke; dank voor de fijne samenwerking en de fietsles in

San Francisco, ik hoop dat ons werk nog een staartje krijgt! Joan; dank voor je deskundigheid en

engelengeduld bij mijn PCR-bezigheden. An, Barbara, Marjo, Marianne en Els; met veel nadruk

wil ik jullie bedanken voor het meten van vele honderden monsters. Ik weet niet wat ik had

gemoeten zonder jullie; heel hartelijk dank! Eric Endert, veel dank voor je steun en de prioriteit

die je mijn project altijd hebt gegeven.

Dr. A. Boelen. Lieve Anita, er zijn van die mensen met wie het meteen klikt, en die eigenlijk nooit

iets fout kunnen doen. Ik heb erg genoten van alle gezelligheid in Boston, Toronto, Napels, San

Francisco en Washington, de vele theesessies over alles behalve onderzoek en de tochten op

natuurijs deze winter. Het is fantastisch te zien hoe jij in rap tempo aan je eigen onderzoekslijn

bouwt. Alle geluk!

A special thank to dr. Tom Scanlan and dr. David Grandy for an extremely exciting collaboration

on thyronamines.

In de laatste fase van mijn project ben ik een aantal maanden geadopteerd door fijne collega’s van

de afdeling Endocrinologie en Metabole Ziekten van het Leids Universitair Medisch Centrum.

Prof. dr. J.A. Romijn. Beste Hans, vanaf de eerste dag heb ik me meer dan welkom gevoeld

in het Leidse. Jouw hartelijke voorkomen en warme belangstelling hebben daar enorm aan

bijgedragen. Zeer veel dank voor je steun op meerdere vlakken. Het is een voorrecht dat je plaats

zal nemen in mijn promotiecommissie op 17 september.

137

Chapter 8

Dankw

oord


Beste Claudia, wij hebben samen echt heel mooie proeven gedaan. Dank voor de fijne

samenwerking en alle gezelligheid! Patrick, Marieke, Sjoerd en Peter, heel veel dank voor het

op gang helpen van de metabole kooi experimenten, de technische ondersteuning en jullie

expertise.

Vrienden en familie Koen de Heer. Beste Koen, ik vind het geweldig dat jij me tijdens mijn verdediging bijstaat als

paranimf. Als polderbeukers-on-tour hebben we veel meegemaakt. Ik noem jouw lijdensweg naar

Alpe d’huez, die je als anti-klimmer (zoals het een echte polderbeuker betaamt), zonder dat cola-

infuus achteraf niet had overleefd, en de nimmer bevestigde afdaling zonder bril, achtervolgd

door een dolle stier in het centraal massief. We bewandelen tegengestelde paden; nu ik bijna

klaar ben met mijn promotie en aan mijn opleiding begin, rondt jij je opleiding binnenkort af en

begint je promotie-traject. Ik hoop dat we over een aantal jaar weer samen in het AMC mogen

werken!

Ferring pharmaceuticals, dank voor de (financiële) injecties; zonder jullie waren de Polderbeukers

een groepje welwillende wieler-amateurs gebleven.

Bas, Jurgen, Robert en Vincent, wij kennen elkaar al sinds onze vroege jeugd en hoewel de

meesten zijn uitgewaaierd, is onze vriendschap altijd gebleven. De laatste tijd is er veel gebeurd,

en ik vind het heel fijn dat het voor mij geen vraag is wie mijn trouwste vrienden zijn.

Lieve Mirthe, mijn kleine zusje. Ik ben heel blij dat jij zo’n prominente plaats hebt in mijn leven,

en hoop dat we nog heel veel mooie dingen gaan beleven samen. Ik ben trots dat je me met al

je wijsheid bijstaat op 17 september (..parawattes?!).

Lieve mam en pap, dit boekje begon met jullie, en niet voor niets. Zolang ik me kan herinneren

hebben jullie me gestimuleerd mijn hart te volgen in alles wat ik deed en zijn jullie er voor

me geweest. Jullie trots is onbetaalbaar. Liefste mam, iedereen die bij ons kwam werd

altijd ondergedompeld in jouw warmte en enthousiasme, en er is niets veranderd. Ik hou

onvoorwaardelijk van je. Lieve pap, ik ben bang dat wij meer op elkaar lijken dan jij soms denkt.

Hoewel de onderzoekswereld niet de jouwe is, ben je altijd vol belangstelling en kan ik eindeloos

met je discussiëren over wat dan ook. Wanneer gaan we samen weer het hooggebergte in? Dit

boekje is voor jullie.

Als laatste de voor mij belangrijkste.

Lieve Madeleine, als ik dit schrijf is Stan pas 2 dagen bij ons, en het lijkt allemaal niet op te

kunnen. Wil nog eindeloos veel meer van dit...

Ik hou zielsveel van jou.

138

Chapter 8.indd 138 6-8-2009 11:08:00

BiografieLars Peter Klieverik werd op 17 maart 1978 geboren, en groeide op in het Twentse Borne.

Na volgen van het basisonderwijs aan de plaatselijke Flora school, behaalde hij in 1996 zijn

Atheneum diploma aan het Twickel college in Hengelo (ov). In hetzelfde jaar begon hij aan een

studie medische biologie aan de Universiteit van Amsterdam, waarvan hij in 1997 het propedeuse

examen behaalde. Kort daarop werd hij ingeloot voor zijn eerste keus Geneeskunde aan dezelfde

universiteit. Tijdens zijn studie werkte hij lang als barman in een Amsterdams grachthotel en was

drummer in meerdere pop-rock bands. Daarnaast speelde hij jarenlang in het eerste herenteam

van Volleybal Vereniging Amsterdam en was hij actief als student-assistent in een grote studie

naar het gebruik van automatische defibrillatoren door de Amsterdamse brandweer en politie

(afdeling cardiologie, Academisch Medisch Centrum (AMC)). Zijn wetenschappelijke stage

volgde hij in het laboratorium voor Celbiologie en Histologie van prof. C.J. van Noorden en dr.

W.M. Frederiks in het AMC, waar hij onderzoek deed naar de effecten van een visolie dieet

op de metastasering van colonkanker. Uit dit onderzoeksproject kwam een tweetal publicaties

voort. In 2004 behaalde hij zijn artsexamen, waarna hij startte met zijn promotie-onderzoek als

beleids-AIO op de afdeling Endocrinologie en Metabolisme van het AMC (prof. dr. E. Fliers en

prof. dr. H.P. Sauerwein), in nauwe samenwerking met de vakgroep hypothalame integratie

mechanismen van het Nederlands instituut voor neurowetenschappen (dr. A. Kalsbeek). Op 1

april 2009 is hij begonnen met de opleiding tot internist in het opleidingscluster AMC (opleider

Prof. dr. P. Speelman), startend in het Flevoziekenhuis te Almere (opleider dr. S. Peters). Op 7 mei

2009 trouwde hij Madeleine Sombekke en samen kregen zij op 29 juli 2009 een zoon: Stan.

139

Chapter 8

Biografie


thyroid hormone, metabolism and the brain...pathway, is catalysed by both d1 and d3 (3). thyroidal...

Documents