tor1 and tor2 have distinct locations in live cells · agglutinin-tagged tor1 and tor2 localized to...

EUKARYOTIC CELL, Oct. 2008, p. 1819–1830 Vol. 7, No. 101535-9778/08/$08.00�0 doi:10.1128/EC.00088-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

TOR1 and TOR2 Have Distinct Locations in Live Cells�†Thomas W. Sturgill,1* Adiel Cohen,2 Melanie Diefenbacher,2 Mark Trautwein,2

Dietmar E. Martin,2 and Michael N. Hall2

Department of Pharmacology, University of Virginia Health Sciences Center, Charlottesville, Virginia 22908,1

and Biozentrum, University of Basel, CH-4056 Basel, Switzerland2

Received 11 March 2008/Accepted 9 July 2008

TOR is a structurally and functionally conserved Ser/Thr kinase found in two multiprotein complexes thatregulate many cellular processes to control cell growth. Although extensively studied, the localization of TORis still ambiguous, possibly because endogenous TOR in live cells has not been examined. Here, we examinedthe localization of green fluorescent protein (GFP) tagged, endogenous TOR1 and TOR2 in live S. cerevisiaecells. A DNA cassette encoding three copies of green fluorescent protein (3XGFP) was inserted in the TOR1gene (at codon D330) or the TOR2 gene (at codon N321). The TORs were tagged internally because TOR1 orTOR2 tagged at the N or C terminus was not functional. The TOR1D330-3XGFP strain was not hypersensitive torapamycin, was not cold sensitive, and was not resistant to manganese toxicity caused by the loss of Pmr1, allindications that TOR1-3XGFP was expressed and functional. TOR2-3XGFP was functional, as TOR2 is anessential gene and TOR2N321-3XGFP haploid cells were viable. Thus, TOR1 and TOR2 retain function after theinsertion of 748 amino acids in a variable region of their noncatalytic domain. The localization patterns ofTOR1-3XGFP and TOR2-3XGFP were documented by imaging of live cells. TOR1-3XGFP was diffuselycytoplasmic and concentrated near the vacuolar membrane. The TOR2-3XGFP signal was cytoplasmic butpredominately in dots at the plasma membrane. Thus, TOR1 and TOR2 have distinct localization patterns,consistent with the regulation of cellular processes as part of two different complexes.

TOR (target of rapamycin) is a large (�2,500 amino acids),highly conserved protein kinase that controls cell growth inresponse to nutrients. In Saccharomyces cerevisiae, there aretwo highly related TOR proteins, TOR1 and TOR2 (11). Bothproteins associate with membranes and are partially resistantto extraction with Triton X-100 (3, 21). TOR is found in twostructurally and functionally distinct multiprotein complexes,TORC1 and TORC2 (41). TORC1 contains TOR1 or TOR2and Kog1, Tco89, and Lst8. TORC2 contains TOR2, Avo1,Avo2, Avo3, Bit61, and Lst8. Both TORC1 and TORC2 areessential, but only TORC1 is inhibited by rapamycin. TORC1controls several growth-related processes, including transcrip-tion, translation, ribosome biogenesis, nutrient transport, andautophagy. TORC2 controls a different set of processes, in-cluding actin organization, endocytosis, and lipid biosynthesis(4). The TORCs, their components, and their key role in cellgrowth have been conserved from yeast to human. A majorunanswered question is how TOR regulates so many processes,directly or indirectly.

One potential source for the diversity of biologic processesunder TOR regulation is the subcellular localization of TOR.TOR signaling may depend on the colocalization of TOR withkey substrates involved in different cellular functions at differ-ent times to define branches in TOR signaling. The localizationof TOR1 and TOR2 in cells has been studied by biochemicalfractionation and immunostaining. In an early study, TOR2

was localized to the surface of the vacuolar membrane by usingantibody raised against a sequence in TOR2 (5). Subsequently,both [35S]TOR1 and [35S]TOR2 were found in P13 and P100membrane fractions (21). The P13 fraction is enriched in theplasma membrane (PM), endoplasmic reticulum (ER), vacu-oles, and mitochondria, whereas the P100 fraction is enrichedin Golgi bodies, endosomes, and secretory vesicles. TOR1 andTOR2 from the P13 fraction further fractionated on equilib-rium sucrose gradients similarly to Pma1, a PM marker. TheTORs were also found in a distinct, unidentified membranepool. As revealed by immunofluorescence, overexpressed hem-agglutinin-tagged TOR1 and TOR2 localized to discrete sitesor “dots” at or just beneath the PM (21). By immunogoldelectron microscopy, Wedaman et al. identified hemagglutinin-tagged TOR2 adjacent to the PM and along intracellular mem-branous tracks (40). In a recent biochemical study, TORC2components Avo3 and TOR2 correlated best with an earlyendosome marker (Rsv5), whereas TORC1 components over-lapped diffusely with trans-Golgi, ER, and vacuolar markers(3). Li et al. reported in an immunostaining study that TOR1is predominantly nuclear and exported to the cytoplasm inresponse to rapamycin treatment or nutrient starvation (24).Thus, the localization of TOR is ambiguous, possibly becauseprevious studies always relied on fixed or fractionated cells.Here, we visualize the localization of functional, internallygreen fluorescent protein (GFP)-tagged TOR1 and TOR2 inlive cells. We find that the localization patterns of TOR1-3XGFP(TOR1 tagged with a DNA cassette encoding three copies ofGFP) and TOR2-3XGFP (TOR2 with a DNA cassette encodingthree copies of GFP) are distinct and complex, possibly account-ing for the heretofore ambiguity in TOR localization. Further-more, the various localization patterns of the TORs may underliehow they control many different cellular processes.

* Corresponding author. Mailing address: Department of Pharma-cology, Box 800735, Room 5045, Jordan Hall, University of VirginiaHealth Sciences Center, Charlottesville, VA 22908. Phone: (434) 924-1919. Fax: (434) 924-5207. E-mail: [email protected].

† Supplemental material for this article may be found at http://ec.asm.org/.

� Published ahead of print on 22 August 2008.

1819

on Septem

ber 27, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/EC.00088-08&domain=pdf&date_stamp=2008-10-01

http://ec.asm.org/

MATERIALS AND METHODS

Yeast media. Rich medium (YPD) or synthetic medium (SD or SC) wasprepared as described previously (35). Rapamycin was added to YPD mediumfrom dilutions of a 1-mg/ml stock in 90% ethanol-10% Tween 20 just beforeplates were poured.

Strains with 3XGFP inserted into TOR1 or TOR2. A sequence for 3XGFP withthe S65G mutation and optimized for expression in yeast was amplified frompBS-3XGFP-TRP1 (22) with primers MT101 (5�-CCCGATATCGGAGGATCCATGTCTAAAGGT-3�) and MT102 (5�-GGACTAGTTTTGTACAATTCATCCATACCAT-3�) and cloned into the EcoRV and SpeI sites of pUG6 afterrestriction, creating pOM3. We constructed 3XGFP strains as described previ-ously using pOM3, with minor modifications (15). The strategy uses a kanMX6resistance marker to select recombinants that is later removed by the Cre re-combinase, restoring the open reading frame (ORF) for the gene containing therepeated tag. The specific TOR primers used to amplify the 3.8-kb cassette frompOM3 are given in Table 1. Portions of the PCRs were used to transform haploidTB50a (for TOR1) and diploid TB50a/� (for TOR2) strains by a high-efficiencylithium acetate-polyethylene glycol method. Transformants were allowed to re-cover for 4 to 6 h in YPD before being plated on YPD plates containing G418.Single colonies were streaked on YPD plates and allowed to grow at 30°C, andplates were stored at 4°C as the primary isolates.

The TOR1 ORF is disrupted by the stop codon of the kanMX6 marker untilremoval by the Cre recombinase (15). The primers used in the characterizationof strains are listed in Table 2. Colonies were tested for integration at the correctsite by a colony PCR before the Cre step, using a reverse primer (kanMX6/Rev)

in the nonrepeated kanMX6 ORF. With TOR1/Fwd/�500, the expected prod-ucts were observed in 9/15 colonies tested for N-terminal tagging (741 nucleo-tides [nt]), 8/15 tested for D67 tagging (942 nt), and 11/16 tested for D330 tagging(1,731 nt), and with TOR2/Fwd/�486, the expected product (727 nt) was ob-served in 2/2 colonies.

Cells taken from cultures in liquid YPD were transformed with pSH47 withlithium acetate-polyethylene glycol by a lower-efficiency, simplified method, andthe transformants were selected on SD-uracil (SD-ura) plates (secondary colo-nies). Plasmid pSH47 introduces Gal-inducible Cre on a 5-fluoroorotic acidremovable plasmid. Tiny amounts of single colonies were inoculated into 4 ml ofSC-ura containing 1% galactose and 1% raffinose in 15-ml disposable tubes.After induction for 5 h (30°C), the cells were collected by centrifugation, resus-pended in a small residual volume, and streaked so as to obtain single colonieson YPD plates. These tertiary colonies were identified, circled and labeled, andstreaked on YPD plates and YPD plates containing G418 to test for excision ofkanMX6 by Gal-induced Cre. A convention, for example, TOR1N-15-6-1, washelpful to indicate the gene and site followed by three single colony numbers (forprimary [G418], secondary [SD-ura], and tertiary [YPD] colonies after the in-troduction of Cre). The tertiary colonies that had lost the kanMX6 marker werestudied further.

Validation of TOR1-3XGFP strains. TOR2-3XGFP strains were verified asdescribed later in the text. TOR1-3XGFP strains were verified as follows. Re-combination to integrate the full 3XGFP cassette was confirmed by colony PCRwith primers to TOR1 sequences outside the cassette. PCR with primers TOR1/Fwd/�72 and TOR1/Rev/�280 (Table 2) gave the 2,599-nt band diagnostic for

TABLE 1. Primers for 3XGFP tagging of TOR1 and TOR2 by using pOM3

Primer Target Sequence (5� to 3�)a

TOR1-N-Fwd N terminus GGTAAAGTGAAACATACATCAACCGGCTAGCAGGTTTGCATTGATATG TGC AGG TCG ACA ACC CTT AAT

TOR1-N-Rev N terminus CGCTTTCAAAAGTTTACTCTTCCAAATCTGCTCCTCATGCGGTTCGCG GCC GCA TAG GCC ACT

TOR1-D67-Fwd D67 TGACTTCTAGTAGGTTTGATGGAGTGGTGATTGGCAGTAATGGGTGC AGG TCG ACA ACC CTT AAT

TOR1-D67-Rev D67 GGTTAATTCGCGGAAAATTTTCTCCAAAATGGGCTTAAAATTTACGCG GCC GCA TAG GCC ACT

TOR1-D330-Fwd D330 ATCCATGCAAGTTTGTTGGTTTATAAGGAAATCTTGTTTTTGAAGTGC AGG TCG ACA ACC CTT AAT

TOR1-D330-Rev D330 TATGCAATTTAGACACATTTGGTCGAACACTTGATTCAAAAAGGGGCG GCC GCA TAG GCC ACT

TOR2-N-Fwd N terminus TCTTTCTCAAAGAGATTTCTGATCTTTACTTTCCCCATATGAAAAATG TGC AGG TCG ACA ACC CTT AAT

TOR2-N-Rev N terminus AGACAATAAGTTAGGTGGCGTGGTGTATTTGTTAATGTATTTATTGCG GCC GCA TAG GCC ACT

TOR2-N321-Fwd N321 CAAAGATTATTTCAAGGTTGTACACATGGCTTAAGTCTCAATACGTGC AGG TCG ACA ACC CTT AAT

TOR2-N321-Rev N321 GCTGAGTAATTCTCGAAATACCAACAGAGTAGCATGCACTGAATCGCG GCC GCA TAG GCC ACT

a The underlined portion is the sequence in TOR1 or TOR2. The italicized portion is the ATG codon added to the primer to replace the initiating ATG codon.Sequence that is neither italicized nor underlined is the sequence in the pOM3 template.

TABLE 2. Primers used in characterization of strains

Primer Locationa Sequence

TOR1/Fwd/�500 Promoter, �500 to �480 5�-AGACAGCAAACCACCTGTTGC-3�TOR1/Fwd/�72 Promoter, �72 to �53 5�-CCATAGTAGCTTCACGAGAG-3�TOR1/Fwd/�801 ORF, 801 to 821 5�-GGTGATCAGAATTGATGCGTC-3�TOR1/Rev/�280 ORF, 258 to 280 5�-TACTGGCCAATTTTCGTTCCTCC-3�TOR1/Rev/�1101 ORF, 1080 to 1101 5�-TGCTAATAGGGGAACAATCTGG-3�TOR2/Fwd/�486 Promoter, �486 to �464 5�-CGTCATTTTTTACATACTGCTGC-3�TOR2/Fwd/�711 ORF, 711 to 730 5�-ATACAGGAGACATGCTGCGC-3�TOR2/Fwd/�931 ORF, 931 to 951 5�-TTTCAAGGTTGTACACATGGC-3�TOR2/Rev/�990 ORF, 970 to 990 5�-CAGAGTAGCATGCACTGAATC-3�kanMX6/Rev 3XGFP cassette 5�-CCGTGCGGCCATCAAAATG-3�GFP/Rev 3XGFP cassette, 165 to 185 (after Cre) 5�-GCATCACCTTCACCTTCACCG-3�

aLocation is nt from ATG start codon where specified.

1820 STURGILL ET AL. EUKARYOT. CELL

on Septem


.org/D

ownloaded from

http://ec.asm.org/

3XGFP for colony TOR1/D67-1-1-1, which became strain VA38 (Table 3). PCRwith the same set gave the expected 2,602-nt band expected for 3XGFP forcolony TOR1N-15-6-1, strain VA41 (Table 3). PCR with TOR1/Fwd/�801 andTOR1/Rev/�1101 gave the expected 2,548-nt band diagnostic for 3XGFP withTOR1/D330-14-1-6 and 14-1-3, strains VA34 and VA35, respectively, but alarger �3.4-kb band for TOR1/D330-3-1-2, strain VA33.

As a second proof, we repeated the PCR with a primer specific for the GFP inpOM3. Using TOR1/Fwd/�72 and GFP/Rev, three bands corresponding to theexpected 456-, 1,176-, and 1,896-nt products for 3XGFP insertion were all clearlypresent with strain VA38 (Table 3). VA34 was confirmed by observation of theexpected 372-, 1,092-, and 1,896-products by using TOR1/Fwd/�801 and GFP/Rev. A PCR for VA38 with TOR1/Fwd/�72 and GFP/Rev gave the expected260- and 980-nt products but not the 1,700-nt product in VA38, due to prefer-ential amplification of smaller products.

As a third and final proof, correct integration was also confirmed by sequenc-ing. Genomic DNA was purified after cell breakage by a phenol-chloroformmethod and amplified by PCR with TOR1/Fwd/�801 (for VA34 and VA35),TOR1/Fwd/�72 (for VA34 and VA41), and GFP/Rev. The band from primingto the first GFP was purified and sequenced. VA33 and VA34/VA35 are fromindependent primary colonies.

Isolation of proteins and Western blot analysis. A crude supernatant protein(1,500 � g for 1 min) was isolated by a method using glass beads for the breakageof cells. The lysis buffer was ice-cold phosphate-buffered saline, 10% glycerol,and 0.5% Tween 20 with inhibitors (1.25 �g/ml leupeptin, 0.75 �g/ml antipain,0.25 �g/ml chymotrypsin, 0.25 �g/ml elastinol, 5 �g/ml pepstatin, 1 mM phen-ylmethylsulfonyl fluoride, 1 mM EDTA). Protein (40 �g), in sodium dodecylsulfate sample buffer, was loaded on a 7.5% sodium dodecyl sulfate-polyacryl-amide gel electrophoresis gel and used for Western blot analysis (6). A mixtureof two mouse monoclonal antibodies (clones 7.1 and 13.1) to GFP (RocheApplied Science) was used at a dilution of 1:1,000. The antibody detection system(ECL kit) was from Amersham.

Kog1-8XGFP strains. Plasmid pTA19 contains a portion (3,000 to 4,671 nt) ofthe KOG1/LAS24 ORF at the HindIII and XbaI sites of p8XGFPIU (2). TB50awas transformed with SalI-treated pTA19, generating strain VA19 after colonyselection on SD-ura (Table 3). To generate strains with both Kog1-GFP and

TOR1-3XGFP, VA109 (constructed similarly to VA19 but in TB50�) wascrossed with VA66 and the desired segregant (VA121) was chosen.

Spottings for growth assays. Strains were grown overnight in liquid YPD (5-mlculture), collected by centrifugation, and washed once with water, and 0.1 ml wasused to inoculate SD (5 ml) overnight. Cells were adjusted in concentration to anoptical density at 600 nm of 1.0, then serially diluted 1:10 in a 96-well plate, andtransferred to plates with a pinning device.

FM4-64 staining. Cells were grown in YPD to an A600 of 0.8. Cells (20 to 40A600 units ml�1 in YPD medium) were incubated on ice for 30 min with 30 �molliter�1 FM4-64 dye (Molecular Probes Inc.), washed once with YPD, and incu-bated for 60 min for steady-state experiments as described previously (38).

Microscopy. Cells were imaged while in log phase, after immobilization onslides coated beforehand with concanavalin A. Microscopy of 3XGFP strains wasperformed with a Zeiss Axioplan 2 microscope equipped with an MRm camera(Carl Zeiss, Aalen Oberkochen, Germany) and a Plan Apochromat 63�/1.40-numerical-aperture objective for oil. Zeiss Axiovision 3.1 software was used tocontrol filters and to acquire images once a field was chosen in differentialinterference contrast (DIC). Exposure settings for GFP in different figures variedbetween 800 and 2,000 ms except where noted; comparisons for intensity arevalid within figures but not between figures. Images were analyzed with Axiovi-sion software (Zeiss), with equal adjustments for all images (control and 3XGFPstrains) taken in each experiment. Axiovision files were exported in TIFF formatand cropped in Photoshop without further modification of brightness or contrast.For confocal imaging, we used an Olympus 1X81 spinning-disk microscope anda Plan Apochromat 60�/1.42-numerical-aperture oil objective, and we used IQAndor software to collect and deconvolute Z-stack images. Deconvoluted imageswere exported into ImageJ and then to Photoshop.

RESULTS

Identification of a region in TOR1 for internal 3XGFP tag-ging. Visualization of low-abundance proteins, such as TORs,often requires the incorporation of multiple tags. The incor-

TABLE 3. Yeast strains and plasmids

Strain or plasmid Genotype or description Reference or source

StrainsTB50a MATa leu2-3,112 ura3-52 rme1 trp1 his3 HMLa Hall collectionTB50a/� MATa/� leu2-3,112/leu2-3,112 ura3-52/ura3-52 rme1/rme1 trp1/trp1 his3/his3 HMLa/HMLa Hall collectionJK9-3da/� MATa/� leu2-3,112/leu2-3,112 ura3-52/ura3-52 rme1/rme1 trp1/trp1 his4/his4 HMLa/HMLa Hall collectionAN9-2a MATa leu2-3,112 ura3-52 rme1 trp1 his3 tor1::kanMX6 HMLaLJ25-1A MATa leu2-3,112 ura3-52 rme1 trp1 his3 pmr1�::kanMX4 HMLa 10LJ25-2C MAT� leu2-3,112 ura3-52 rme1 trp1 his3 pmr1�::kanMX4 HMLa 10VA19 MATa leu2-3,112 ura3-52 rme1 trp1 his3 KOG18XGFP::URA3 HMLa This studyVA33 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D330-3XGFP HMLa/pSH47 CEN URA3 This studyVA34 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D330-3XGFP HMLa/pSH47 CEN URA3 This studyVA35 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D330-3XGFP HMLa/pSH47 CEN URA3 This studyVA36 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D67-3XGFP HMLa/pSH47 CEN URA3 This studyVA38 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D67-3XGFP HMLa/pSH47 CEN URA3 This studyVA41 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1N-3XGFP HMLa/pSH47 CEN URA3 This studyVA43 MATa/� leu2-3,112/leu2-3,112 ura3-52/ura3-52 rme1/rme1 trp1/trp1 his3/his3 TOR2N321-3XGFP/

TOR2 HMLa/HMLaThis study

VA66 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D330-3XGFP HMLa This studyVA68-9c MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR1D330-3XGFP HMLa/pSH47 CEN URA3 This studyVA68-9c MATa leu2-3,112 ura3-52 rme1 trp1 his3 pmr1�::kanMX4 TOR1D330-3XGFP HMLa This studyYGD25 MATa leu2-3,112 ura3-52 rme1 trp1 his3 tor1�::LEU2-4 pmr1�::kanMX4 HMLa 9VA86 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR2N321-3XGFP HMLa/pSH47 CEN URA3 This studyVA102 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR2N321-3XGFP HMLa This studyVA109 MATa leu2-3,112 ura3-52 rme1 trp1 his3 OG18XGFP::URA3 HMLa This studyVA121 MATa leu2-3,112 ura3-52 rme1 trp1 his3 TOR2N321-3XGFP KOG18XGFP::URA3 HMLa This studyYGD25 MATa leu2-3,112 ura3-52 rme1 trp1 his3 tor1�::LEU2-4 pmr1�::kanMX4 HMLa 9

PlasmidspSH47 pGAL-cre CEN URA3 16pTA19 Integrating plasmid KOG1 (nt 3000–4671)-8XGFP:URA3 2pTPQ128 pADH1-Sec7-dsRed CEN LEU2 31pTPQ127 pGPD1-FYVE-dsRed CEN LEU2 31

VOL. 7, 2008 TOR1-3XGFP AND TOR2-3XGFP 1821

on Septem


.org/D

ownloaded from

http://ec.asm.org/

poration of multiple copies can be either at the N terminus orat the C terminus of the protein in question. However, in ourexperience (data not shown), neither TOR1 nor TOR2 cantolerate the fusion of a tag to either the N or C terminus.Consistent with these previous observations, TOR1 or TOR2with 3XGFP at the N terminus (encoded by TOR1N-3XGFP or

TOR2N-3XGFP, respectively) was nonfunctional (see Fig. 5 and8). TOR contains multiple subdomains, some of which havenot been fully characterized but are important for interactionswith conserved components of TOR complexes. We reasonedthat an internal region permissive for the insertion of 3XGFPmight be revealed by a comparison of evolutionary divergent

FIG. 1. The alignment of evolutionary divergent species identifies a region of TOR for the insertion of 3XGFP. Proteins were aligned byClustalW (7). Only the relevant portion is shown. Residues D67 and D330 in TOR1 and N321 in TOR2 are indicated by asterisks. Arrows indicatesites where 3XGFP was inserted at D330 (TOR1) or N321 (TOR2) with retention of function. Humans, Caenorhabditis elegans, and Cryptococcusneoformans have only one TOR. Default colors and alignment parameters are from the implementation of ClustalW (7) at http://npsa-pbil.ibcp.fr/.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

TOR proteins. To identify a candidate region for the insertionof 3XGFP, we aligned six TOR proteins (viz., human mTOR[mammalian TOR], Saccharomyces cerevisiae TOR1 and TOR2,Schizosaccharomyces pombe Tor2, Caenorhabditis elegans TOR,and Cryptococcus neoformans TOR) (Fig. 1). We found a variableregion near D330 in the noncatalytic domain of S. cerevisiaeTOR1. This region in some of the TORs contains natural inser-tions, and D330 in TOR1 was thus viewed as potentially permis-sive for the insertion of 3XGFP. To test this hypothesis, we gen-erated three independent strains (VA33, VA34, and VA35), all ofwhich contain an in-frame cassette encoding 3XGFP replacingD330 in TOR1 (see Materials and Methods and Table 3). The3XGFP insertion is shown by the alignments in Fig. S1 in thesupplemental material. We used three different phenotypic teststo determine the functionality of the new TOR1D330-3XGFP alleleencoding TOR1-3XGFP, as described directly below.

TOR1-3XGFP encoded by TOR1D330-3XGFP is functional.TOR1-3XGFP was expressed as an intact protein with anapparent mass greater than 250 kDa (Fig. 2A). A phenotypefor the loss of TOR1 is rapamycin hypersensitivity. Rapa-mycin hypersensitivity of tor1� cells is due to a specific lossof TOR1 function because point mutations that inactivateTOR1 kinase activity cause hypersensitivity to a low con-centration (1 nM) of rapamycin (33). The three independentstrains of TOR1D330-3XGFP were not hypersensitive to 1 nMor 2 nM rapamycin (Fig. 2B and C) and grew equivalently inthe absence of rapamycin (Fig. 2A), indicating that TOR1-3XGFP was expressed and functional. A higher concentra-tion of rapamycin (5 nM) nearly completely inhibited thegrowth of the TOR1D330-3XGFP and TOR1 strains as ex-pected (data not shown).

FIG. 2. TOR2-3XGFP is expressed, and TOR1D330-3XGFP strains have normal sensitivity to rapamycin. (A) Western blot with anti-GFP antibodies of 40 �gof total protein (see Materials and Methods) of the control (Ctl), TB50a, and VA34 strains. The indicated strains were streaked onto YPD (B), YPD plus 1 nMrapamycin (Rap) (C), and YPD plus 2 nM rapamycin (D). Cells were grown for 2 days at 30°C after streaking and then scanned.

FIG. 3. TOR1D330-3XGFP strains adapt to cold stress. The indicatedstrains were streaked onto YPD (A) or YPD plus 2 nM rapamycin(Rap) (B) Cells were grown for 4 days at 15°C (15 deg C) afterstreaking and then scanned.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

The loss of TOR1 causes a cold-sensitive growth defect (Fig.3). Adaptation to cold stress is not rescued by a kinase-defec-tive TOR1 (data not shown). TOR1D330-3XGFP strains were notcold sensitive (Fig. 3A). In fact, TOR1D330-3XGFP strains grewsomewhat better at 15°C than the wild type. This enhancedgrowth potential of TOR1D330-3XGFP strains at 15°C was alsoobserved in the presence of 2 nM rapamycin (Fig. 3B). Thisresult shows as well that Tor1D330-3XGFP is expressed and func-tional because adaptation to cold stress requires active TOR1kinase activity.

Pmr1 is a P-type ATPase that localizes predominantly toGolgi bodies and transports Ca2� or Mn2� into the lumenfrom the cytoplasm (13). Pmr1 function is important for Ca2�

regulation in the secretory pathway and for the removal oftoxic levels of Mn2�. TOR1 has a genetic interaction withpmr1� (9). A pmr1� strain does not grow in the presence of 2mM Mn2�, and growth is rescued by the loss of TOR1. We foundthat a TOR1D330-3XGFP pmr1� strain is as sensitive to Mn2� as aTOR1 pmr1� strain (Fig. 4). Thus, as assayed by three separatephenotypic tests, TOR1-3XGFP encoded by TOR1D330-3XGFP isfunctional like wild-type TOR1.

For comparison to the insertion at D330, we also con-structed 3XGFP strains that targeted residue D67, nearer to

the N terminus of TOR1, where there is significantly moredivergence in sequence than at D330 (Fig. 1). Notably, TOR1is functional with 2XMyc but not higher numbers of Myc pro-teins, placed between residues 86 and 87 in this N-terminalsegment (27; A. Lorberg, personal communication). We foundthat TOR1D67-3XGFP was only partially functional because itconferred only partial resistance to 1 nM rapamycin (Fig. 5A).The function of TOR1D67-3XGFP was greater than that ofTOR1N-3XGFP, as reflected in the rapamycin or cold sensitivityof the corresponding strains. The TOR1D330-3XGFP strain wasmore functional for growth in the presence of rapamycin or at15°C than either the TOR1N-3XGFP or TOR1D67-3XGFP strain(Fig. 5B).

Kog1 is an essential protein that binds TOR1 or TOR2 inTORC1 (27). Strains containing Kog1 with 3XGFP or 8XGFPincorporated at the C terminus as genomic tags are viable (2,37). We confirmed that KOG1C-8XGFP cells (VA19) were nothypersensitive to 1 nM rapamycin (Fig. 5B).

TOR1-3XGFP is diffusely cytoplasmic and concentrated atdiscrete sites near vacuolar membranes. TOR1-3XGFP en-coded by TOR1D330-3XGFP was visualized in live cells. In cellsgrown in rich medium (YPD), TOR1-3XGFP was dispersedthroughout the cytoplasm and was concentrated near the vac-uolar membrane, sometimes as a dot (Fig. 6). TOR1-3XGFPwas also observed, although rarely, in dots near the plasmamembrane (data not shown). The vacuole (Fig. 6A) was iden-tified by autofluorescence of its contents at red wavelengthsand by morphology in DIC. Vacuolar autofluorescence wasmore prominent when cells were grown in rich medium

A. YPDTOR1,PMR1

TOR1,pmr1∆

tor1∆,PMR1

tor1∆,pmr1∆

TOR1D330-3XGFP,PMR1

TOR1D330-3XGFP,pmr1∆

B. YPD + 2 mM Mn2+

TOR1,PMR1

TOR1,pmr1∆

tor1∆,PMR1

tor1∆,pmr1∆

TOR1D330-3XGFP,PMR1

TOR1D330-3XGFP,pmr1∆

FIG. 4. TOR1D330-3XGFP, like TOR1, is sensitive to Mn2� in apmr1� strain. The indicated strains were streaked onto YPD (A) orYPD containing 2 mM Mn2� (final concentration) (B). Cells weregrown for 2 days at 30°C, and then plates were scanned. The TOR1PMR1 (TB50a), tor1� PMR1 (AN9-2a), tor1� pmr1� (YGD25),TOR1 pmr1� (LJ25-1A), TOR1D330-3XGFP pmr1� (VA68-9c), andTOR1D330-3XGFP PMR1 (VA34) strains were used (Table 3).

FIG. 5. TOR1D67-3XGFP is partially functional. (A) Growth on YPDcontaining 1 nM rapamycin. The indicated strains (Table 3) werestreaked, and after 3 days of growth, the plate was scanned. Growthpatterns on YPD from streaks in the same experiment were similar(data not shown). (B) Growth at 15°C (15 deg) on YPD or YPD plus1 nM rapamycin (Rap). The indicated strains were assayed by a 10-folddilution and pinning; TOR1D67-3XGFP (VA38) was used. The plateswere scanned after 4 days.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

(YPD). We confirmed the perivacuolar localization of theTOR1-3XGFP signal by comparing it to that of FM4-64, whichspecifically stains the vacuolar membrane at steady state (Fig.6B) (38). A portion of TOR1-3XGFP overlapped with theexpected ring-like staining of FM4-64 marking the vacuolarmembrane.

The predominant localization of KOG1-GFP to the vac-uolar membrane has been reported previously (2, 37). Wecompared TOR1-3XGFP and Kog1-GFP strains to a straincontaining both GFP fusions (VA121) (see Fig. S2 in thesupplemental material). The perivacuolar signal for GFP inthe double-GFP strain was dramatically increased (see Fig.S2 in the supplemental material) compared to that in eithersingle-GFP strain. TOR2-3XGFP, studied for comparison,did not show perivacuolar localization (see Fig. S2 in thesupplemental material).

The localization of TOR1-3XGFP was compared to that ofSec7-dsRed or FYVE-dsRed (Fig. 7) (31). Cells were grown inselective synthetic medium to maintain the plasmid encodingthe dsRed marker. Sec7 is a high-molecular-weight protein

that contains a guanine-nucleotide exchange activity for Arfproteins involved in Golgi function (8). Sec7-dsRed is a markerfor the trans-Golgi (28). The localization of TOR1-3XGFP wasqualitatively different from that of Sec7-dsRed. First, the Sec7-dsRed vesicles were more numerous than the dots of TOR1-3XGFP, and second, the punctate signals for TOR1-3XGFP(Fig. 7) did not exactly correspond. A closer correspondencewas observed between TOR1-3XGFP and the FYVE-dsRedmarker.

The FYVE-dsRed fusion protein binds phosphatidylino-sitol-3-phosphate (for a review, see reference 23) and isgenerally a marker for early endosomes but is also foundnear the vacuole. FYVE-dsRed localizes “to punctate struc-tures adjacent to the vacuole, weakly on the vacuole-limitingmembrane, and in some cases within the vacuole” (18). Weemphasize this description because TOR1-3XGFP localiza-tion was similar to this description with regard to the vacu-ole. TOR1-3XGFP also appeared to localize very near to, ifnot within, the FYVE-dsRed punctate structures near the

FIG. 6. TOR1D330-3XGFP is predominantly cytoplasmic and concentrated as dots near the vacuolar membrane. (A) Localization ofTOR1-3XGFP in cells grown in YDP. Merged GFP (green; GFP channel) and autofluorescence images for TB50a (control) lacking a GFPcassette and TOR1-3XGFP (VA34) strains are shown. Strains were grown overnight in YPD, diluted, and imaged while still in log phase aftercentrifugation and suspension in synthetic medium. The arrow indicates a dot near the vacuole, and the feathered arrow indicates a dot nearthe vacuolar membrane. (B) The TOR1-3XGFP signal overlaps FM4-64 staining (see Materials and Methods) of the vacuolar membrane.Control, strain TB50a lacking a GFP cassette; TOR1-3XGFP, strain VA102. The exposure settings used were as follows: DIC, 300 ms; GFP,10,000 ms; and Fm4-64 (Cy3), 10,000 ms.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

vacuole. However, TOR1-3XGFP localization was distinctfrom FYVE-dsRed localization in that TOR1-3XGFP wasalso diffusely cytoplasmic and not all the dot-like concen-trations of TOR1-3XGFP were found near the vacuole.

TOR2 is functional when 3XGFP is inserted to replaceN321. Our success with TOR1D330-3XGFP encouraged us togenerate GFP fusion alleles of TOR2 (Fig. 8). We targetedthe N terminus and residue N321 of TOR2. Like D330 inTOR1, N321 in TOR2 corresponds to a variable region inthe noncatalytic domain of TOR2. The TOR2-targeted3XGFP cassette was introduced into diploid strains becauseTOR2 is essential. To assess the functionality of the GFPfusion proteins, diploids containing the desired TOR2N-3XGFP orTOR2N321-3XGFP allele were sporulated, dissected, and ger-minated. The TOR2N-3XGFP allele was nonfunctional be-cause only two spores were viable in 13/13 tetrads dissected(see Fig. S3 in the supplemental material). In contrast,TOR2N321-3XGFP was functional (see Fig. S3 in the supple-mental material). Nineteen of 23 dissected tetrads forTOR2N321-3XGFP produced four viable spores. An expecteddiagnostic PCR product (441 nt) was observed with 2:2segregation for all tetrads analyzed, and the product wasabsent in control cells (Fig. 8A).

The 441-nt product is that expected from the reverse primeramplifying at the closest site in the first GFP sequence. Tofurther assess this, we performed a colony PCR with primerschosen close to and flanking the N321 site (Fig. 8B). One

candidate had the complete 3XGFP cassette because the prin-cipal product was an �2.3-kb band and was chosen for furtherstudy (becoming VA102). The other candidates were 2XGFPor 1XGFP. TOR2-3XGFP in VA102 was expressed as a �250-kDa protein by Western blotting with anti-GFP antibodies(Fig. 8C). These results together demonstrate that TOR2 re-mains functional despite the insertion of 3XGFP at N321whereas TOR2 with 3XGFP at the N terminus is nonfunc-tional.

TOR2-3XGFP localizes to punctate structures near theplasma membrane. The localization of TOR2-3XGFP (en-coded by TOR2N321-3XGFP in VA102) was compared with thatof Sec7-dsRed or FYVE-dsRed under conditions similar tothose used for TOR1-3XGFP (Fig. 9). TOR2-3XGFP did notcolocalize with either Sec7-dsRed or FYVE-dsRed, andTOR2-3XGFP was not found concentrated near the vacuolarmembrane. Instead, TOR2-3XGFP was detectable above thebackground in punctate structures. These structures were mostapparent beneath the plasma membrane.

To better resolve these structures, we used confocal micros-copy (Fig. 10; see also Fig. S4 in the supplemental material).The TOR2-3XGFP signal was cytoplasmic and concentrated inpunctate structures at or very near the plasma membrane.TOR1-3XGFP was cytoplasmic and concentrated near the vac-uole. The identities of the TOR structures near the plasmamembrane are unknown, although they resemble eisosomes inlocation and appearance but are less numerous than eiso-

FIG. 7. TOR1D330-3XGFP localization is distinct from that of Sec7-dsRed and similar to that of FYVE-dsRed. We performed microscopy withthe following strains in SD or SD-leu (top to bottom): TB50a (control strain, in SD), TOR1D330-3XGFP (V66, in SD), TOR1D330-3XGFP plusFYVE-dsRed (VA66 transformed with pTPQ127, in SD-leu), and TOR1D330-3XGFP plus Sec7-dsRed (VA66 transformed with pTPQ128, inSD-leu). The arrow shows an example of colocalization of TOR1D330-3XGFP with an FYVE domain marker in a punctate structure. The exposuresettings used were as follows: DIC, 100 ms; GFP, 2,000 ms; and dsRed, 500 ms.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

somes. Eisosomes have recently been defined and character-ized as punctate structures at the plasma membrane involvedin the early steps of endocytosis (36, 39).

DISCUSSION

We constructed functional TOR1-3XGFP and TOR2-3XGFP proteins to localize TOR in living cells. Importantly,this required the insertion of GFP within the TOR1 and TOR2ORFs rather than at the N or C terminus. TOR1-3XGFP wascytoplasmic and concentrated at a prevacuolar compartmentand at the vacuolar membrane. TOR2-3XGFP was also cyto-plasmic and, most strikingly, concentrated at the plasma mem-brane. We did not detectably observe TOR1-3XGFP in thenucleus, and the nucleus qualitatively often correlated withdecreased staining versus the surrounding cytoplasm (data notshown). More studies will be required to address this. Imaging

functional tagged proteins should be complementary to imag-ing proteins in fixed cells with antibodies. Fixation may cause aloss of vesicular localization of proteins, for example, Rheb(34). The various localization patterns of TORs may provide amolecular basis for the large number of processes controlled byTOR and may also explain why different studies have observedTOR in different cellular locations. The localization of TOR inmammals has also been ambiguous, possibly because mTOR(also known in literature as FRAP [FKBP12-rapamycin-asso-ciated protein[) is also found in different locations. mTOR hasbeen reported to be principally cytoplasmic and to shuttlebetween the cytoplasm and nucleus (20), to be principallynuclear in some cancer cell lines (42), to be cytoplasmic andassociated with Golgi bodies and the ER (26), or to be asso-ciated with a regulatory subunit of protein kinase A (RI�) onlate endosomes and autophagosomes (30). Only the last studyused GFP-tagged mTOR, but GFP-tagged mTOR was over-

FIG. 8. TOR2 is functional if N321 is replaced by 1X-, 2X-, or 3XGFP. (A) A 441-nt product (asterisk) establishes the insertion of GFP ingerminated spores with 2:2 segregation (see the text). Primers TOR2/�711 and GFP/Rev and spores 2A to 2D (template) were used for colonyno. 1 (TB50a/� background). (B) Results of PCR consistent with 2XGFP replacing N321 after the recombination event in JK9 colony no. 1, 1XGFPin TB50 colony no. 2, and 3XGFP in TB50 colony no. 1 (see the text). Primers TOR2/Fwd/�931 and TOR2/Rev/�990 were used. The templatesused were as follows: 2XGFP-JK9 lanes, 2A, 2B, none, and 20C; 1XGFP-TB50 lanes, 18A, 18B, 20A, and 20B (colony no. 2); and 3XGFP-TB50lanes, 2A, 2B, 7C, and 7D (colony no. 1). Arrows indicate diagnostic bands for 1X-, 2X-, and 3XGFP (see the text). (C) Western blot with anti-GFPof 40 �g of lysate protein (see Materials and Methods) from the control (Ctl), TB50a, and VA102 strains.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

expressed and N terminally tagged with 1XGFP and its func-tionality remains to be established.

The concentration of TOR1-3XGFP near the vacuolarmembrane is consistent with some reports in the literature.The loss of TOR1 is synthetically lethal with loss of class C VPS(vacuolar protein sorting) genes (43). This genetic interactionis likely specific to TOR1 because the overexpression of TOR2fails to rescue the synthetic lethality. As a second correlation,the TOR1 interactors Kog1 and Tco89 were detected near thevacuolar membrane by imaging of Kog1-GFP in live cells or byimmunogold staining for Tco89 in fixed cells (2, 32, 37). Be-cause strain differences can affect TOR1-related phenotypes(9, 32), we confirmed that Kog1-8XGFP was also concentratedat the vacuolar membrane in TB50 (see the supplementalmaterial). As a third correlation, TOR1 interacts geneticallyand biochemically with Gtr2 in the Ego complex, found nearthe vacuolar membrane (12). Finally, the phosphorylation ofSch9 by TORC1 may occur near the vacuole because Sch9localizes near this organelle and an artificial Sch9 substratetethered to the vacuolar membrane is phosphorylated in aTORC1-dependent manner (37). If there is a connection ofTORC1 to the vacuole, it may derive from the role of thevacuole in nutrient supply or regulation of autophagy (19).The physiological relevance of TOR1 in the cytoplasm or at theplasma membrane also remains to be determined.

The localization of TOR2-3XGFP at discrete sites near theplasma membrane is similar to that of eisosomes, recentlydescribed as protein complexes important for endocytosis (39).Interestingly, TOR2 is found mainly in TORC2, which is im-

plicated in endocytosis and actin dynamics (14). Furthermore,TOR2 activates the AGC family kinase Ypk2 (17). Ypk2 phos-phorylates Pil1 and Lsp1, proteins involved in eisosome for-mation and function (29). Moreover, TORC2 is required forsphingolipid biosynthesis (4) and Ypk2 is also activated bysphingolipids (for a review, see reference 25). These findingsmake eisosomes an interesting candidate for the location ofTOR2 at the plasma membrane. We attempted to address thisby introducing an mCherry tag at the C terminus of LSP1 orSUR7 in the TOR2-3XGFP strain and found that (i) the Lsp1and Sur7 mCherry signals are very much brighter than theTOR2-3XGFP signal and (ii) the TOR2-3XGFP signal showedpartial colocalization with these markers (data not shown).Avo3 shows partial colocalization with Pil1 (an eisosomemarker) by immunofluorescence of fixed cells (R. Shioda, un-published data). The specific localization of TOR2-3XGFP toeisosomes remains to be defined.

Our findings provide insight into the structure of TOR. It isremarkable that TOR, a strongly conserved protein of �2,500amino acids, retains at least partial function after the insertionof 748 amino acids (3XGFP cassette) in the noncatalytic do-main. The functionality of the internally tagged TOR1-3XGFPand TOR2-3XGFP proteins may be due to the placement of3XGFP between subdomains. The majority of the N terminusof TOR consists of repeated HEAT motifs (21). D330 andN321 are in a gap between HEAT repeats (see Fig. S5 in thesupplemental material). Furthermore, a recent electron mi-croscopy structure of TOR1 suggests that the noncatalytic do-main forms an N-terminal head, a turn, and an arm (1). We

FIG. 9. TOR2N321-3XGFP localizes to punctate structures near the plasma membrane. We performed microscopy with the following strains inSD or SD-leu (top to bottom): TB50a (control strain, in SD), TOR1-3XGFP (V102, in SD), TOR1-3XGFP plus FYVE-dsRed (VA102transformed with pTPQ127, in SD-leu), and TOR2-3XGFP plus Sec7-dsRed (VA102 transformed with pTPQ128, in SD-leu). The VA102 strainlost the pSH47 (URA3) plasmid by 5-fluoroorotic acid treatment (Table 3).


on Septem


.org/D

ownloaded from

http://ec.asm.org/

predict that D330 and N321 are near a gap between two ofthese subdomains. The preservation of function with internaltagging of TOR with GFP may also be due to the fact that theN terminus and the C terminus of GFP are near each other(see Protein Data Bank entry 1EMM), minimizing displace-ment at the point of insertion.

ACKNOWLEDGMENTS

We thank our colleagues in the Spang and Hall laboratories for theirhelp. We thank Christiana Walch-Solimena and Yukifumi Uesonso forimportant reagents.

This research was supported by the Swiss National Science Foun-dation and the Canton of Basel (M.N.H.) and by the National Insti-tutes of Health (DK052753) (T.W.S.).

REFERENCES

1. Adami, A., B. Garcia-Alvarez, E. Arias-Palomo, D. Barford, and O. Llorca.2007. Structure of TOR and its complex with KOG1. Mol. Cell 27:509–516.

2. Araki, T., Y. Uesono, T. Oguchi, and E. A. Toh. 2005. LAS24/KOG1, acomponent of the TOR complex 1 (TORC1), is needed for resistance tolocal anesthetic tetracaine and normal distribution of actin cytoskeleton inyeast. Genes Genet. Syst. 80:325–343.

3. Aronova, S., K. Wedaman, S. Anderson, J. Yates III, and T. Powers. 2007.Probing the membrane environment of the TOR kinases reveals functionalinteractions between TORC1, actin, and membrane trafficking in Saccharo-myces cerevisiae. Mol. Biol. Cell 18:2779–2794.

4. Aronova, S., K. Wedaman, P. A. Aronov, K. Fontes, K. Ramos, B. D. Ham-mock, and T. Powers. 2008. Regulation of ceramide biosynthesis by TORcomplex 2. Cell Metab. 7:148–158.

5. Cardenas, M. E., and J. Heitman. 1995. FKBP12-rapamycin target TOR2 isa vacuolar protein with an associated phosphatidylinositol-4 kinase activity.EMBO J. 14:5892–5907.

6. Cohen, A., N. Perzov, H. Nelson, and N. Nelson. 1999. A novel family of yeastchaperons involved in the distribution of V-ATPase and other membraneproteins. J. Biol. Chem. 274:26885–26893.

7. Combet, C., C. Blanchet, C. Geourjon, and G. Deleage. 2000. NPS@: net-work protein sequence analysis. Trends Biochem. Sci. 25:147–150.

8. Deitz, S. B., A. Rambourg, F. Kepes, and A. Franzusoff. 2000. Sec7p directsthe transitions required for yeast Golgi biogenesis. Traffic (Copenhagen)1:172–183.

9. Devasahayam, G., D. J. Burke, and T. W. Sturgill. 2007. Golgi manganesetransport is required for rapamycin signaling in Saccharomyces cerevisiae.Genetics 177:231–238.

10. Devasahayam, G., D. Ritz, S. B. Helliwell, D. J. Burke, and T. W. Sturgill.2006. Pmr1, a Golgi Ca2�/Mn2�-ATPase, is a regulator of the target ofrapamycin (TOR) signaling pathway in yeast. Proc. Natl. Acad. Sci. USA103:17840–17845.

11. De Virgilio, C., and R. Loewith. 2006. Cell growth control: little eukaryotesmake big contributions. Oncogene 25:6392–6415.

12. Dubouloz, F., O. Deloche, V. Wanke, E. Cameroni, and C. De Virgilio. 2005.The TOR and EGO protein complexes orchestrate microautophagy in yeast.Mol. Cell 19:15–26.

13. Durr, G., J. Strayle, R. Plemper, S. Elbs, S. K. Klee, P. Catty, D. H. Wolf, andH. K. Rudolph. 1998. The medial-Golgi ion pump Pmr1 supplies the yeastsecretory pathway with Ca2� and Mn2� required for glycosylation, sorting,and endoplasmic reticulum-associated protein degradation. Mol. Biol. Cell9:1149–1162.

14. Fadri, M., A. Daquinag, S. Wang, T. Xue, and J. Kunz. 2005. The pleckstrinhomology domain proteins Slm1 and Slm2 are required for actin cytoskele-ton organization in yeast and bind phosphatidylinositol-4,5-bisphosphate andTORC2. Mol. Biol. Cell 16:1883–1900.

15. Gauss, R., M. Trautwein, T. Sommer, and A. Spang. 2005. New modules forthe repeated internal and N-terminal epitope tagging of genes in Saccharo-myces cerevisiae. Yeast (Chichester) 22:1–12.

16. Guldener, U., S. Heck, T. Fielder, J. Beinhauer, and J. H. Hegemann. 1996.A new efficient gene disruption cassette for repeated use in budding yeast.Nucleic Acids Res. 24:2519–2524.

17. Kamada, Y., Y. Fujioka, N. N. Suzuki, F. Inagaki, S. Wullschleger, R.Loewith, M. N. Hall, and Y. Ohsumi. 2005. Tor2 directly phosphorylates theAGC kinase Ypk2 to regulate actin polarization. Mol. Cell. Biol. 25:7239–7248.

18. Katzmann, D. J., S. Sarkar, T. Chu, A. Audhya, and S. D. Emr. 2004.Multivesicular body sorting: ubiquitin ligase Rsp5 is required for the modi-fication and sorting of carboxypeptidase S. Mol. Biol. Cell 15:468–480.

19. Khalfan, W. A., and D. J. Klionsky. 2002. Molecular machinery required forautophagy and the cytoplasm to vacuole targeting (Cvt) pathway in S. cer-evisiae. Curr. Opin. Cell Biol. 14:468–475.

20. Kim, J. E., and J. Chen. 2000. Cytoplasmic-nuclear shuttling of FKBP12-rapamycin-associated protein is involved in rapamycin-sensitive signalingand translation initiation. Proc. Natl. Acad. Sci. USA 97:14340–14345.

21. Kunz, J., U. Schneider, I. Howald, A. Schmidt, and M. N. Hall. 2000. HEATrepeats mediate plasma membrane localization of Tor2p in yeast. J. Biol.Chem. 275:37011–37020.

22. Lee, W. L., J. R. Oberle, and J. A. Cooper. 2003. The role of the lissencephalyprotein Pac1 during nuclear migration in budding yeast. J. Cell Biol. 160:355–364.

23. Lemmon, M. A. 2003. Phosphoinositide recognition domains. Traffic (Co-penhagen) 4:201–213.

24. Li, H., C. K. Tsang, M. Watkins, P. G. Bertram, and X. F. Zheng. 2006.Nutrient regulates Tor1 nuclear localization and association with rDNApromoter. Nature 442:1058–1061.

25. Liu, K., X. Zhang, C. Sumanasekera, R. L. Lester, and R. C. Dickson. 2005.Signalling functions for sphingolipid long-chain bases in Saccharomycescerevisiae. Biochem. Soc. Trans. 33:1170–1173.

26. Liu, X., and X. F. Zheng. 2007. Endoplasmic reticulum and Golgi localiza-tion sequences for mammalian target of rapamycin. Mol. Biol. Cell 18:1073–1082.

27. Loewith, R., E. Jacinto, S. Wullschleger, A. Lorberg, J. L. Crespo, D. Bonen-fant, W. Oppliger, P. Jenoe, and M. N. Hall. 2002. Two TOR complexes, onlyone of which is rapamycin sensitive, have distinct roles in cell growth control.Mol. Cell 10:457–468.

28. Losev, E., C. A. Reinke, J. Jellen, D. E. Strongin, B. J. Bevis, and B. S. Glick.2006. Golgi maturation visualized in living yeast. Nature 441:1002–1006.

29. Luo, G., A. Gruhler, Y. Liu, O. N. Jensen, and R. C. Dickson. 2008. Thesphingolipid long-chain base-Pkh1/2-Ypk1/2 signaling pathway regulateseisosome assembly and turnover. J. Biol. Chem. 283:10433–10444.

30. Mavrakis, M., J. Lippincott-Schwartz, C. A. Stratakis, and I. Bossis. 2007.mTOR kinase and the regulatory subunit of protein kinase A (PRKAR1A)

FIG. 10. TOR1 and TOR2 have distinct localization patterns byconfocal microscopy. The control (TB50), TOR1-3XGFP (VA66), andTOR2-3XGFP strains grown in YPD were imaged by confocal micros-copy (see Materials and Methods). The exposure settings used were asfollows: Tor1, 400 ms GFP and 50% laser intensity; Tor2, 800 ms GFPand 70% laser intensity; and TB50, 800 ms GFP and 70% laser inten-sity.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

spatially and functionally interact during autophagosome maturation. Auto-phagy 3:151–153.

31. Proszynski, T. J., R. W. Klemm, M. Gravert, P. P. Hsu, Y. Gloor, J. Wagner,K. Kozak, H. Grabner, K. Walzer, M. Bagnat, K. Simons, and C. Walch-Solimena. 2005. A genome-wide visual screen reveals a role for sphingolipidsand ergosterol in cell surface delivery in yeast. Proc. Natl. Acad. Sci. USA102:17981–17986.

32. Reinke, A., S. Anderson, J. M. McCaffery, J. Yates III, S. Aronova, S. Chu,S. Fairclough, C. Iverson, K. P. Wedaman, and T. Powers. 2004. TORcomplex 1 includes a novel component, Tco89p (YPL180w), and cooperateswith Ssd1p to maintain cellular integrity in Saccharomyces cerevisiae. J. Biol.Chem. 279:14752–14762.

33. Reinke, A., J. C. Chen, S. Aronova, and T. Powers. 2006. Caffeine targetsTOR complex I and provides evidence for a regulatory link between the FRBand kinase domains of Tor1p. J. Biol. Chem. 281:31616–31626.

34. Saito, K., Y. Araki, K. Kontani, H. Nishina, and T. Katada. 2005. Novel roleof the small GTPase Rheb: its implication in endocytic pathway independentof the activation of mammalian target of rapamycin. J. Biochem. 137:423–430.

35. Schmelzle, T., T. Beck, D. E. Martin, and M. N. Hall. 2004. Activation of theRAS/cyclic AMP pathway suppresses a TOR deficiency in yeast. Mol. Cell.Biol. 24:338–351.

36. Swaminathan, S. 2006. Eisosomes: endocytic portals. Nat. Cell Biol. 8:310.37. Urban, J., A. Soulard, A. Huber, S. Lippman, D. Mukhopadhyay, O. De-

loche, V. Wanke, D. Anrather, G. Ammerer, H. Riezman, J. R. Broach, C. DeVirgilio, M. N. Hall, and R. Loewith. 2007. Sch9 is a major target of TORC1in Saccharomyces cerevisiae. Mol. Cell 26:663–674.

38. Vida, T. A., and S. D. Emr. 1995. A new vital stain for visualizing vacuolarmembrane dynamics and endocytosis in yeast. J. Cell Biol. 128:779–792.

39. Walther, T. C., J. H. Brickner, P. S. Aguilar, S. Bernales, C. Pantoja, and P.Walter. 2006. Eisosomes mark static sites of endocytosis. Nature 439:998–1003.

40. Wedaman, K. P., A. Reinke, S. Anderson, J. Yates III, J. M. McCaffery, andT. Powers. 2003. Tor kinases are in distinct membrane-associated proteincomplexes in Saccharomyces cerevisiae. Mol. Biol. Cell 14:1204–1220.

41. Wullschleger, S., R. Loewith, and M. N. Hall. 2006. TOR signaling in growthand metabolism. Cell 124:471–484.

42. Zhang, X., L. Shu, H. Hosoi, K. G. Murti, and P. J. Houghton. 2002.Predominant nuclear localization of mammalian target of rapamycin in nor-mal and malignant cells in culture. J. Biol. Chem. 277:28127–28134.

43. Zurita-Martinez, S. A., R. Puria, X. Pan, J. D. Boeke, and M. E. Cardenas.2007. Efficient Tor signaling requires a functional class C Vps protein com-plex in Saccharomyces cerevisiae. Genetics 176:2139–2150.


on Septem


.org/D

ownloaded from

http://ec.asm.org/

tor1 and tor2 have distinct locations in live cells · agglutinin-tagged tor1 and tor2 localized to...

Documents