towards a novel electrochemical sensing platform for …€¦ · klebsiella pneumoniae) in a...
TRANSCRIPT
Towards a Novel Electrochemical Sensing Platform for Diagnosing Urinary Tract Infections
by
R. Davis Holmes
A thesis submitted in conformity with the requirementsfor the degree of Master of Applied Science
Institute of Biomaterials and Biomedical EngineeringUniversity of Toronto
© Copyright by R. Davis Holmes 2012
Towards a Novel Electrochemical Sensing Platform for Diagnosing Urinary Tract Infections
R. Davis Holmes
Master of Applied Science
Institute of Biomaterials and Biomedical EngineeringUniversity of Toronto
2012
AbstractUrine culture, the current gold standard for urinary tract infection (UTI) diagnosis, does not produce
results in an acceptable length of time. An ultra-sensitive, cost-effective electrochemical biosensing
platform with nanostructured microelectrodes was designed to address the need for a rapid, point-of-care
(PoC) test that could achieve a sample-to-answer time in less than an hour. Printed circuit boards and
metallized glass slides were processed using various techniques and then tested for their ability to form
nanostructured microelectrodes. Peptide nucleic acid probes for the bacteria and yeast as well as ten
probes for antibiotic resistance genes were designed and synthesized for use with the new platform.
Validation of the sensor's specificity was performed using high concentrations (100nM) of synthetic DNA
oligomers. Furthermore, a clinically relevant sensitivity of 103 cfu/mL was demonstrated by detecting 4
pathogen lysates (Staphylococcus saprophyticus, Pseudomonas aeruginosa, Enterococcus faecalis and
Klebsiella pneumoniae) in a buffered solution.
ii
Acknowledgments
First and foremost I would like to thank my supervisor, Dr. Shana Kelley. While leading an incredibly
busy life of her own, she was always available to discuss matters related to my project. I can not admire
her enough for her unending devotion to creating an academic environment without any limits on creative
thinking. I not only revere her for her knowledge in the field of biosensing, but also for her ability to take
a lab discovery to market. She was an excellent role model and I aspire to walk the path of success that
she has demonstrated is possible.
Thanks are due for my committee members: Dr. Axel Guenther and Dr. Christopher Yip. In addition to
providing support and insightful feedback for my project, they underlined the relevance of my work
outside the area I chose to focus on. This gave me an important boost in self-confidence, which motivated
me throughout my time at the University of Toronto. It was an honour to have such distinguished faculty
members on my committee.
My experience with the Kelley Lab would not have been nearly as exciting without my labmates. Firstly,
thank you to Paul Lee for letting me hop on the quantum dot express when my initial jump into
electrochemistry had a harder than expected landing. Good experimental technique and a zealous attitude
toward research were but a few things that I learned from Paul. Thank you to Brian Lam for letting me
join his project when quantum dots provided as many head scratching moments as biosensing. Finishing
my degree in a timely manner would not have been possible without his support. Thank you to Jagotamoy
Das, the most intelligent electrochemist that I have ever met. Jagotamoy never turned me away when I
beckoned for help to interpret results. Thank you to Andrew Sage and Ludo Ludovic for setting aside their
own projects to help me meet impending deadlines. Thank you to Kristin Cedarquist for being a
bottomless source of support when times were tough in the lab.
I would like to thank my fellow Master students: Justin Beasant, Mario Moscovici, Sean Guo, Rida
Mourtada and Graham Chamberlain. We were all taken aback by the pace at which we needed to perform
in the lab, but I could not imagine a better group of fledgling scientists to help me tackle such adversity.
Justin Beasant was not only my outlet for wayward philosophical thinking about science but also a great
guy to catch a concert with. Mario Moscovici taught me the importance of being organized and not
putting off future plans. Much thanks to Sean Guo who taught me basic biology in the most lucid way
possible and provided an endless source of “life lessons” that I could thankfully learn vicariously. Special
thanks to Rida Mourtada and Graham Chamberlain. Although they worked on projects unrelated to
biosensing, Rida was a formidable opponent on the squash court and Graham added a healthy dose of
humour in every situation that we shared.
iii
Finally, I would like to thank my family for their supportive role. My mom, Laura Holmes, taught me the
value of a strong worth ethic from a young age and gave me the confidence to pursue new interests. My
father, Kenneth Holmes, emphasized the importance of balance in life, which certainly helped me enjoy
the city of Toronto. Thank you to my aunt, Anita North, for steering me in the direction of medicine and
being the most enjoyable housemate that I will ever have. Thank you to my siblings, Adam and Royce
Holmes: my two best friends. I love you all.
iv
Table of Contents
I.Urinary Tract Infections: Causes, Prevalence and a Route to Better Diagnosis............................1Urinary Tract Infections .............................................................................................................1UTI Pathogens.............................................................................................................................2Antibiotic Resistance Trends in UTIs.........................................................................................4Clinical Diagnostic Tests.............................................................................................................6Shortcomings of Current Diagnostics.........................................................................................7State-of-the-Art Diagnostics.......................................................................................................8Nanostructured Electrochemical Sensors ...................................................................................9Project Objectives.....................................................................................................................14
II.Testing the Versatility of NME Fabrication...............................................................................15Introduction...............................................................................................................................15
Printed Circuit Boards..........................................................................................................15Copper Corrosion.................................................................................................................16
Results.......................................................................................................................................18Noble Metal Barriers for Corrosion Resistance...................................................................18Modified NME Electroplating Baths....................................................................................23Photolithography with Glass Slides......................................................................................26
Discussion.................................................................................................................................29Methods.....................................................................................................................................32
Materials ..............................................................................................................................32Glass Chip Fabrication.........................................................................................................32Gold Corrosion Barrier.........................................................................................................33Pd Corrosion Barrier.............................................................................................................33HAuCl4 With Various Supporting Electrolytes ...................................................................34Gold-on-Glass/Chromium-on-Glass Platform......................................................................35
III.Towards a Multiplexed System for UTI Diagnosis and Resistance Profiling..........................36Introduction...............................................................................................................................36
Probe Design and Synthesis.................................................................................................36Probe Validation...................................................................................................................37
Results.......................................................................................................................................37Probe Validation with Synthetic Targets...............................................................................37Probe Validation with Pathogen Lysate ...............................................................................40
Discussion.................................................................................................................................44Methods.....................................................................................................................................46
Materials...............................................................................................................................46Species Probe Design...........................................................................................................47Probe Synthesis....................................................................................................................51Probe Solubility....................................................................................................................54Probe Validation with Synthetic Target................................................................................54Probe Validation with Pathogen Lysate...............................................................................56
IV.References.................................................................................................................................59V.Appendix....................................................................................................................................66
Antibiotic Resistance Genes.................................................................................................66Peptide Synthesis Protocols..................................................................................................67
v
List of Tables
Table 1: Bacterial demographic in different patient populations.....................................................4Table 2: Percentage of UTI pathogens with given antimicrobial resistance....................................5Table 3: Overview of performance characteristics of current diagnostic methods for UTIs...........8Table 4: PCB material combinations and plating methods surveyed in finding new platform.....16Table 5: Probe design property cut-offs ........................................................................................49Table 6: Species-specific PNA probe sequences...........................................................................50Table 7: Antibiotic resistance probe sequences.............................................................................51Table 8: HPLC solvent gradient profile for PNA probe purification.............................................53Table 9: Program report for swell coupling step of PNA synthesis...............................................67Table 10: Program report for single coupling step of PNA synthesis............................................68
vi
List of Figures
Figure 1: Stages of urinary infection leading to urosepsis caused by E coli. .................................2Figure 2: Relative number of UTIs in hospitalized patients in the Calgary Health Region ...........3Figure 3: CHROMagar orientation plate ........................................................................................6Figure 4: First generation 8 electrode biosensor ...........................................................................10Figure 5: Effect of probe molecule on background signal before hybridization with target ........12Figure 6: Sensor response using 3 differently structured microelectrodes and illustration of gold-on-silicon multiplexability.............................................................................................................13Figure 7: Cross-section of a PCB displaying the 4 major layers...................................................15Figure 8: Corrosion of pure copper PCB.......................................................................................17Figure 9: Corrosion of electroless nickel immersion gold finished PCB......................................18Figure 10: Characterization of PCB with gold corrosion barrier...................................................20Figure 11: Galvanic displacement of palladium corrosion barrier.................................................21Figure 12: Characterization of PCB with palladium corrosion barrier..........................................23Figure 13: Corrosion testing PCB exposed to HAuCl4 in various supporting electrolytes...........24Figure 14: NMEs formed under different applied potentials with basic HAuCl4..........................25Figure 15: SEM images of NME deposited from basic HAuCl4...................................................25Figure 16: Gold-on-glass sensor with 20 electrodes divided into 4 groups of 5...........................26Figure 17: Characterization of NMEs deposited in apertures of the gold-on-glass platform. ......27Figure 18: NMEs electrodeposited on Cr-coated glass slides........................................................28Figure 19: Pore corrosion model of ENIG finished PCB..............................................................30Figure 20: Effect of electroplating in low aspect ratio apertures...................................................31Figure 21: SEM images of Au NMEs electrodeposited from 50mM HAuCl4 + 0.5M HCl ..........37Figure 22: Top and side views of a gold-on-glass biosensor.........................................................38Figure 23: Sample differential pulse voltammograms for testing probe PP140............................38Figure 24: Change in reduction current due to target hybridization reported for each species-specific probe. ...............................................................................................................................39Figure 25: Change in reduction current due to target hybridization reported for each antibiotic resistance probe .............................................................................................................................40Figure 26: SEM images of 3 NMEs electrodeposited in gold-on-glass apertures.........................41Figure 27: Sample differential pulse voltammogram of gold-on-glass platform..........................41Figure 28: Pathogen detection results using the gold-on-glass platform.......................................42Figure 29: Agarose gels qualitatively confirming mechanical lysis..............................................43Figure 30: Workflow for compiling a list of potential probes.......................................................48Figure 31: Example of a chromatography column following an unsuccessful cleavage...............52Figure 32: Probe validation workflow ..........................................................................................55
vii
I. Urinary Tract Infections: Causes, Prevalence and a Route to Better Diagnosis
Urinary Tract Infections Background and Prevalence. In 2000, a total of 8 million adults in the US were diagnosed with a
urinary tract infection (UTI) and the associated health care costs were $3.5 billion. A lower urinary tract
infection, referred to as cystitis, is an infection of the bladder. Urinary tract infections are divided into 2
categories: complicated and uncomplicated.
An uncomplicated UTI is the infection that a typical individual acquires. . A patient is diagnosed with
uncomplicated cystitis if their midstream urine specimen has between 103 to 105 colony forming units
(cfu)/mL [1], [2]. Symptoms manifest as discomfort during urination, an increase in frequency and/or
urgency to urinate, suprapubic tenderness, and fever. If left untreated, cystitis leads to pyelonephritis as
the bacteria ascend the ureters and reach the renal pelvis of the kidneys. Fast and effective treatment of
UTIs is important for ensuring that a bladder infection does not evolve into a kidney infection, which can
result in permanent kidney damage.
Complicated UTIs are those that occur due to an underlying functional or anatomical abnormality (e.g.
immunocompromised patients), the presence of instrumentation within the body (e.g. a catheter) or in
pregnant women or the elderly. Complicated UTIs have the same diagnostic criteria as uncomplicated
UTIs. Recurrent infection by pathogens with increased resistance is a troubling consequence of
complicated UTIs [3]. Interestingly, UTIs are such a rare occurrence in the young male population that
male UTIs are almost always considered complicated. However, the elderly, institutionalized
(uncatheterized) male population has uncomplicated UTI prevalence rates varying from 19% to 37% [3].
Catheter-assisted urinary tract infections are another form of complicated UTI that can be more
aggressive than uncomplicated UTIs because of the frequent invasion of biofilm-forming bacteria.
Between 15% and 25% of hospital patients may receive a short-term indwelling catheter and
approximately 5% of residents in long-term care facilities in the US have long-term indwelling catheters
[4], [5]. Up to 23% of short-term catheterized patients and 100% of long-term catheterized patients will
have urine specimens that are culture positive [6].
1
Pathogenesis. The pathogenesis of urinary tract infections is straightforward and is described in Figure
1. Bacteria or yeast typically enter the urethra as a result of uncleanliness or by the assistance of a catheter
(step 1). Pathogens that express specific genes that allow them to colonize the bladder then adhere to
uroepithelial tissue (step 2). The pathogens invade the epithelial tissue and even epithelial cells inducing
apoptosis and exfoliation of bladder epithelium (steps 3 and 4). At this point, patients can experience UTI
symptoms and visit a physician. More often in catheter-assisted UTIs, pathogens can ascend the ureters
and infiltrate the kidneys (steps 7 and 8) and cause a kidney infection. Community-acquired sepsis due to
an untreated urinary tract infection is only seen in individuals that are immunocompromised, have
structural abnormalities or a preexisting renal disease [7]. However, urosepsis constitutes nearly one-
quarter of all cases of sepsis [8]. In these scenarios, the pathogen invades the bloodstream through the
one-cell-thick proximal tubule of kidney nephrons to enter the bloodstream [9].
UTI PathogensCharacteristics of UTI Pathogens. The overwhelming majority of uncomplicated UTIs are caused
by members of the Enterobacteriaceae family with ~75% of occurrences associated with Uropathogenic
Escherichia coli (UPEC) [10]. UPEC has a genome that is 300-400kb larger than the innocuous E coli K-
2
Figure 1: Stages of urinary infection leading to urosepsis caused by E coli. Illustration taken from [9].
12 largely due to genetic elements known as pathogenicity islands [11]. Pathogenicity islands are gene
clusters that code for virulence factors that help the pathogen defeat the host immune system. For
example, UPEC produces aerobactin, α-hemolysin and cytotoxic necrotizing factor I, which help
sequester iron, obtain nutrients from host cells and kill host cells, respectively. Gram-positive species
occur in 30 to 40% of complicated UTI isolates and display a range of unique virulence factors [12]. They
are more commonly seen in catheterized patients as they can secrete factors that form a protective biofilm
(e.g. S epidermidis produces PIA antigen biofilms). Fungal UTIs are not commonly diagnosed in the
otherwise healthy patient population. However, a notably large proportion of fungal UTIs are found in
hospitalized patients, especially in the intensive care unit where bladder catheters are heavily used.
Species Prevalence Based on Subpopulation. Subpopulations of UTI patients have very different
pathogen prevalence rates, which underlines the importance of diagnostic systems that are multiplexed.
The normal patient population representing community-acquired UTIs have a pathogen demographic
represented by Figure 2. E coli, K pneumoniae and Enterococcus spp represent 74.2%, 6.2%% and 5.3%,
respectively.
Table 1 illustrates 3 different patient subpopulations and the diversity of the pathogens isolated from urine
3
Figure 2: Relative number of UTIs in hospitalized patients in the Calgary Health Region during 2004-2005 attributed to various bacterial species [68].
Escherichia coliKlebsiella pneumoniaeEnterococcus speciesStreptococcus agalactiaeProteus mirabilisStaphylococcus saprophyticusViridans streptococcusKlebsiella oxytocaPseudomonas aeruginosaOther
cultures. Unlike the normal population, the catheterized female subpopulation is very prone to multi-
pathogen UTIs, where UPEC (39%) is the third most common isolate following Providencia spp (58%)
and Proteus mirabilis (55%). For reasons based on differences of anatomy, UTIs are much less prevalent
among men. However, elderly men in long term care facilities acquire UTIs and they are far more
commonly caused by Proteus mirabilis, Providencia spp and Pseudomonas aeruginosa.
Organism Chronic Catheterized
Women
HospitalizedPatients
Institutionalized Men
PregnantWomen
[13]
Escherichia coli 39 35 15 75-90
Klebsiella pneumoniae 21 15 8.2 < 5
Proteus mirabilis 55 7.5 42 < 5
Providencia spp 58 - 22 -
Pseudomonas aeruginosa 32 12 27 -
Other Gram-negative organisms
39 24 9.4 -
Enterococcus spp Not Sig. 1.1 7.1 -
Group B Streptococcus Not Sig. 1.1 2.4 < 5
Coagulase-negative Staphylococci
Not Sig. 1.1 2.4 -
Other Gram-positive organisms
39 0.6 3.5 -
Table 1: Bacteria demographic in different patient populations. Other gram-negative species include, Citrobacter spp, Enterobacter spp, Morganella morganii, Serratia marcescens, and nonfermenters other than Pseudomonas aeruginosa. Note: Staphylococcus aureus is coagulase positive [3].
Fungal UTIs are not as well-documented as bacterial UTIs. The prevalence rate varies significantly with
the patient population from 11% among leukemia patients to 26.5% among catheterized patients [14],
[15]. More recent estimates find 10-15% of nosocomial UTIs to be caused by Candida spp [16].
Antibiotic Resistance Trends in UTIsApproximately 15% of community-prescribed antibiotics are for the treatment UTIs [17]. Antibiotic
resistance among uropathogens has been under increased surveillance for the last decade. Antibiotic-
susceptibility testing is recommended for patients with atypical symptoms, with symptoms that are not
resolved within 2-4 weeks or symptoms of pyelonephritis [18]. Empiric therapy performed before
4
antibiotic susceptibility results are available take into account (1) spectrum and geographic susceptibility
patterns (if available), (2) tolerability, (3) adverse effects, (4) costs and (5) antibiotic availability. The only
component of empiric therapy that carries any sort of antibiotic targeting information is geographic
susceptibility patterns. Depending on the type (uncomplicated vs. uncomplicated cystitis) and severity
(cystitis vs. pyelonephritis), more than 7 different classes of drugs (e.g. Trimethoprim, beta-lactams,
cephalosporins, fluoroquinolones, nitrofurantoin, fosfomycin) could be prescribed [18], [19].
Antibiotic resistance among uropathogens is increasing and the use of ineffective treatments deserves part
of the blame. Between 1992 and 1996, E coli isolates showed an increase in resistance from 9% to 18% in
women with acute uncomplicated cystitis [20]. An international study of antibiotic resistance among
uropathogens in 17 countries was performed in 2003 and the resistance profiles for the most common
uropathogens encountered are provided in Table 2 [21].
Ampicillin was once the first line of therapy for UTIs; however, rates of resistance of nearly 30% have
removed it from use. Trimethoprim and sulphamethoxazole also displayed unusually high rates of
resistance, which is why current guidelines more strongly urge the use of nitrofurantoin and fosfomycin
as first lines of therapy. Despite being in use for many decades, nitrofurantoin and fosfomycin still only
have resistance rates of approximately 1% in E coli isolates.
Issues arise if effective antimicrobials agents against E coli, such as nitrofurantoin, are prescribed as they
often are. For example, other uropathogens have an intrinsic resistance to nitrofurantoin such as P
mirabilis and Klebsiella spp. UTI-causing S saprophyticus have an intrinsic resistance to fosfomycin,
another effective antibiotic for E coli; however, it has been found that they are susceptible ampicillin [21].
5
Antimicrobial Agents
Pathogen AMP TMP SUL NIT FOF GEN
E coli 29.8 14.8 29.1 1.2 0.7 1.0
P mirabilis 16.1 25.5 19.3 100 3.1 1.6
Klebsiella spp. 83.5 12.4 21.6 100 56.7 0
Other Enterobacteriaceae 45.9 9 9 40.2 15.6 0.8
S saprophyticus 1.7 0 3.4 0 100 4.3
Table 2: Percent of UTI pathogens with given antimicrobial resistance (data taken from [21]).AMP = ampicillin, TMP = Trimethoprim, SUL = sulphamethoxazole, NIT = nitrofurantoin, FOF = fosfomycin, GEN = gentamycin.
Undeniably, treatment of patients would improve if physicians could know the identity and antibiotic
resistance profile of pathogens infecting their patients before declaring a treatment method.
Clinical Diagnostic TestsDipstick Test and Urine Culture. Urinalysis involves a combination of a dipstick test and urine
culture [22]. The dipstick assay was first developed in the 1920s to assess for the presence nitrites, which
are present as a result of bacterial growth [23]. Dipstick tests have advanced into multiplexed sample
analysis strips with 10 readouts capable of characterizing: (1) specific gravity, (2) pH, (3) nitrites, (4)
leukocyte, (5) protein, (6) glucose, (7) urobilirubin, (8) bilirubin, (9) ketones and (10) erythrocytes [24].
The two tests on a dipstick with the most positive predictive value for UTI are the nitrite and leukocyte
tests [25]. Nitrate-reducing bacteria reduce nitrates naturally found in urine to nitrites, which are then
detected via a colorimetric reaction. A positive nitrite dipstick test is indicative of bacterial levels that are
>10,000cfu/mL. This test is inherently insensitive to UTI infections caused by non-nitrate reducing
bacteria [22]. The leukocyte test is a semi-quantitative test that
indicates increasing levels of leukocyte esterase, which is
released by neutrophils in urine that are lysed as a result of
fighting infections [26].
Culturing bacteria for the purpose of species identification and
antibiotic-susceptibility testing remains the gold standard for
UTI diagnosis. Microscope identification of bacterial strains is
performed after culturing the bacteria on trypticase soy agar
with defibrinated sheep blood, MacConkey agar or Mueller-
Hinton agar. A chromogenic agar, called CHROMagar
Orientation (CHROMagar Company), is available that changes
colour (see Figure 3) based on the bacterial species that grow to
simplify identification [27]. The following is a list of species
that can be correctly identified using CHROMagar Orientation:
E coli, K pneumoniae, C freundii, Enterobacter spp, P mirabilis, M morganii, P aeruginosa,
Acinetobacter spp, Enterococcus spp, Streptococcus spp, Staphylococcus spp, Lactobacillus spp,
Corynebacterium spp, Candida spp, Torulopsis glabrata. However, Klebsiella, Enterobacter and
6
Figure 3: CHROMagar orientation plate displaying change in medium colour for different bacteria: (1) P mirabilis (2) E faecalis (3) K pneumoniae (4) P aeruginosa (5) E coli (6) S aureus.
Citrobacter spp cannot be differentiated due to their similarity in color, which is the result of genus
relatedness.
Fluorescence-Activated Cell Sorting. Flow cytometry has been used to screen urine samples to
reduce the number of samples sent for urine culture. The UF-1000i (Biomérieux Inc.) uses 5 proprietary
reagents to stain for erythrocytes, leukocytes, epithelial cells, casts and bacterial nucleic acids. One
hospital microbiology laboratory has reduced its load of urine cultures by 43% using the UF-1000i with
optimized screening thresholds [28]. Kadkhoda et al. [29] optimized thresholds so that 35% of urine
specimens would not have been needlessly cultured, while 99.2% of gram-negative and 85% of gram-
positive bacteria would been appropriately cultured.
Molecular Diagnostics. Polymerase-chain reaction (PCR) is one of the most sensitive methods of
detecting pathogenic bacteria in human samples. PCR-based assays amplify a specific region of DNA
(e.g. 16S rDNA) using a heat-stable DNA polymerase and characterize the amplified region by restriction
enzyme digestion (e.g. restriction fragment length polymorphism mapping) or sequencing. PCR
performed with urine samples does not display the sensitivity of urine culture [30]. PCR had a sensitivity
of 95% for single pathogen UTIs while only a 57% sensitivity for multi-pathogen UTIs [30]. SeptiFast is
a commercially available real-time PCR blood pathogen test but it has not been applied to urine samples.
In a study using the SeptiFast and clinical isolates, 61 of 67 positive samples were correctly identified
[31].
Shortcomings of Current DiagnosticsUrine culture and PCR are the most sensitive diagnostic methods. For UTIs, PCR offers a sufficient
turnaround time; however, it requires expensive enzymes, equipment and highly skilled technicians. In
addition, PCR requires stringent nucleic acid purification steps from uncultured samples. PCR assays are
susceptible to false-negative results due to DNA polymerase inhibitors that are not removed during
sample purification.
Urine culture and serotyping for the identification of bacterial species and antibiotic susceptibility testing
have turnaround times on the order of days, which is too long to wait before commencing treatment. The
administration of ineffective antimicrobial agents is the leading cause of increased antibiotic resistance in
UTI bacteria.
7
Dipstick tests are extremely cheap and simple to perform; the process has even become automated with
dipstick readers. However, dipsticks tests do not have the required sensitivity for more stringent diagnosis
guidelines (103 cfu/mL), nor do they provide the specificity for diagnosing non-nitrate reducing bacteria
species. The leukocyte esterase test has high negative predictive value; however, pyuria can be caused by
other sources of inflammation other than an infection. As well, the leukocyte esterase content of a urine
specimen gives no indication of pathogen identity.
While flow cytometers have an unparalleled throughput, they do not provide bacterial identification,
which is needed to make antibiotic treatments targeted. The performance of current diagnostic methods is
summarized in Table 3.
Methods Sensitivity Specificity Time Skilled Technician
Costper test
Multiplexed
Urine culture 1 cfu/mL All species 24-48h yes <$1 yes
Dipstick 104 cfu/mL [22] Nitrate-reducing species
<1h no $0.27 [32] yes
Real time PCR 10 cfu/mL [31] All species 4-5h yes $8.20 [33] 5 to 15 [31]
Flow cytometry <105 cfu/mL [34] Bacteria vs. No bacteria
<1min yes <$1 [35] no
Table 3: Overview of performance characteristics of current diagnostic methods for urinary tract infections.
State-of-the-Art DiagnosticsImmunoassays. Immunoassays for the detection of bacteria are more commonly reported for food
samples rather than human samples. Enzyme-based immunoassays, such as ELISA, have many different
formats but generally rely on an antibody specific for the targeted bacteria conjugated with an enzyme
(e.g. horseradish peroxidase or alkaline phosphatase) capable of generating a luminescent signal when
presented with its substrate and a light-generating molecule. Ultimately, optical readout is used to
quantify the number of bacteria present in the sample. Unfortunately, whole cell ELISA only affords
identification based on binding to cell surface antigens, which can be quite variable within a species. For
example, antibodies for E coli target the lipopolysaccharide (O antigen) and/or flagella (H antigen), which
8
place the E coli into a specific serogroup (e.g. E coli O157:H7). However, 75% of UPEC strains are
spread over 6 O serogroups making a universal UPEC cocktail difficult to generate. Banada et al. [36]
present a thorough overview of immunoassays for bacterial pathogens. Commercial immunoassays with
colorimetric readout exist for 2 UTI species (E coli and S aureus); however, limits of detection of 105
cfu/mL remain too high to be used for UTI diagnosis. An attractive alternative to ELISA kits come in the
form of lateral flow assays for bacteria. Results can be visualized in 5 to 10 minutes; however, sensitivity
is still limited to 107 – 109 cells, which is far fewer than the 103 – 104 available in real urine samples [37].
More sophisticated detection techniques that make use of antibodies as recognition elements for bacteria
include surface plasmon resonance sensors, quartz microbalance sensors, and protein microarrays.
Surface plasmon resonance sensors are a label-free approach to sensing but share sensitivities with ELISA
(105 to 108cfu/mL). Antibody microarrays can be thought of as highly multiplexed ELISA plate. However,
the real multiplex-ability is limited by antibody cross-reactivity (false-positives) or hyper-specificity
(false-negatives). Lathrop et al. [38] describe the high rate of cross-reactivity when producing antibodies
against L monocytogenes-specific peptides.
Electrochemical Assays. Electrochemical sensors for UTI diagnosis are still relegated to academia.
Bacterial identification has been performed using an electrochemical chip-based assay targeting the 16S
rRNA of lysed bacteria in patient samples [39]. This system achieved a sensitivity of 104cfu/mL, which
meets the clinical guidelines of 105 cfu/mL, but would fail by the stricter guideline of 103cfu/mL. Pan et
al. [40] designed a sandwich amperometric immunoassay to detect lactoferrin, a putative biomarker for
host immune response. Lactoferrin is an 80kDa iron-binding protein secreted by white blood cells and
provides a measure of infection severity. The array had a limit-of-detection of 145pg/mL with a dynamic
range of 3 orders of magnitude, which is suitable for detection in clinical samples since lactoferrin is in
relatively high concentrations for most patients with pyuria (>10ng/mL). However, the sensor's ability to
identify bacterial species was again limited to 104cfu/mL and while lactoferrin provides clinically useful
information, detection of lactoferrin is not a direct indicator of a urinary tract infection. Electrochemical
sensors that provide sensitive species-specific detection of pathogens in urine samples are in urgent need.
Nanostructured Electrochemical Sensors Nanostructured electrochemical sensors provide a host of solutions to the many problems that plague
other assays. Affordable readout equipment, portability, and most importantly sensitivity are clear
9
advantages that nanostructured electrochemical sensors have over other assay types.
Detecting native levels of nucleic acid targets requires signal amplification. Many different methods have
been used to accomplish this with electrochemical sensors by using gold nanoparticles [41], PNA/LNA
molecular recognition [42], nanostructured electrodes [43], enzymatic amplification [44], and
electrocatalysis [45]. The nucleic acid assay developed in the Kelley Group uses nanostructured
microelectrodes, PNA and electrocatalysis to achieve the sensitivity and specificity required to work with
clinical samples.
A schematic of the Kelley Group's nucleic acid assay and the gold-on-silicon platform are shown in
Figure 4. A gold nanostructured microelectrode (NME) is electroplated into small, circular apertures
(5μm) in the biosensor surface (step 1). Next, the gold surface is functionalized with a probe molecule
(e.g. DNA or PNA) and a blocking compound (e.g. mercaptohexanol) via thiol-gold chemistry (step 2a).
Differential pulse voltammetry (DPV) is used to measure the current due to the reduction of ruthenium
hexaamine (Ru(NH3)63+), which adsorbs to the probe layer on the sensor's surface (step 2b).
Ru(NH3)63+ is a groove-binding coordination complex that interacts with the charged DNA/RNA
backbone via ionic attraction. After target nucleic acids are incubated with the sensor and sufficient time
is allowed for hybridization (step 3a), another electrochemical measurement is performed (step 3b). Due
to the increased negative charge at the electrode surface following target hybridization, there is an
10
Figure 4: A rendering of the first generation 8 electrode biosensor (far left). Nanostructured electrodes are electroplated (step 1), followed by deposition of a probe molecule (step 2a). A baseline electrochemical measurement using the Ru(NH3)6
3+/Fe(CN)63- reporter system is made (step 2b), followed by the
incubation of the biosensor with target molecules (step 3a). Another electrochemical measurement of each sensor is made after probe-target duplexes have formed on the sensor's surface (step 3b).
Step 1
Electroplating
Step 2
a. Probe Deposition
b. Electrochemical Measurement
Step 3
a. Target Hybridization
b. Electrochemical Measurement
increased number of adsorbed Ru(NH3)63+ molecules and a subsequently larger reduction current. The
change in peak current is how nucleic acid detection is performed.
Ferricyanide (Fe(CN)63-) in solution with Ru(NH3)6
3+ acts as a pseudo-catalyst in order to increase the
current produced by adsorbed Ru(NH3)63+. This is accomplished via the following coupled reactions,
Ru(NH3)63+ + e- Ru(NH3)6
2+ Eq. i
Fe(CN)63- + Ru(NH3)6
2+ Fe(CN)62- + Ru(NH3)6
3+ Eq. ii
In order to only measure the reduction current of Ru(NH3)63+ adsorbed to DNA/RNA at the electrode
surface and not electroactive species (e.g. Fe(CN)63-) diffusing to the electrode surface, a low
concentration of Ru(NH3)63+ is required. Ru(NH3)6
3+ has a reduction potential of -0.19V (vs. Ag/AgCl),
which is seen as a peak in the voltammogram. Fe(CN)63- has a reduction potential of +0.25V (vs.
Ag/AgCl) and therefore spontaneously oxidizes Ru(NH3)2+ as illustrated by Eq. ii. This chemical reaction
regenerates Ru(NH3)3+ so that it can once again be reduced at the electrode, which amplifies the reduction
current of Ru(NH3)63+.
In order to see a significant change in the peak current from a small number of probe-target hybridization
events, a low reduction current is needed with the first measurement. PNA probe molecules enable one to
achieve better sensitivity than DNA since DNA carries a negative charge proportional to its length while
PNA is naturally uncharged. Thus, the initial current reading before probe hybridization is much lower
when PNA probe is used instead of DNA as illustrated in Figure 5.
11
The length scale of electrode surface structures has been found to have a significant effect on detection
sensitivity. Soleynami et al. [43] demonstrated that palladium electrodes electrodeposited on the Kelley
Group's platform under three different conditions yielded sensors with three non-overlapping dynamic
ranges covering six to seven orders of magnitude as illustrated in Figure 6a.
12
Figure 5: Effect of probe molecule on background signal before hybridization with target nucleic acid. (Left) PNA probe molecule (two negative charges introduced) attracts a few ruthenium hexaamine ions (red circules) yielding a small reduction current using differential pulse voltammetry. (Right) The charged backbone of DNA probe molecules attracts many ruthenium hexaamine ions and produces a larger reduction current.
SiO2
Au SiO2
S-
-
S-
-
S-
-
S
-
-S
-
-3+
3+3+
3+ 3+
3+ 3+3+
3+
3+
3+
3+3+
3+ 3+
3+ 3+3+
3+
3+
S-
-
----
-3+
3+3+
3+3+
3+
3+
SiO2
Au SiO2
S-
-
-----
3+3+
3+3+
3+3+
3+
S-
-
-----
3+3+
3+3+
3+3+
3+S
-
-
-----
3+3+
3+3+
3+3+
3+
S----
3+
3+3+3+
3+
3+
V
I
V
I
The platform displayed in Figure 4 was challenged with clinical samples taken from patients with prostate
cancer. Three different genotypes were discriminated in order to demonstrate the system's ability to be
multiplexed and provide clinically relevant information (see Figure 6b). The limit-of-detection was found
to be 10ng of purified RNA from a tissue biopsy.
Most recently, a new biosensor layout with more electrodes and integrated electrodes for electrical lysis,
was used in the detection of bacteria that commonly cause UTIs: E coli and S saprophyticus. Previous
work illustrated the importance of using large electrodes in order to accumulate large targets in a
reasonable length of time [46]. Therefore, large (100μm) highly nanostructured electrodes were formed
by electroplating a scaffold of Au and nanostructuring the surface with palladium. This seminal work by
the Kelley Group demonstrated two impressive features of this assay: (1) detection of 103 cfu/mL and 105
cfu/mL of bacteria in a complex matrix (i.e. urine), and (2) a sample-to-answer time with unamplified
target molecules in under 30 minutes.
13
Figure 6: (a) Sensor response using 3 differently structured microelectrodes displaying non-overlapping dynamic ranges varying over 6 to 7 orders of magnitude. Plot taken from [43]. (b) Multiplexed discrimination of Type I, III and IV gene fusions in prostate cancer patient samples and prostate cancer cell lines (DU145, VCaP, NCI-H660). Chart taken from [85].
(a) (b)
Project ObjectivesPoint-of-care diagnostic devices aim to reduce reliance on centralized testing, shorten assay turnaround
times, minimize the technical training required to perform tests and remain relatively inexpensive. The
requirement that a UTI diagnostic assay be affordable is emphasized by the fact that 30% of samples sent
to a clinical laboratory are urine [47]. The Kelley Group has developed a biosensing platform with the
detection sensitivity and specificity needed for the direct identification of UTI bacteria using a silicon-
based chip with an electrochemical readout. The current commercial cost of the gold-on-silicon platform
with 20 leads is ~$50 ($5000 per wafer with 100 chips per wafer). This is likely too expensive to be used
for UTI diagnosis. The same 20 lead chip, if it could be commercially manufactured using traditional
printed circuit boards (PCBs) or gold-coated glass slides, would cost approximately $1.
A chip-based assay to identify bacterial species as well as resistance genes would require massive
multiplexing to be comprehensive. A massively multiplexed chip architecture has not been designed and
will require many rounds of prototyping. Silicon chip manufacturers take 3 to 6 months to deliver new
architectures, which is a prohibitive length of time for prototyping. Using cheaper materials would not
only provide cost savings, but it also would allow new architectures to be tested with a turnaround time of
1 to 2 weeks. The objectives of this project are to (1) test different material platforms for their
applicability as biosensors using the Ru(NH3)63+/Fe(CN)6
3- reporter system, (2) design probe sequences to
discriminate 20 bacterial species that are reported to cause UTIs and 10 antibiotic resistance genes, (3)
synthesize and validate probes using the new platform, and (4) demonstrate detection on the new platform
using bacterial lysate.
14
II. Testing the Versatility of NME Fabrication
Introduction
Printed Circuit Boards
More cost-effective substrates and conductive surfaces as well as simple methods for patterning apertures
in an electrically insulating material were investigated to mimic the design of the gold-on-silicon
platform. Affordable rapid prototyping methods are available for producing conductive surfaces useful for
biosensing. Perhaps the most widely used and inexpensive method for patterning materials is screen
printing. Screen printing is a process used to apply dyes to clothing and the insulating soldermask to
printed circuit boards. Printed circuit boards (PCBs) are the platforms used to build dense electrical
circuits. From a biosensing perspective, they are versatile conductive surfaces that can be processed to
form electrodes for electrochemical sensors. A finished PCB consists of 4 major layers as shown in Figure
7: a substrate layer (e.g. FR-4, polyimide, teflon), a copper layer, a metallic surface finish layer and a
dielectric layer (e.g. soldermask). The dielectric is most commonly a photoimageable polymer, which
allows the selective removal of dielectric material to expose areas of the underlying conductor. The
exposed areas can be used to make electrical connections as well as small openings to electroplate NMEs
for biosensing.
Various PCB material combinations were tested in large part to determine if electroless
deposition/corrosion of PCBs using typical NME fabrication methods could be avoided. A listing of the
combinations tested is described in Table 4.
15
Figure 7: Cross-section of a PCB displaying the 4 major layers: (1) substrate, (2) copper, (3) surface finish and (4) dielectric (soldermask).
CuSurface Finish
Dielectric Dielectric
Substrate
# Substrate Base metal Surface finish Fill NME
1 FR-4 Cu ENIG Na3Au(SO3)2 HAuCl4a
2 FR-4 Cu ENIG Ni HAuCl4a
3 FR-4 Cu None Ni HAuCl4a
4 FR-4 Cu ENIG AgNO3 AgNO3b
5 FR-4 Cu None None HAuCl4b
6 Polyimide Cu ENIG Pd(NH3)4Cl2 HAuCl4a
7 Polyimide Cu ENIG Pd(NH3)4Cl2 Pd(NH3)4Cl2a
a electroplatedb electrolessly plated
Table 4: PCB material combinations and plating methods surveyed in finding new platform.
NME formation on the various platforms was characterized in 2 main aspects:
shape/morphology/structuring and electrochemical behaviour. The morphology of electrodes
electrodeposited on PCBs was studied using scanning electron microscopy (SEM) but more often using
optical microscopy. Electrochemical properties were investigated using cyclic voltammetry with
commonly used compounds: ferrocyanide (Fe(CN)64-), ruthenium hexamine (Ru(NH3)6
3+) and sulphuric
acid (H2SO4). A necessary aim of testing various materials and preparative conditions was to obtain a pure
gold deposit with no competing electrochemical processes occurring within the potential window of
+0.1V and -0.3V as well as an overall branched hemispherical structure similar to that obtained with the
gold-on-silicon platform.
Copper Corrosion
Copper, as the base material of printed circuit boards, requires additional metal coatings to improve
solderability and resistance to corrosion due to moisture. Ordinarily, NMEs are electrodeposited from a
solution of HAuCl4 in HCl. When transferred to the PCB platform, a dark, irregularly shaped deposit
forms in under one minute as seen in Figure 8.
16
This result could be predicted given the electrochemical potential of the likely half-cell reactions:
Cu2+ + 2e- Cu(s) (Eo = +0.34V vs NHE) Eq. iii
AuCl4- + 3e- Au(s) + 4Cl- (Eo = +1.0V vs NHE) Eq. iv
Similar corrosive attack was observed with H2PdCl4 in HClO4, an electroplating solution used for
nanostructuring [46]. Two general approaches were attempted to overcome the corrosive attack of the
underlying copper: (1) passivate copper with a noble metallic barrier, and (2) alter the electroplating
solution composition to one that uses a more stable metal salt. Instead of relying completely on the PCB
platform for future work, photolithography processing of gold-coated glass slides was investigated as
well. Feature sizes were kept as large as possible so that the lithography could be performed outside a
cleanroom, akin to PCB manufacturing.
17
Figure 8: (a) Optical microscope image of a pure copper surface at the bottom of an aperture in a PCB. (b) Galvanic displacement of copper surface by 50mM HAuCl4
after 1 minute of incubation visualized with light microscopy (50x). Apertures are approximately 65μm.
(a) (b)
Results
Noble Metal Barriers for Corrosion Resistance
Various barrier metals were deposited to separate the copper layer and the electroplating solution: (1)
electroless Ni immersion gold (ENIG), (2) ENIG followed by electroplating with gold sulphite bath, and
(3) ENIG followed by electroplating with a palladium bath.
Electroless Nickel Immersion Gold Corrosion Barrier. Attack of the metallic surfaces at the
bottom of apertures was not inhibited by an ENIG finished PCB as evidenced by Figure 9. Consistent,
dark cracked deposits formed very quickly upon submerging an aperture in 20mM HAuCl4 + 0.5M HCl.
To rule out the possibility of corrosion due to HCl, HAuCl4 was removed from the electroplating solution
and no corrosion of the ENIG PCB was observed. An ENIG finish provides a thick layer of Ni (~3-6μm)
but only a vary thin layer of gold (<100nm) [48]. Ni is also a non-noble metal (Eo = -0.25 vs. NHE) and
susceptible to attack by HAuCl4. Two plausible explanations of this result are: (1) the Ni barrier was not
thick enough to prevent solution access to the underlying Cu, or (2) the immersion gold layer was too thin
to prevent solution access to Ni. Therefore attempts were made to increase the thickness of the barrier
18
Figure 9: (a) Optical microscope image of 65μm PCB aperture with an ENIG surface finish. (b) ENIG finished surface after being introduced to 20mM HAuCl4 + 0.5M HCl for 5 minutes.
(a) (b)
Bond pads
Groups of 5 apertures
between the non-noble metals (Cu and Ni) by depositing a thick gold layer using gold sulphite
electroplating chemistry.
Gold Corrosion Barrier. Gold sulphite (Au(SO3)23-) has a lower reduction potential and slower
deposition kinetics compared to HauCl4, which resulted in longer plating times. Figure 10 demonstrates
the result of depositing a layer of Au(SO3)23- for 120 minutes with an applied potential of -450mV
followed by NME growth using chronoamperometry (applied voltage: 0mV, time: 240s) in 20mM
HAuCl4 + 0.5M HCl.
19
Cyclic voltammetry in 2mM Ru(NH3)63+ + 0.1xPBS of the aperture illustrates the behaviour consistently
observed with PCBs received from the manufacturer. There is a rapid drop in current below -0.2V, which
could be the result of having an electroactive surface in a depression. Characterization of the gold barrier
with cyclic voltammetry in 50mM H2SO4 (Figure 10b, middle) displays very little in common with the
oxidation-reduction processes that take place at a pure Au surface. The oxidation process at +0.6V could
not be identified by examining voltammograms of pure Cu, Ni, or Pd wires; however, the negative linear
loping current from +0.5V to +1.5V and subsequent reduction process from 0V to -0.2V is indicative of
20
Figure 10: (a, top) Optical microscope image of an aperture with an ENIG surface, (a, middle) 50mM H2SO4 and (a, bottom) 2mM Ru(NH3)6
3+ cyclic voltammograms. (b, top) Optical microscope image of aperture following electrodeposition of Au from a Au(SO3)2
3- plating solution, (b, middle) 50mM H2SO4
and (b, bottom) 2mM Ru(NH3)63+ cyclic voltammograms. (c, top) Optical microscope image of an NME
deposited in a 65μm aperture on top of a layer of Au(SO3)23-, (c, middle) 50mM H2SO4 and (c, bottom)
2mM Ru(NH3)63+ cyclic voltammograms. Ru(NH3)6
3+ scans were performed with 0.1xPBS as the supporting electrolyte.
Cu
Substrate
Dielectric
Cu
Dielectric
Substrate
50mM H2SO
4
2mM Ru(NH3)
63+
+ 0.1xPBS
(a) (b)
Cu
Substrate
Cu
Substrate
Dielectric
Au (ENIG)Ni
Au(SO3)
23-
AuCl4
-
(c)
Cu, based on experiments performed with pure copper wire. Au(SO3)23- minimizes the process at +0.65V
seen on the aperture 50mM H2SO4 voltammogram; however, the gold-related signal does not improve
significantly.
The oxidation process at +1.1V and subsequent reduction process at +0.87V seen in the H2SO4 cyclic
voltammogram in Figure 10c are characteristic redox processes of a gold surface. However, there are
additional oxidation-reduction processes that occur at approximately +0.25V as well as an overall
superimposed linear current suggesting the presence of some other material. Characterization with
Ru(NH3)63+ also displays additional electrochemical processes below -0.1V, which would directly
influence electrochemical sensing.
Pd Corrosion Barrier. Palladium, a noble metal, has been used to form NMEs and therefore was
considered as a viable metal barrier option. Similar to AuCl4-, the chloride complex of Pd (PdCl4
2-) is a
very reactive form of Pd (II) with a standard reduction potential of +0.62V [49]. Pd (II) is more stable
when complexed with amine groups (i.e. Pd(NH3)42+ (aq) + 2e- Pd(s) + 4NH3 Eo = 0.0V). A
tetraamine palladium plating bath (see [49], [50]) was used to fill the PCB aperture to mitigate chemical
attack due to AuCl4- or PdCl4
2-. A corrosion test of the Pd passivated PCBs was performed by dipping the
PCBs in 20mM HAuCl4 + 0.5M HCl for 5 minutes. The results of the test are displayed in Figure 11.
21
Figure 11: (Top row) Light microscope images (50x) of 3 apertures with electrodeposited Pd on top of ENIG finished PCB. All leads of 20 electrode chip (65μm apertures) were plated simultaneously using chronoamperometry (applied voltage: -800mV, time: 45 minutes). (Bottom row) Displacement of Pd following submersion of apertures in 20mM HAuCl4 + 0.5M HCl for 5 minutes.
Pd(NH3)
42+
Electroplated
AuCl4-
Displacement
A
A B
B C
C
Galvanic displacement occurred even with the Pd barrier; however, it occurred at a very slow rate and
could have been self-limiting as large, uncontrolled growth of structures were not observed. NMEs were
electrodeposited using 20mM HAuCl4 + 0.5M HCl under various plating voltages and times on top of the
Pd barrier. The structures that formed as well as the electrochemical characterization scans are found in
Figure 12. Consistently, two oxidation processes occurred at potentials of +0.6V and +0.9V before the
onset of Au oxidation at +1.2V when the NMEs were cycled in 50mM H2SO4. Cycling in 2mM
Ru(NH3)63+ + 0.1xPBS consistently displayed the behaviour of a reversible reaction, while ferrocyanide
voltammograms displayed distinctly non-reversible voltammograms with potentially 2 oxidation
processes occurring within 0V and +0.5V.
22
Modified NME Electroplating Baths
Various Pd and Au Complexes. The characteristic branched, fractal-like structures of NMEs do not
form using stable metal salts such as Pd(NH3)4Cl2 or Na3Au(SO3)2. Dendritic structuring of metal
deposits is the result of mass transport limitations, thus the kinetics at the electrode/electrolyte interface
must be fast [49]. Attempts were made to apply large overpotentials to Pd(NH3)42+ and Au(SO3)2
3-
electroplating bath; however, only large grained structures with minimal branching formed.
HAuCl4 With Various Supporting Electrolytes. The pH dependence of attack on the PCB surfaces
was tested in search of a new NME electroplating solution. ENIG finished PCBs were submerged in
23
Figure 12: (a) Light microscope images of NMEs deposited on a Pd barrier using 20mM HAuCl 4 + 0.5M HCl with chronoamperometry under various plating potentials and times. NMEs were characterized with cyclic voltammetry in 50mM H2SO4, 2mM Ru(NH3)6
3+ and 10mM Fe(CN)64-. (left column) Applied
voltage: 0mV for 150s, (middle column) applied voltage: 50mV for 250s, and (right column) 150mV for 500s.
(a) (b) (c)
50mM H2SO
4
2mM Ru(NH3)
63+ + 0.1XPBS
10mM Fe(CN)6
4- + 0.1XPBS
acidic (pH 1-2), neutral (pH ~7) and basic (pH >10) solutions of HAuCl4 and the apertures were imaged
before and after submersion (see Figure 13).
Under basic conditions, electroless deposition of HAuCl4 ceases while under neutral and acidic
conditions, corrosion and uncontrolled growth occur as shown in Figure 13. Various plating conditions
with 20mM HAuCl4 + 0.5M NaOH were tested to generate NMEs. A sampling of the structures that could
be formed are displayed in Figure 14.
24
Figure 13: Light microscope images of 65μm apertures before and after submersion in 20mM HAuCl4 + 1xPBS, 20mM HAuCl4 + 0.5M NaOH, 20mM HAuCl4 + 1M H2SO4. HAuCl4 under basic conditions is the only electroplating solution that does not chemically interact with the PCB surface.
Before
After
Supporting Electrolytes
1x PBS 0.5M NaOH 1M H2SO
4
The reduction potential of HAuCl4 shifted from E > +150mV to E < -300mV, which could indicate that a
different Au complex formed. In addition, the limiting current for plating was lower under basic
conditions, which was why a higher concentration of HAuCl4 was used. Electroplating under applied
potentials of -400mV and -500mV yielded branched structures. Branches thinner and more numerous
25
Figure 14: NMEs formed under different applied potentials with 80mM HAuCl4 + 0.5M NaOH. Electroplating results for 0mV, -100mV, -200mV and -300mV were not shown since deposition did not occur.
Figure 15: Test PCB with inset displaying electrodeposited Au tree-like sensing electrode imaged with a light microscope (A) and SEM (B).
A B
-500mV
-400mV
AppliedPotentials
with the NMEs generated under -500mV. Both conditions displays preferential growth closer to the
aperture edges. The large depressions in the NMEs have limited solution access, which hinders target
access to the sensing surface. Characterization of an NME with scanning electron microscopy (Figure 15)
displays the small characteristic feature sizes of NMEs.
Photolithography with Glass Slides
Photolithography was used to produce 2 different platforms using glass as the substrate, SU-8 as the
insulator and 2 different base metals: chromium and
gold. The chip layout is nearly identical to the 20
electrode sensors fabricated on the PCB platform and is
shown in Figure 16.
Gold-on-Glass Platform. Light microscope images of
NMEs electrodeposited into 45μm apertures with 20mM
HAuCl4 + 0.5M HCl using the gold-on-glass platform
are displayed in Figure 17. NMEs appear to be
structurally similar to NMEs produced using the gold-
on-silicon platform. Growth of large branches occurred
preferentially at the edges of apertures, an effect
explained by the relatively large diameter ,which results
in greater current densities at the edges. Cyclic
voltammetry performed in 50mM H2SO4 displayed the
typical oxidation and reduction behaviour of pure gold
without any extraneous electrochemical processes. The onset of gold oxidation to gold hydroxide
occurred at +1.2V and the onset of gold hydroxide reduction peak occurred at +0.82V. Between 0 and
+0.6V, only non-faradaic charging occurred, which is a requirement for electrochemical sensing with
Ru(NH3)63+/Fe(CN)6
3-. Ru(NH3)63+ and Fe(CN)6
4- displayed typical cyclic voltammograms of reversible
electro-active species. The largest NME (Figure 17c) performed like a macroelectrode while the smaller
NMEs (Figure 17a and Figure 17b) showed behaviour transitioning towards a microelectrode.
26
Figure 16: Gold-on-glass sensor with 20 electrodes divided into 4 groups of 5. Transparent SU-8 insulating layer was used to produce apertures at the ends of leads.
Bond pads
Groups of 5 apertures
Chromium-on-Glass Platform. Light microscope images of NMEs electrodeposited into 45μm
apertures with 20mM HAuCl4 + 0.5M HCl using the chromium-on-glass platform were images with a
light microscope (Figure 18). The processed chromium slide was not susceptible to attack by the acidic
electroplating solution. NMEs displayed a similar morphology to the gold-on-glass platform; however,
they were consistently darker when observed through a microscope, which would suggest either a rougher
surface or the presence of impurities. Cyclic voltammetry with 2mM Ru(NH3)63+ and 10mM Fe(CN)6
4-
solutions displayed reversible sensor responses as expected; however, cyclic voltammetry with 50mM
H2SO4 displays a very large oxidation process onset at +1.1V. The reduction processes on the reverse scan
do not display a typical gold response.
27
Figure 17: (Top row) Light microscope images of NMEs deposited in apertures of the gold-on-glass platform with the following conditions: (A) chronoamperometry performed at 0mV for 150s, (B) chronoamperometry performed at 50mV for 200s, (C) chronoamperometry performed at -100mV for 200s. (Bottom row) Cyclic voltammetry performed in 50mM H2SO4, 2mM Ru(NH3)6
3+ + 0.1xPBS, 10mM Fe(CN)6
4- + 0.1xPBS.
A B C
28
Figure 18: NMEs electrodeposited on Cr-coated glass slides processed with photolithography. Electrodeposition conditions using chronoamperometry: (A) applied voltage: 50mV for 150s, (B) applied voltage: -150mV for 200s, and (C) applied voltage: -250mV for 300s.
A B C
DiscussionA thorough investigation of printed circuit boards (PCBs) and metallized glass slides was undertaken in
an attempt to find alternative, cost-effective material platforms for electrochemical biosensing.
Converting PCBs into biosensors had 2 main obstacles: (1) undesired electrochemical processes due to
the underlying non-noble metals occurring within the potential window for biosensing, and (2) NMEs
grew predominately at the edges of apertures. Metallized glass slides were more well-behaved
electrochemically; however, large apertures still had problems in growing hemispherical, highly branched
NMEs.
Printed Circuit Boards. Typical methods of generating NMEs on PCBs failed due to the corrosive
nature of Cl-complexes of Pd (e.g. H2PdCl4) and Au (e.g. HAuCl4), which generated reaction products in
an uncontrollable manner as seen in Figure 13. There are a number of hypotheses for why the electrode
surfaces of PCBs are so reactive even following deposition of a noble metal such as palladium or gold:
(1) there are unreacted components of the proprietary soldermask material that act as reducing agents, (2)
there are chemical components of the substrate material that act as reducing agents, and (3) the
electrodeposited layers are porous thus non-noble metals are still accessible to solution.
The first hypothesis was disproven by trying 2 different soldermask material as well as removing the
soldermask (data not shown) and still witnessing the same corrosion/reduction of HAuCl 4 on the surface
of the PCB. The second hypothesis was disproven by purchasing PCBs with 2 different substrate
materials: FR-4 and polyimide. Polyimide is a relatively inert polymer, akin to Teflon in terms of
properties, yet corrosive attack persisted [51]. Also, the substrates likely did not influence the Fe(CN)64-
cyclic voltammograms in any scenario since polyimide [52] and FR-4 [53] have been used in
ferrocyanide-based electrochemical biosensors.
A review of literature found few examples of PCBs used as electrochemical sensors [53–55].
Unfortunately, none reported electrodepositing reactive metal salts during fabrication of the sensing
surface. A study of the corrosion resistance of ENIG finished PCBs exposed to gaseous H2S provides
some insight into why passivation attempts have failed [56]. Pores at the Ni/Au interface act as initiation
sites for corrosion. Ni reacts with H2S dissolved in condensation on the PCB to form the corrosion
product NiS. After a significant amount of pitting, Cu is contacted by H2S, which leads to corrosion of the
underlying copper. This mechanism is displayed in Figure 19 and through an analogous mechanism, our
29
PCB sensors could have been corroded [56].
Passivation layers need to be more closely monitored for porosity and deposit thickness. The results of
silver coating copper contacts indicate that the thickness of the deposit has the highest correlation the
most with corrosion resistance [57]. Future attempts to passivate PCBs for biosensing with NMEs should
examine: (1) electroless Au or Pd plating, (2) pulse plating, and (3) localized laser annealing. Electroless
deposition and pulse electroplating can produce denser deposits than chronoamperometry [58]. Localized
annealing of a thick gold deposit (5μm thickness) was a critical step in providing a pore-free gold layer in
the PCB biosensors developed by others [53]
Metallized Glass Slides. Metallized glass slides provided the best alternative to the gold-on-silicon
platform. Cyclic voltammetry of NMEs grown on chrome-coated glass and gold-coated glass was
described. However, NMEs on chromium-coated glass displayed a behaviour different from gold when
cycled in H2SO4 suggesting that an alloy or contamination of the surface had occurred. To avoid potential
complications that a complex surface composition might produce in downstream applications, the
decision to use the gold-on-glass platform was made.
One noticeable drawback of all systems was the NME morphology. The smallest aperture PCB
manufacturers can make reproducibly is 50μm to 75μm. It was discovered during the development of the
gold-on-silicon platform that smaller apertures (i.e. 0.5μm to 5μm) were necessary for producing NMEs
with a roughly hemispherical shape. The edges of apertures have radial diffusion profiles while the
centers have liner diffusion profiles. This results in a higher current density at the edges and therefore a
faster growth rate at the edges leading to “rabbit-ears” as seen in Figure 20a [59]. If apertures are made
small enough such that the diffusion profiles of the edges are essentially overlapping, the opening of the
aperture will have a radial diffusion profile overall and the resulting deposit will be hemispherical as seen
30
Figure 19: Pore corrosion model of ENIG finished PCB exposed to H2S. Illustration taken from [56].
in Figure 20b.
Extended growth of the NME away from the sensor surface and into solution is important for capturing
diffusing molecules in a reasonable length of time [46]. Therefore, future work with the gold-on-glass
platform required sensors to be re-designed with 5μm apertures.
31
Figure 20: (a) Small depth-to-width ratio of aperture opening. So-called “rabbit ears” metal deposit creates areas of greater deposition away from the center and a concave center region. (b) Large depth-to-width ratio of aperture opening results in “rabbit ears” converging to form a hemispherical deposit.
DielectricDielectricMetal
Substrate
Electrodeposit
DielectricDielectricMetal
Substrate
DielectricMetal
Substrate
Electrodeposit
DielectricDielectricMetal
Substrate
(a) (b)
Methods
Materials
Fabrication. Printed circuit boards were ordered from Omega Circuits (Scarborough, ON). Apertures of
2, 3 and 4 mil were ordered and visually inspected for aperture size consistency using a light microscope.
PCBs with unopened apertures for any leads were discarded. ENIG finishing of PCBs was performed by
the manufacturer.
Gold-coated glass slides (Telic Company) with prespun positive photoresist and chromium-coated glass
slides (EMF Corporation) were used as starting materials for sensors. Shipley Microposit MF-321
developer (Microchem Corporation), gold etchant TFA (Transene Company, Inc.), CR-4 chrome etchant
(Transene Company, Inc.), AZ 300T positive resist stripper (Clariant Corporation), SU-8 2002
(Microchem Corporation) and SU-8 developer (Microchem Corporation) were used during the fabrication
of sensors.
Electrochemistry. All voltage measurements were made relative to a Ag/AgCl reference electrode
(RE-6 BASi Inc.) and Pt wire counter electrode (Sigma Aldrich #267236). All electrochemical
measurements were taken with an Epsilon potentiostat (BASi Inc.). HAuCl4 (Sigma Aldrich #484385),
NH4OH (Sigma Aldrich #320145), Pd(NH3)4Cl2 (Sigma Aldrich #323438) and NH4Cl (Sigma Aldrich
#254134) were used in preparing electroplating baths. Gold sulphite electroplating was performed using
TSG-250 (Transene Company).
Microscopy. Light microscope images were taken using a Eclipse LV100 (Nikon Instruments Inc.) in
reflectance mode. Scanning electron microscope images were acquired using an ASPEX 3025 (ASPEX
Corp.). Acetone (Sigma Aldrich #650501) and isopropanol (Sigma Aldrich #I9516) were used to clean
PCBs and glass substrates.
Glass Chip Fabrication
Etching. Gold-coated glass slides and chromium-coated glass slides were processed using the clean
room facilities at the University of Toronto Bahen Centre. The slides were exposed to a UV source
through an acetate positive photoresist mask for 12s with a Karl Suss MA6 Mask Aligner, then developed
with MF-321 for 60s and rinsed with diH2O. Regions of exposed gold were etched with gold etchant TFA
32
for 10s and the underlying chromium was etched in CR-4 etchant for 10s. The gold etching step was
skipped when processing the chromium-coated slides. Finally, the remaining positive photoresist was
stripped for 120s in AZ 300T.
SU-8 Patterning. SU-8 2002 was spun on slides at 5000 rpm for 45s. Slides were then prebaked for 60s
at 95oC. The SU-8 was exposed with an acetate mask for 12s and processed with a post-exposure bake of
60s at 95oC. Apertures and contacts were opened by submerging the slide in SU-8 developer for 60s.
Slides were then rinsed with diH2O and dried under N2. Finally, the SU-8 layer was hard baked at 200oC
for 20min.
Gold Corrosion Barrier
PCB Preparation. PCBs with 65μm apertures were sonicated in acetone for 5 minutes and then rinsed
with solvents in the following order: acetone, isopropanol then diH2O. Rinsing was performed on both
faces of the PCB for approximately 15s to remove contaminants that could have adsorbed on the surface
during the manufacturing process. Finally, PCBs were blown dry under N2.
Au Electrodeposition. Electrodeposition of an initial Au layer was performed using a commercial
Au(SO3)23- bath (Transene Company). Chronoamperometry performed simultaneously on all leads was
used to fill in apertures by applying -450mV for 120 minutes. NME electrodeposition was performed
using 20mM HAuCl4 in 0.5M HCl. Chronoamperometry was used to deposit the NMEs by applying 0mV
for 240s.
Electrochemical Characterization. Cyclic voltammetry was performed on the apertures using 50mM
H2SO4 scanning from 0V to +1.5V for 5 cycles at 200mV/s. Cyclic voltammetry on the apertures using
2mM Ru(NH3)63+ in 0.1xPBS (N2 purged for 30min). Two cycles were performed scanning from +0.1V to
-0.4V. The same procedure was used to characterize the Au barrier and Au NMEs after they were
electrodeposited. The PCB, reference electrode and counter electrode were thoroughly rinsed with diH2O
between characterization scans.
Pd Corrosion Barrier
PCB Preparation. PCBs with 65μm apertures were sonicated in acetone for 5 minutes and then rinsed
with solvents in the following order: acetone, isopropanol then diH2O. Rinsing was performed on both
33
faces of the PCB for approximately 15s to remove contaminants that could have adsorbed on the surface
during the manufacturing process. Finally, PCBs were blown dry with N2..
Pd Electrodeposition. Deposition of Pd from a tetraamine complex was performed using the bath
described in [49]: 70mM Pd(NH3)4Cl2 + 1.12M NH4Cl (pH 8 adjusted with NH4OH). To prepare 10mL of
electroplating solution, 190mg of Pd(NH3)4Cl2 was dissolved in 5mL diH2O. Subsequently, 600mg of
NH4Cl was dissolved in the 5mL of solution. NH4OH was added in 20μL increments until the solution pH
was 8. The final volume was brought to 10mL using diH2O
The Pd barrier was electrodeposited using chronoamperometry under an applied potential of -800mV for
45 minutes. PCBs were rinsed with diH2O and dried by wicking away moisture with a Kim wipe. Au
NMEs were electrodeposited using a solution of 20mM HAuCl4 + 0.5M HCl using chronoamperometry
under various conditions specified in the results.
Electrochemical Characterization. Cyclic voltammetry was performed on the NMEs using 50mM
H2SO4 scanning from 0V to +1.5V for 2 cycles at 200mV/s. Next, cyclic voltammetry was performed
using 2mM Ru(NH3)63+ in 0.1xPBS (N2 purged for 30min). Two cycles were performed sweeping from
0V to -0.4V. Finally, cyclic voltammetry was performed using 10mM Fe(CN)64- in 0.1xPBS with one
cycle sweeping between 0V and +0.5V. The PCB, reference electrode and counter electrode were
thoroughly rinsed with diH2O between characterization scans.
HAuCl4 With Various Supporting Electrolytes
PCB Preparation. PCBs with 65μm apertures and ENIG finishes were sonicated in acetone for 5
minutes and then rinsed with solvents in the following order: acetone, isopropanol then diH 2O. Rinsing
was performed on both faces of the PCB for approximately 15s to remove contaminants that could have
adsorbed on the surface during the manufacturing process. Finally, PCBs were blown dry under N2.
Corrosion Test. 5mL solutions of 20mM HAuCl4 in 1xPBS/0.5M NaOH/1M H2SO4 were prepared.
Three small petri dishes were filled with each solution to a height so that when a PCB was stood upright
in the dish, only the apertures would be submerged. PCBs were submerged in each solution for 5 minutes.
After the PCBs were removed from solution, they were gently rinsed with diH2O and imaged using a
light microscope to observe any corrosion products.
34
Electrodeposition. From the same batch of PCBs prepared for corrosion tests, NMEs were
electrodeposited under applied voltages of 0mV, -100mV, -200mV, -300mV, -400mV and -500mV in
freshly prepared 80mM HAuCl4 + 0.5M NaOH. 0.5M NaOH must be prepared before diluting
concentrated HAuCl4; adding HAuCl4 to more concentrated NaOH results in an orange precipitate that
does not re-dissolve with agitation.
Gold-on-Glass/Chromium-on-Glass Platform
Glass Chip Preparation. Glass chips with 45μm apertures were sonicated in acetone for 1 minute and
then rinsed with solvents in the following order: acetone, isopropanol then diH2O. Rinsing was performed
on both faces of the PCB for approximately 15s to remove contaminants that could have adsorbed on the
surface during the manufacturing process. Sonication for less time than PCBs was necessary since 5
minutes of sonication lifted the SU-8 from the glass surface. Finally, the chips were blown dry with N2..
Au Electrodeposition. Concentrated stocks of HAuCl4 and HCl were combined and diluted to final
concentrations of 50mM and 0.5M, respectively, with diH2O. NMEs were electrodeposited individually
using chronoamperometry with various combinations of applied voltage and time specified with the
results. Deposition under the same conditions was performed for groups of 3 NMEs.
Electrochemical Characterization. Cyclic voltammetry was performed on the NMEs using 50mM
H2SO4 scanning from 0V to +1.4V for 2 cycles at 200mV/s. Next, cyclic voltammetry was performed
using 2mM Ru(NH3)63+ in 0.1xPBS (N2 purged for 30 minutes). Two cycles were performed scanning
from 0V to -0.3V. Finally, cyclic voltammetry was performed using 10mM Fe(CN)64- in 0.1xPBS with 2
cycle sweeping between 0V and +0.5V. The chip, reference electrode and counter electrode were
thoroughly rinsed with diH2O between characterization scans.
35
III. Towards a Multiplexed System for UTI Diagnosis and Resistance Profiling
IntroductionThe combination of a cost-effective platform and multiplexed pathogen detection will change how UTIs
are diagnosed in the clinic. While the gold-on-glass platform behaved most similarly to the gold-on-
silicon platform, evidence of biosensing is required for unequivocal validation of the system. Two
important modifications were made to the gold-on-glass platform characterized previously: (1) apertures
were reduced to 5μm, and (2) the chips were selectively etched with O2 plasma. The smaller apertures
made it possible to grow hemispherical NMEs, while the selective etching was performed to control
droplet spreading on the chip. The process of validating the gold-on-glass platform has been divided into
the following categories: (1) probe design and synthesis, (2) probe validation with synthetic targets, and
(3) probe validation with pathogen lysate. Probe validation with synthetic target was performed with the
Ru(NH3)63+/Fe(CN)6
3- reporter system described previously taking advantage of the hydrophobic
properties of the SU-8 insulating layer to treat different groups of NMEs with different probes and targets.
This was done to increase the efficiency with which probes could be tested as well as illustrate the
potential for high levels of multiplexing on a single chip. Probe validation with pathogen lysate used the
same reporter system but used the chips in a uniplexed format.
Probe Design and Synthesis
A few different nucleic acid probe molecules can be used with the Kelley Group biosensor. DNA is an
excellent probe molecule because self-assembled DNA monolayers are well-studied. However, binding
affinity as well as the background electrochemical signal inherent to a charged probe molecule limit
detection sensitivity. Peptide nucleic acids (PNA) can be more sensitive and specific compared to DNA
for the following reasons: (1) PNA/DNA and PNA/RNA form more stable duplexes than DNA/RNA, (2)
PNA is nuclease-resistant and (3) PNA-DNA stability is more sensitive to nucleotide mismatches [60].
However, PNA suffers from poor aqueous solubility due to its lack of a negatively charged backbone.
Therefore, two aspartic acid residues are added to the ends of the molecule. The PNA is synthesized with
a terminal cysteine residue to provide a thiol group needed for immobilization on a Au electrode.
16S ribosomal RNA is the molecular standard for species identification for many bacterial pathogens
36
since it is highly conserved and highly expressed [61]. In cases of very high interspecies sequence
similarity more variable gene targets are also used, such as gyrA, parC and rpoβ [62], [63].
Probe Validation
Probe validation is accomplished by demonstrating assay specificity and sensitivity. Tests of specificity
were performed using high concentrations of complementary and non-complementary synthetic
oligomers that exactly match the length of the probe (18-22nt). Lysates of samples containing bacteria
have large amounts of non-complementary DNA and RNA, which the probes must not respond to. Tests
of sensitivity were performed by mechanically lysing and detecting the following uropathogenic species
at 103 and 105 cfu/mL: Staphylococcus saprophyticus, Pseudomonas aeruginosa, Enterococcus faecalis,
and Klebsiella pneumoniae. Tests of specificity were performed in conjunction by using the most
common UTI-causing species, E coli, as a negative control at 105 cfu/mL
Results
Probe Validation with Synthetic Targets
Relatively small NMEs (~20μm) were used for probe validation with synthetic oligomers. Small NMEs
were used with such targets because the accumulation of molecules 20 nucleotides in length takes place
on the order of seconds [46]. Given the high concentration of target molecules, nanostructuring was not
performed with Pd or Au. The size and morphology of NMEs on each sensor was consistent as seen in
Figure 21.
Selective etching of the SU-8 layer was a very simple and effective method of limiting droplet spreading.
A schematic of the etching process as well as the result are displayed in Figure 22.
37
Figure 21: SEM images of Au NMEs (~20μm) electrodeposited from 50mM HAuCl4 + 0.5M HCl.
Synthetic target at high concentrations (100nM) was used to demonstrate assay specificity for 20 species
-specific probes and 10 antibiotic resistance markers with a modified workflow relative to the detection
assay described on page 55. Sensors were first incubated with a non-complementary target, then the
sensor response (Ibefore) was measured. Next, the same sensor was incubated with a complementary target
and the sensor response was measured (Iafter). The change in current (ΔI = Iafter – Ibefore) due to the
accumulation of complementary target on the sensor surface was calculated for each probe. Differential
pulse voltammograms before and after incubation with the complementary target for 3 different NMEs
can be seen in Figure 23
38
Figure 22: Top (left) and side (right) views of a gold-on-glass biosensor with treated SU-8 surface spotted with 4 probes.
1cm
Figure 23: Sample differential pulse voltammograms for testing probe PP140 with synthetic oligomer targets with gold-on-glass chip.
This process was repeated with the rest of the species-specific probes and the results are presented in
Figure 24. There was a large variation in the sensor responses depending on which probes were used for
functionalization. This is understandable in the context that probes will form various secondary structures
that inhibit hybridization with target.
Probes with a statistically significant (p<0.05) change in current above the non-complementary
background are denoted in Figure 24. PP140 had the strongest response with the largest ΔI, while PP160,
PP190, PP291, PP100, PP97, PP290 and PP200 displayed sub-optimal sensor responses. Approximate
secondary structure stability was used in probe design by calculating the melting temperature of the most
stable secondary structure assuming that PNA forms similar structures with DNA. There was no notable
trend between probe secondary structure and performance.
39
Figure 24: Bars represent change in reduction current (ΔI) due to target hybridization reported for each species-specific probe (N = 3 or 4). Table 6 shows the names of the probes and their species of origin. Asterisks indicate probes that display a statistically significant (p<0.05) change in current following incubation with a complementary target. The dashed line corresponds to the right y-axis and represents the probe's secondary structure melting temperature calculated with the following parameters: 50mM Na+, 0mM Mg2+, 0.25µM probe DNA and 0.25µM target DNA. Calculated temperatures are not meant to be accurate representations of actual melting temperatures, but were used as a relative measure of probe secondary structure stability.
* ** * * * * *
**
* *
*
*
Probe Validation with Pathogen Lysate
NMEs approximately 60μm in size were electrodeposited using a two stage electroplating process: a gold
scaffold was electrodeposited with 50mM HAuCl4 + 0.5M HCl followed by nanotexturing with palladium
in 5mM H2PdCl4 + 0.5 HClO4. The reproducible, dendritic structure was visualized using SEM as seen in
Figure 26.
40
Figure 25: Bars represent change in reduction current (ΔI) due to target hybridization reported for each antibiotic resistance probes (N = 3 or 4). Table 7 shows the names of the probes and their corresponding antibiotic resistance gene. Asterisks indicate probes that display a statistically significant (p<0.05) change in current following incubation with a complementary target. The dashed line corresponds to the right y-axis and represents the probe's secondary structure melting temperature calculated with the following parameters: 50mM Na+, 0mM Mg2+, 0.25µM probe DNA and 0.25µM target DNA. Calculated temperatures are not meant to be accurate representations of actual melting temperatures, but were used as a relative measure of probe secondary structure stability. .
***
*
* *
*
The gold-on-glass platform was further challenged with a more complex sample of pathogen lysate in
1xPBS. Testing was performed with the following UTI species and associated probe ID: K pneumoniae -
PP97, P aeruginosa - PP110, E faecalis - PP150 and S saprophyticus – PP33. Bacteria were mechanically
lysed at a high concentration (~1010 cfu/mL) and serially diluted to clinically relevant concentrations of
105 and 103 cfu/mL. A negative control target of E coli was used in all experiments. Figure 27 displays a
set of representative differential pulse voltammograms to visualize the effect of introducing a complex
sample to the sensor.
The results of K pneumoniae, P aeruginosa, E faecalis and S saprophyticus detection are displayed in
Figure 28. Statistical significance (p<0.05) relative to the negative control was achieved for both 10 3 and
105 cfu/mL with multiple trials run per species (N>2).
41
Figure 26: SEM images of 3 NMEs electrodeposited in gold-on-glass apertures using 2 step plating process. Biosensors were mounted at 45o related to the electron beam path.
Figure 27: (a) Differential pulse voltammograms of negative control chip with E coli lysate (105 cfu/mL) target and P aeruginosa probe. (b) Positive control chip with P aeruginosa lysate (105 cfu/mL) and P aeruginosa probe.
(a) (b)
The sensor response to the lysate differs across the species tested, thus quantification of each species
concentration would require a calibration curve for each probe. Gel electrophoresis of the crude lysate
confirms lysis of positive (lane 5) and negative (lane 4) control species as seen in Figure 29. Lane 4
displays greater degradation of total RNA compared to the negative control sample represented by the
bright smearing. However, the majority of the fluorescence is seen between 80nt and 1000nt according to
lane 2, which suggests that the chip was still exposed to detectable fragments of negative control RNA.
42
Figure 28: Detection results using the gold-on-glass platform exposed S saprophyticus (yellow), K pneumoniae (blue), P aeruginosa (red) and E faecalis (purple) lysates. Error bars represent the standard error of the mean for N > 5 leads.
43
Figure 29: Agarose gels qualitatively confirming mechanical lysis performed for probe validation experiments. Lane 1 = 1000nt ssRNA ladder, lane 2 = 100nt ssRNA ladder, lane 3 = E coli total RNA (purified), lane 4 = E coli crude lysate, lane 5 = test bacteria crude lysate.
54321
K pneumoniae
16S rRNA
5S rRNA
23S rRNA
1000 20003000
80
P aeruginosa54321
S saprophyticus54321
54321E faecalis
1000 20003000
80
16S rRNA
5S rRNA
23S rRNA16S rRNA
5S rRNA
23S rRNA
1000 20003000
80
1000 20003000
80
16S rRNA
5S rRNA
23S rRNA
DiscussionIn this study, a novel electrochemical sensing platform using PNA oligomer probes and the Ru(NH 3)6
3+
/Fe(CN)63- reporter system successfully detected pathogen lysates. Expertise from several disciplines
including microfabrication, electrochemistry and microbiology were required to design and implement
such a sensor. Few others have reported detection of pathogens at clinically relevant concentrations using
nucleic acid hybridization without amplification making this an extraordinary achievement [44], [64–67].
Probe Design and Synthesis. A set of species-specific probes capable of recognizing over 95% of
uropathogens submitted for urinalysis in clinical microbiology laboratories were designed and
synthesized. The targeted species were chosen based on their prevalence documented in surveillance
studies [68]. Probe design consisted of exhaustively searching for short sequences (18-22 nt) in genes
used for species identification. In total, twenty species-specific sequences were selected: 17 bacterial
species, 2 control probes and 1 yeast probe. Probes designed as a part of this work target the gene rpoβ.
RNA polymerase is a transcription enzyme, therefore rpoβ is predicted to be a highly expressed gene
[69]. Past work by the Kelley Group quantified rpoβ in E coli to be 1400 copies/cell [46]. The control
probes are based on consensus sequences of Enterobacteriacae bacteria and all target sequences. Even
though a more variable gene was targeted, probe design of some species (e.g. Citrobacter freundii and
Enterobacter aergoenes) were not possible.
Standard molecular identification of fungi uses the internal transcribed spacer (ITS) region of the rRNA
cistron. However, since the ITS is removed during ribosome assembly, it was not a viable target gene. An
investigation of PCR performance comparing ITS, rpoβ, large ribosomal subunit rRNA (LSU) and small
ribosomal subunit rRNA (SSU) found that ITS and LSU to perform similarly as targets [70]. LSU was
selected as a target for probe design.
As a proof-of-concept, a panel of antibiotic resistance targets was selected to cover the major drug
classes: MLS, tetracyclines, aminoglycosides, β-lactams, trimethoprim, and sulfonamides. All of these
antibiotics could be prescribed based on the type and severity of UTI (see page 4).
Probe Validation with Synthetic Target. Probe validation performed using a high concentration
(100nM) of synthetic target demonstrated a fast method of interrogating 4 probes on a single chip. Many
factors were considered during probe design with secondary structure stability being perhaps the most
heavily weighted consideration. Predictions of PNA secondary structure were made using IDT
44
OligoAnalyzer [71], which assumes that DNA or RNA secondary structures are desired. It is clear from
Figure 24 and Figure 25 that secondary structure is not necessarily a good predictor of assay performance.
However, it was still a useful design criterion since probes with greater secondary structure were more
difficult to purify post-synthesis. The purity of PNA would impact how consistently the sensing
monolayer formed.
Probe Validation with Pathogen Lysate. Probe validation performed using pathogen lysates at 2
clinically relevant concentrations (103 cfu/mL and 105 cfu/mL) in 1xPBS demonstrates that the platform is
effective at handling complex samples. Under all conditions tested, lysates of all 4 bacteria displayed
statistically significant (p<0.05) increases in current were observed for target species when compared to
the negative control target, E coli. Assuming transcription levels are similar to those predicted for rpoβ in
E coli [46], 103 cfu/mL represents ~10fM of target molecules, which approaches the best limit-of-
detection reported using the original gold-on-silicon platform [43].
Interestingly, a comparison of probe performance based on sensor response using synthetic targets versus
lysate do not correlate. While PP110 (P aeruginosa) and PP33 (S Saprophyticus) performed well in the
validation study with synthetic oligomer targets, PP150 barely reached significance and PP97 did not
even reach statistical significance. While it is instructive to study and test sensor response with synthetic
target, the behaviour of probes when presented with real targets can be substantially different.
Gel confirmation of lysis was very important for ensuring samples did not degrade substantially. RNA
integrity was monitored using the relative brightness of rRNA bands (i.e. intact RNA) compared to the
rest of the lane (i.e. degraded RNA). As evidenced by Figure 29, E coli (Lane 4) seemed more prone to
degradation even when other bacteria samples were processed in parallel. It should be noted that Lane 3
of gels for P aeruginosa and E faecalis have no fluorescence, smeared or banded. This was due to E coli
purified total RNA degrading after multiple uses.
45
Methods
Materials
Peptide Synthesis. Solid phase PNA-peptide probe synthesis was performed using a Prelude peptide
synthesizer (Peptide Instruments, Inc.). PNA monomers (Fmoc-PNA-A(Bhoc)-OH, Fmoc-PNA-C(Bhoc)-
OH, Fmoc-PNA-G(Bhoc)-OH, Fmoc-PNA-T-OH) were obtained from Link Technologies Ltd and amino
acids (Fmoc-L-Gly-OH, Fmoc-L-Cys(Trt)-OH, Fmoc-L-Asp(OtBu)-OH) were obtained from Peptide
Instruments Ltd. HATU activator was obtained from Advanced ChemTech. 20% piperidine in DMF and
0.4M NMM in DMF were obtained from Peptide Instruments Ltd. PNA-peptide probes were synthesized
on Knorr Resin (Advanced Chemtech #SA5060). N,N-Dimethylformamide (Sigma Aldrich #D4551) and
dichloromethane (Sigma Aldrich #443484) were the solvents used by the synthesizer. Methanol (Sigma
Aldrich #179337) was used for synthesizer washes.
Trifluoroacetic acid (Sigma Aldrich #T6508), m-cresol (Sigma Aldrich #65996) and triisopropyl silane
(Sigma Aldrich #233781) were used in the cocktail to deprotect monomer bases/side-chains and cleave
the PNA-peptide from the resin. Bio-spin Chromatography Columns (Bio-Rad Laboratories, Inc.) were
used during the PNA-peptide deprotection/cleavage.
Peptide Purification. Dithiothreitol (Sigma Aldrich #43815), tris(2-carboxyethyl)phosphine
hydrochloride (Sigma Aldrich #93284) and acetonitrile (Sigma Aldrich #360457) were used to prepare
crude PNA synthesis products for HPLC purification. Organic and polar mobile phases were prepared by
adding trifluoroacetic acid (Sigma Aldrich #T6508) to acetonitrile and vacuum filtered (0.22μm) diH2O.
Samples were centrifugally filtered using Costar Spin-X centrifuge tube filters (0.22μm). A C-18 PRP-1
21.2 x 250mm HPLC column (Hamilton Company) was used with an Agilent 1100 HPLC (Agilent
Technologies).
Bacteria Growth. Klebsiella pneumoniae ATCC 27799, Escherichia coli K12 ATCC 33876,
Staphylococcus saprophyticus ATCC 15305, Pseudomonas aeruginosa PAO1, and Enterococcus faecalis
ATCC 29212 were grown in Nutrient Broth (Difco #23400). Approximate quantification of bacteria was
performed by measuring the OD at 600nm with an Agilent 8453 UV-vis spectrometer.
Gel Electrophoresis. Gels were prepared using electrophoresis grade agarose (Bioshop #AGA002)
with 10xTris-Borate-EDTA buffer (Sigma Aldrich #T4415). ssRNA Ladder (No. N0362S) and low range
46
ssRNA ladder (No. N0364S) were obtained from New England Biolabs Inc. E coli purified total RNA
(No. AM7940) for gel electrophoresis was obtained from Invitrogen Life Technologies. A Thermo
Scientific Owl Easycast B1AS gel runner and Bio-rad Power Pac 3000 power supplied were used to
perform gel electrophoresis.
Biosensing. PNA was quantified using the OD at 260nm measured using a Nanodrop 2000 (Thermo
Fisher Scientific Inc.). Oligonucleotide DNA targets were synthesized and cartridge purified by ACGT
Corporation and delivered in lyophilized form. Target concentrations were quantified using the measured
OD at 260nm and extinction coefficients were calculated using OligoAnalyzer [71]. Stock solutions of
Ru(NH3)6Cl3 (Sigma Aldrich No. 262005) and K3Fe(CN)6 (Sigma Aldrich No. 244023) were prepared in
diH2O every two weeks and refrigerated (4-8oC) while not in use. HAuCl4 (Sigma Aldrich No. 520918)
and HCl (BioShop No. HCL444) were combined to form the electrodeposition solutions; fresh solution
were prepared every week and stored at room temperature in a dark environment. Dilutions of
mercaptohexanol (Sigma Aldrich #725226) in diH2O were prepared for each set of experiments.
Phosphate buffered saline (1x, pH 7.4) was obtained from Invitrogen (No. 10010-023). All
electrochemical measurements were made using an Epsilon Potentiostat (BASi Inc.). Reactive ion etching
was performed using a SAMCO RIE System (Model: RIE-1C) with an ENI RF Generator. AZ 300T
stripping solution was used to remove the positive resist on chips following reactive ion etching.
Species Probe Design
A semi-automated workflow was followed to obtain a list of potential probes based on the rpoβ sequence
of a species. All rpoβ gene sequences were gathered using the NCBI Nucleotide Database. If multiple
strains of a given species had complete rpoβ sequences, a consensus sequences was used in downstream
probe design to avoid single nucleotide polymorphisms. Whenever possible, rpoβ sequences of bacteria
isolated from urine were used.
For a given bacterial sequence, a BLAST [72] search was performed to identify the rpoβ sequence of the
most similar bacterial species that could potentially cross-hybridize. Generally, the next most similar
species displayed 90 to 95% sequence similarity. This sequence was retrieved and aligned with the
targeted bacterial sequence using CLUSTALW2 [73]. The output of CLUSTALW2 does not differ from
the output produced by BLAST; however, it is an easier file format to parse with computer scripts for later
analysis. A script was used to identify regions of greatest variability since they can be used to best
47
differentiate the target species from non-target species. This process is summarized in Figure 8.
The compiled potential probes list will definitely not cross-hybridize with the sequence that has the
greatest overall similarity to the target sequence; however, that does not mean it could not cross-hybridize
with another less similar sequence. The potential probes list was processed with BLAST and a script was
used to filter the results into 3 different categories: urinary tract infection organisms, pathogenic bacteria,
and commensal bacteria. The script sorted the results from BLAST by cross-referencing BLAST hits with
lists of species for each category compiled using various sensors. The list of urinary tract infection
organisms was comprised of the target bacteria for which probes were being designed. The pathogenic
bacteria list was assembled using a combination of web resources and literature. The commensal bacteria
list was assembled from the list of bacterial genomes sequenced in the Human Microbiome Project [74].
The restraints placed on cross-hybridization are outlined as criteria 4 and 5 in Table 5.
Eliminating potential probes that could cross-hybridize with non-target molecules in a patient sample is
the most limiting criterion in designing probes, which is why it was performed as early in the work flow
as possible. Sacrifices in terms of other probe characteristics, such as secondary structure melting
temperature, were deemed allowable in order to ensure optimal specificity. Criteria 1, 2 and 3 in Table 5
were the final filters placed on the potential probe list. Homodimer formation, secondary structure
melting temperature and heterodimer melting temperature were all calculated using OligoAnalzyer [71].
48
Figure 30: Workflow for compiling a list of potential probes to scrutinize based on criteria to enhance hybridization efficiency.
Identify closelyrelated species
(BLAST)
Align rpoB of input and match
(ClustalW2)
Identify highly variable regions
atgcgtcgatcgatcgaaaaatcgcgctagcttgatgcaatgagagct
rpoβ target
atgcgtcgatcgatcg
20mer probe 1
gtgcgcgtagtgatg
20mer probe 2 ggggtacattcgatg
20mer probe 3
# Property Criteria Rationale
1 Hetero-dimer melting temperature (Tm) Tm > 50oC Sensitivity
2 Secondary structure melting temperature (Tm 2o) Tm(2o) < 30oC Sensitivity
3 Homodimer base-pairing < 5 consecutive bp Sensitivity
4 Low affinity for human transcripts < 16 bp Specificity
5 Low affinity for extraneous commensal transcripts < 18bp Specificity
Table 5: Probe design property cut-offs and the performance-related characteristics they influence.
49
Species Designation Target Sequence (5' to 3') Pos. Accession No. Ref
E coli PP32 rpoβ ATCTGCTCTGTGGTGTAGTT 673 CP000243.1 -
P mirabilis PP120 rpoβ AAGCGAGCTAACACATCTAA 955 NC_010554.1 -
S saprophyticus PP22 rpoβ AAGTAAGACATTGATGCAAT 1141 AP008934.1 -
S aureus PP74 rpoβ CCACACATCTTATCACCAAC 2761 CP002110.1 -
K pneumoniae PP97 rpoβ GTTTAGCCACGGCAGTAACA 2172 NC_009648.1 -
M morganii PP100 16S CGCTTTGGTCCGAAGACATTAT 171 AJ301681.1 [67]
P aeruginosa PP110 16S CCCGGGGATTTCACATCCAACTT 562 Z76651.1 [67]
K oxytoca PP130 rpoβ CCAGTAGATTCGTCAACATA 901 CP003218.1 -
S marescens PP140 16S TGCGAGTAACGTCAATTGATGA 414 GU046545.1 [75]
E faecalis/faecium PP150 16S CGACACCCGAAAGCGCCTTT 212 NC_004668.1 [67]
A baumannii PP160 rpoβ CGTCAAGTCAGCACGTAATG 1052 NC_011586.1 -
S pyogenes PP170 rpoβ TCTTGACGACGGATTTCCAC 2080 NC_017053.1 -
S agalactiae PP180 rpoβ GTTCAGTAACTACAGCATAA 1020 CP000114.1 -
S epidermidis PP190 rpoβ AAATAACTCATTGAGGCAAC 1141 NC_002976.3 -
E cloacae PP200 rpoβ TCAACGTAATCTTTCGCGGC 889 NC_014121.1 -
S pneumoniae PP210 rpoβ GTTACGACGCGATCTGGATC 1078 FM211187.1 -
P stuartii PP230 rpoβ GCCAAGTGCCAATTCACCTAG 948 DQ836282.1 -
C albicans PP240 28S GCTATAACACACAGCAGAAG 461 JN940610.1 -
C trachomatis PP66 proteinb GCCTAACCGCTCAGTGATAA 89 HE601801.1 -
Enterobacteriaceae PP290 16S ACTTTATGAGGTCCGCTTGCTCT 1269 CP000243.1 [76]
Universal bacteria PP291 16S GGTTACCTTGTTACGACTT 1492 CP000243.1 [77]b Hypothetical protein with high expression levels but unknown function. Protein was identified in transcriptome analysis of C trachomatis [78].
Table 6: Species-specific PNA probe sequences. NH2 and CONH2 are analogous to 5' and 3' of DNA with PNA. NH2-Cys-Gly-Asp-(PNA)N-Asp-CONH2 were the actual molecules synthesized. The sequences provide correspond to (PNA)N.
50
Antibiotic Designation Target Sequence (5' - 3') Pos. Accession No. Ref.
Methicillin PP71 mecA TGAAAGGATCTGTACTGGGTT 1579 NC_017341.1 -
Erythromycin PP320 ermA1 ATAGTAAACCCAAAGCTCGT 417 NC_002952.2 -
Vancomycin PP330 vanA GGTCAATCAGTTCGGGAAGT 984 FN424376.1 -
Tetracycline PP370 Tet(M) TTATATAATAAGCTTTCTGT 58 DQ223247.1 -
β-lactam PP390 blaSHVc AGATAAATCACCACAATGCGC 761 AF148850.1 -
Trimethoprim PP400 dfrAd TTAACCCTTTTGCCAGATTT 455 NC_015472.1 [79]
SMX PP410 sul2 GTGTGTGCGGATGAAGTCAG 728 NC_012692.1 [80]
Aminoglycoside PP420 AAC(6')-le-APH(2”)
AACTTCATCTTCCCAAGGCT 155 NZ_ACGL01000189.1
-
β-lactam PP430 blaTEM-1 GAAGCTAGAGTAAGTA 459 JQ779067.1 -
β-lactam PP440 blaKPC-2 CAAGACAGCAGAACTAGACG 16 NC_016846.1 [81]c blaSHV-1,2,5,7,8,12,24,36,37 (not 30,38,40)d dfrA1 (not 7,10,12,17,19)
Table 7: Antibiotic-resistance probe sequences that target the transcripts of proteins that confer resistance. Probes without a reference were designed in-house.
Probe Synthesis
HATU (333mM) and monomers (100mM) were dissolved in N,N'-Dimethylformamide (DMF) on the
starting day of synthesis. Note, 40 to 50mL excess of activator solution, 5mL excess of PNA monomer
solution and 10mL excess of peptide monomer solutions were prepared relative to the synthesizer
suggested volumes due to the dead volume of reagent bottles. PNA was synthesized on a 20μmol scale.
Approximately 0.35mg of Knorr resin (0.56mmol/g substitution) was used per reaction vessel. All
syntheses were preceded by a complete system wash with methanol.
All steps in the following description were programmed into the peptide synthesizer. The first coupling
serves to swell the resin and deprotect sites for peptide elongation as well as add the first monomer (L-
Asp). The Swell Coupling protocol on page 67 outlines the exact procedure. In summary, swell coupling
has the following protocol: (1) 30min resin swell, (2) 20min resin deprotection, (3) wash, (4) 1min
monomer activation, (5) 60min coupling under basic conditions, (6) wash, (7) 20min monomer
deprotection, (8) wash. All other couplings were performed with the Single Coupling protocol (see page
68), which can be summarized as follows: (1) 1min monomer activation, (2) 60min coupling, (3) wash,
(4) 20min deprotection, (5) wash.
51
After completing the synthesis, the PNA was rinsed twice filling each reaction vessel with DMF before
draining on a vacuum manifold. The resin was transferred to a 1.5mL empty chromatography column by
re-suspending the resin in DMF and pipetting into the column. In the column, the resin was rinsed twice
with DMF using the vacuum manifold, then the resin was swelled with dichloromethane (DCM) and
given a final rinse with DMF. The swell step was performed by filling the column full with DCM and
giving the beads enough time to increase and size before floating to the top of the DCM. DCM was
removed from the column before proceeding with cleavage from the resin and deprotection of the
bases/amino acid side chains.
The cleavage/deprotection cocktail was prepared freshly each time a synthesis was performed by
combining the following components: 12.5mL trifluoroacetic acid, 1.5mL m-cresol, 375μL triisopropyl
silane and 375μL diH2O. The cap was put on the bottoms of the chromatography columns, 1.5mL of
cleavage cocktail was added to each chromatography column and the top cap was firmly inserted into
each column. The columns were placed into separate 50mL tubes and allowed to incubate on a tilting
platform for 2 hours under foil. The supernatant was collected and the beads stored in case the cleavage
was unsuccessful.
Initially, unsuccessful cleavages were experienced due to poor mixing of the cleavage cocktail. There is a
notable difference in the volume of the resin after a successful cleavage versus an unsuccessful one. The
resin has a significantly
larger volume (i.e. swells
more) after a successful
cleavage as can be seen on in
Figure 31.
Cleavage solution was
emptied from each column
into separate 15mL falcon
tube. The last drops of
solution were removed from the columns by repeatedly and rapidly removing and replacing the top cap.
PNA was precipitated from cleavage cocktail using cold (-80oC) diethyl ether (12mL ether : 1mL cleavage
solution) for 30 minutes followed by centrifugation at 4,000rpm (-9oC) for 10mins. The supernatant was
decanted and replaced with new diethyl ether. Precipitation was performed 3 times after which, the
52
Figure 31: Example of a chromatography column following an unsuccessful cleavage. Resin inside chromatography column after cleavage cocktail has been removed. The red line indicates the height of the resin in the column before adding the cocktail.
diethyl ether was removed and the crude synthesis product was allowed to evaporate overnight.
Crude synthesis product was further purified using a HPLC C-18 reverse-phase semi-prep
chromatography column. 0.1% TFA in acetonitrile and 0.1% TFA in diH2O were used as the organic and
polar mobile phases, respectively. Samples for purification consisted of <1mg crude synthesis product,
10% acetonitrile, 0.5M dithioretinol (DTT). Samples were centrifugally filtered (1min @ 13,000rpm)
prior to HPLC purification.
A modified preparation procedure was used after a few rounds of synthesizing probes. PNA synthesized
using Fmoc/Bhoc chemistry forms a salt with TFA, thus when it is dissolved in an unbuffered solution,
the solution pH is quite low (pH 1-2). TCEP is more effective at reducing disulphide bonds below pH 8
compared to DTT [82]. The modified sample preparation requires <1mg PNA be dissolved in 200mM
TCEP in diH2O for at least 30 minutes.
The gradient profile outlined in Table 8 was used to purify all PNA oligomers. Purification was performed
at 45oC. The injected volume was adjusted for each preparation such that the maximum absorbance for
the entire chromatogram was approximately 2000mAU.
Time (min)
ACN +0.1%TFA (%)
H2O + 0.1% TFA (%)
Flow rate (mL/min)
0 5 95 3
40 45 55 3
42 90 10 3
52 90 10 3
54 5 95 3
68 5 95 3
Table 8: HPLC solvent gradient profile for PNA probe purification.
Fractions were collected at 30s intervals for each probe (1.5mL per fraction) over a time range from
approximately 13.5s to 16.5s. Fractions were aliquotted into smaller volumes and lyophilized. Each
fraction was characterized by mass spectrometry at the Advanced Protein Technology Centre, SickKids
Hospital. Completely pure fractions could not always be obtained; however, fractions with the greatest
abundance of probe were used in downstream experiments.
53
Probe Solubility
The PNA probe molecules are a chimera of L-amino acids and PNA monomers. In terms of charged
elements of the molecule, the probe has: (1) primary amine terminus (pKa = 9.7), (2) amide terminus
(pKa = -0.5), (3) aspartic acid residues (pKa = 3.7). Under the physiological pH conditions, which are
used when performing the chip-based assay, the amide group has is completely deprotonated. Crude
synthesis product following cleavage and base-deprotection are very soluble in pure water at room
temperature (22oC) and much less soluble to the point of being insoluble in 1xPBS (pH 7.4) . The ionic
species in 1xPBS are not likely the cause of insolubility since PNA probes were essentially insoluble in
1xTris buffer (pH 8) as well.
Crude synthesis product contains a significant amount of TFA as a counter ion, which is why PNA re-
suspended in water has a pH between 1 and 2. To study the pH dependence of PNA solubility, 0.1M acetic
acid buffers at pH 3.7 and 5.5 as well as 1xPBS (pH 7.4) were used to dissolve PP180. At pH 4, PNA
precipitates from solution. It is not entirely clear whether the insolubility is a result of a change in the
protonation state of the two aspartic acid residues or the nitrogen groups in the PNA bases.
To improve solubility, 3 different techniques were employed during experiments: (1) heating to 60oC for 5
minutes, sonicating for 5 minutes and heating to 60oC for 5 minutes, (2) modifying the probe solution
with 10% acetonitrile, and (3) dissolving probe in pure water rather than a buffer at physiological pH.
Insoluble PNA molecules at room temperature can be solubilized after rounds of heating and sonication;
however, upon finally cooling, the concentration PNA can change dramatically. In experiments using
PNA in buffered solutions (pH 7.4), probe was deposited on the biosensor as soon as possible after
heating to 60oC.
Probe Validation with Synthetic Target
Gold-on-Glass Chip Preparation. Chips were etched with O2 plasma for 20s at 15W. The positive
etch resist on the chips protecting regions that one wishes to remain hydrophobic removed using the AZ
300T stripping solution. Chips were then rinsed with diH2O for approximately 15s.
54
Electrodeposition (Step 1). Gold-on-
glass biosensors were fabricated using the
University of Toronto fabrication facilities
as described on page 32. NMEs were
electrodeposited with all leads of each
biosensor connected together so that
electroplating was performed
simultaneously. The electroplating solution
consisted of 50mM HAuCl4 in 0.5M HCl.
NMEs were deposited using
chronoamperometry: 0mV applied for 30s.
This electroplating produces NMEs
approximately 20μm in size. All leads
were visually inspected using a light
microscope to ensure similarity in the
NME morphology across individual
biosensors.
Probe Deposition (Step 2). PNA
(HPLC purified) from Table 6 or Table 7
was dissolved in 1xPBS. Solubilization
required 2 rounds of heating to 60oC
separated by 5 minutes of sonication.
Probe solution was remade every 4 days.
The PNA solution was diluted to a
concentration of 5μM. A 5μM solution of
mercaptohexanol (MCH) was prepared in
diH2O. PNA and MCH solutions were combined in a 1:9 ratio to create the probe solution. For probes that
failed initial testing, 5μM PNA only solutions were used for monolayer formation.
Four different probe solutions were spotted on each biosensor with each probe droplet (3.7μL) covering a
group of 5 NMEs (see Figure 22). Probe solution was deposited on a chip for 30 minutes in a humidity
55
Figure 32: Probe validation workflow with step numbers corresponding to the steps in the text description.
Functionalize NMEs
2
ElectrodepositNMEs
1
Incubate with non-specific
target
3
Measure adsorbedRu(NH
3)
63+
4
Incubate with complementary
target
5
Measure adsorbedRu(NH
3)
63+
6
AuSU-8
Glass
S
S
Non-comp DNA
S
Ru(NH3)
63+
V-3500
IBefore
V-3500
I ΔI
BeforeAfter
chamber. Non-specifically adsorbed probe was removed from the sensor surface by depositing 50μL
1xPBS on each chip for 5 minutes, and then repeating.
Incubation with Non-Complementary Target (Step 3). A synthetic non-complementary oligomer
was dissolved in 1xPBS and diluted to a final concentration of 100nM. 50μL of non-specific target
solution was deposited on each set of NMEs for 30 minutes in a humidity chamber. Two rounds of
washing using 1xPBS was performed before taking electrochemical measurements.
Electrochemical Measurement (Step 4). The before-scan was made in 10μM Ru(NH3)63+ + 4mM
Fe(CN)64- in 0.1xPBS. A DPV measurement was made twice for each lead and only the second scan was
considered for analysis. The following DPV parameters were used for the before and after-scans: E step =
5mV, tperiod = 100ms, Epulse = 50mV, tpulse = 50ms.
Incubation with Complementary Target (Step 5). A synthetic complementary oligomer was
dissolved in 1xPBS and diluted to a final concentration of 100nM. 50μL of specific target solution was
deposited on each set of NMEs for 30minutes in a humidity chamber. Two rounds of washing using
1xPBS was performed before taking electrochemical measurements.
Electrochemical Measurement (Step 6). The measurement procedure in step 4 was repeated.
Probe Validation with Pathogen Lysate
Bacteria Growth Conditions
All bacteria were grown in nutrient broth under aerobic conditions at 37oC overnight on a shaker (120
rpm). All broth cultures were started from a single colony obtained from a starter culture plate. Bacterial
concentrations were estimated on the day of performing each assay by measuring the OD600nm. A more
accurate estimate of the bacterial concentrations was made by performing serial dilutions of the bacteria,
culturing the diluted samples and counting the number of colony-forming units.
Bacterial Lysate Preparation and Verification
Cells in culture media (4 mL) were pelleted by centrifugation (2 minutes @ 9,000 rpm) and re-suspended
in 100μL to 400μL of 1xPBS in order to concentration the cells prior to lysis. The cell concentrate was
drawn into the mechanical lysis chamber of a OmniLyse Ultra-rapid Cell Lysis Kit (ClaremontBio
56
Solutions) at a rate of ~100μL per 15 seconds. The lysate was quickly transferred from the syringe into an
RNAse-free microcentrifuge tube and stored on ice until it was used. Cellular debris was pelleted by
centrifuging lysates (5 minutes @ 9,000rpm). The supernatant was transferred to a new microcentrifuge
tube before being serially diluted to 105 cfu/mL and 103 cfu/mL for positive control bacteria and
105cfu/mL for negative control.
Verification of lysis was demonstrated by running the lysate on a 2% agarose gel made with 1xTBE
buffer (pH 8). The gel was run for 75 minutes at 110V. Escherichia coli was always lysed and run as a
positive lysis control on the gel. 15μL gel lysate samples consisted of 7.5μL 2x ssRNA loading dye and
7.5μL lysate. 15μL gel ladder samples consisted of 7.5μL 2x ssRNA loading dye, 2μL HW/LW, 5.5μL
RNAse-free H2O.
Electrodeposition. Gold-on-glass biosensors were fabricated using the procedure described on page
32. NMEs were electrodeposited for 3 chips with all leads of each biosensor connected together so that
they could be electroplated simultaneously. Electrodeposition consisted of growing a Au dendritic
structure followed by nanostructuring with Pd [46]. Au electrodeposition was performed using
chronoamperometry (applied voltage: 0mV, time: 100s) in 50mM HAuCl4 + 0.5M HCl. The resulting
structures were approximately 60μm in size. Pd electrodeposition was accomplished using
chronoamperometry (applied voltage: -250mV, time: 10s) in 5mM PdCl4 in 0.5M HClO4. The sensors
were rinsed with diH2O and dried between electrodeposition steps. All leads were visually inspected using
a light microscope to ensure similarity in the NME morphology across individual biosensors.
Probe Deposition. Probe solution was prepared within the last 4 days of each experiment. PNA probe
specific for the species being detected was dissolved in 1xPBS. Solubilization required 2 rounds of
heating to 60oC for 5 minutes separated by 5 minutes of sonication. The PNA solution was diluted to a
concentration of 5μM. A 5μM solution of mercaptohexanol (MCH) was prepared in diH2O. The PNA and
MCH solution were combined in a 1:9 ratio to create the probe solution. Probe solution was deposited on
3 chips for 30 minutes in a humidity chamber. Non-specifically adsorbed probe was removed from the
sensor surface with washing. Washing was performed by depositing 50μL 1xPBS on each chip for 5
minutes, and then repeating.
Electrochemical Measurement. The before-scan was made in 10μM Ru(NH3)63+ + 4mM Fe(CN)6
4- in
0.1xPBS (purged with N2 for 30 minutes before use). A DPV measurement was made twice for each lead
57
and only the second scan was considered for analysis. The following DPV parameters were used for the
before and after-scans: Estep = 5mV, tperiod = 100ms, Epulse = 50mV, tpulse = 50ms.
Target Incubation. Lysate was prepared simultaneously during the biosensor preparative stages
according to the procedure described on page 56. Positive control lysates corresponding to 105cfu/mL and
103cfu/mL were deposited on 2 separate chips while 105cfu/mL negative control lysate was placed on the
third chip. Lysate was incubated at 37oC for 30 minutes. Finally, two 5 minute washes with 1xPBS were
performed in the same manner as after probe deposition.
Electrochemical Measurement. The same DPV parameters and methods used for the before-scan were
repeated.
58
IV. References[1] T. M. Hooton and W. E. Stamm, “Diagnosis and treatment of uncomplicated urinary tract
infection,” Infect. Dis. Clin. North Am., vol. 11, no. 3, pp. 551–581, Sep. 1997.[2] K. Gupta, T. M. Hooton, K. G. Naber, B. Wullt, R. Colgan, L. G. Miller, G. J. Moran, L. E.
Nicolle, R. Raz, A. J. Schaeffer, and D. E. Soper, “International Clinical Practice Guidelines for the Treatment of Acute Uncomplicated Cystitis and Pyelonephritis in Women: A 2010 Update by the Infectious Diseases Society of America and the European Society for Microbiology and Infectious Diseases,” Clin Infect Dis., vol. 52, no. 5, pp. e103–e120, Mar. 2011.
[3] L. Nicolle, “Complicated urinary tract infection in adults,” Can J Infect Dis Med Microbiol, vol. 16, no. 6, pp. 349–360, 2005.
[4] J. W. Warren, “Catheter-associated urinary tract infections,” Int. J. Antimicrob. Agents, vol. 17, no. 4, pp. 299–303, Apr. 2001.
[5] M. A. M. Rogers, L. Mody, S. R. Kaufman, B. E. Fries, L. F. McMahon Jr, and S. Saint, “Use of urinary collection devices in skilled nursing facilities in five states,” J Am Geriatr Soc, vol. 56, no. 5, pp. 854–861, May 2008.
[6] “Asymptomatic Bacteriuria in Adults - September 15, 2006 - American Family Physician.” [Online]. Available: http://www.aafp.org/afp/2006/0915/p985.html. [Accessed: 04-Dec-2011].
[7] B. A. Cunha, Infectious Diseases in Critical Care Medicine. CRC Press, 2007.[8] O. P. Kalra and A. Raizada, “Approach to a Patient with Urosepsis,” J Glob Infect Dis, vol.
1, no. 1, pp. 57–63, 2009.[9] J. B. Kaper, J. P. Nataro, and H. L. T. Mobley, “Pathogenic Escherichia coli,” Nature
Reviews Microbiology, vol. 2, no. 2, pp. 123–140, Feb. 2004.[10] B. Foxman, “The epidemiology of urinary tract infection,” Nat Rev Urol, vol. 7, no. 12, pp.
653–660, Dec. 2010.[11] J. Hacker, “Urinary tract infection: from basic science to clinical application,” Adv. Exp.
Med. Biol., vol. 485, pp. 1–8, 2000.[12] F. M. E. Wagenlehner and K. G. Naber, “New drugs for Gram-positive uropathogens,”
International Journal of Antimicrobial Agents, vol. 24, Supplement 1, no. 0, pp. 39–43, Sep. 2004.
[13] M. Rizvi, F. Khan, I. Shukla, A. Malik, and Shaheen, “Rising Prevalence of Antimicrobial Resistance in Urinary Tract Infections During Pregnancy: Necessity for Exploring Newer Treatment Options,” J Lab Physicians, vol. 3, no. 2, pp. 98–103, 2011.
[14] R. Platt, B. F. Polk, B. Murdock, and B. Rosner, “Risk Factors for Nosocomial Urinary Tract Infection,” Am. J. Epidemiol., vol. 124, no. 6, pp. 977–985, Dec. 1986.
[15] A. G. Rivett, J. A. Perry, and J. Cohen, “Urinary candidiasis: A prospective study in hospital patients,” Urological Research, vol. 14, no. 4, pp. 183–186, 1986.
[16] C. A. Kauffman, “Candiduria,” Clinical Infectious Diseases, vol. 41, no. Supplement 6, pp. S371–S376, Sep. 2005.
[17] T. Mazzulli, “Resistance trends in urinary tract pathogens and impact on management,” J.
59
Urol., vol. 168, no. 4 Pt 2, pp. 1720–1722, Oct. 2002.[18] M. Grabe, T E Bjerklund-Johansen, H Botto, M Cek, K G Naber, P Tenke, and F
Wagenlehner, “Guidelines on Urological Infections 2010,” in EAU Guidelines, Edition presented at the 25th EAU Annual Congress, Barcelona 2010., European Association of Urology, 2010.
[19] C. Carson and K. G. Naber, “Role of fluoroquinolones in the treatment of serious bacterial urinary tract infections,” Drugs, vol. 64, no. 12, pp. 1359–1373, 2004.
[20] K. Gupta, T. M. Hooton, and W. E. Stamm, “Increasing Antimicrobial Resistance and the Management of Uncomplicated Community-Acquired Urinary Tract Infections,” Ann Intern Med, vol. 135, no. 1, pp. 41–50, Jul. 2001.
[21] G. Kahlmeter, “Prevalence and antimicrobial susceptibility of pathogens in uncomplicated cystitis in Europe. The ECO·SENS study,” International Journal of Antimicrobial Agents, vol. 22, Supplement 2, pp. 49–52, Oct. 2003.
[22] J. A. Simerville, W. C. Maxted, and J. J. Pahira, “Urinalysis: a comprehensive review,” Am Fam Physician, vol. 71, no. 6, pp. 1153–1162, Mar. 2005.
[23] A. Hyman and L. T. Mann, “The nitrite reaction as an indicator of urinary infection,” vol. 22, p. 521, 1929.
[24] “Urisys 1100 Urine Analyzer.” Roche Diagnostics Corporation, 2008.[25] J. O. Eigbefoh, P. Isabu, E. Okpere, and J. Abebe, “The diagnostic accuracy of the rapid
dipstick test to predict asymptomatic urinary tract infection of pregnancy,” J Obstet Gynaecol, vol. 28, no. 5, pp. 490–495, Jul. 2008.
[26] R. W. Schrier, Diseases of the kidney and urinary tract. Lippincott Williams & Wilkins, 2007.
[27] Z. Samra, M. Heifetz, J. Talmor, E. Bain, and J. Bahar, “Evaluation of Use of a New Chromogenic Agar in Detection of Urinary Tract Pathogens,” J Clin Microbiol, vol. 36, no. 4, pp. 990–994, Apr. 1998.
[28] B. Pieretti, P. Brunati, B. Pini, C. Colzani, P. Congedo, M. Rocchi, and R. Terramocci, “Diagnosis of bacteriuria and leukocyturia by automated flow cytometry compared with urine culture,” J. Clin. Microbiol., vol. 48, no. 11, pp. 3990–3996, Nov. 2010.
[29] K. Kadkhoda, K. Manickam, P. Degagne, P. Sokolowski, P. Pang, N. Kontzie, and M. Alfa, “UF-1000i flow cytometry is an effective screening method for urine specimens,” Diagn. Microbiol. Infect. Dis., vol. 69, no. 2, pp. 130–136, Feb. 2011.
[30] L. E. Lehmann, S. Hauser, T. Malinka, S. Klaschik, F. Stüber, and M. Book, “Real-time polymerase chain-reaction detection of pathogens is feasible to supplement the diagnostic sequence for urinary tract infections,” BJU Int., vol. 106, no. 1, pp. 114–120, Jul. 2010.
[31] L. E. Lehmann, S. Hauser, T. Malinka, S. Klaschik, S. U. Weber, J.-C. Schewe, F. Stüber, and M. Book, “Rapid Qualitative Urinary Tract Infection Pathogen Identification by SeptiFast® Real-Time PCR,” PLoS ONE, vol. 6, no. 2, p. e17146, Feb. 2011.
[32] Y. Waisman, E. Zerem, L. Amir, and M. Mimouni, “The Uriscreen test was not better than standard urinalysis and dipstick tests for detecting urinary tract infection in children,” Evid Based Med, vol. 5, no. 4, pp. 126–126, Jul. 2000.
[33] D. S. Marshall, D. R. Linfert, A. Draghi, Y. S. McCarter, and G. J. Tsongalis, “Identification of Herpes Simplex Virus Genital Infection: Comparison of a Multiplex PCR Assay and
60
Traditional Viral Isolation Techniques,” Modern Pathology, vol. 14, no. 3, pp. 152–156, Mar. 2001.
[34] J. Wang, Y. Zhang, D. Xu, W. Shao, and Y. Lu, “Evaluation of the Sysmex UF-1000i for the Diagnosis of Urinary Tract Infection,” AJCP, vol. 133, no. 4, pp. 577–582, Apr. 2010.
[35] J. Steinmetz, J. Henny, and R. Gueguen, “Stepwise strategies in analysing haematuria and leukocyturia in screening,” Clin. Chem. Lab. Med., vol. 44, no. 4, pp. 464–470, 2006.
[36] P. P. Banada and A. K. Bhunia, “Antibodies and Immunoassays for Detection of Bacterial Pathogens,” in Principles of Bacterial Detection: Biosensors, Recognition Receptors and Microsystems, M. Zourob, S. Elwary, and A. Turner, Eds. Springer New York, 2008, pp. 567–602.
[37] P. A. Chapman and R. Ashton, “An evaluation of rapid methods for detecting Escherichia coli O157 on beef carcasses,” Int. J. Food Microbiol., vol. 87, no. 3, pp. 279–285, Nov. 2003.
[38] A. A. Lathrop, P. P. Banada, and A. K. Bhunia, “Differential expression of InlB and ActA in Listeria monocytogenes in selective and nonselective enrichment broths,” J. Appl. Microbiol., vol. 104, no. 3, pp. 627–639, Mar. 2008.
[39] K. E. Mach, C. B. Du, H. Phull, D. A. Haake, M.-C. Shih, E. J. Baron, and J. C. Liao, “Multiplex pathogen identification for polymicrobial urinary tract infections using biosensor technology: a prospective clinical study,” J. Urol., vol. 182, no. 6, pp. 2735–2741, Dec. 2009.
[40] Y. Pan, “Electrochemical immunosensor detection of urinary lactoferrin in clinical samples for urinary tract infection diagnosis,” Biosensors and Bioelectronics, vol. 26, no. 2, pp. 649–654, Oct. 2010.
[41] J. Zhang, S. Song, L. Zhang, L. Wang, H. Wu, D. Pan, and C. Fan, “Sequence-Specific Detection of Femtomolar DNA via a Chronocoulometric DNA Sensor (CDS): Effects of Nanoparticle-Mediated Amplification and Nanoscale Control of DNA Assembly at Electrodes,” J. Am. Chem. Soc., vol. 128, no. 26, pp. 8575–8580, 2006.
[42] C. Briones and M. Moreno, “Applications of peptide nucleic acids (PNAs) and locked nucleic acids (LNAs) in biosensor development,” Analytical and Bioanalytical Chemistry, Feb. 2012.
[43] L. Soleymani, Z. Fang, E. H. Sargent, and S. O. Kelley, “Programming the detection limits of biosensors through controlled nanostructuring,” Nat Nano, vol. 4, no. 12, pp. 844–848, Dec. 2009.
[44] J. C. Liao, M. Mastali, V. Gau, M. A. Suchard, A. K. Møller, D. A. Bruckner, J. T. Babbitt, Y. Li, J. Gornbein, E. M. Landaw, E. R. B. McCabe, B. M. Churchill, and D. A. Haake, “Use of Electrochemical DNA Biosensors for Rapid Molecular Identification of Uropathogens in Clinical Urine Specimens,” J Clin Microbiol, vol. 44, no. 2, pp. 561–570, Feb. 2006.
[45] J. Zhang, L. Wang, D. Pan, S. Song, and C. Fan, “DNA hybridization ‘turns on’ electro-catalysis at gold electrodes,” Chem. Commun. (Camb.), no. 11, pp. 1154–1156, Mar. 2007.
[46] L. Soleymani, Z. Fang, B. Lam, X. Bin, E. Vasilyeva, A. J. Ross, E. H. Sargent, and S. O. Kelley, “Hierarchical Nanotextured Microelectrodes Overcome the Molecular Transport Barrier To Achieve Rapid, Direct Bacterial Detection,” ACS Nano, vol. 5, no. 4, pp. 3360–
61
3366, 2011.[47] S. Mayo, D. Acevedo, C. Quiñones-Torrelo, I. Canós, and M. Sancho, “Clinical laboratory
automated urinalysis: comparison among automated microscopy, flow cytometry, two test strips analyzers, and manual microscopic examination of the urine sediments,” J. Clin. Lab. Anal., vol. 22, no. 4, pp. 262–270, 2008.
[48] C. Harper and R. Sampson, Electronic Materials and Processes Handbook, 2nd ed. McGraw-Hill Professional, 1993.
[49] M. Schlesinger, Modern Electroplating. John Wiley & Sons, 2010.[50] H. D. Hedrich and C. J. Raub, “Untersuchungen zur galvanischen palladium-abscheidung
aus zusatzfreien, ammoniakalischen elektrolyten,” Surface Technology, vol. 8, no. 4, pp. 347–362, Apr. 1979.
[51] Plastics Design Library Staff, Chemical Resistance of Plastics and Elastomers (3rd Electronic Edition) - Knovel, 3rd ed. William Andrew Publishing/Plastics Design Library, 2001.
[52] G. C. Jensen, C. E. Krause, G. A. Sotzing, and J. F. Rusling, “Inkjet-printed gold nanoparticle electrochemical arrays on plastic. Application to immunodetection of a cancer biomarker protein,” Phys. Chem. Chem. Phys., vol. 13, no. 11, pp. 4888–4894, Jan. 2011.
[53] P. Liepold, H. Wieder, H. Hillebrandt, A. Friebel, and G. Hartwich, “DNA-arrays with electrical detection: A label-free low cost technology for routine use in life sciences and diagnostics,” Bioelectrochemistry, vol. 67, no. 2, pp. 143–150, Oct. 2005.
[54] P. Liepold, T. Kratzmüller, N. Persike, M. Bandilla, M. Hinz, H. Wieder, H. Hillebrandt, E. Ferrer, and G. Hartwich, “Electrically detected displacement assay (EDDA): a practical approach to nucleic acid testing in clinical or medical diagnosis,” Analytical and Bioanalytical Chemistry, vol. 391, no. 5, pp. 1759–1772, 2008.
[55] R. M. Umek, S. W. Lin, J. Vielmetter, R. H. Terbrueggen, B. Irvine, C. J. Yu, J. F. Kayyem, H. Yowanto, G. F. Blackburn, D. H. Farkas, and Y.-P. Chen, “Electronic Detection of Nucleic Acids: A Versatile Platform for Molecular Diagnostics,” The Journal of Molecular Diagnostics, vol. 3, no. 2, pp. 74–84, May 2001.
[56] M. Reid, J. Punch, G. Grace, L. F. Garfias, and S. Belochapkine, “Corrosion resistance of copper-coated contacts,” Journal of the Electrochemical Society, vol. 153, no. 12.
[57] T. Imrell, “The importance of the thickness of silver coating in the corrosion behaviour of copper contacts,” in Proceedings of the Thirty-Seventh IEEE Holm Conference on Electrical Contacts, 1991, 1991, pp. 237 –243.
[58] J. W. Dini, Electrodeposition: The Materials Science of Coatings and Substrates. William Andrew, 1993.
[59] R. L.T., “A path: from electroplating through lithographic masks in electronics to LIGA in MEMS,” Electrochimica Acta, vol. 42, no. 20–22, pp. 2985–3005, 1997.
[60] F. Pellestor and P. Paulasova, “The peptide nucleic acids (PNAs), powerful tools for molecular genetics and cytogenetics,” Eur J Hum Genet, vol. 12, no. 9, pp. 694–700, Jun. 2004.
[61] Molecular Detection of Human Bacterial Pathogens - CRC Press Book. .[62] B. Ghebremedhin, F. Layer, W. Koenig, and B. Koenig, “Genetic classification and
distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60,
62
rpoB, sodA, and tuf gene sequences,” J. Clin. Microbiol., vol. 46, no. 3, pp. 1019–1025, Mar. 2008.
[63] T. Adékambi, M. Drancourt, and D. Raoult, “The rpoB gene as a tool for clinical microbiologists,” Trends in Microbiology, vol. 17, no. 1, pp. 37–45, Jan. 2009.
[64] K. E. Mach, R. Mohan, E. J. Baron, M.-C. Shih, V. Gau, P. K. Wong, and J. C. Liao, “A biosensor platform for rapid antimicrobial susceptibility testing directly from clinical samples,” J. Urol., vol. 185, no. 1, pp. 148–153, Jan. 2011.
[65] K. E. Mach, P. K. Wong, and J. C. Liao, “Biosensor diagnosis of urinary tract infections: a path to better treatment?,” Trends in Pharmacological Sciences, vol. 32, no. 6, pp. 330–336, Jun. 2011.
[66] J. C. Liao, M. Mastali, Y. Li, V. Gau, M. A. Suchard, J. Babbitt, J. Gornbein, E. M. Landaw, E. R. B. McCabe, B. M. Churchill, and D. A. Haake, “Development of an Advanced Electrochemical DNA Biosensor for Bacterial Pathogen Detection,” J Mol Diagn, vol. 9, no. 2, pp. 158–168, Apr. 2007.
[67] R. Mohan, K. E. Mach, M. Bercovici, Y. Pan, L. Dhulipala, P. K. Wong, and J. C. Liao, “Clinical Validation of Integrated Nucleic Acid and Protein Detection on an Electrochemical Biosensor Array for Urinary Tract Infection Diagnosis,” PLoS ONE, vol. 6, no. 10, p. e26846, Oct. 2011.
[68] K. B. Laupland, T. Ross, J. D. D. Pitout, D. L. Church, and D. B. Gregson, “Community-onset urinary tract infections: a population-based assessment,” Infection, vol. 35, no. 3, pp. 150–153, Jun. 2007.
[69] S. Karlin, J. Mrázek, A. Campbell, and D. Kaiser, “Characterizations of Highly Expressed Genes of Four Fast-Growing Bacteria,” J Bacteriol, vol. 183, no. 17, pp. 5025–5040, Sep. 2001.
[70] C. L. Schoch, K. A. Seifert, S. Huhndorf, V. Robert, J. L. Spouge, C. A. Levesque, W. Chen, E. Bolchacova, K. Voigt, P. W. Crous, A. N. Miller, M. J. Wingfield, M. C. Aime, K.-D. An, F.-Y. Bai, R. W. Barreto, D. Begerow, M.-J. Bergeron, M. Blackwell, T. Boekhout, M. Bogale, N. Boonyuen, A. R. Burgaz, B. Buyck, L. Cai, Q. Cai, G. Cardinali, P. Chaverri, B. J. Coppins, A. Crespo, P. Cubas, C. Cummings, U. Damm, D. Beer, Z. Wilhelm, D. Hoog, G. Sybren, R. Del-Prado, B. Dentinger, J. Diéguez-Uribeondo, P. K. Divakar, B. Douglas, M. Dueñas, T. A. Duong, U. Eberhardt, J. E. Edwards, M. S. Elshahed, K. Fliegerova, M. Furtado, M. A. García, Z.-W. Ge, G. W. Griffith, K. Griffiths, J. Z. Groenewald, M. Groenewald, M. Grube, M. Gryzenhout, L.-D. Guo, F. Hagen, S. Hambleton, R. C. Hamelin, K. Hansen, P. Harrold, G. Heller, C. Herrera, K. Hirayama, Y. Hirooka, H.-M. Ho, K. Hoffmann, V. Hofstetter, F. Högnabba, P. M. Hollingsworth, S.-B. Hong, K. Hosaka, J. Houbraken, K. Hughes, S. Huhtinen, K. D. Hyde, T. James, E. M. Johnson, J. E. Johnson, P. R. Johnston, E. B. G. Jones, L. J. Kelly, P. M. Kirk, D. G. Knapp, U. Kõljalg, G. M. Kovács, C. P. Kurtzman, S. Landvik, S. D. Leavitt, A. S. Liggenstoffer, K. Liimatainen, L. Lombard, J. J. Luangsa-Ard, H. T. Lumbsch, H. Maganti, S. S. N. Maharachchikumbura, M. P. Martin, T. W. May, A. R. McTaggart, A. S. Methven, W. Meyer, J.-M. Moncalvo, S. Mongkolsamrit, L. G. Nagy, R. H. Nilsson, T. Niskanen, I. Nyilasi, G. Okada, I. Okane, I. Olariaga, J. Otte, T. Papp, D. Park, T. Petkovits, R. Pino-Bodas, W. Quaedvlieg, H. A. Raja, D. Redecker, T. L. Rintoul, C. Ruibal, J. M. Sarmiento-Ramírez, I. Schmitt, A. Schüßler, C.
63
Shearer, K. Sotome, F. O. P. Stefani, S. Stenroos, B. Stielow, H. Stockinger, S. Suetrong, S.-O. Suh, G.-H. Sung, M. Suzuki, K. Tanaka, L. Tedersoo, M. T. Telleria, E. Tretter, W. A. Untereiner, H. Urbina, C. Vágvölgyi, A. Vialle, T. D. Vu, G. Walther, Q.-M. Wang, Y. Wang, B. S. Weir, M. Weiß, M. M. White, J. Xu, R. Yahr, Z. L. Yang, A. Yurkov, J.-C. Zamora, N. Zhang, W.-Y. Zhuang, and D. Schindel, “Nuclear Ribosomal Internal Transcribed Spacer (ITS) Region as a Universal DNA Barcode Marker for Fungi,” PNAS, vol. 109, no. 16, pp. 6241–6246, Apr. 2012.
[71] R. Owczarzy, A. V. Tataurov, Y. Wu, J. A. Manthey, K. A. McQuisten, H. G. Almabrazi, K. F. Pedersen, Y. Lin, J. Garretson, N. O. McEntaggart, C. A. Sailor, R. B. Dawson, and A. S. Peek, “IDT SciTools: a suite for analysis and design of nucleic acid oligomers,” Nucleic Acids Res., vol. 36, no. Web Server issue, pp. W163–169, Jul. 2008.
[72] S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman, “Basic local alignment search tool,” J. Mol. Biol., vol. 215, no. 3, pp. 403–410, Oct. 1990.
[73] M. A. Larkin, G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson, and D. G. Higgins, “Clustal W and Clustal X version 2.0,” Bioinformatics, vol. 23, no. 21, pp. 2947–2948, Nov. 2007.
[74] J. Peterson, S. Garges, M. Giovanni, P. McInnes, L. Wang, J. A. Schloss, V. Bonazzi, J. E. McEwen, K. A. Wetterstrand, C. Deal, C. C. Baker, V. Di Francesco, T. K. Howcroft, R. W. Karp, R. D. Lunsford, C. R. Wellington, T. Belachew, M. Wright, C. Giblin, H. David, M. Mills, R. Salomon, C. Mullins, B. Akolkar, L. Begg, C. Davis, L. Grandison, M. Humble, J. Khalsa, A. R. Little, H. Peavy, C. Pontzer, M. Portnoy, M. H. Sayre, P. Starke-Reed, S. Zakhari, J. Read, B. Watson, and M. Guyer, “The NIH Human Microbiome Project,” Genome Res, vol. 19, no. 12, pp. 2317–2323, Dec. 2009.
[75] C.-P. Sun, J. C. Liao, Y.-H. Zhang, V. Gau, M. Mastali, J. T. Babbitt, W. S. Grundfest, B. M. Churchill, E. R. B. McCabe, and D. A. Haake, “Rapid, species-specific detection of uropathogen 16S rDNA and rRNA at ambient temperature by dot-blot hybridization and an electrochemical sensor array,” Mol. Genet. Metab., vol. 84, no. 1, pp. 90–99, Jan. 2005.
[76] M. Mastali, J. T. Babbitt, Y. Li, E. M. Landaw, V. Gau, B. M. Churchill, and D. A. Haake, “Optimal probe length and target location for electrochemical detection of selected uropathogens at ambient temperature,” J. Clin. Microbiol., vol. 46, no. 8, pp. 2707–2716, Aug. 2008.
[77] G. James, “Universal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA Gene,” in PCR for Clinical Microbiology, M. Schuller, T. P. P. Sloots, G. S. S. James, C. L. L. Halliday, and I. W. J. W. J. Carter, Eds. Springer Netherlands, 2010, pp. 209–214.
[78] M. Albrecht, C. M. Sharma, R. Reinhardt, J. Vogel, and T. Rudel, “Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome,” Nucl. Acids Res., vol. 38, no. 3, pp. 868–877, Jan. 2010.
[79] M. Grape, A. Motakefi, S. Pavuluri, and G. Kahlmeter, “Standard and real time multiplex‐ PCR methods for detection of trimethoprim resistance dfr genes in large collections of bacteria,” Clinical Microbiology and Infection, vol. 13, no. 11, pp. 1112–1118, Aug. 2007.
[80] M. Trobos, H. Christensen, M. Sunde, S. Nordentoft, Y. Agerso, G. S. Simonsen, A. M. Hammerum, and J. E. Olsen, “Characterization of sulphonamide-resistant Escherichia coli
64
using comparison of sul2 gene sequences and multilocus sequence typing,” Microbiology, vol. 155, no. 3, pp. 831–836, Mar. 2009.
[81] L. Poirel, T. R. Walsh, V. Cuvillier, and P. Nordmann, “Multiplex PCR for detection of acquired carbapenemase genes,” Diagnostic Microbiology and Infectious Disease, vol. 70, no. 1, pp. 119–123, May 2011.
[82] J. C. Han and G. Y. Han, “A procedure for quantitative determination of tris(2-carboxyethyl)phosphine, an odorless reducing agent more stable and effective than dithiothreitol,” Anal. Biochem., vol. 220, no. 1, pp. 5–10, Jul. 1994.
[83] S. R. Bushby and G. H. Hitchings, “Trimethoprim, a sulphonamide potentiator.,” Br J Pharmacol Chemother, vol. 33, no. 1, pp. 72–90, May 1968.
[84] D. M. Livermore, T. G. Winstanley, and K. P. Shannon, “Interpretative reading: recognizing the unusual and inferring resistance mechanisms from resistance phenotypes,” Journal of Antimicrobial Chemotherapy, vol. 48, no. suppl 1, pp. 87–102, Jul. 2001.
[85] Z. Fang, L. Soleymani, G. Pampalakis, M. Yoshimoto, J. A. Squire, E. H. Sargent, and S. O. Kelley, “Direct Profiling of Cancer Biomarkers in Tumor Tissue Using a Multiplexed Nanostructured Microelectrode Integrated Circuit,” ACS Nano, vol. 3, no. 10, pp. 3207–3213, 2009.
65
V. Appendix
Antibiotic Resistance Genes
MecA is the penecillin-binding protein 2a that prevents penecillin-like antibiotics from inhibiting
transpeptidase activity, which is required for the assembly of a cell wall. ErmA1 provides resistance to
erythromycin, which works by inhibiting protein translation via binding to the 23S rRNA subunit. ErmA1
is rRNA adenine N-6-methyltransferase, which methylates adenine at position 2058 of 23S rRNA, thus
preventing binding. VanA confers resistance to vancomycin, which binds to the D-Ala-D-Ala ends of the
peptidoglycan used to crosslink bacterial cell walls. VanA is an operon containing genes that synthesize
peptidoglycan (cell wall cross-linking molecules) with D-Ala-D-lactate, which vancomycin can no longer
bind, rendering vancomycin useless. Tet(M) confers resistance to tetracycline, which is commonly used in
the treatment of C trachomatis. Tetracycline binds the A-site of ribosomes sterically hindering aminoacyl-
tRNA from elongating peptides. Tet(M) is a ribosomal protection protein that inhibits tetracycline binding
to ribosomes. BlaSHV represents a class of sulfhydryl-dependent beta-lactamases capable of degrading
penecillin, 1st, 2nd and 3rd generation cephalosporins but not carbapenems. BlaSHV enzymes are most
commonly found in clinical isolate of K pneumoniae. DfrA represents a class of dihydrofolate reductases
that are resistant to trimethoprim binding. Dihydrofolate reductase reduces dihydrofolate to
tetrahydrofolate in the folic acid metabolism pathway, and trimethoprim ordinarily works by disrupting its
activity. Sul2 is 1 of 3 sulphonamide resistance genes. Sulphamethoxazole is a sulphonamide that acts as a
dihydropteroate synthetase (DHPS) inhibitor. Trimethoprim and sulphamethoxazole (TMP-SMX) are
commonly used in combination since they target different portions of the folate synthesis pathway and
have been found to work synergistically [83]. TMP-SMX is a first line of therapy for UTIs but trends of
increasing resistance have been reported as described on page 4. AAC(6')-le-APH(2”) is a bifunctional
enzyme that degrades aminoglycosides via acetylation and phosphorylation. This aminoglycoside-
modifying enzyme is of greatest medical importance since it confers resistance to all aminoglycosides
except gentamicin [84]. blaTEM is a class of beta-lactamases with blaTEM-1 being the most commonly
expressed beta-lactamase. BlaKPC-2 is the most common beta-lactamase in the K pneumoniae
carbapenemases (KPC) class. KPC beta-lactamases confer resistance to all known penecillin-like
antibiotics, making them incredibly difficult to treat.
66
Peptide Synthesis Protocols
Swell Coupling
Step Operation Solvent Volume (μL)
Mix Time (hh:mm:ss)
Repeats Drain On
1 DMF Top Wash DMF 1000 00:10:00 3 True
2 Deprotection 20% piperidine/DMF 1000 00:10:00 2 True
3 DMF Top Wash DMF 2000 00:00:30 3 True
4 DCM Wash DCM 2000 00:00:30 1 True
5 DMF Top Wash DMF 2000 00:00:30 2 True
6 AA Building Block Reagent 1000 00:00:00 1 False
7 Activator 2 HATU/DMF 300 00:01:00 1 False
8 Base 0.4M NMM/DMF 500 01:00:00 1 True
9 DMF Top Wash DMF 2000 00:00:30 3 True
10 DCM Top Wash DCM 2000 00:00:30 1 True
11 DMF Top Wash DMF 2000 00:00:30 2 True
12 Deprotection 20% piperidine/DMF 1000 00:10:00 2 True
13 DMF Top Wash DMF 2000 00:00:30 3 True
14 DCM Top Wash DCM 2000 00:00:30 1 True
15 DMF Top Wash DMF 2000 00:00:30 2 True
Table 9: Program report for swell coupling step of PNA synthesis. Steps 1 corresponds to the 30 minute swell step in DMF.
67
Single Coupling
Step Operation Solvent Volume (μL)
Mix Time (hh:mm:ss)
Repeats Drain On
1 AA Building Block Reagent 1000 00:00:00 1 False
2 Activator 2 HATU/DMF 300 00:01:00 1 False
3 Base 0.4M NMM/DMF 500 01:00:00 1 True
4 DMF Top Wash DMF 2000 00:00:30 3 True
5 DCM Top Wash DCM 2000 00:00:30 1 True
6 DMF Top Wash DMF 2000 00:00:30 2 True
7 Deprotection 20% piperidine/DMF 1000 00:10:00 2 True
8 DMF Top Wash DMF 2000 00:00:30 3 True
9 DCM Top Wash DCM 2000 00:00:30 1 True
10 DMF Top Wash DMF 2000 00:00:30 2 True
Table 10: Single coupling protocol used for all coupling reactions after the first monomer addition.
68