towards computing the cure for cancer -...
TRANSCRIPT
synergy.cs.vt.edu
Towards Computing the Cure for Cancer
Wu Feng, PhD Department of Computer Science
Department of Electrical & Computer Engineering
Heshan Lin, PhD Department of Computer Science
synergy.cs.vt.edu
Facts about Cancer
• How frequent does a person die from cancer in the U.S.? – Once every MINUTE
• How many new cases of cancer diagnosed worldwide in 2007? – More than 12 MILLION (12,000,000)
• How many died from cancer in 2007? – 7.6 MILLION, making it the leading cause of death worldwide
• What are the conservative projections for 2050? – New Cases: More than 27 MILLION – Deaths: 17.6 MILLION if our ability to prevent, diagnose and treat cancer
does not improve
Sources: ICGC, TCGA, WHO
synergy.cs.vt.edu
Goals of Cancer Genome Research
• Identify changes in the genomes of tumors … that drive cancer progression • Identify new targets for therapy • Select drugs based on the genomics of the tumor
Source: ICGC
The Ultimate Goal
The right treatment … at the right dose … for the right patient … at the right time … for the right outcome
Source: MediaPharma
synergy.cs.vt.edu
Large-Scale Cancer Genome Studies
• Johns Hopkins U. (Wood et al., Science, Oct. 2007) – More than 18,000 genes analyzed for mutations – 11 breast and 11 colon tumors
• Welcome Trust Sanger Institute (Greenman et al., Science, Mar. 2007) – 518 genes analyzed for mutations – 210 tumors of various types
• The Cancer Genome Atlas (Collins & Barker, Sci. Am., Mar. 2007) – Multiple technologies to map genetic changes of 20 cancers
• International Cancer Genome Consortium – Identify genomic, transcriptomic, and epigenomic changes in 50 tumor
types
synergy.cs.vt.edu
Sequencing Throughput
synergy.cs.vt.edu
Cost of DNA Sequencing
800-fold drop from 2007 to 2012
synergy.cs.vt.edu
Next-gen sequencing (NGS) presents many opportunities to
understanding cancer genome changes
synergy.cs.vt.edu
Challenges of Next-Generation Sequencing (NGS) for Cancer
• Efficiently store and analyze massive amounts of DNA data
synergy.cs.vt.edu
Personalizing NGS … Not the Analysis
synergy.cs.vt.edu
Towards Personalizing NGS Analysis
synergy.cs.vt.edu
Short-Read Mapping
• Bfast • BioScope • Bowtie/Bowtie2 • BWA • CLC bio • CloudBurst • Eland/Eland2 • GenomeMapper • GnuMap • Karma • MAQ
• SeqMap • SHRiMP/SHRiMP2 • Slider/Slider II • SOAP/SOAP2 • Srprism • Stampy • Vmatch • ZOOM … and so on
• MOM • Mosaik • MrFAST/
MrsFAST • NovoAlign • PASS • PerM • RazerS • RMAP • SSAHA2 • Segemehl
synergy.cs.vt.edu
Pain Points for Cancer Biologist • Time to Solution
– Sequencing throughput >> compute throughput – Days to analyze (instead of hours or even
minutes)
• Ease of Use – Steep learning curve to identify right tools, use
tools, and integrate & compose tools
How do I integrate the use of tools from my toolbox?
Which bio tool do I use and how do I use it?
Key Unmet Need in NGS
“Lack of user-friendly tools to decipher the large amount of data generated by next-generation sequencing (NGS).”
Source: DeciBio, November 2011
synergy.cs.vt.edu
Towards Computing the Cure for Cancer http://www.computethecure.org/
• Empower scientists to fight cancer … through innovative parallel computing
• Foster a community … for developing accelerated bioinformatics tools
• Develop an easy-to-use genome analysis framework … to allow cancer biologists to focus on the science of cancer rather than on the computer science
synergy.cs.vt.edu
NVIDIA Confidential
A Framework for Genome Analysis
BED
Local Realignment
Input Files(Raw data from ANYnextgen sequencer)
FASTQ
BAM
Framework
Mapping
BWA-GPU
STAMPY-GPU
OTHER VT-LR
OTHER
Output Files
BAM
interpretability with other tools/
pipelines
VCF
Variation data for use by
researcher/genome browsers
Command Line
BioPerl, etc.
GenomeBrowsers
User Interface
Discovery
CIGARSER
OTHER
Improved Tools
Novel Tools
RepeatSeq FastR
Source: NVIDIA Foundation & D. Mittelman (Inspired by GATK @ Broad Institute)
Open Genomics Engine (OpenGE)
Phase 1
synergy.cs.vt.edu
Overall Status of OpenGE
• Open-source software framework for cancer researchers to improve the productivity (i.e., speed and ease of use) with which to identify DNA mutations that lead to cancer.
• Sample OpenGE Workflows – BWA GATK IndelRealigner GATK Genotyper – BWA FastR Dindel – BWA SAMtools
• Primary OpenGE Plug-Ins – Short-Read Mapping: BWA and (soon) CUSHAW – Local Realignment: FastR and GATK Realignment – Discovery: Dindel and RepeatSeq
synergy.cs.vt.edu
Teaser: Beyond OpenGE
Example: N-body • Fermi
– 400M interactions (200,000 bodies) – 1M particles/second
• Kepler – 789M interactions (280,875 bodies) – 10M particles/second billions of
years of simulation
• Hardware design that keeps future applications in mind
• Basis for future applications? 13 computational dwarfs
Similar Idea for OpenGE – Abstract common algorithmic
components – Provide a library of GPU-
accelerated components for building high-performance analysis (plug-in) tools
Why?
synergy.cs.vt.edu
Roadmap
• Cancer Genome Research – Goals – Challenges of Next-Generation Sequencing – Towards Computing the Cure for Cancer (Phase I)
Open Genomics Engine (OpenGE)
• OpenGE – Overview – Workflow & Plug-In Specification – User Interface – Beyond OpenGE
synergy.cs.vt.edu
OpenGE Design Goals
• Flexible – Support majority of existing genomics analysis tools – Allow composing sophisticated workflows
• Extensible – Fine-grained control of heterogeneous resources
Mapping between plugins and GPUs Establish pipeline between CPU and GPUs
• Easy to Use – Lightweight – Currently provides intuitive command line interface – Could be extended to GUI in the future
synergy.cs.vt.edu
OpenGE Overview
Workflows
Executing Engine
Parser
Instantiated Pipeline
User Inputs
Output
Plugin1 Plugin2 PluginN …
synergy.cs.vt.edu
Plugin XML Definition
• Inspired by Galaxy • Structures
– Command(s) – Input parameters – Output parameters
• Conditional parameters – Ternary operator
[condition? para1: para2] String comparison
– Str1 == Str2 – Str1 != Str2
Boolean variables – True – False
<plugin id="bwa_aln" name="BWA Align" version="0.5.9"> <description>Align reads with BWA</description> <commands> <command> bwa aln [$num_threads != ""? -t $numthreads] $ref_genome $input_read -f $output_sai </command> </commands>
<inputs> <param name="ref_genome" type="file" format="bwt_index" label="Index of reference genome"/> <param name="input_read" type="file" format="fastq" label="Input read file"/> <param name="num_threads" type="int" value="4" label="Number of threads"/> </inputs>
<outputs> <param name="output_sai" type="file" format="sai" label="Output BWA alignments" /> </outputs> </plugin>
synergy.cs.vt.edu
Workflow XML Definition
• Essentially a directed acyclic graph (DAG) of plugins • Structure
– Inputs – Outputs – Steps
Plugin/sub-workflow Inputs Outputs
• Dependencies – Express dependency via input-output connections between steps – Output file automatically generated
synergy.cs.vt.edu
Example Workflow <inputs> <param name="in.read1" type="file" format="fastq" /> <param name="in.read2" type="file" format="fastq" /> <param name=“in.genome" type="file” format="bwt" /> </inputs>
<steps> <step id=”1" type="plugin" plugin_id="bwa_aln" > <inputs> <param name="input_read" value="$in.read1" /> <param name="ref_genome" value=”$in.genome" /> </inputs> <outputs>
<param name="output_sai" /> </outputs> </step> <step id=”2" type="plugin" plugin_id="bwa_aln" > <inputs> <param name="input_read" value=”$in.read2" /> <param name="ref_genome" value="$in.genome" /> </inputs>
<outputs> <param name="output_sai" /> </outputs> </step>
<step id=”3" type="plugin" plugin_id="bwa_sampe" > <inputs> <param name="input_read1" value="$in.read1" /> <param name="input_read2" value="$in.read2" /> <param name="ref_genome" value=”$in.genome" /> <param name="input_sai1" value=”$1.output_sai" /> <param name="input_sai2" value=”$2.output_sai" /> </inputs> <outputs> <param name="output_sam" /> </outputs> </step> </steps>
<outputs> <param name="output_sam" type="file" format="sam" value=”$3.output_sam" /> </outputs>
synergy.cs.vt.edu
Workflow DAG
Input
Step1 Step2
Step3
Output
in.read1
input_read = $in.read1 ref_genome = $in.genome
in.read2
in.genome
1. output_sai 2.output_sai
ref_genome = $in.genome $input_sai1 = 1.output_sai $input_sai2 = 2.output_sai
input_read = $in.read1 ref_genome = $in.genome
synergy.cs.vt.edu
OpenGE User Interface
• Command line interface
• Programmable interface
• Annotated script importer
synergy.cs.vt.edu
Command Line Interface
• Query – listWorkflows – listPlugins – queryWorkflow – queryPlugin – …
• Edit – CreatePluginTemplate – CreateWorkflow – …
• Execute – testWorkflow – executeWorkflow – …
synergy.cs.vt.edu
CLI Screen Shot
ctc > testWorkflow bwa_pe_sam --input-read1 1.fastq --input-read2 2.fastq --ref_genome hg19.fa --output_sam aln.sam
[Mon May 14 20:04:46 2012] Changing working directory to /Users/hlin2/codes/CTC/engine/test/workspace/TfMkkJrxO [Mon May 14 20:04:46 2012] Executing: bwa aln -n 0.04 -o 1 -e -1 -d 16 -i 5 -k 2 -t 4 -M 3 -O 11 -E 4 -q 0 -B 0 hg19.fa 1.fastq -f /Users/hlin2/codes/CTC/engine/test/workspace/TfMkkJrxO/aln1-bwa_aln-output_sai.tmp.sai [Mon May 14 20:04:46 2012] Executing: bwa aln -n 0.04 -o 1 -e -1 -d 16 -i 5 -k 2 -t 4 -M 3 -O 11 -E 4 -q 0 -B 0 hg19.fa 2.fastq -f /Users/hlin2/codes/CTC/engine/test/workspace/TfMkkJrxO/aln2-bwa_aln-output_sai.tmp.sai [Mon May 14 20:04:46 2012] Executing: bwa sampe -a 500 -o 100000 -n 3 -N 10 hg19.fa aln1-bwa_aln-output_sai.tmp.sai aln2-bwa_aln-output_sai.tmp.sai 1.fastq 2.fastq -f /Users/hlin2/codes/CTC/engine/test/workspace/TfMkkJrxO/tosam-bwa_sampe-output_sam.tmp.sam [Mon May 14 20:04:46 2012] Moving file from tosam-bwa_sampe-output_sam.tmp.sam to /Users/hlin2/codes/CTC/engine/aln.sam [Mon May 14 20:04:46 2012] Changing working directory to /Users/hlin2/codes/CTC/engine
ctc >
synergy.cs.vt.edu
Programmable Interface
Workflow workflow;
// Construct inputs of the workflow Parameter p1(DATA_FILE, "", "fastq", ""); workflow.addInput("in_read1", p1); …. // Construct steps of the workflow WorkflowStep s_aln1(PLUGIN, "aln1", "bwa_aln"); s_aln1.addInput("input_read", "$in_read1"); s_aln1.addInput("ref_genome", "$in_genome"); s_aln1.addOutput("output_sai"); workflow.addStep(s_aln1); … WorkflowStep s_aln2(PLUGIN, "aln2", "bwa_aln"); s_aln2.addInput("input_read", "$in_read2"); s_aln2.addInput("ref_genome", "$in_genome"); s_aln2.addOutput("output_sai"); workflow.addStep(s_aln2);
… WorkflowStep s_tosam(PLUGIN, "tosam", "bwa_sampe"); s_tosam.addInput("input_read1", "$in_read1"); s_tosam.addInput("input_read2", "$in_read2"); s_tosam.addInput("ref_genome", "$in_genome"); s_tosam.addInput("input_sai1", "$aln1.output_sai"); s_tosam.addInput("input_sai2", "$aln2.output_sai"); s_tosam.addOutput("output_sam"); workflow.addStep(s_tosam);
Parameter p4(DATA_FILE, "$tobam.output_bam", "bam", ""); workflow.addOutput("output", p4); … Engine engine(engine_dir); engine.executeWorkflow(workflow, paras, true);
synergy.cs.vt.edu
Annotated Scripts
• Import from users’ existing workflow scripts – Automatically generate XML
plugins and workflows – Automatically connect two
consecutive steps
• Limitation – Support single input and
single output for each step
• Inspired by Bpipe http://code.google.com/p/bpipe/
WORKFLOW_ID=imported_variant_calling WORKFLOW_NAME="Call variants with samtools" WORKFLOW_VERSION=1.0.0
REFERENCE=hg19.fa align := { bwa aln -I -t 8 $REFERENCE $input > ${input}.sai bwa samse $REFERENCE ${input}.sai $input > $output } sort := { samtools view -bSu $input | samtools sort - $output mv ${output}.bam ${output} } index := { samtools index $input } call_variants := { samtools mpileup -uf $REFERENCE $input | bcftools view -bvcg - > $output }
synergy.cs.vt.edu
Acknowledgements
• David Mittelman, PhD, Assoc. Prof. @ VBI – Guidance on the life science aspects for the project – Caretaker of OpenGE
Future correspondence and questions on OpenGE to be forwarded to him
• Kenneth Lee and Jing Zhang – Contributions to FastR and the “Compute the Cure” framework
Open Genomics Engine (OpenGE)
• Gareth Highman – Contributions to RepeatSeq
• Ashwin Aji, NVIDIA Graduate Fellow – Contributions to GPU-accelerated dindel
synergy.cs.vt.edu
Roadmap
• Cancer Genome Research – Goals – Challenges of Next-Generation Sequencing – Towards Computing the Cure for Cancer (Phase I)
Open Genomics Engine (OpenGE)
• OpenGE – Overview – Workflow & Plug-In Specification – User Interface – Beyond OpenGE: A Computer Scientist’s Perspective
synergy.cs.vt.edu
From Reads to Genetic Variation Detection
Source: 1000 Genomes project: From mapping reads to de novo mutations, Mark DePristo, Broad Institute
synergy.cs.vt.edu
Read Mapping
• Problem definition – Given a read, identify where is from the reference genome
• Computational challenge? – Make it FAST … VERY FAST
Fastest short-read mapping algorithms take 13 CPU day to align a human genome with standard coverage
– Make it accurate Sequencing errors Mapping errors
synergy.cs.vt.edu
Hash-Based Mapping Algorithms
• Basic idea: Seed and extend – Build a hash table on k-length words on genome or reads – Segment query sequence into k-length seed words
… CAAACCAGCTCTTAAGGGCAGAACTCTGAAAGACAACTGAGCTGCTG …!Ref Genome: Read Seed:
Read
AGGGCAGAAC!
Hash Table
synergy.cs.vt.edu
Hash-Based Mapping Algorithms (Cont.)
• Improvement: Spaced seeding – More sensitive than consecutive seeding
• Hashing strategies – Hash on reads
Memory efficient: controllable usage Redundant computation for repetitive regions in the genome
– Hash on genome Save computation for searching repetitive regions Memory intensive: 10s of GBs
… CAAACCAGCTCTTAAGGGCAGAACTCTGAAAGACAACTGAGCTGCTG …! 100111110111! ATTGCAGACCTC!
Ref Genome: Mask: Read Seed:
synergy.cs.vt.edu
FM-Index Based Mapping
• Build upon Burrows-Wheeler Transform • Tree-based search backward search ranges in suffix array
– Mimic inexact search with exhaustive tree traversal
Source: Fast and Accurate Short Read Alignment with Burrows-Wheeler Transfer
synergy.cs.vt.edu
FM-Index Based Mapping (Cont.)
• Advantages – Small memory footprint
FM-Index: 2-8 GBs Suffix tree: > 35 GBs Suffix array: > 12 GBs Hash-table: > 12 GBs
– Fast mapping on repetitive regions
• Disadvantages – Search space grow fast as more mismatches and gaps allowed – Not applicable for long reads
synergy.cs.vt.edu
FM-Index vs. Hash-Based Mapping
• FM-Index based mappers are widely used for speed – But less sensitive than hash-based approach
• Most accurate mappers are still hash-based – Examples: NovoAlign, Stampy
• Alignment tools used in the 1000 Genomes Project – Illumina: BWA (FM-Index) – ABI Solid: BFAST (Hash) – Roche 454: MOSAIK (Hash)
synergy.cs.vt.edu
Emergent Trends
• Hybrid mapper – Use FM-Index based mappers to align well matched reads, and use
hash-based mappers to align the rest – Example: Stampy
• FM-Index seed-and-extend mappers – Lookup seed matching in FM-Index – Extend seeded alignments with dynamic programming – Can be used to align long reads
Examples: BWA-SW, Bowtie2
synergy.cs.vt.edu
Common Programming Components
• Indexing and lookup – Hashing with spaced seeding – FM-Index
• Dynamic programming – E.g., Smith-Waterman, Needleman-Wunsch
• Preliminary studies on GPU acceleration
Applications Speedup on GPU
Hashing on reads RMAP 10 X
FM-Index SOAP3 7.5 X over BWA
CUSHAW 6-12 X over BWA
Smith Waterman FastR (w/o traceback) 30 X
FastR (w traceback) 7 X
synergy.cs.vt.edu
Variation Discovery
• Opportunities – Abundance of parallelism (MapReduce type of computation)
Inference on each variant sites are independent
– Early GPU acceleration study case GSNP: 40X over SOAPsnp
• Challenges – Mapping statistical analysis on GPUs – Preliminary effort in accelerating DIndel with GPU
Detect short insertions and deletions in genome based probalistic realignments
Compute intensive: 18 hours on chromosome 22 Initial speedup: 2X
– Bottleneck: data marshaling and demarshaling
synergy.cs.vt.edu
Closing Thought
• A GPU-accelerated bioinformatics library for genome analysis? – Possible with convergence of algorithmic patterns
• Challenges – Bioinformatics algorithms are irregular
More challenging to map compared to dense matrix computation Solution: Kepler?
– What is the right level of abstractions Balance between code restructuring and performance Higher-level programming model to bridge the gap?
synergy.cs.vt.edu
Conclusion
• Compute the Cure – A strategic philanthropic initiative of the NVIDIA Foundation that aims
to support cancer researchers in the search for a cure.
• Open Genomics Engine (OpenGE) – An open-source software framework for cancer researchers to
accelerate the identification of DNA mutations that lead to cancer.
• We Want You! – Open access to the OpenGE framework. – Source code repository to add algorithms and create plug-ins. – Seeking sponsors and adopters that may wish to connect OpenGE to
their existing genomics workflow tools.