transcription of dna to rna
DESCRIPTION
TRANSCRIPT
Transcription of DNA to RNA
How does RNA differ from DNA?
DNA RNA
•Deoxyribonucleic acid•Double helix
•Ribonucleic acid•Single strand•Makes proteins
Both have different
nucleotides!
Both have different
nucleotides!
Differences in Nucleotides
RNA Nucleotides
DNA Nucleotides
• Guanine• Cytosine• Adenine• Uracil
• Guanine• Cytosine• Adenine• Thymine
G
T
A
C
G
U
A
C
RNA
DNA
What is transcription?•Transcription is the name given to the process where the information in a gene in a DNA strand is transferred to an RNA molecule.
Transfer RNA
Messenger RNA (mRNA)
Ribosome RNA
Transfer RNA•Transfers specific amino acids to growing polypeptide chains at the ribosomal site of protein synthesis during translation.
Messenger RNA (mRNA)•The form of RNA that mediates the transfer of genetic information from the cell nucleus to ribosomes in the cytoplasm, where it serves as a template for protein synthesis.
Ribosomal RNA•It’s a component of the ribosome, and is essential for protein synthesis in all living organisms.
RNA Polymerase Binds to DNA
Elongation
Termination
RNA Polymerase Binds to DNA•DNA is transcribed by an enzyme called RNA
polymerase. Specific nucleotide sequences tell RNA polymerase where to begin and where to end. RNA polymerase attaches to the DNA at a specific area called the promoter region.
Elongation•Certain proteins called transcription factors unwind
the DNA strand and allow RNA polymerase to transcribe only a single strand of DNA into a single stranded RNA polymer called messenger RNA (mRNA).
•The strand that serves as the template is called the antisense strand. The strand that is not transcribed is called the sense strand.
Termination• RNA polymerase moves along the DNA until it reaches
a terminator sequence. At that point, RNA polymerase releases the mRNA polymer and detaches from the DNA.
• The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.
http://www.youtube.com/watch?v=5MfSYnItYvg
SUMMARY• RNA is created from DNA template• RNA polymerase bonds to the promoter site of a DNA strand in order to
begin DNA transcription• It conbines with transcription factors to form the transcription iniciation
complex• RNA polymerase moves thru DNA and breaks hidrogen bonds• Only one strand of DNA is copied in the process of transcription• RNA nucleotides pair with complementary DNA nucleotides in order to
form a RNA strand (its known as mRNA; its the copy of the message contained in the gene)
• Ends when the RNA polymerase reaches the termination site of the DNA, the DNA strands unite again and the RNA moves away.
• The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.
Activity DNA-RNA
•ACTGGATCAAGTAGGATCATGAA
•TACGGATCGTTATTCGATAGTTCA
•TTTCGGATGGTCTAGGATAGTACG