transcription, translation & protein synthesis. protein synthesis protein synthesis is the...

26
Transcription, Transcription, Translation & Translation & Protein Synthesis Protein Synthesis

Upload: leo-mcdaniel

Post on 28-Dec-2015

234 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Transcription, Transcription, Translation &Translation &

Protein SynthesisProtein Synthesis

Page 2: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Protein Synthesis

Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA.

However: DNA is only found in the nucleus Proteins are only made outside the

nucleus – in the cytoplasm.

Page 3: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Protein Synthesis

How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus?

A molecular cousin of DNA – RNA – is used to carry these messages.

Page 4: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Ribonucleic Acids (RNA)

The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm).

There are three types of RNA:1. mRNA – carries a message from the DNA to

the ribosome2. tRNA – transports amino acids to the mRNA

to make a protein3. rRNA – make up ribosomes, which make

protein.

Page 5: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Ribonucleic Acids (RNA)

RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a

deoxyribose sugar (hence the name…)

Contains uracil instead of thymine. RNA is single-stranded, not double-

stranded

Page 6: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Ribonucleic Acids (RNA)

Page 7: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Protein Synthesis

Occurs in TWO steps:1. Transcription – the genetic

information from a strand of DNA is copied into a strand of mRNA

2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

Page 8: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

The Central Dogma

This order of events is called the central dogma of molecular biology:

DNA RNA P RO T E

IN

Page 9: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step One: Transcription

1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix.

2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different??

3. New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

Page 10: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step One: Transcription

Watch this simplified animation:

Transcription Animation

Page 11: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step One: Transcription

Try it! What RNA strand will be made from the following DNA sequence?

TACGCATGACTAGCAAGTCTAACT

Page 12: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step One: Transcription

Try it! What RNA strand will be made from the following DNA sequence?

TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA

Page 13: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step 1½: RNA Editing

An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed.

An mRNA sequence that does NOT code for protein is called an interoninteron. A sequence that is useful in making a protein is called an exonexon.

Page 14: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step 1½: RNA Editing

DNA

exon 1 interon exon 2 interon exon 3

pre-RNA (in nucleus)

exon 1 exon 2 exon 3

RNA (in cytoplasm)

transcription

interon

interon

RNA editing

Page 15: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence.

How does the mRNA sequence translate into an amino acid sequence?

Page 16: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

Problem: There are 20 different amino acids. There are 4 RNA bases.

phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly

A T C G

Page 17: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

Watch this simplified animation:

Translation Animation

Page 18: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

1. So how do you exactly go about determining what protein your cells are going to make?

2. FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA:

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Page 19: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:

?

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Page 20: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

The Genetic Code

Page 21: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

?

Page 22: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

The Genetic Code

Page 23: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp ???arg thr asp arg ser

Page 24: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

The Genetic Code

Page 25: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

Step Two: Translation

2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:

met

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

asp STOPmet thr asp arg ser

Page 26: Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message

RECAP:

1. DNA is transcribed into mRNA in the nucleus.

2. The mRNA leaves the nucleus and enters the cytoplasm.

3. The protein is translated from the mRNA sequence using tRNA and amino acids.