transfection of cdna with g→t point mutation at the cleavage site of insulin receptors to cos 7...

Vol. 167, No. 3, 1990 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

March 30, 1990 Pages 1073-1078

TRANSFECTION OF cDNA WITH G+T POINT MUTATION AT THE CLEAVAGE SITE OF INSULIN RECEPTORS TO COS 7 CELLS

Masashi Kobayashi. Masaaki Sugibayashi. Toshiyasu Sasaoka. Katsuya Egawa, Yuikio Shigeta, Mikio Tamaki*, Etsuo Nakamura*. and Hiroshi Teraoka*

Third Department of Medicine, Shiga University of Medical Science,

Oh tsu, Japan

*Shionogi Research Laboratories, Shionogi & Co. Ltd.,

Osaka, Japan

Received January 30, 1990

To study whether the G+T point mutation of insulin proreceptors at the cleavage site which changed -Arg-Lys-Arg-Arg- to -Arg-Lys-Arg-Ser- caused unprocessed insulin receptors with decreased insulin binding 7

affinity. we performed transfection of cDNA with the mutation in COS 7 cells and examined the expressed insulin receptors. After site-directed mutagenesis, an expression vector pGEM3SV was used to make a plasmid which contained full- length HIRcDNA behind SV40 early promoter. Transfection of normal HIR cDNA produced normal insulin receptors on the plasma membranes in COS 7 cells. However, transfection of cDNA with the mutation resulted in the presence of 210K proreceptors in the plasma membranes with decreased insulin binding ability (35% of normal). These results suggest that the mutation, not the defect of converting enzyme, was the cause for unprocessed insulin proreceptors in the patients with insulin resistance. 0 1990 Academic Press. Inc.

We previously reported the siblings with insulin resistance which was

caused by unprocessed insulin proreceptors due to point mutation at the

cleavage site (1.2) _ The mutation changed the structure of the cleavage

site from Arg-Lys-Arg-Arg to Arg-Lys-Arg-Ser which could not be cleaved by

processing enzyme in the cells of the patients. The abnormal cleavage site

was cleaved by trypsin to produce normal a-subunit and B-subunit, and the

binding ability and insulin action were normalized (3.4). Therefore, the

receptor structure other than the cleavage site appeared to be normal.

However, it still remained to be clarified whether the abnormal processing

enzyme or the mutation at the cleavage site was the cause for the

unprocessed insulin proreceptors. Thus, we performed transfection of cDNA

0006-291x/90 $1.50

1073 Copyright 0 1990 by Academic Press, Inc.

All rights of reproduction in any form reserved.


with the mutation to COS 7 cells and examined the expressed insulin

receptors.

Materials and Methods

Materials:Purified porcine insulin was a gift from Shimizu Phamaceutical Co (Shizuoka. Japan). Na [ ‘“‘I] was purchased from New England Nuclear (Boston, MA, USA), Dulbecco’s Eagles medium and fetal calf serum (FCS) from Gibco Biological Co (Grand Island, NY, USA), disuccinimydyl suberate (DSS) from Pierce-Chemical Co (Rockford Ill. USA), Protein A (Pansorbin) was from Calbiochem-Behring Co (La Jolla, CA, USA), wheat germ agglutinin (WGA) agarose from Pharmacia PL Biochemical Co (Uppsala. Sweden). Insulin receptors cDNA was kindly supplied by Dr. G.I. Bell of Chicago University and COS 7 cells by Dr. Sokawa of Kyoto University, Japan. All the restriction enzymes were purchased from Takara Shuzo Co.(Kyoto, Japan). DNA manipulation:All DNA manipulations were carried out by standard procedure (5). A eukaryotic expression vector, designated pCEM3SV. was constructed from pGEM3 and pKSV-10. A full-length cDNA of HIR carrying 130 bp and 940 bp of 5’- and 3’-noncoding region, respectively. was prepared. This DNA fragment containing the entire coding sequence of HIR cDNA was blunt-ended with the Klenow enzyme and inserted into an expression vector pGEM3. after the BgllI site had been made blunt. The resulting plasmid was named pCEM3SV- HIR and contained full-length HIR cDNA behind the SV40 early promotor, splicing and polyadenylation signals, and sv40 origin of replication (Figure 1). Site-directed in vitro mutagenesis:The BamHI-PstI fragment (586bp) containing the coding sequence for a normal connecting peptide between Q- and B-subunits was subcloned into M13mplO;single-stranded DNA from this recombinant phase was used as template for oligonucleotide-directed mutagenesis (6). The oligonucleotide used was 5’ GGAAACGCAGTTCCCTTGGCG 3’ to create an Arg-tSer mutation as detected in the patient as prevously reported (1). A mutant Ml3 plaque was identified and the double-stranded replicative form was isolated. The BamHI- PstI fragment was then cloned into BamHI/PstI- cleaved pGEM3SV-HIR and the resulting plasmid pGEM3SV-HIR with mutated cDNA was used for transfection. The structure of mutant plasmid was verified by restriction enzyme analysis and nucleotide sequencing.

Figure 1. The structure of plasmid. pCEM3SV-HIR. The method to construct the DNA of the plasmid is described in Method.

1074


Cells and transfection:COS 7 cells were grown in Dulbecco’s Eagles medium supplemented with 10% fetal calf serum. Cells were transfected with 5 ug plasmid DNA per lo5 cells, using DEAE dextran method (7). Insulin binding and analysis of insulin receptors:Insulin binding and surface labeling of cells and subsequent analysis of insulin receptors by electrophoresis after preparation of partially purified insulin receptors were previously reported (1,2,3). Insulin binding was performed in a monolayer in the 6 well dishes and was normalized to percent bound to 10’ cells.

Results

After transfection with normal or mutated cDNA. insulin binding was

perfomed in these transfected cells. Insulin binding reached the maximal at

72 hrs after transfection with normal or mutated cDNA and then it decreased

gradually. The cells without transfection showed very low insulin binding

,’ 1 0 24 48 72 96 120 144

hours

Figure 2. Time course of insulin binding to COS 7 cells after transfection -- with Intact (C--O) or mutated ( e--m ) HIR cDNA. Percentage binding shown in the vertical axis indicates percent binding over that shown in the COS 7 cells without transfection. The binding data of those in COS 7 cells without transfection were defined as 100%. Data represent mean f SEM. There were significant differences (p<O.O5) between the two groups transfected with intact or mutant HIR cDNA transfection at all time points from 48 to 144 hours.

1075


IR-Ab C-1 (+) C-1 (t) C-1 (+I

Figure 3. Surface labeling of cos 7 cells with [lz51] After immunoprecipitation with (t) or without (-) anti-insulin-receptor antibody (IR Ab) plus pansorbin. sample was treated with Laemmli buffer containing 199 mM dithiothreitol and was applied to sodium dodecyl sulfate polyacrylamide gel electrophoresis. Control:wild type. no transfection. Intactztransfection with intact HIR cDNA, and Mutanttransfection with mutated HIR cDNA.

i.e. 0.5 % per lo5 cells at a tracer concentration of insulin indicating

that COS 7 cells had small amount of insulin receptors in the plasma

membranes. Insulin binding to the cells transfected with normal HIR cDNA

increased to 40 times of that of wild type of cells. i.e. 20.5% per 10’

cells. In contrast, insulin binding to the cells transfected with mutated

cDNA was only 35% of that to the cells transfected with normal HIR cDNA as

shown in Fig. 2.

To examine the size of the expressed insulin receptors in these cells,

surface labeling of the cells with [lZ5 I] was performed. The molecular size

of insulin receptors expressed in the cells transfected with normal HIR cDNA

was 135K u-subunit as shown in Fig. 3. However, transfection with mutated

cDNA produced only 210K unprocessed proreceptor. Thus, the G-T mutation at

the cleavage site produced unprocessed insulin proreceptors with decreased

insulin binding affinity.

Discussion

The previous report described insulin proreceptors in the cells from the

insulin resistant siblings with the typical type A insulin receptor disease.

1076


(1). Subsequent DNA analysis revealed G+T point mutation at the cleavage

site which changed the structure of the interconnecting peptide from Arg-

Lys-Arg-Arg to Arg-Lys-At-g-Ser (2). However, the structural change of the -

cleavage site may not be responsible for the unprocessed proreceptors and

the defective converting enzyme could not be ruled out for the cause.

Furthermore, it is of interest to see whether the mutated cDNA transfection

can express the unprocessed proreceptor in other cell lines. As reported in

this paper, the mutation indeed prevented processing of insulin

proreceptors. Thus, the last Arg of the four basic amino acids is important

for the processing enzyme to cleave the proreceptors. The phenomenon was

equally reproduced in COS 7 cells which were monkey kidney derived

fibroblasts and the species specificity was not shown in the processing

mechanism at least in human and monkey.

The binding ability of unprocessed proreceptors was 26% of normal in the

patient’s cells, but that of cells transfected with mutated DNA was 35% of

normal. Therefore, it appeared that binding ability was different among the

different ceils in which the abnormal proreceptors were expressed from the

mutated DNA. The discrepancy is not clear at present. The tertiary structure

of proreceptors expressed in COS 7 cells may be different from that in the

patient’s cells due to he difference in the membrane environments

sourrounding the receptors. Alternatively, it may be the explanation that

the cDNA used for the transfection possessed additional 36 nucleotides just

before the cleavage site as Ebina et al described (8). whereas DNA found in

the transformed lymphocytes from the patient did not have these nucleotides

(9). Thus, the additional 12 amino acids peptide insertion may explain the

difference in insulin binding affinity by chnaging the tertiary structure of

the insulin binding site of the proreceptor.

The expressed proreceptors of the patient were cleaved to normal sized

receptors by trypsin (1, 4) and its binding specificity was abnormal(3). Our

preliminary results showed that the similar phenomena were found in the

cells transfected with the mutated DNA (the manuscript in preparation).

Therefore, the insulin proreceptors in these COS 7 cells were similar to

1077


those expressed in the patient’s cells except for slightly increased binding

activity of the proreceptors in COS 7 cells.

In summary, Arg+Ser (G+T) point mutation at the cleavage site prevents

insulin proreceptor processing in monkey kidney derived fibroblasts

indicating that the unprocessed proreceptors found in the patients are also

due to the point mutation but not due to the defective converting enzyme.

Acknowledgments

This work was supported in part by a research grant for intractable disease from the Ministry of Health and Welfare and a grant-in-aid from the Ministry of Education, Science and Culture, Japan.

References

1.

2.

3.

4.

5.

6. 7. 5.

9.

Kobayashi M, Sasaoka T, Takata M, Hisatomi A, Shigeta Y. (1988) Diabetes 37:653-656. Kobayashi M. Sasaoka T. Takata M. Ishibashi 0. Sugibayashi M, Shigeta Y. Hisatomi A, Nakamura E, Tamaki M, Teraoka H. (19883 Biochem Biophys Res Comm 153:657-663. Sasaoka T. Shigeta Y. Takata Y, Sugibayashi M. Hisatomi A. Kobayashi M. (1989) Diabetologia 32:371-377.

Sasaoka T. Shigeta Y, Takata Y. Ishibashi 0, Sugibayashi M, Hisatomi A. Kobayashi M. (1989) Metabolism 38:990-996. Maniatis T. Fritsch E. Sambrook J. (1982) Molecular cloning:8 laboratory manual, Cold Spring Harbor, New York. Nakamaye KL, Eckstein F. (1986) Nucl Acids Res 14:9679-9698. Stafford J, Queen C. (1983) Nature 306:77-79. Ebina Y, Ellis L, Jarnagin K, Edery M. Graf L, Clauser E. Ou JH, Masiaz F. Kan YW, Goldfine ID, Roth R. Rutter WS. (1985) Cell 40:747-758. Ullrich A. Bell JR, Chen EY, Herrera R, Petruzzelli LM. Dull TJ, Gray A. Coussens L, Liao YC. Tsubokawa M. Mason A, Seeburg PH, Grunfeld C. Rosen OM. Ramachandran J. (1985) Nature 313:756-761.

1078

transfection of cdna with g→t point mutation at the cleavage site of insulin receptors to cos 7...

Documents