transposon a&*vator do not stimulate meiotic homology ...€¦ · recombination or...

Copyright 0 1997 by the Genetics Society of America

Germinal Excisions of the Maize Transposon A&*vator Do Not Stimulate Meiotic Recombination or Homology-Dependent Repair at the bx Locus

Hugo K. Dooner and Isabel M. Martinez-Fkrez

The Waksman Institute, Rutgers University, Piscataway, New Jersey 08855 Manuscript received July 22, 1997

Accepted for publication September 5, 1997

ABSTRACT Double-strand breaks have been implicated both in the initiation of meiotic recombination in yeast

and as intermediates in the transposition process of nonreplicative transposons. Some transposons of this class, notably P of Drosophila and Tcl of Cmorhabditis elegans, promote a form of homologydependent premeiotic gene conversion upon excision. In this work, we have looked for evidence of an interaction between Ac transposition and meiotic recombination at the bz locus in maize. We find that the frequency of meiotic recombination between homologues is not enhanced by the presence of Ac in one of the bz heteroalleles and, conversely, that the presence of a homologous sequence in either trans (homologous chromosome) or cis (tandem duplication) does not promote conversion of the Acinsertion site. However, a tandem duplication of the bz locus may be destabilized by the insertion of Ac. We discuss possible reasons for the lack of interaction between Ac excision and homologous meiotic recombination in maize.

T HE double-strand break (DSB) model for the initiation of meiotic recombination in yeast (SZOSTAK

et al. 1983; SUN et al. 1991) is widely accepted today (STAHL 1996). Strong support for the model was provided by the physical demonstration of double-strand breaks at the high conversion ends of genes, sites where recombination is presumed to initiate (SUN et aL 1989; Wu and LICHTEN 1994; BULLARD et al. 1996). Transpos- able elements that transpose by a “cut-and-paste” mechanism are potentially capable of generating tran- sient double strand breaks upon excision and, in recent years, have been reported to enhance recombination.

The best documented example of a transposon effect on recombination comes from Drosophila. The P element promotes male recombination (reviewed in ENG ELs 1989; PRESTON and ENGELS 1996; SVOBODA et al. 1996) and a form of efficient gene conversion that allows targeted gene replacement in Drosophila (ENG ELS et aL 1990; GLOOR et al. 1991; LANKENAU et al. 1996). A striking property of Pis that its frequency of excision is homology dependent. The presence in the genome of a sequence that is homologous to the site of Pinser- tion stimulates P element loss, measured as reversion of an unstable allele, several hundred-fold. Moreover, a large fraction of revertants carry precise excisions. Based on these observations, ENGELS et al. (1990) proposed a double-strand gap repair model of P element excision and transposition in which a sister chromatid or a homologous chromosome is used as template for repair of the gap. The authors suggested that other

Corresponding authur Hugo K. Dooner, The Waksman Institute, Rutgers University, Piscataway, NJ 08855. E-mail: [email protected]

Genetics 147: 1923-1932 (December, 1997)

transposons of the cut-and-paste type, such as Ac in maize, may also transpose by an analogous mechanism. Parallel observations with the Tcl element in C. ekguns (PLASTERK 1991) have also led to the proposal of a method of gene replacement based on transposon excision (PLASTERK and GROENEN 1992).

In maize, the Ac element has been reported to induce premeiotic recombination at the Plocus. Some Palleles carry a displaced direct duplication, which is unstable only when Ac is inserted in the vicinity of the repeats (ATHMA and PETERSON 1991; XIAO and PETERSON 199’7). Exactly one member of the duplication and the intervening unique sequence are lost in deletion derivatives of these unstable alleles, suggesting that the dele- tions occur by homologous recombination between the two direct repeats. The transposable element Mu1 also appears to increase recombination within a duplication in maize (LOWE et al. 1992). Mu1 elements inserted near the junction of the Knl-0 tandem duplication promote a 100-2000-fold increase in the loss of one repeat relative to what is seen in Knl-0 alleles without elements. Whether this type of recombination is meiotic or premeiotic could not be ascertained in that study. In contrast, intragenic meiotic recombination at either wx or bz is not stimulated by the presence of an Ac insertion in a wx heteroallele (NELSON 1976) or a Mu1 insertion in a 62 heteroallele (DOONER and RALSTON

We examine here whether Ac can affect meiotic recombination at the bz locus in maize and, in light of the P and Tcl element findings, whether the frequency and types of Ac excisions depend on the presence of a homologous sequence in either trans (homologous

1990).

1924 H. K Dooner and I. M. Martinez-Fkrez

chromosome) or cis (tandem duplication). The bz gene is well suited for this type of study: it conditions an easily scored seed color phenotype, it harbors wellchar- acterized Ac and Ds insertions (DOONER et d . 1985; FUR- TEK et al. 1988; RALSTON et al. 1988), and it is the most highly recombinogenic gene yet described in a higher plant (DOONER 1986; DOONER and MART~NEZ-F~~REZ 1997). We find that the frequency of meiotic recombination between homologues is not enhanced by the presence of Ac in one of the bz heteroalleles and, conversely, that the presence of a homologous sequence in either cis or trans does not affect the frequency or type of Ac excision from the bz gene. The insertion of Ac in a direct repeat of the bz locus may have a destabilizing effect similar to that reported at the P locus (ATHMA and PETERSON 1991). We discuss possible reasons for the absence of a general interaction between Ac excision and homologous meiotic recombination in maize.

MATERIALS AND METHODS

Description of brmue aUeIes: The bronze alleles used in this study were in the common genetic background of the inbred W22. The aleurone phenotypes conditioned by the various alleles in the presence of all the complementary factors for anthocyanin pigmentation are in parentheses.

Bz-McC (purple): The normal progenitor allele of the bz- m2 mutation.

bz-m2 (purple spots on a bronze background): An allele that arose from the insertion of the 4.6kilobase (kb) Activator (Ac) element at position 755-762 in the second exon of Bz- McC (MCCLINTOCK 1955; RALSTON et al. 1988).

Bz-W22 (purple): The normal Bz isoallele carried in the W22 inbred.

bz-E4 (bronze): EMS-induced transition at position 1221 in Bz-W22 (DOONER 1986; DOONER and hhRTfNEZ-l%REZ 1997).

bz-R (bronze): The bz reference allele, associated with a 340-base pair (bp) deletion that extends from within the single intron to the second exon of bz and includes the Ac insertion site in bz"m2 (RHOADES 1952; R " o N et al. 1987, 1988).

sh-bz-m (bronze): An X-ray-induced deletion that includes the sh and bz loci (MOTTINGER 1973).

Markers: The mutations sh (shrunken endosperm) and wx (waxy endosperm) were used as markers flanking bz They map, respectively, -3 cM distal and 25 cM proximal to bz in 9s. The sh-wx region exhibits high chiasma interference (DOONER 1986), so double crossovers in the region are rare. PI (plant color) was used as a pollen marker in some crosses.

Selection and analysis of Bz and bz derivatives: bz-m2/bz-E4; PI and bz-m2/bz-R; PI heteroallelic combinations were crossed reciprocally with a sh bz-R wx tester. Putative revertants and intragenic recombinants were selected as purple seed OC- curring singly in ears otherwise containing only bronze and spotted seeds. The selections were backcrossed to the bz-R parent to verify their heritability and the recovery of the pollen markers. Some gametophytic reversions did not breed true and were excluded from further analysis.

The new unstable mutation bz(Dp26)-ml arose in a stock carrying the duplication Bz(Dp26) and the Ac mutable allele wx-m9. The mutation confers a similar, though finer spotted, phenotype to bz-m2 and, like bz-m2, mutates to stable purple and bronze types.

Sh bz(Dp26)-ml /sh-bz-X3 heterozygotes were pollinated with sh-bz-X3 and two classes of kernels were selected: purple (Bz)

and plump bronze (Sh h - s ) . The selections were either selfed or crossed to a sh bz-R tester to confirm their heritability. DNA extraction, PCR amplification, and sequencing: Leaf

DNA was isolated by the urea extraction procedure of GREENE et al. (1994). Genomic DNA was amplified in the presence of 10% DMSO by PCR (SAIKI 1990) in a Perkin-Elmer GeneAmp System. To analyze the Ac excision in Bz' revertants from bz- m2, genomic DNA was amplified by a nested PCR with primers N and F and A and bz-863r, and PCR products were sequenced with primer bz-599. To localize the Ac in the mutant bz(Dp26)- ml, the junction between Bz-McC and Ac was amplified with the primers F and Ac-132r and sequenced using the primers T and Ac-100r. Genomic DNA from Bz' revertants and bz-s derivatives from bz (Dp26)-ml was amplified with the primers L and F and PCR products were sequenced directly with primer T. To determine the crossover junctions in the two recombinants, their genomic DNA were also amplified with primers C and F, the PCR products from the proximal side were sequenced with the primers P and M, and the PCR products from the distal side were sequenced with primers I and D to identlfy all the heterologies. Figures 1B and 2B show the location of all the primers used in either amplification or sequencing. The PCR conditions used in all cases consisted of an initial incubation at 95" for 5 min, followed by 35 cycles of 30-sec denaturation at 95", 30-sec of annealing at 55", and a 2-min extension at 72". The PCR reactions were terminated with a 7-min incubation at 72" and stored at 4". In all cases, PCR products were purified with a Wizard PCR purification system and sequenced directly by the dideoxy method using the Sequenase kit (US. Biochemical Corp.) .

The bz primers used in this study were as follows: A = GAACCTGCGCTTCGTCGA, bz-599 = cgaatggctgttgcatttc catcg; bz-863r = ACGGGACGCAGTTGGGCAGGAT; C = CXCAACACGTTCCCACGC; D = TCATCCGCTGGTCGCCGA; F = CGACAGACTATCTCCACGA, 1 = GAGATCCGTCCCAA CTG, L = ATCGCATTCGCATCGCATC; M = GATGACG TAGTTGAAGTCGC; N = CACGCTCTCGTTCCTCTCCA; P=AGCGCGTCGGTGCCGATGTG;T=GCCCTCATCCGC GCCCC'ITCCTC. The Ac primers used were: Ac-132r = TCT ACCG'ITTCCGTTTCCGTTTAC; and Ac-100r = ATATCC CGITTCCGTTCCGmC.

RESULTS

Comparison of b-2 reversion frequencies in different heterozygotes: bz-m2 is an unstable bz mutation harboring a 4.6kb Ac element in the second exon of the Bz-McCallele (RALSTON et al. 1988). It reverts frequently to a functional form (Bz') in somatic tissues, giving rise to purple spots or stripes against a bronze background, and, in germinal tissues, giving rise to fully purple seeds in ears with otherwise mostly spotted seeds (MCCLIN- TOCK 1955; DOONER and BELACHEW 1989). To test whether reversion of bz-m2 to Bz' was affected by the presence in the homologue of a sequence homologous to the site of insertion of Ac, we compared reversion frequencies in bz-rnZ/bz-E4and bz-m2/bz-Rheterozygotes. The bz-E4 mutation was induced by EMS in Bz-W22, a Bz allele that differs from Br-McC in one simple sequence repeat in the intron and 20 single base pair polymorphisms scattered throughout the gene. The lesion in bz-E4 is a point mutation located 466-bp downstream of the insertion site of Acin bz-m2 (DOONER and MART~NEZ- F ~ R E Z 1997). This distance places an upper limit on

Ac Excision and Meiotic Recombination at bz 1925

how far a potential conversion tract that results in a Bz reversion event can extend from the Ac insertion site in one direction. Though in Drosophila the average P- element induced conversion tract is 1379 bp (GLOOR et al. 1991), -50% of tracts extend less than 466 bp on one side of the P insertion site and, therefore, of the break believed to be produced by P excision (GLOOR et al. 1991; NASSIF and ENGELS 1993). Therefore, the current experimental set-up should detect Ac-induced conversion tracts if Ac excision leads to similar conse- quences as P excision. The bz-R mutation is a 340-bp deletion that arose in a different progenitor allele and includes bz-mzs Ac insertion site (RALSTON et al. 1988).

As can be seen from the data presented in Figure lA, there is no difference in the bz“m2 reversion frequency between the two heterozygotes, in either the female or the male germ line. All the Br’ revertants were recovered as single purple kernels in ears of bz-m2 heterozygotes, suggesting that the reversion events occurred at or near meiosis. Premeiotic events would have resulted in clusters of purple kernels instead. The measured reversion frequencies appear higher in the male than in the female germ line. However, since premeiotic events in the male inflorescence are randomized upon pollen shedding, it is not possible to tell from this experiment whether the difference is due to a higher frequency of premeiotic or meiotic excision events. What we can conclude from the data is that the presence of a homologous sequence in trans, i e . , in the homologue, does not affect the frequency with which Ac is excised from the bz locus to produce Bz’ revertants.

Sequence analysis of Br’ revertants: Though the frequency of Bz’ revertants from bz-m2 does not depend on the nature of the homologue, it is still possible that the types of reversion events differ in the two heterozygotes. Bz’ revertants can arise by gene conversion, crossing over, or simple end-joining at the site of Ac excision. Because the progenitor alleles of the mutations differ at multiple polymorphic sites (Figure lB), it is possible to distinguish between these possibilities. To determine the relative contribution of these three different modes of origin, we sequenced a subset of Bz‘ revertants from each heterozygote: 16 from bz-m2/bz-E4 female parents, 25 from bz-m2/bz-E4 male parents, 10 from bz-mZ/bz-R female parents, and nine from bz-m2/bz-R male parents. The sequence data are presented in Table 1 and the results are summarized graphically in Figure 1C.

Of the 41 Bz’ revertants from bz-m2/bz-E4 heterozygotes, 39 carry typical Ac excision footprints and all the polymorphic sites contributed by the bz-m2 chromosome. Thus, the vast majority of revertants result from simple end-joining following Ac excision. The remaining two lack an excision footprint and represent crossovers between the site of insertion of Ac and the bz-E4 mutant site. None represent conversion events of the type generated by P or Tcl excision. All 19 analyzed Bz’ revertants from bz-m2 /bz-R heterozygotes have Ac

excision footprints flanked by DNA polymorphisms from the bz-m2 chromosome. These revertants arise from end-joining following Ac excision, as was expected because the bz-R deletion allele lacks sequences homologous to the Ac insertion site in bz-m2.

We have previously measured recombination between bz-E4 and bz-mZ(DI), a Ds derivative of bzm2 that arose by internal deletion of Ac and cannot transpose in the absence of Ac (MCCLINTOCK 1962; DOONER et al. 1986). The frequency of recombination between bz-E4 and bzm2(DI) in female meioses is 3 X (DOONER 1986), which is considerably lower than recombination between two point mutations at an equivalent physical distance (DOONER and h/L9RTfNEZ-F6REZ 1997). In our present experiment we obtained a single recombinant between bz-E4 and bzm2 in the female germ line, which would translate into a recombination frequency of 4 X

One would need to generate larger populations of gametes and sort through a large number of revertants to derive a reliable estimate of the recombination frequency between bz-m2 and bz-E4. Nevertheless, there is no suggestion from the present data that Ac can appreciably increase recombination at bz.

As expected of Ac excisions from exons that restore gene function, all 58 transposon footprints are multi- ples of three, the most common one being +6 (46/ 58). These Ac excisions result in the addition of two amino acids to the UFGT enzyme encoded by the bz locus. They fall into four classes, one of which (+CAGGGG) accounts for half of the recovered footprints (29/58). This class arises by deletion of the two central bases in the &bp target site direct repeat and is the most common outcome observed in exonic revertants, i.e., in excisions from exons that restore gene function (FEDOROFF 1989). Among the remaining Bz’ revertants, there were two “0, seven +3, and three +9 excision footprints. Though +3 footprints are rare among both selected and unselected excision products ( B M et al. 1992; SCOTT et al. 1996), they comprise 12% of the analyzed footprints among Bz’ revertants from bz-m2. They are still rare, however, when footprints of bz-s derivatives (loss of function and mutability) from previous work are also considered. These derivatives occur four to five times more frequently than Bz‘ derivatives from bz-m2 homozygotes (MCCLINTOCK 1955; DOONER and BELACHEW 1989) and have mostly +8 excision footprints of various types (I. M. MARTfNEZ-FhEZ and H. K. DOONER, unpublished observations).

Characterization of Bz’ revertants from br(Dp26)-ml, a new mutable allele carrying Ac in a tandem duplication of the bz locus: The lack of P-type conversion events among Ac excision products is not altogether surpris- ing. P excision events occur premeiotically, presumably in the G2 (or GI) phase of the cell cycle (GLOOR et al. 1991), in a species where somatic chromosome pairing is well documented. Ac transposition occurs during chromosome replication, i e . , in the S phase of the cell

1926 H. K. Dooner and I. M. Martinez-F&ez

A. Y bz-m2

bz-m +Bz'

9 & = 0.33%

8 &-= 1.49%

bz-m +Bz'

18 = 0.39% 4577

A= 1.81% 4091

B. A A C A T T A G T C C C ACAGCG C G T

bz-m2

bz-E4

bZ-R

C. 9 bz-m2

bz-E4

8

1

C T TACAG

C [G CAC

1521

T T c ATTTATAG C G T .

I

TACTACAG C T T G C """"""- T C A T T AT G C G """""""-

J 15 1

d 24 1

bz-m2 P d 10

bz-R 8 L 9 -

FIGURE 1.-(A) Comparison of bz-rn2 reversion frequencies in bz-m2/bz-E4 and bz-m2/bz-R heterozygotes. Ac is inserted at position 750-757 of the Bz-McCallele (RALSTON et al. 1988). bz-E4 is a nonsense mutation at position 1221 of the Rz-WZ2 allele (DOONER and MART~NEZ-F~REZ 1997) and bz-R is a 340-bp deletion stretching from 568 to 908, relative to the Bz-McC sequence (-TON et al. 1988). Bz (purple) selections were obtained from reciprocal crosses between each heterozygote and the tester sh bz-R wx and characterized genetically and molecularly. (B) Sequence polymorphisms among bz-m2, bz-E4, and bz-R, the three mutations used in this analysis. Oligonucleotides used as primers in PCR and sequencing are identified by name above arrows that indicate their 5' to 3' strand polarity. (C) Sequence analysis of Bz selections (based on data presented in Table 1). The number of Bz selections of each class is given on the right. The sequence polymorphisms contributed by either bz-rn2 or b7X4 are diagrammed following the patterns used to represent the two alleles in B. The box represents an Ac excision site. The position of the crossover junctions was determined relative to the single base pair heterologies shown in B.

cycle (GREENBUTT and BRINK 1962; LAUFS et al. 1990; WIRTZ et al. 1997), in a species where somatic association of homologous chromosomes is reportedly absent (HESLOP-HARRISON et al. 1988; HESLOP-HARRISON and BENNETT 1990). The reversion events analyzed here probably arise during DNA replication in spore mother cells, prior to the initiation of homologous chromosome pairing. The identification of a recently originated tandem duplication of the bz locus has provided us with the opportunity to examine whether the physi-

cal proximity of homologous sequences in cis can affect the outcome of Ac excision events.

Details of the origin and characterization of the duplication will be reported elsewhere (H. DOONER and Z. ZHENG, unpublished results). The duplication was found in an unusual parentally marked Rz intragenic recombinant (IGR) from bz-ml/bz-E4 heterozygotes (DOONER 1986). An imprecise recombination event generated a 2-kb tandem repeat of the br locus bearing a recombinant Bz allele in the proximal member and

Ac Excision and Meiotic Recombination at bz 1927

TABU 1

Sequence of &’ revertants from bm2/b*E4 and b n 2 / b R heterornotes ~~ ~

No. of Bz’ revertants Flanking Extra

Genotype Class Excision site” Female Male heterologies* base pairs

Bz-McC WT

bz-m2/ bz-E4 I

I1

I11

N

V

VI

VI1

VI11

IX

bz-m2/ bz-R I1

N

V

VI1

ATG GGG CAG T M G Q

M G Q

M G G Q

ATG GGG CAG T

ATGGGGGGG CAGT

A T G G G G C G C C A G T M G R Q

ATGGGGCAC GGG C A G T M G H G Q

M G Q G Q

M G Q G Q

M G H W Q

M G H M G Q

A T G G G G C A G G G G C A G T

A T G G G G C A A G G G C A G T

ATG GGG CAC TGG CAG T

ATG GGG CAC ATG GGG CAG T

ATG GGG CAC AGG GGG CAG T M G H R G Q

A T G G G G G G G C A G T M G G Q

ATG GGG CAC GGG CAG T M G H G Q

M G Q G Q

M G H W Q

A T G G G G C A G G G G C A G T

ATGGGGCAC TGG C A G T

Bz-McC

1 1 2

1 1 0

Bz-McC Bz-McC/ Bz-W22 Bz-McC

0

3

3

6

6

6

6

9

9

3

6

6

6

1 0 Bz-McC

3 4 Bz-McC

4 16 Bz-McC

0 1 Bz-McC

2 1 BZ-McC

2 0 Bz-McC

Bz-McC 0 1

Bz-McC 2

1

2

Bz-McC

Bz-McC

Bz-McC

4

3

WT, wild type. The 8bp target site is shown in boldface. The predicted amino acid sequence is given below the nucleotide sequence. ’ Sequence of two polymorphisms proximal (5’) to the Ac excision site, except for the two crossovers, where all nine polymor-

phisms between bz-m2 and bz-E4 were read. The switch from Bz-W22 to Bz-McC polymorphisms, i.e., the location of the two recombination junctions is shown in Figure 1C.

a mutant bz-E4 allele in the distal member of the duplication (Figure 2A). We refer to this Bz derivative as Bz(Dp26) because it carries a duplication and it was initially identified as Bz IGR 26 (DOONER 1986: Table 4).

From a stock carrying Bz(Dp26) and the linked wx- m9(Ac) allele, we recovered a new, finely spotting, bronze mutable allele that we designated bz(Dp26)ml. Upon subsequent genetic and molecular analysis, bz(Dp26)-mI turned out to carry an Ac element in the second exon of the functional Br allele present in the proximal member of the duplication (Figure 2B). In bz(Dp26)-ml, Acis inserted at position 1247-1254 (eight bases are duplicated on either side of Ac), 39 bp downstream of the site corresponding to the bz-E4 mutation in the distal member of the duplication.

To test whether Ac excisions from the proximal member of the duplication in bz(Dp26)ml can be repaired using the distal member as template, we isolated and sequenced Bz‘ revertants from heterozygotes between bz(Dp26)-ml and the X-ray-induced sh-bz-X3 deletion

that spans the entire sh-bz region (MOTTINGER 1973). From a population of 7400 Sh gametes, we recovered eight Bz’ revertants (0.11%) as single kernel events, i e . , as events that occurred at or around meiosis.

The sequence of the Ac empty sites is given in Table 2. Four of the revertants had typical Ac excision footprints, but the remaining four lacked them. The latter could have arisen by either end-joining at the site of Ac excision, crossing over, or gene conversion using the homologous, Bz-W22derived, sequence in the distal member as repair template. Because Ac is inserted in a part of the duplication derived from the Bz-McC allele, it is possible to distinguish between these three mecha- nisms by examining the sequence polymorphisms flanking the Ac excision site on either side. As shown in Table 2, two of the four Bz selections

retained all the single base pair heterologies from Bz- McC five proximal, including the &-E4 site, and two distal, including the BstXI polymorphism. These polymorphisms extend from 138 bp proximal to 122 bp

1928 H. K. Dooner and I. M. Martinez-F6rez

A. Bz(DpZ6)

2.0-kb Dp

2.0-kb Dp

FIGURE 2.-(A) Structure of the Bz(Dp26) tandem duplication. The proximal member carries a recombinant Bz allele; the distal member cames a mutant &-E4 allele. The duplication chromosome is predominantly a Bz-W22 chromosome with a gene conversion tract from the Bz-McC allele (shaded). A few restriction site polymorphisms distinguishing the Bz-McC and Bz-WZ2 differentiated parts of the duplication are shown. For reference purposes, presence of a site is indicated by an upper case first letter and absence of the corresponding site in the homologous sequence by a lower case first letter. (B) Structure of bz(Dp26)- ml. Ac is inserted at position 1247-1254 of the functional allele in the proximal member of the duplication. Oligonucleotides used as primers in PCR and sequencing are identified by name above arrows that indicate their 5' to 3' strand polarity.

distal to the Acinsertion site. In addition, the selections sions of Ac from bz(Dp26)-ml. The remaining two Bz retain the Dp26 duplication, based on the observation selections lost the Dp26 duplication and were marked that approximately one half of the 700-bp DNA frag- by Bz-McC polymorphisms on the proximal (5') side ment amplified by primers C and D was digested by and Bz-W22 polymorphisms on the distal (3') side of PvuII (cf : Figure 2). Clearly, these represent +O exci- the Ac insertion site. They represent intrachromatid

TABLE 2

Sequence of Bz' revertants from bz(Dp26)mZ

No. of Bz' Flanking Extra Class Excision site" revertants heterologies' Dp26 base pairs

WT G GTG CCC ATG G Bz-McC - - V P M

I G GTG CCC ATG G 2 Bz-McC/ B z - W ~ ~ - 0 V P M 2 Bz-McC +

I1 G G T G C C C A A T C C C A T G G 1 Bz-McC + 6 V P N P M

111 G G T G C C C A T G C C C A T G G 2 Bz-McC + 6

Iv G G T G CCC CTG C C C A T G G 1 Bz-McC + 6 V P M P M

V P L P M

W T , wild type. " The 8bp target site is shown in boldface. The predicted amino acid sequence is given below the nucleotide

'Sequence of the BxtXI polymorphism distal and of five polymorphisms, including the bz-Ed site, proximal se uence.

to the Ac excision site.

Ac Excision and Meiotic Recombination at bz

TABLE 3

Sequence of bts derivatives from bx(@26)-mI

NO. Of bz-s Flanking Extra Class Excision site derivatives heterologies" base pairs

WT GTGCCCAT BZ-McC - I GTGCCCAACTGCCCAT 16 BZ-McC 8 I1 GTGCCCAATTGCCCAT 3 BZ-McC 8 I11 GTGCCCAA-TGCCCAT 3 Bz-McC 7 Iv GTGCCCA-CTGCCCAT 2 BZ-McC 7 V GTGCCCAA -CCCAT 2 BZ-McC 5

WT, wild type. Sequence of two polymorphisms distal and of five polymorphisms, including the bz-E4 site, proximal to

1929

the Ackxcision site. - . -

crossovers between the bz-E4 site and the Ac insertion site in the two members of the duplication (LAUGHNAN 1961). None of the eight was a conversion of the Ac insertion site by the homologous sequence in the tandem duplication.

A potential concern with the previous analysis is that the site of insertion of Ac in bz(Dp26)-ml and the site allelic to the bz-E4 lesion are separated by only 39 bp. If Ac excisions are corrected by gap repair, and if the gap in the bz-m member of the duplication always extends beyond the wild-type site allelic to bz-E4, then the conversion tracts would always include the bz-E4 mutation and the products of gap repair would be stable bronze mutants, rather than purple revertants. To test this possibility, we screened for stable bronze (bz- s) derivatives among the plump (Sh) seed from the cross Sh bz(Dp26)-ml/sh-bz-X3 X sh-bz-X3.

Seeds with a stable bronze phenotype occurred frequently. From just seven ears that produced 1173 plump spotted seeds, we isolated 28 bz-s derivatives (2.4%). The sequence information for 26 of them is summarized in Table 3. All 26 had Ac excision footprints with eight, seven, or five extra bases at the previous site of Ac insertion. None of these footprints would restore the correct Bz reading frame, in agreement with the bronze mutant phenotype of the bz-s derivatives. The most common footprint adds 8 extra bp to the bz gene and has a transversion of the central 2 bp in the target site duplication, a type also found to predomi- nate among unselected Ds excisions from the waxy allele wx-m5(CS18) ( S C O ~ et al. 1996). All 26 footprints were flanked on either side by Bz-McC heterologies, including the site allelic to the bz-E4 mutation. Thus, like most Bz' revertants, bz-s derivatives from bz(Dp26)-ml arise simply by ligation of the cut ends produced by Ac excision and not by gap repair using as template the adjacent homologous sequence in the Dp26 duplication.

DISCUSSION

Transposons can have various effects on recombination. As immobile insertions (e.g., Ds elements), they

clearly suppress meiotic recombination in maize (DOONER 1986; DOONER and MART~NEZ-F~RXZ 1997). The presence of Ds insertions also affects the resolution of recombination intermediates in an unusual way. In heterozygotes between a Ds insertion mutation and a point mutation, most intragenic recombinants have a crossover arrangement of outside markers (DOONER 1986; DOONER and KERMICLE 1986; PATTERSON et al. 1995), whereas in heterozygotes between two Ds insertion mutations, most intragenic recombinants have a parental arrangement of outside markers (DOONER and KERMICLE 1986). But, as mobile elements, transposons of the excisive type (Ac, Spm, P, Tcl, etc.) have the potential of stimulating recombination by creating DSBs.

Upon excision, the Pelement of Drosophila (ENGELS et al. 1990) and the Tcl element of C. ehguns (PLASTERK 1991) promote somatic homologous recombination. The DSBs produced by these elements are presumably expanded into a gap and lead to a form of somatic gene conversion that may be exploitable as a strategy for gene replacement (GLOOR et al. 1991; PLASTERK and GROENEN 1992). These conversion events were initially detected because of homologydependent increases in the reversion frequencies of mutant alleles harboring insertions.

In maize, both Ac and Mutator transposons have been found to promote recombination, albeit in both reported cases, between the repeats of a direct duplication (ATHMA and PETERSON 1991; L o w et al. 1992). The promotion of recombination by Ac was clearly premeiotic, the Mueffect, less certain. Recently, Acwas also reported to induce a low level somatic recombination between ectopic sites ( 10-4-10-5) in transgenic tobacco (SHALEV and LEVY 1997), but no germinal recombinants could be recovered in that study. The recombinational enhancement seen with duplications in maize may be specific, restricted to tandem or closely linked displaced repeats whose members might be able to interact physically in sporogenous mitotic cell divisions. In contrast to this destabilizing effect of transposons on duplications, homologydependent increases in the

1930 H. K. Dooner and I. M. Martinez-FCrez

reversion frequency of mutable alleles have yet to be documented in the maize transposable element literature, despite decades of research on the subject. In fact, in a key early study, the frequency of reversion of the Ac mutable allele wx-B3 was found to be the same whether the homologous sequence of the Ac insertion site was present in the heteroallele or not (NELSON 1976; discussed in BARAN et al. 1992).

In this study we have examined the issue of Ac effects on recombination in maize from a different perspec- tive. We have taken advantage of the wealth of genetic variation available at the bz locus to investigate whether Ac excision shows any of the characteristics associated with excision of the Pand Tcl transposons. Specifically, we have investigated whether the frequency of Ac excision from the bz locus is homology dependent, whether Ac excision promotes intragenic recombination at bz, and whether conversion tracts, suggestive of homology- based repair, occur among Ac excision events.

We compared reversion frequency of the Ac mutable allele bz-m2 in the presence and absence of the wild-type homologous sequence in the heteroallele (the point mutation bz-,?% and the deletion mutation bz-R, respectively) and found them to be the same (Figure 1A). This result supports NELSON’S (1976) earlier finding with wx-B3. The recovery of Bz‘ revertants as exclusively single kernels in ears of bz-m2 heterozygotes argues that the reversion events most likely originated at meiosis. Among 41 sequenced Bz selections from bz-m2/bz-E4 heterozygotes, only two turned out to be intragenic crossovers and none were convertants. The vast majority (39/41) evidenced typical excision footprints, indica- tive of simple end-joining (Figure lC , Table 1) . The frequency of recombination between bz-E4 and bz-m2 appears no different from the frequency of recombination between bz-E4 and bz-m2(DI), a Ds derivative of bz- m2 that cannot excise in the absence of Ac (DOONER 1986). Thus, our data provide no indication of a stimu- latory effect of Ac excision on meiotic recombination.

The lack of convertants argues that Ac-induced DSBs are not repaired using the homologous chromosome as template. Because homologous chromosomes do not appear to associate in premeiotic mitoses in cereals (HESLOP-HARIUSON and BENNETT 1990), but only when they begin pairing at zygotene (DAWE et al. 1994), we thought that the homologues might not be in sufficient proximity to each other at the time of Ac excision for one homologue to serve as gap repair template for the other. One could test this possibility by analyzing Ac excisions from a tandem duplication, in which the homologous sequences are located adjacent to each other in the same chromosome, rather than on separate chromosomes. The recovery of a new mutable allele, bz(Dp26)-ml, which carries Ac in one of the two members of a 2-kb tandem duplication, enabled us to pursue that approach.

We analyzed two types of AG excision products from

bz(Dp26)-ml: those that restore gene function (Bz) and those that don’t (bz-s). Eight Bz and 26 bz-s derivatives were isolated and sequenced. Gene conversion tracts would be easily identified in this duplication because of the multiple sequence polymorphisms that differentiate the two members of the repeat (Figure 2), yet none were found. All 26 bz-s derivatives and four of the Bz’ revertants had characteristic Ac excision footprints (Ta- bles 2 and 3). Two of the remaining four Bz selections were Ac excisions of the +O type, ie., they represent restorations of the original wild-type sequence. More importantly, the excision site in all 32 selections was flanked on either side by heterologies flanking the Ac insertion site in the parent chromosome. Therefore, not even the close physical proximity of a homologous sequence in a 2-kb tandem duplication promotes a gene conversion type of repair following Ac excision at meiosis. This contrasts with P-mediated repair in Drosophila, which occurs much more frequently when the homologous template is on the same chromosome, as much as 15 Mb away, than on a separate chromosome (ENGELS et al. 1994).

The remaining two Bz derivatives have lost one member of the duplication by an intrachromatid crossing over event between the Ac insertion site in the proximal member of the duplication and the bz-E4 site in the distal member. Though only two such events out of 7400 gametes were recovered in this study, their frequency appears surprisingly high given that only 39 bp separate the two mutant sites in the bz second exon (DOONER and MARTINEZ-FGREZ 1997). Perhaps Ac has a destabilizing effect on Dp26, but about two orders of magnitude lower than reported for the Plocus (ATHMA and PETERSON 1991; XIAO and PETERSON 1997). It will be interesting to determine if these two intrachromoso- mal crossovers represent a sampling error or if the destabilizing influence of Ac on duplications, first reported for a 5.2-kb displaced duplication at P, can be extended to the 2.0-kb Dp26 tandem duplication at bz. The destabilization of direct duplications by DSBs has been well studied in yeast. Breaks induced by the HO endonuclease are most frequently repaired by a single strand annealing (SSA) mechanism that also results in deletion of one duplication member along with any intervening sequences (OZENBERGER and ROEDER 1991; FISHMAN-LOBELL et al. 1992)

The lack of a general interaction between Ac excision and meiotic recombination events could be due to either temporal or spatial separation or both. There is evidence that the two events are separated in time. Ac transposition occurs during DNA replication in the S phase (GREENBLATT and BRINK 1962; LAWS et al. 1990; WIRTZ et al. 1997), before the pairing of homologous chromosomes, whereas recombination occurs at or after the zygotene stage of the first meiotic division, when chromosomes are paired (see, e.g., MAGUIRE 1997). If the Ac transposase has a short half-life, it may

AC Excision and Meiotic Recombination at bz 1931

not be present at the later stage when meiotic recombination takes place.

The events could also be spatially separated if the Ac transposase and the enzymes of meiotic recombination are parts of different enzyme complexes that do not interact. The recombinational machinery of the cell is probably localized in the recombination nodules (BISHOP 1994) that form between paired chromosomes in the context of the synaptonemal complex. The Ac transposase possibly only binds to and introduces DSBs in unpaired chromosomes. Furthermore, though DSBs may be formed during Ac transposition, it could be that the cut ends are never released from the transposase complex and are religated together before they can promote repair from a homologous sequence.

The discovery of homology-mediated repair of transposon excisions provided a possible means of targeted gene replacement (GLOOR et al. 1991; PLASTERK and GROENEN 1992). Given the difficulties in gene tar- geting in plants, a strategy based on Ac excision, similar to those proposed for P and Tcl, appeared attractive initially. However, based on the results presented here, it appears unlikely that such an approach will also work with Ac.

We thank ZHENWEI ZHENG for unpublished observations, JOACHIM MESSING for comments on the manuscript, and STEVE MAURMS for DNA extractions. The project was supported in part by a grant from the National Science Foundation (MCB 9630358) to H.K.D.

LITERATURE CITED

ATHMA, P., and T. PETERSON, 1991 Acinduces homologous recombination at the maize P locus. Genetics 128 163-173.

BARAN, G., C. ECHT, T. BUREAU and S. WESSLER, 1992 Molecular analysis of the maize wx-B3 allele indicates that precise excision of the transposable Ac element is rare. Genetics 130 377-384.

BISHOP. D. K., 1994 RecA homologs Dmcl and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis. Cell 79: 1081-1092.

BULLARD, S. A., S. KIM, A. GALEWITH and R MALONE, 1996 Double strand breaks at the HIS2 recombination hotspot in Sacchuromyces cerevisiue. Proc. Natl. Acad. Sci. USA 9 3 13054-13059.

DAWE, R. K, J. W. SEDAT, D. A. AGARD and W. Z. WE, 1994 Mei- otic chromosome pairing in maize is associated with a novel chromatin organization. Cell 7 6 901-912.

DOONER, H. K., 1986 Genetic fine structure of the bronze locus in maize. Genetics 113 1021-1036.

DOONER, H. IC, and A. BELACHEW, 1989 Transposition pattern of the maize element Ac from the bz-m2(Ac) allele. Genetics 122: 447-457.

DOONER, H. K., and J. L. KERMICLE, 1986 The transposable element Ds affects the pattern of intragenic recombination at the bz and R loci in maize. Genetics 113: 135-143.

DOONER, H. IC, and I. M. MARTfNEZ-FkREZ, 1997 Recombination occurs uniformly within the bronze locus, a meiotic recombination hotspot in the maize genome. Plant Cell 9: 1633-1646.

DOONER, H. K., and E. RALSTON, 1990 Effect of the Mu1 insertion on intragenic recombination at the bz locus in maize. Maydica 35: 333-337.

DOONER, H. IC, J. ENGLISH, E. -TON and E. WECK, 1986 A single genetic unit specifies two transposition functions in the maize element Activator. Science 234: 210-211.

DOONER, H. IC, E. WECg S. A D A M S , E. -TON, M. FAWU et al., 1985 A molecular genetic analysis of insertion mutations in the bronze locus in maize. Mol. Gen. Genet. 200: 240-246.

ENGELS, W. R., 1989 P elements in Lhosqphila melanoguster, pp. 437-

484 in Mobile DNA, edited by D. Berg and M. Howe. American Society for Microbiology, Washington, D.C.

ENGELS, W. R., D. M. JOHNSON~CHLITZ, W. B. EGGLESTON and J. SWD, 1990 High-frequency P element loss in Drosophila is homolog dependent. Cell 63: 515-525.

ENGELS, W. R., C. R. PRESTON and D. M. JOHNSON~CHLITZ, 1994 Long-range cis preference in DNA homology search over the length of a Drosophila chromosome. Science 263: 1623-1625.

FEDOROFF, N., 1990 Maize transposable elements, pp. 377-411 in Mobile DNA, edited by D. Berg and M. Howe. American Society for Microbiology, Washington, D.C.

FISHMAN-LOBELL, J., N. RUDIN andJ. E. W E R , 1992 Two alternative pathways of double-strand break repair that are kinetically sepa- rable and independently modulated. Mol. Cell. Biol. 19: 1292- 1303.

FURTEK, D. B., J. W. SCHIEFELBEIN, F. JOHNSTON and 0 . E. NELSON, 1988 Sequence comparisons of three wild-type B m w l alleles from Zea mays. Plant Mol. Biol, 11: 473-481.

GLOOR, G. B., N. A. NASSIF, D. M. JOHNSON~CHLITZ, C. R. PRESTON and W. R. ENGELS, 1991 Targeted gene replacement in Dro- sophila via P element-induced gap repair. Science 253 1110- 1117.

GREENBLATT, I. M., and R A. BRINK, 1962 Twin mutations in me- dium variegated pericarp maize. Genetics 47: 489-501.

GREENE, B., R WALKO and HAKE, S., 1994 Mutator insertions in an intron of the maize knotted1 gene result in dominant suppressible mutations. Genetics 138: 1275-1285.

HESLOFHARRISON, J., and M. D. BENNETT, 1990 Nuclear architec- ture in plants. Trends Genet. 6: 401-405.

HESLOP-HARRISON, J., J. SMITH and M. D. BENNETT, 1988 The a b sence of association of centromeres of homologous chromosomes in grass mitotic metaphases. Chromosoma 9 6 119-131.

LANKENAU, D. H., V. G. CORCES and W. R. ENGELS, 1996 Compari- son of targeted-gene replacement frequencies in Drosophila mel- anogaster at the forked and white loci. Mol. Cell. Biol. 16: 3535- 3544.

LAUFS, J.. U. WIRTZ, M. KAMMANN, V. MATZEIT, S. SCHAEFER et al., 1990 Wheat dwarf virus Ac-Ds vectors: expression and excision of transposable elements introduced into various cereals by a viral replicon. Proc. Natl. Acad. Sci. USA 87: 7752-7756.

LAUGHNAN, J., 1961 The nature of mutations in terms of genes and chromosome changes. Symposium on Mutation and Plant Breeding. Natl. Acad. Sci.- Natl. Res. Council Publ. 891: 3-29.

LOWE, B., J. MATHERN and S. HAKE, 1992 Active Mututmelements suppress the knotted phenotype and increase recombination at the K n l - 0 tandem duplication. Genetics 132: 813-822.

MAGUIRE, M. P., 1997 The role of the synaptonemal complex in pairing and crossing over. Maydica 49: 227-238.

MCCLINTOCK, B., 1955 Controlled mutation in maize. Carnegie Inst. Wash. Year Book 5L: 245-255.

MCCLINTOCK, B., 1962 Topographical relations between elements of control systems in maize. Carnegie Inst. Wash. Year Book 61:

MOITINGER, J., 1973 Unstable mutants of bronze induced by premeiotic X-ray treatment in maize. Theor. Appl. Genet. 4 3 190-195.

NASSIF, N., and W. R. ENCELS, 1993 DNA homology requirements for mitotic gap repair in Drosophila. Proc. Natl. Acad. Sci. USA

NELSON, 0 . E., 1976 Previously unreported wx heteroalleles. Maize Genet. Newsl. 5 0 109-113.

OZENBERCER, B. A., and G. S. ROEDER, 1991 A unique pathway of

Mol. Cell. Biol. 11: 1222-1231. double-strand break repair operates in tandemly repeated genes.

PATTERSON, G. I., K. M. KUBO, T. SHROYER and V. L. CHANDLER, 1995 Sequences required for paramutation of the maize b gene map to a region containing the promoter and upstream sequences. Genetics 140 1389-1406.

PLASTER& R. H., 1991 The origin of footprints of the Tcl transposon of Cmorhubditis eleguns. EMBO J. 10: 1919-1925.

PLASTEq R. H., and J. T. GROENEN, 1992 Targeted alterations of the Cummhabditis clegans genome by transgene instructed DNA double strand break following Tcl excision. EMBO J. 11: 287- 290.

PRESTON, C. R, and W. R ENGELS, 1996 P-element-induced male recombination and gene conversion in Drosophila. Genetics 144:

448-461.

90: 1262-1266.

1611-1622.

1932 H. K Dooner and 1. M. Martinez-Ferez

RALSTON, E. J., J. ENGLISH and H. K. DOONER, 1987 Stability of deletion, insertion and point mutations at the bronre locus in maize. Theor. Appl. Genet. 74: 471-475.

RAI-STON, E. J., J. ENGLISH and H. K. DOONER, 1988 Sequence of three bronzealleles of maize and correlation with the genetic fine structure. Genetics 119 185-197.

RHOADES, M. M., 1952 The effect of the bronzelocus on anthocyanin formation in maize. Am. Nat. 86: 105-108.

SAIKI, R. EL, 1990 Amplification of genomic DNA, pp. 13-20 in PCR Protocols: A Guide to Methodr and Applications, edited by M. A. INNIS, D. H. GELFAND, J. J. SNINSW and T. J. WHITE. Academic Press, San Diego.

SCOTT, L., D. LAFOE and C. F. WEIL, 1996 Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142 237-246.

SHALEV, G., and A. A. LEVY, 1997 The maize element Ac induces recombination between the donor site and an homologous ectopic sequence. Genetics 146: 1143-1151.

STAHL, F., 1996 Meiotic recombination in yeast: coronation of the double-strand-break repair model. Cell 87: 965-968.

SVOBODA, Y., M. ROBSON and J. A. SVED, 1996 Pelement-induced male recombination can be produced in Drosophila mhnoguster

by combining enddeficient elements in tram Genetics 139

SUN, H., D. TRECO, N. SCHULTES and J. W. SZOSTAK, 1989 Double- strand breaks at an initiation site for meiotic gene conversion. Nature 338 87-90.

SUN, H., D. TRECO and J. W. SZOSTAK, 1991 Extensive 3”overhang- ing, single-stranded DNA associated with the meiosis-specific double-strand breaks at the ARC4 recombination initiation site. Cell 64: 1155-1161.

SZOSTAK, J. W., T. ORR-WEAVER, R. ROTHSTEIN and F. STAHL, 1983 The double-strand-break repair model for recombination. Cell

WIRTZ, U., B. OSBORNE and B. BAKER, 1997 Ds excision from extra- chromosomal geminivirus vector is coupled to vector DNA replication. Plant J. 11: 125-135.

WU, T.-C., and M. LICHTEN, 1994 Meiosis-induced double strand break sites determined by yeast chromatin structure. Science 263

XIAO, Y., and T. PETERSON, 1997 Transposon(Ac)-induced homologous recombination at maize P locus and in transgenic Arabi- dopsis. Maize Genet. Newsl. 71: 3.

1601-1610.

33: 25-35.

515-518.

Communicating editor: J. A. BIRCHLER

transposon a&*vator do not stimulate meiotic homology ...€¦ · recombination or...

Documents