MOLECULAR AND CELLULAR BIOLOGY, June 1994, p. 3596-3603 Vol. 14, No. 60270-7306/94/$04.00+0Copyright © 1994, American Society for Microbiology

tRNAIlU (TFIIIR) Plays an Indirect Role in Silkworm Class IIITranscription In Vitro and Inhibits Low-Frequency

DNA CleavageHEATHER M. DUNSTAN,' 2 LISA S. YOUNG,' AND KAREN U. SPRAGUE' 2*

Institute of Molecular Biology' and Department of Biology,2 University of Oregon, Eugene, Oregon 97403

Received 23 November 1993/Returned for modification 26 December 1993/Accepted 24 February 1994

tRNAleU provides an activity, originally called TFIIIR, necessary to reconstitute transcription by silkwormRNA polymerase III in vitro from partially purified components. Here we report studies on the role of tRNA'IAUin in vitro transcription. We show that tRNA['eU does not act positively but, rather, is required to prevent theaction of a transcriptional inhibitor. We also show that the presence of tRNA'U in transcription reactionmixtures prevents low-frequency DNA cleavage by the TFIIIB fraction. Studies on the mechanism oftranscriptional inhibition suggest that this DNA cleavage could cause transcriptional inhibition throughtrans-inactivation of transcription machinery. The ability to block DNA cleavage, like the ability to facilitatetranscription, is highly specific to silkworm tRNA"'1U.

Promoter-specific transcription by eukaryotic RNA poly-merases requires the action of transcription factors in additionto the polymerases themselves (reviewed in references 7, 8,and 21). In the silkworm, Bombyx mori, RNA polymerase III(pol III) and the auxiliary transcription factors involved intranscription of class III genes can be provided by nuclearextracts that support promoter-specific transcription in vitro(22). The activities necessary for in vitro transcription of tRNAgenes have been chromatographically separated into five par-tially purified fractions (17, 29). These consist of the RNApolymerase III fraction and factor-containing fractions TFIIIB,TFIIIC, TFIIID, and TFIIIR, a fraction in which the transcrip-tion activity is provided by RNA (29). In an accompanyingreport (6), we demonstrate that transcriptional activity of theTFIIIR fraction is due to silkworm tRNA"eu and that tran-scriptional activity is highly specific for this RNA.

Silkworm tRNA gene transcription is initiated by the asso-ciation of the transcription factors TFIIIB, TFIIIC, andTFIIID with the promoter to form a highly stable complex thatcan support multiple rounds of transcription in vitro (17). Wereport here that, in contrast to these transcription factors,tRNA"U is not necessary for active transcription complexformation. Instead, tRNAI"u is necessary to protect transcrip-tion complexes by preventing the generation of a transcrip-tional inhibitor. The transcription inhibition that occurs in theabsence of tRNA'U involves the TFIIIB fraction and DNAand correlates with low-level DNA cleavage. Our resultssuggest that the DNA cleavage that occurs in the absence oftRNA"'u is responsible for transcription inhibition.

MATERIALS AND METHODS

Cloned genes used in this work The template DNA for allexperiments except that whose results are shown in Fig. 4 wasa 4.8-kb plasmid containing a 436-bp fragment of silkwormDNA that includes a tRNAC la gene and sequences -221 to+215 relative to the transcription start site, inserted betweenthe PvuII and AvaI sites of pBR322 (13). The template DNA

* Corresponding author. Mailing address: Institute of MolecularBiology, University of Oregon, Eugene, OR 97403. Phone: (503)346-6094. Fax: (503) 346-5891.

used for the experiments in Fig. 4 was a 2.5-kb deletionderivative of this plasmid that includes the tRNACIa gene andsequences from -221 to +89 inserted between the EcoRI andPvuII sites of pBR322 (13).RNA preparation. Silkworm tRNA'U was purified from

total silk gland nucleic acids by gel filtration chromatographyand polyacrylamide gel fractionation, as described previously(6). Silkworm rRNA was prepared as described previously(23). Escherichia coli tRNA'IC (27) was purchased from Subri-den RNA and was .90% pure, based on amino acid accep-tance as measured by the supplier. Bacillus subtilis tRNA"'e(10) was the kind gift of S. Yokoyama.

Transcription fractions. TFIIIC, TFIIID, and the phospho-cellulose fractions that make up the tRNAeU complementa-tion assay were prepared as described previously (17). TFIIIBand pol III were obtained by gel filtration fractionation of theDEII fraction described previously (17). The DEII fraction,containing both TFIIIB and pol III activities, was concentrated20-fold by Amicon pressure ultrafiltration. Next, 0.7 ml of theconcentrate was fractionated on a Superose 6 column (Phar-macia HR 10/5) equilibrated in buffer containing 50 mMTris-HCl (pH 7.5), 125 mM KCl, 5 mM MgCl2, 10% glycerol,1 mM dithiothreitol, and 1 ,uM leupeptin. Column fractionscontaining TFIIIB and pol III were identified by transcriptioncomplementation assays, as described previously (17). TheTFIIIB or pol III fractions were pooled and used withoutfurther fractionation. The pol III fraction used for the exper-iment in Fig. 1 was prepared by heparin-Sepharose chroma-tography, as previously described (17).Other materials. Recombinant T4 DNA ligase was pur-

chased from U.S. Biochemical. The purity of this preparationwas estimated by the supplier to be -99%, based on sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. Activity units are based on a PPi exchangeassay (25). Restriction enzymes and the Klenow fragment ofDNA polymerase I were purchased from New England Biolabsor Boehringer Mannheim. [c_-32P]UTP and [at-32P]dCTP werepurchased from NEN-DuPont.

Transcription assays. Standard transcription reaction con-ditions were 600 F.M unlabeled nucleotides (ATP, CTP, andGTP), 25 ,uM [ot-32P]UTP (5 Ci/mmol), 65 mM KCl, 5 mMMgCI2, 50 mM Tris-HCl (pH 7.5), 8% (vol/vol) glycerol, and 1

3596

ROLE OF tRNA'IC (TFIIIR) IN TRANSCRIPTION 3597

mM dithiothreitol. Reaction volumes, fraction composition,and DNA composition varied among experiments, as indi-cated. Purified tRNA""u, when present, was provided at 5 ngper reaction mixture unless otherwise specified. Transcriptionreaction mixtures were incubated at room temperature(-22°C) for 3 h unless otherwise specified. Reactions werestopped by bringing the mixtures to 0.1% SDS. Products werefractionated on 8% polyacrylamide gels containing 7 M ureaand 0.1% SDS, and gels were autoradiographed as describedpreviously (16).

(i) tRNA"U complementation assay. Standard reaction mix-tures for the tRNA"eu complementation assay included 5 RIeach of TFIIIB-pol III and TFIIIC/D-containing phosphocel-lulose fractions (17) and 200 ng of template DNA (correspond-ing to 64 fmol of template) in a final volume of 40 RI.

(ii) Resolved factor assay system. Standard reaction mix-tures for the resolved factor assay included 4 ,u1 of TFIIIB, 6.5,u1 of TFIIIC, 5 p.1 of TFIIID, 6 p.1 of pol III, and 150 ng oftemplate DNA (corresponding to 48 fmol of template) in afinal volume of 38 pI.

(iii) Single-round transcription assay. Single-round tran-scription reactions were performed under the standard condi-tions except that reactions were initiated in the absence of CTPand labeled nucleotide to stall complexes at position +8 of thetRNACyla gene. Initiation reaction mixtures included 150 ng ofDNA (48 fmol of template), 4 p.1 of TFIIIB, 6.5 p.l of TFIIIC,1.4 pL. of TFIIID, and 3 p.1 of pol III (prepared by theheparin-Sepharose method) in a 33-plI final volume. After 60min, CTP was added to a final concentration of 600 p.M, and[a-32P]UTP was added to a final specific activity of 300Ci/mmol, either with or without heparin to a final concentra-tion of 100 p.g/ml. The final reaction volume was 35 pI.Reaction mixtures containing heparin were incubated for 10min (a period previously determined to be sufficient fortranscript elongation), and reaction mixtures without heparinwere incubated for 3 h. Reactions were stopped by adjustingthe mixtures to 0.1% SDS. After extraction with phenol-chloroform (1:1) in the presence of carrier RNA, nucleic acidswere recovered by ethanol precipitation and then gel fraction-ated as described above.

(iv) Preincubation conditions. Transcription assay compo-nents were preincubated (see Fig. 3, 4, and 9) under standardtranscription conditions, in an appropriate volume to preservethe ratio of input fraction volume to incubation volume (0.56)typical of the resolved factor assay.DNA cleavage assays. For the cleavage assays with radiola-

beled DNA, a 436-bp PvuII-AvaI DNA fragment containingthe tRNA la gene was end labeled by incorporation of[a-32P]dCTP at the AvaI site by using the Klenow fragment ofDNA polymerase I. DNA cleavage was measured under theconditions of the standard resolved factor assay, except thateither 10 fmol of labeled fragment was added in addition to the150 ng of unlabeled plasmid DNA or, for the experimentshown in Fig. 6, 200 ng of unlabeled plasmid DNA was used.When single transcription fractions were assayed for nucleaseactivity, the fraction storage buffer containing bovine serumalbumin was added in place of the other transcription frac-tions.

RESULTS

tRNA"U is not required for transcription complex forma-tion. In the assay that originally revealed the requirement fortRNAeu (TFIIIR) (29), transcription was measured underconditions that allow each complex to direct multiple rounds oftranscription. The amount of transcript was therefore depen-

AtRNA : - - + +

0- - w

'V:!fF'l

tRNAi

0-

0-

Single Round Multiple Rounds

FIG. 1. Effect of tRNA0u on transcription complex formation.Elongating transcription complexes stalled at position +8 of thetRNA '" gene were formed by omitting CTP and labeled nucleotidefrom initiation reaction mixtures (see Materials and Methods). Stalledcomplexes were allowed to form either in the presence (+) or in theabsence (-) of tRNA'Au, as indicated, for I h. The initiation mixtureswere then split, and CTP plus [cx-32P]UTP was added to allowelongation from the stalled complexes, either with heparin to preventreinitiation (A) or without heparin (B). Transcription proceeded for 10min in the presence of heparin and for 3 h in its absence. Reactionswere stopped, and the resulting transcripts were purified and resolvedon polyacrylamide gels (see Materials and Methods). Shown areautoradiograms of the gels, with the positions of the tRNA$9'a tran-scripts (T) and the gel origin (0) indicated. The two autoradiograms inpanel A represent two different exposure times for the same gel. Thetop exposure in panel A is equal to the exposure in panel B.

dent both on the number of active transcription complexes andon the number of rounds directed by each complex. tRNAcUcould potentially affect either parameter. To determinewhether tRNA"c affects the number of active complexesformed, we limited transcription to a single round so that thenumber of transcripts produced would directly reflect thenumber of transcription complexes. To achieve such a limita-tion, stalled transcription complexes were allowed to form inthe absence of CTP for 60 min and then CTP was added in thepresence of heparin to allow elongation from the stalledcomplexes but prevent reinitiation (11). The results in Fig. 1show that tRNA0cu has no effect when transcription from thestalled complexes is limited to a single round (Fig. IA),whereas tRNA"'u has an approximately 80-fold effect whenmultiple rounds are allowed (Fig. IB). Thus, the number ofcomplexes formed in 60 min is not influenced by tRNA"cIU.tRNA,U protects preformed transcription complexes. To in-

vestigate the role of tRNA,U in facilitating transcription afterthe first round, we determined the effect of tRNA1IC on tran-scription rates at various times after initiation of complex forma-tion. Transcription was allowed to proceed in the absence oflabeled nucleotides for a variable amount of time (a preincuba-tion period), labeled nucleotide was then added, and the amountof transcript produced during a fixed, short time interval wasmeasured. Results of such an experiment are shown graphically inFig. 2. Initially (at preincubation time zero), transcription rates

VOL. 14, 1994

3598 DUNSTAN ET AL.

88000A

4000

0-0 20 40 60 80 100

Preincubation Time (minutes)FIG. 2. Effect of tRNA"Au on transcription rate. Standard

tRNAI"U (TFIIIR) complementation assay mixtures (see Materialsand Methods) were incubated in the absence of labeled nucleotide forvarious times (preincubation time) in either the absence (O and A) orpresence (0) of tRNA''u. After preincubation, [ot-32P]UTP wasadded to a specific activity of 10 Ci/mmol, and transcription proceeded,either with (O) or without (A) added tRNA"'u, for 30 min. Reactionswere stopped, and the transcription products were resolved on poly-acrylamide gels. Shown are the Cerenkov counts per minute in thetRNAt" transcripts excised from the gels.

are similar in the presence and absence of tRNA"eu. This resultis consistent with the observation that tRNA"'u does not influ-ence the first round of transcription (Fig. 1). At later times,differences are apparent, however. When tRNA"U is presentduring preincubation (solid circles), the transcription rateincreases initially and then reaches a plateau at about 40 min.On the basis of other experiments with these transcriptioncomponents (results not shown), this increase reflects the timecourse of transcription complex formation. When tRNA"'U isabsent from the preincubation mixture (solid triangles), thetranscription rate increases initially but, with longer preincu-bation, decreases to approach zero. The decrease in thetranscription rate could indicate that contaminating tRNAc-IUis consumed during preincubation or that tRNA"'u is neces-sary to prevent the loss of activity from transcription complexesthat were once active. Since the addition of tRNAIAu afterpreincubation (open squares) does restore transcription activ-ity, it is unlikely that tRNA"'u is simply consumed duringpreincubation. The simplest interpretation of the data in Fig. 2is that transcription complexes that were initially active areirreversibly damaged in the absence of tRNA'U and that therole of tRNAI"U is protective.

Incubation of the TFIIIB fraction with DNA is necessaryand sufficient for transcription inhibition. The previous resultssuggest that the fractionated transcription machinery con-tains an inhibitor of transcription whose action is blocked bytRNAIeAu. We used preincubation experiments to determinewhich fraction(s) contains such an inhibitor. Subsets of thetranscription machinery were incubated for 60 min with orwithout tRNA"'u, and the transcriptional competence of eachsubset was then measured by providing the remaining tran-scription components, labeled nucleotides, and sufficienttRNAeu to prevent further damage. Results of such anexperiment are shown in Fig. 3. As expected, preincubation ofthe full transcription machinery (pol III and factor fractionsTFIIIB, TFIIIC, and TFIIID) with DNA, but withouttRNAICu, results in severe inhibition of transcription (com-pare lanes 1 and 2). This inhibition does not occur, however, ifeither the template DNA (lanes 3 and 4) or the TFIIIBfraction (lanes 5 and 6) is omitted. Preincubation of subsets of

Preincubation AU Fractions, All C, L), POL, B, ESDNA Fractions DNA DNA

Later Additions - DNA B C, D, POL C, D, POl.,DNA

t,NAHle inPre-inc. - + - + - + + -

O _ _llp ~ -II

1 2 3 4 5 6 7 8 9 10

FIG. 3. Determination of components involved in transcriptioninhibition. The indicated subsets of the transcription machinery werepreincubated for I h in either the presence (+) or absence (-) oftRNA"cu. After this period, the remaining components were added(Later Additions), along with [ot-32P]UTP, as well as excess tRNA"IAUto protect the newly added components. Reactions were stopped after3 h, and the resulting transcripts were resolved on a polyacrylamidegel. Shown is an autoradiogram with gel positions of tRNAt'a tran-scripts (T) and the origin (0) indicated. Abbreviations: B, TFIIIB; C,TFIIIC; D, TFIIID; POL, pol III.

the transcription components at room temperature does causea general loss of transcriptional activity (compare lane 2 withlanes 4 and 6), but this loss is not prevented by tRNA1"U. BothDNA and the TFIIIB fraction are necessary for tRNA"'-blocked inhibition. Moreover, preincubation of these twocomponents is sufficient for this inhibition (lanes 7 and 8).

Incubation of the TFIIIB fraction with DNA generates atrans-acting inhibitor of transcription. We have consideredthree possible explanations for the finding that incubation ofthe TFIIIB fraction with DNA causes transcription inhibition(Fig. 3). First, TFIIIB might be inactivated by exposure toDNA. Second, template DNA might be inactivated by expo-sure to TFIIIB. Third, an interaction between the TFIIIBfraction and DNA might generate a diffusible inhibitor thatinactivates or titrates another component of the transcriptionmachinery. These possibilities were examined in the experi-ment whose results are shown in Fig. 4. First, we asked whetherthe loss of TFIIIB activity is responsible for inhibition. For Fig.4, lanes I to 3, template DNA was incubated with the TFIIIBfraction for 60 min in either the absence or the presence oftRNA"eu. Then a full complement of transcription fractions,including TFIIIB, was added, and transcription was allowed toproceed either with or without tRNA"'u. The results showthat preincubation of the TFIIIB fraction with DNA causesinhibition even when fresh TFIIIB is supplied (compare lanes2 and 3). Thus, loss of transcriptional activity is not simply dueto loss of TFIIIB activity during preincubation.The experiment shown in Fig. 4, lanes 4 to 6, addresses the

possibilities of template destruction and inhibition in trans. Inthis experiment, nontemplate DNA was incubated with theTFIIIB fraction and then added to transcription reactionmixtures containing template DNA. The data show that incu-bation of TFIIIB with nontemplate DNA instead of templateDNA is sufficient to cause inhibition (compare lanes 5 and 6).Moreover, the extent of inhibition is the same as whentemplate DNA is included in the preincubation reaction(compare lanes 2 and 3 with lanes 5 and 6). This resultindicates that inhibition is not dependent on template destruc-

MOL. CELL. BIOL.

IWW rl.l

VIW :.i.

:: W., ..:..

W."

ROLE OF tRNA"IC (TFIIIR) IN TRANSCRIPTION 3599

PREINCUBATION DNA GENE VECTORFRACTIONS B B

LATER ADDITIONS DNA VECTOR GENEFRACTIONS ALL ALL

Nle <Preincubation - - + - - +Transcription - + + - + +

O- _.bqpe

AINCUBATION i ,FRACTION(S) ip l I B C D POL

tRNA ne11.A _- + _ _ -

O- aft

Al-

Intact DNA\DS- _

1 2 3 4 5 6

FIG. 4. Effect of preincubation on TFIIIB and DNA. DNA (lanes1 to 3, 75 ng of a tRNAC9'a gene-containing plasmid plus 50 ng pBR322vector DNA; lanes 4 to 6, 125 ng of pBR322 vector DNA) waspreincubated with the TFIIIB fraction for 1 h in the presence (+) orabsence (-) of tRNACu. Afterward, transcription reaction mixturesincluding the preincubated components were assembled by addition ofthe standard tRNAAu complementation assay fractions and theappropriate DNA to bring the final DNA composition of all reactionmixtures to 75 ng of gene-containing DNA (corresponding to 45 fmolof template) plus 125 ng of pBR322 DNA. Transcription proceededfor 3 h in the presence of [ce-32P]UTP. Reactions were stopped, and theproducts were resolved on a polyacrylamide gel. An autoradiogram ofthe gel is shown with the positions of tRNA Aa transcripts (T) and theorigin (0) indicated.

tion and suggests, instead, that some product of a DNA-TFIIIB fraction interaction is capable of mediating inhibitionin trans.Omission of tRNA"U is associated with low-level DNA

cleavage. In search of DNA-TFIIIB fraction interactions thatcould result in inhibition, we examined the integrity of DNAafter incubation with transcription components. The standardtRNA'Ileu transcription complementation assay uses circular,superhelical plasmids as template DNA. Since linearized DNArepresents a more convenient substrate for assessing DNAintegrity, we examined the properties of linearized plasmids inthis assay. These experiments established that circular andlinearized DNA are equally efficient transcription templatesand are equally dependent on tRNACu for efficient multiple-round transcription (data not shown). We therefore askedwhether exposure of DNA to transcription fractions in theabsence of tRNA"'u affects the physical integrity of DNA, byusing a radioactively labeled DNA fragment to maximizesensitivity and denaturing the DNA before monitoring itsintegrity, in order to detect both single- and double-chainbreaks.

In the experiment in Fig. 5A, end-labeled DNA fragmentscontaining the tRNAAa gene were incubated with the com-plete transcription machinery or with separated fractions for40 min. After this incubation, the DNA was denatured andexamined by PAGE. In the absence of tRNAIu, a small

1 2 3 4 5 6 7

BCTGTTGGCATC'ITTTAGATTAAGTAGACAAACAACATTATTGATTCTATCAGAATATATTATT

ATGGCGTCUTGPGlTNTAAAGAACCACGAAATATIATACACTCATTCCGTTTCAAAAGT

GAAGTAATTAAAC ACAATAACCIT1ATAAITTTAACTGAAAATAATAITGTATAATAAGA

CTTTATATTAGTAAIrrMGCcAAGCfIT'C'TCC I(IGGGCGTAGCTCAGAToGTAGAGCGCT

I__ IAIrGCcCGCTTUAGCATSGCGAGAGGTACCGGATCGATACCCGGCGCCTCCAATATGAGAATAGCACGTA

TTATrCGAAACGA7PATATTGCAAATGYA7¶ C ATAAATCACATlITCGAlTCA

ATTCAAIrTIGGAClTATAATA?TTrATACTA'ITATTCTlwACGAAACTACCAACCTCGA

FIG. 5. Effect of tRNA,eu on DNA integrity. (A) A 440-bpend-labeled DNA fragment containing the tRNAAa gene (see Mate-rials and Methods) was incubated with the indicated components ofthe resolved transcription system for 40 min in either the presence (+)or the absence (-) of tRNA'u. Incubations were carried out understandard transcription conditions. After incubation, DNA was dena-tured by boiling in the presence of formamide and then resolved on a10% polyacrylamide gel containing 7 M urea and 0.1% SDS. Shown isan autoradiogram of the gel with positions indicated for intactsingle-stranded DNA fragments (SS) and renatured intact double-stranded DNA fragments (DS), as determined by the positions ofdenatured (lane 1) and native (data not shown) input DNA fragments,respectively. The gel origin (0) is also indicated. Gel slices containingintact fragments or smaller products were excised, and the Cerenkovcounts per minute were quantitated to determine the percentage ofDNA affected (see text). (B) The sequence of the labeled strand of theDNA fragment used to monitor DNA integrity is shown. Arrowsindicate the approximate positions of strong cleavage sites, as deter-mined by comparison of electrophoretic mobility, in 5% polyacryl-amide gels, of the cleavage products with markers produced byrestriction digestion or partial chemical cleavage of the fragment.Brackets indicate the precision to which cleavage sites were mapped.The tRNAt'a gene within the DNA fragment is boxed.

r-

VOL. 14, 1994

LIM

3600 DUNSTAN ET AL.

GENE VECTOR

tRNA le: + + -

Markers: U L U L

oc-L-

CC[,

120

100.-

g 9 80

.g 60

20* 20

- oc|-L

] cc

1 2 3 4 5 6 7 8FIG. 6. Cleavage of circular plasmid DNA. The TFIIIB fraction

was incubated with 200 ng of a tRNAcla gene-containing plasmid(lanes 2 and 3) or pBR322 (lanes 6 and 7) for 1 h under standardtranscription conditions, in the presence (+) or absence (-) oftRNAi'eu. Products were fractionated on a 0.9% agarose gel contain-ing 6 p.g of ethidium bromide per ml, along with markers: untreated(U) and linearized (L) samples of the gene-containing plasmid (lanes1 and 4, respectively) or pBR322 (lanes 5 and 8, respectively). Underthese conditions, all topological forms of closed-circular plasmid (CC)become highly positively supercoiled and migrate more rapidly thanboth Qpen-circular plasmid (OC) and linearized plasmid (L), asestablished by electrophoresis of standards of known topology (notshown). The difference in mobility of closed-circular DNA fromuntreated and incubated samples is due to the presence of a topoisom-erase in the TFIIIB fraction that partially relaxes the initially nega-tively supercoiled DNA.

percentage (-3%) of the DNA molecules is cleaved by thereconstituted machinery (compare lanes 2 and 3). The activityresponsible for this cleavage is contributed primarily by theTFIIIB fraction (lanes 4 to 7), and the extent of cleavage in theTFIIIB fraction alone is greater than that in the full reconsti-tuted system. Since a similar proportion of discrete fragmentsis detectable without prior denaturation idata not shown), it islikely that the cleavage blocked by tRNAI'U results in double-chain breaks. The experiment in Fig. 6 confirmed that circularDNA is also subject to cleavage. Here, plasmid DNA wasincubated with the TFIIIB fraction for 60 min in the presence(lane 2) or absence (lane 3) of tRNA"U and then analyzed ona nondenaturing gel. The figure shows that incubation in theabsence of tRNAl'eu results in the generation of linearizedplasmid DNA. Some DNA is nicked during this incubation aswell, but nicking occurs both in the absence and in thepresence of tRNAlU.The simplicity of the end-labeled fragment pattern (Fig. 5A,

lanes 3 and 4) indicates that cleavage is relatively specific. Theapproximate positions of preferred cleavage sites within theend-labeled fragment are shown in Fig. 5B. Since the DNAsequences surrounding the preferred cleavage sites do notshare obvious sequence features, the basis of specificity is notapparent to us. Although most cleavage sites are within thetRNACIa gene present in the fragment, cleavage does notappear to be related to transcription of the gene. First, asshown in Fig. SA, cleavage occurs in the presence of a singlefraction, TFIIIB, which is not transcriptionally competent byitself (28). Second, cleavage does not require free nucleotides(data not shown). Third, cleavage is not dependent on thepresence of a class III template. As shown in Fig. 6, lanes 5 to8, vector DNA (pBR322) is cleaved to about the same extentas gene-containing DNA. Experiments established that cleav-age of vector DNA also occurs at certain sites preferentially(results not shown).

ng tRNA le added

I'0

10

0 20 40 60 80 100 120

ng tRNA le added

FIG. 7. tRNA specificity in nuclease inhibition compared with tran-scription. The indicated amounts of each tRNA (A, silkworm tRNA!.U3;0, B. subtlstRNAIe;U, E. coi tRNA e) were added to the tRNAlAucomplementation assay. (A) The incorporation of [a-32P]UTP intotRNAIa transcripts was plotted as a percentage of the transcriptionlevel in the positive control reaction (containing saturating silkwormtRNA!Ieu). (B) The assay was carried out with 10 fmol of labeledgene-containing fragment (-1,000 cpm/fmol [Fig. SB] and without[ct-32PJUTP. After resolution on a polyaciylamide gel, the fraction of thecounts per minute in DNA that was smaller than full-length was calcu-lated, and the ability of the indicated amounts of each tRNA to decreasethe fraction of cut DNA was plotted.

Since tRNAIITU prevents both DNA cleavage and transcrip-tion inhibition, we asked whether these two events are corre-lated in terms of the specificity of RNA action. Transcriptionstimulation is highly specific to silkworm tRNA'U comparedwith a variety of other tRNAs (6). To determine whetherprevention of DNA cleavage is also specific to silkwormtRNA,IeU, we compared the ability of three tRNAs (tRNAIIefrom silkworm, B. subtilis, and E. coli) to prevent DNAcleavage. As shown in Fig. 7, these three tRNAs differ in theirability to prevent DNA damage, and the correlation betweentranscriptional activity and nuclease inhibition is striking. Thiscorrelation was extended by demonstrating that silkwormrRNA lacks both transcription activity (6) and the ability toblock DNA cleavage (data not shown).

trans inactivation by damaged DNA as a model for tran-scription inhibition. The experiment in Fig. 4 established thatincubation of the TFIIIB fraction with DNA generates atrans-acting inhibitor of transcription. The experiments in Fig.5 and 6 show that exposure of DNA to the TFIIIB fractioncauses DNA damage. Juxtaposition of these two findingssuggests a model for inhibition in which the damaged DNAgenerated in the absence oftRNAIU constitutes a trans-actinginhibitor of transcription. The inhibitor might act to titrate orotherwise inactivate a component of the transcription machin-ery. In such a model, the extent of cleavage necessary forsevere inhibition depends on the availability of the inactivated

MOL. CELL. BIOL.

ROLE OF tRNAIIe (TFIIIR) IN TRANSCRIPTION 3601

80(

60(

40C

20C

zSUPPLEM2NNrs 0

0- IDO * ____;

0 1

0 20 40 60units T4 DNAUgase

FIG. 8. Effect of DNA ligase on transcription in the absence oftRNAleu. Indicated amounts of recombinant, highly purified T4 DNAligase were added to the standard tRNA"u complementation assay.Plotted are Cerenkov counts per minute in tRNACIa transcripts afterresolution on a polyacrylamide gel. The amount of tRNAC la transcriptproduced in a parallel reaction that was saturated with tRNA'IAU(dashed line) is shown for comparison.

component rather than on the proportion of DNA moleculescleaved. Thus, this model is consistent with damage to a smallproportion of template molecules under transcription condi-tions (Fig. SA, lane 3). Experiments reported below supportthe idea that transcription inhibition is due to trans inactivationby damaged DNA.

First, we tested the possibility that the inhibitor generated bythe absence of tRNAIAu in transcription is an altered form ofthe DNA itself. DNA was incubated in tRNA'U complemen-tation assay mixtures either with or without tRNA'lU for 45min, reisolated, and supplied as a template for transcriptionreactions that included tRNA"eU. The DNA reisolated fromincubation mixtures that lacked tRNA"U gave transcriptionlevels fivefold lower than did DNA reisolated from mixturesthat included tRNA'U. This level of reduction is in goodagreement with the fourfold loss of transcriptional activityresulting from a 40-min preincubation in the absence oftRNAeu (Fig. 2).

Second, we reasoned that if damaged DNA is inhibitory totranscription, inhibition might be relieved by repairing ormasking the damaged DNA. We therefore asked whether T4DNA ligase stimulates transcription in reactions inhibited bythe absence of tRNA"cU. Figure 8 shows the stimulation oftranscription by T4 DNA ligase in the tRNAI'cU complefnen-tation assay. Experiments demonstrated that both transcrip-tion stimulation and DNA ligase activity were lost uponincubation of the ligase preparation at 50°C (results notshown). These results argue that the stimulatory activity isprovided by a protein that is probably DNA ligase. Thisobservation supports the idea that damaged DNA is inhibitoryto transcription. Transcription in the presence of both saturat-ing tRNA 'u and the maximum amount of DNA ligase thatcould be accommodated b?r the assay was not significantly moreefficient than with tRNA"U alone (1.25-fold), consistent withthe possibility that the two activities are serving related func-tions in this assay. It should be noted that T4 DNA ligase waseffective for transcription stimulation when present in 102_ to103-fold stoichiometric excess over template DNA. This sug-gests that ligase may act through an inefficient reaction, such asblunt-end ligation, or simply by binding DNA.

Finally, to examine the possibility that a component of thetranscription machinery is titrated or inactivated by damagedDNA, we asked whether supplementation with any of theseparated transcription fractions decreases the inhibitory effect

1 2 3 4 5 6 7FIG. 9. Effect of transcription factor supplementation on inhibited

reactions. TFIIIB (4 .Ll) plus the tRNAC a gene-containing plasmidwere preincubated for 1 h under standard transcription conditions.Afterward, transcription reaction mixtures including the preincubatedcomponents were assembled by the addition of the tRNA"'u comple-mentation assay fractions, plus the indicated supplementary fractions(4 p.l of TFIIIB [B], 6.3 p.l of TFIIIC [C], 5 ,ul of TFIIID [D], 6.3 p.l ofpol III [POL], 5 ,ul of TFIIIB-pol III [B/POL], or 4.2 [L1 of TFIIIC-TFIIID [C/D]), excess tRNA AU, and [a-32P]UTP. Transcription pro-ceeded in a final volume of 42 p.l, under standard conditions, for 3 h.Reactions were stopped, and the resulting transcripts were resolved ona polyacrylamide gel. Shown is an autoradiogram of the gel with thepositions of the origin (0) and specific tRNAtIa transcripts (T)indicated.

of exposing DNA to the TFIIIB fraction. In the experiment inFig. 9, template DNA was preincubated with the TFIIIBfraction in the absence of tRNA'eu. The complete transcrip-tion machinery was then added either alone (lane 1) or withsupplementary TFIIIB, TFIIIC, TFIIID, or pol III (lanes 2 to5, respectively). Supplementation with phosphocellulose frac-tions of intermediate purity was also done, to test stimulationby certain factor combinations (lanes 6 and 7). ExcesstRNA'leU was added to all reaction mixtures after preincuba-tion to prevent further DNA cleavage. The data show thatsupplementation with the TFIIIC fraction or the fractioncontaining both TFIIIC and TFIIID reduces inhibition,whereas supplementation with the other fractions (TFIIIB,TFIIID, or pol III) has no significant effect. The simplestinterpretation of this result is that damaged DNA reduces theeffective concentration of a constituent of the TFIIIC fraction.It is also possible, however, that the TFIIIC fraction containsanother activity that ameliorates inhibition by another mech-anism, such as repairing or masking the products of DNAdamage. We have tested the specific possibility that the TFIIICfraction contains a DNA ligase. Although T4 DNA ligase isactive under transcription conditions, the TFIIIC fraction didnot exhibit detectable ligase activity under the same conditions(data not shown).

DISCUSSION

Role of tRNA'U in in vitro transcription. The experimentsreported here demonstrate that tRNA' u has an indirect,protective role in facilitating transcription by silkworm pol IIIin vitro. The transcriptional inhibition that occurs in theabsence of tRNAI'u involves the generation of a diffusibleinhibitor of transcription by an interaction between the TFIIIBfraction and DNA. Transcriptional inhibition is associated withlow-frequency DNA cleavage, and the nucleolytic activity

.4" R o

11 ",m u 9. R m U

VOL. 14, 1994

3602 DUNSTAN ET AL.

responsible for this cleavage is contributed by the TFIIIBfraction. Each of the properties of the DNA cleavage reaction,including the specificity of inhibition by tRNA"U, is consistentwith the idea that cleavage causes inhibition. Thus, althoughmodels involving other DNA-TFIIIB fraction interactions havenot been excluded, the simplest model for inhibition is thatdamaged DNA produced by exposure of DNA to the TFIIIBfraction is inhibitory to transcription. This idea is supported bythe observations that DNA reisolated from transcription reac-tions lacking tRNA'eu is functionally impaired and that T4DNA ligase stimulates in vitro transcription.What is the transcriptional inhibitor? Since the DNA dam-

age prevented by tRNA"'u appears to be double-chain breaks,the inhibitor could be DNA ends. DNA ends are not generallyinhibitory to transcription in the silkworm in vitro system,however. For instance, ends generated by digestion with EcoRIor BamHI are not inhibitory at up to 100 fmol per reactionmixture (data not shown). We estimate that in the samereconstituted system, 16 fmol ofDNA ends is generated duringa standard incubation in the absence of tRNAIU. Therefore,if these ends cause transcriptional inhibition, they must eitherbe qualitatively different from the restriction fragment ends orbe considerably more abundant than we estimate. Anotherpossibility is that the DNA damage includes additional prod-ucts or intermediates, such as DNA nicks, gaps, or abasic sites.Which component(s) of the transcription machinery is ti-

trated or inactivated by the damaged DNA? Preformed tran-scription complexes lose activity as a result of inhibition (Fig.2), indicating that the damaged DNA could either disrupt thestable transcription complexes or titrate a cycling componentof the transcription machinery. Initially, the latter possibilitysuggested RNA polymerase as a candidate for the inactivatedcomponent. pol III is known to bind to both DNA nicks (20)and some DNA ends (2). The high-molecular-weight tran-scripts produced in the absence of tRNAIU (see Fig. 4, forexample) arise from increased nonspecific initiation (26),consistent with the idea that pol III can bind and initiatetranscription from the sites of DNA damage. It is unlikely,however, that pol III titration is the cause of transcriptioninhibition, since inhibition is not relieved by added pol III butis relieved by added TFIIIC fraction (Fig. 9). The TFIIICfraction contains at least one activity involved in stable-complex formation (17) but may also contain cycling compo-nents. Therefore, TFIIIC inactivation could cause the loss ofactivity from preformed complexes either by complex disrup-tion or by titration of a cycling component. It should be notedthat although tRNA'eu has no effect on early transcriptioncomplex formation (Fig. 1 and 2), this lack of effect couldsimply reflect the absence of inhibitory DNA damage productsearly in the transcription time course. We have not addressedwhether the products of DNA damage, if present from thebeginning of the transcription incubation, would affect thenumber of active complexes formed.The finding that tRNA'U (TFIIIR) acts to prevent tran-

scription inhibition is surprising, given our earlier results (29).In contrast to the present work, the previous studies failed toreveal transcription inhibition when the transcription machin-ery was preincubated with template DNA in the absence ofTFIIIR (see Fig. 8 in reference 29). We suggest two possibleexplanations for this discrepancy. First, the preincubationperiod in the earlier experiments may not have been sufficientfor significant DNA damage to occur. Consistent with this ideais the finding that different combinations of transcription factorfractions require different preincubation periods for inhibitionto become evident (5). Second, in the current studies, purifiedtRNAI'eu was used as the TFIIIR source, whereas in the

previous study, a native fraction containing both RNA andproteins was used. It is therefore possible that a component inthis native fraction was able to overcome the effects of DNAdamage, either by supplying a titrated factor or by masking thedamage products. Since nucleic acid purified from the nativefraction used in the earlier experiments is sufficient to providefull TFIIIR activity (29), we propose that the native fractionand its nucleic acid subfraction are equivalent in preventingtranscription inhibition, by preventing DNA damage, but differin the capacity to restore transcriptional activity after DNAdamage has already occurred.

Nuclease inhibition by tRNA'e,U. The silkworm TFIIIBfraction contains a nucleolytic activity, apparently a double-stranded DNA endonuclease, whose action is blocked bytRNAI'eU. The identity and cellular function of this nucleaseare unknown. Cleavage is semispecific, but the basis of thecleavage site selection is not apparent. Although the preferredsites of cleavage on a tRNAC' a gene-containing fragment arewithin the tRNACIa gene, cleavage is not dependent ontranscription, on complete transcription complex formation(Fig. 5), or even on the presence of a class III gene (Fig. 6). Itis possible, however, that the preferential cleavage of thetRNAC la gene arises from an association of the nuclease witha component of the transcription machinery that has a liberalbut nonrandom binding specificity in the absence of othertranscription factors.The remarkable feature of this nuclease is the specificity

with which its action is blocked by silkworm tRNA1'U. OthertRNAs, even two isoleucine tRNAs from bacteria, inhibitcleavage much less efficiently (Fig. 7). Although more compli-cated interactions have not been ruled out, the simplest modelfor DNA cleavage inhibition by tRNA"'u involves a directtRNA-nuclease interaction, with tRNA"U acting either as acompetitive inhibitor for DNA binding or as an allostericeffector of the nuclease. The half-saturating concentration oftRNA"U for stimulation of transcription (6) and for inhibitionof DNA cleavage (Fig. 7) is -10-9 M, suggesting an interac-tion of reasonably high affinity.There are known cases of competitive inhibition of DNA

cleavage by tRNA. tRNA is a strong competitive inhibitor ofthe double-strand cleavage activity of E. coli endonuclease I,with a Ki of 10`o M tRNA (14). tRNA also acts as acompetitive inhibitor of DNA cleavage by E. coli topoisomer-ase III (4). Additionally, although competitive inhibition hasnot been established, tRNA inhibits E. coli endonucleases IIIand VII (1, 18), a Proteus mirabilis nuclease thought toresemble E. coli endonuclease I (9), a human endonuclease(24), and the Drosophila bifunctional ribosomal protein S3/APendonuclease (12). To our knowledge, the question of tRNAspecificity in these cases has not been investigated systemati-cally.

It is perhaps not surprising that RNA with double-strandedregions, such as tRNA, could mimic DNA and thus competefor DNase binding. Since tRNA structure is highly conserved,however, it is difficult to understand how one kind of tRNAcould competitively inhibit a DNase more effectively thanothers. What are the possible biological bases for the recogni-tion of a specific tRNA by a nuclease? One possibility is thatthe nucleolytic cleavage and tRNA recognition activities of thesilkworm DNase stem from two independent functions of amultifunctional protein. One protein with these general prop-erties has already been described. The multifunctional glyco-lytic enzyme glyceraldehyde-3-phosphate dehydrogenase hasuracil DNA glycosylase activity in its monomeric form (15) andbinds tRNA with some specificity as a tetramer (19). Alterna-tively, the silkworm DNase could function in a single process

MOL. CELL. BIOL.

ROLE OF tRNAII" (TFIIIR) IN TRANSCRIPTION 3603

that involves both nuclease activity and specific tRNA recog-nition. One example of such a process is the tRNA-primedreverse transcription and chromosomal integration associatedwith retroelement replication (see reference 3 and referencestherein). Another possibility is that the nuclease is involved incontrolled DNA breakdown, with the level of tRNA'leu actingas a regulatory signal. This suggestion is plausible because thesilk gland, the origin of the fractions used in these studies, is aterminally differentiated tissue that is programmed for break-down in the next stage of the silkworm life cycle-the larval-to-pupal transition.

ACKNOWLEDGMENTS

We are grateful to Shigeyuki Yokoyama for supplying tRNAs and toMark Kelley for discussing unpublished results. We also thank PamWitte and Harriet Sullivan for the preparation of some of the reagentsused in this study and Kyoko Maruyama for helpful comments on themanuscript.

This work was supported by Public Health Service grants GM25388(K.U.S.) and GM32851 (K.U.S. and L.S.Y.), an American HeartAssociation Grant-in-Aid (K.U.S.), and Public Health Service predoc-toral training grant 5T32GM07759 (H.M.D.).

REFERENCES1. Bonura, T., R. Schultz, and E. C. Friedberg. 1982. An enzyme

activity from Escherichia coli that attacks single-stranded deoxyri-bopolymers and single-stranded deoxyribonucleic acid containingapyrimidinic sites. Biochemistry 21:2548-2556.

2. Campbell, F. E., and D. R. Setzer. 1992. Transcription terminationby RNA polymerase III: uncoupling of polymerase release fromtermination signal recognition. Mol. Cell. Biol. 12:2260-2272.

3. Chapman, K. B., A. S. Bystrom, and J. D. Boeke. 1992. Initiatormethionine tRNA is essential for Tyl transposition in yeast. Proc.Natl. Acad. Sci. USA 89:3236-3240.

4. DiGate, R. J., and K. J. Marians. 1992. Escherichia coli topo-isomerase III-catalyzed cleavage of RNA. J. Biol. Chem. 267:20532-20535.

5. Dunstan, H. M. Unpublished observations.6. Dunstan, H. M., L. S. Young, and K. U. Sprague. 1994. TFIIIR is

an isoleucine tRNA. Mol. Cell. Biol. 14:3588-3595.7. Gabrielsen, 0. S., and A. Sentenac. 1991. RNA polymerase III(C)

and its transcription factors. Trends Biochem. Sci. 16:412-416.8. Geiduschek, E. P., and G. P. Tocchini-Valentini. 1988. Transcrip-

tion by RNA polymerase III. Annu. Rev. Biochem. 57:873-914.9. Goebel, W., and D. R. Helinski. 1971. Endonuclease I of Proteus

mirabilis. II. Properties of the noncomplexed and transfer ribonu-cleic acid-complexed forms of the enzyme. J. Biol. Chem. 246:3857-3862.

10. Green, C. J., G. C. Stewart, M. A. Hollis, B. S. Vold, and K. F. Bott.1985. Nucleotide sequence of the Bacillus subtilis ribosomal RNAoperon, rrnB. Gene 37:261-266.

11. Kassavetis, G. A., D. L. Riggs, R. Negri, L. H. Nguyen, and E. P.Geiduschek. 1989. Transcription factor IIIB generates extended

DNA interactions in RNA polymerase III transcription complexeson tRNA genes. Mol. Cell. Biol. 9:2551-2566.

12. Kelley, M. R. 1993. Personal communication.13. Larson, D., J. Bradford-Wilcox, L. S. Young, and K. U. Sprague.

1983. A short 5' flanking region containing conserved sequences isrequired for silkworm alanine tRNA gene activity. Proc. Natl.Acad. Sci. USA 80:3416-3420.

14. Lehman, I. R., G. G. Roussos, and E. A. Pratt. 1962. Thedeoxyribonucleases of Escherichia coli. III. Studies on the natureof the inhibition of endonuclease by ribonucleic acid. J. Biol.Chem. 237:829-833.

15. Meyer-Siegler, K., D. J. Mauro, G. Seal, J. Wurzer, J. K. DeRiel,and M. A. Sirover. 1991. A human nuclear uracil DNA glycosylaseis the 37-kDa subunit of glyceraldehyde-3-phosphate dehydroge-nase. Proc. Natl. Acad. Sci. USA 88:8460-8464.

16. Morton, D. G., and K. U. Sprague. 1984. In vitro transcription of asilkworm 5S gene requires an upstream signal. Proc. Natl. Acad.Sci. USA 81:5519-5522.

17. Ottonello, S., D. H. Rivier, G. M. Doolittle, L. S. Young, and K. U.Sprague. 1987. The properties of a new polymerase III transcrip-tion factor reveal that transcription complexes can assemble bymore than one pathway. EMBO J. 6:1921-1927.

18. Radman, M. 1976. An endonuclease from Escherichia coli thatintroduces single polynucleotide chain scissions in ultraviolet-irradiated DNA. J. Biol. Chem. 251:1438-1445.

19. Singh, R., and M. R. Green. 1993. Sequence-specific binding oftransfer RNA by glyceraldehyde-3-phosphate dehydrogenase. Sci-ence 259:365-368.

20. Slattery, E., J. D. Dignam, T. Matsui, and R. G. Roeder. 1983.Purification and analysis of a factor which suppresses nick-inducedtranscription by RNA polymerase II and its identity with poly-(ADP-ribose) polymerase. J. Biol. Chem. 258:5955-5959.

21. Sprague, K. U. Transcription of eukaryotic tRNA genes. In D. SoIland U. RajBhandary (ed.), The molecular biology of tRNA, inpress. ASM Press, Washington, D.C.

22. Sprague, K. U., D. Larson, and D. Morton. 1980. 5' flankingsequence signals are required for activity of silkworm alaninetRNA genes in homologous in vitro transcription systems. Cell22:171-178.

23. Suzuki, Y., and E. Suzuki. 1974. Quantitative measurements offibroin messenger RNA synthesis in the posterior silk gland ofnormal and mutant Bombyx mori. J. Mol. Biol. 88:393-407.

24. Tsuruo, T., M. Arens, R. Padmanabhan, and M. Green. 1978. Anendonuclease of human KB cells. J. Biol. Chem. 253:3400-3407.

25. United States Biochemical Corp. 1993. United States Biochemicalmanual. United States Biochemical Corp., Cleveland.

26. Witte, P. R. Unpublished observations.27. Yarus, M., and B. G. Barrell. 1971. The sequence of nucleotides in

tRNA"' from E. coli B. Biochem. Biophys. Res. Commun. 43:729-733.

28. Young, L. S. Unpublished observations.29. Young, L. S., H. M. Dunstan, P. R. Witte, T. P. Smith, S. Ottonello,

and K. U. Sprague. 1991. A class III transcription factor composedof RNA. Science 252:542-546.

VOL. 14, 1994