Research Article 1067

IntroductionThe Notch locus encodes a transmembrane receptor that is thecentral element of an evolutionarily conserved signaling pathwaycontrolling a broad spectrum of cell-fate decisions during metazoandevelopment. Signals through the Notch receptor couple cell-fateacquisition of an individual cell to the cell-fate choices made byits immediate neighbors (Artavanis-Tsakonas et al., 1999) affectingproliferation, differentiation and apoptotic decisions indevelopment. Abnormal Notch signaling has profoundconsequences for normal development in metazoans and increasingevidence links the Notch signaling pathway with pathogenicconditions such as cancer (Callahan and Egan, 2004; Ellisen et al.,1991; Fre et al., 2009; Jhappan et al., 1992; Kiaris et al., 2004).

Our current mechanistic understanding of Notch signaling hasthe Notch receptor on the surface of one cell, interacting withmembrane-bound ligands on the surface of a neighboring cell,triggering a cascade of proteolytic events that eventually cleavethe entire intracellular domain of the receptor. The intracellulardomain carries nuclear localization signals (Kopan et al., 1996;Stifani et al., 1992) and translocates into the nucleus, where itdirectly participates in a transcriptional complex, which drivesNotch-dependent transcription. The complexity of the geneticcircuitry controlling Notch signals is very high, and invariably thedevelopmental outcome of modulating the activity of the Notchpathway depends on the cellular context (Hurlbut et al., 2009;Hurlbut et al., 2007; Kankel et al., 2007).

Mammals contain four Notch receptor paralogs: Notch 1, Notch2, Notch 3 and Notch 4, all of which have been associated withtumorigenic events (Allenspach et al., 2002; Callahan and Egan,2004; Capobianco et al., 1997; Kiaris et al., 2004). Notch canbehave as a bona fide oncogene. For instance, somatic or viral-induced mutations that result in the constitutive activation of the

Notch receptor have been shown to be oncogenic both in vitro andin vivo (Robbins et al., 1992; Smith et al., 1995; Talora et al.,2008). Importantly, activating mutations in Notch1 have beenlinked in humans to almost 50% of all cases of T-cell acutelymphoblastic leukemia (T-ALL) (Weng et al., 2004). Althoughthe Notch receptor can behave as an oncogene, it is becomingincreasingly clear that the Notch pathway can have a verysignificant role in oncogenesis via the synergy between Notchsignals and other cellular elements, which, in a context-dependentmanner, can create the conditions favoring tumor development(Fre et al., 2009; Kiaris et al., 2004). How Notch integrates itsaction with other cellular elements is of fundamental interest, bothto understand the role of the pathway in development as well as togain insights into its pathogenic action.

Several studies associated the Notch receptor and, indeed,differential Notch receptor paralog action, with the major tumorsuppressor transformation-related protein 53 (henceforth we referto the mouse gene as Trp53 and to the human counterpart asTP53), which is somatically mutated in almost half of all humancancers (Vogelstein et al., 2000). The levels of the Trp53 protein,which under normal circumstances are very low, are regulated byE3 ubiquitin-protein ligase Mdm2-dependent ubiquitylation (Fanget al., 2000; Haupt et al., 1997; Honda and Yasuda, 2000), whichin turn is affected by an autoregulatory loop that directly targetsexpression of the Mdm2 gene by Trp53 (Gottlieb and Oren, 1996;Picksley and Lane, 1993).

In spite of the significant number of studies linking Notch andTrp53, the underlying molecular basis remains unclear (Beverly etal., 2005; Kim et al., 2007; Mao et al., 2004). Here, we examinethe antagonistic relationship between Trp53 and Notch4, a Notchreceptor paralog shown to be highly tumorigenic in the mousemammary epithelium (Jhappan et al., 1992). We find that Trp53

SummaryNotch receptors and their ligands have crucial roles in development and tumorigenesis. We present evidence demonstrating theexistence of an antagonistic relationship between Notch 4 and Trp53, which is controlled by the Mdm2-dependent ubiquitylation anddegradation of the Notch receptor. We show that this signal-controlling mechanism is mediated by physical interactions between Mdm2and Notch 4 and suggest the existence of a trimeric complex between Trp53, Notch 4 and Mdm2, which ultimately regulates Notchactivity. Functional studies indicate that Trp53 can suppress NICD4-induced anchorage-independent growth in mammary epithelialcells and present evidence showing that Trp53 has a pivotal role in the suppression of Notch-associated tumorigenesis in the mammarygland.

Key words: Trp53, Mdm2, Notch, Ubiquitylation, Tumorigenesis

Accepted 16 November 2010Journal of Cell Science 124, 1067-1076 © 2011. Published by The Company of Biologists Ltddoi:10.1242/jcs.068965

Trp53 regulates Notch 4 signaling through Mdm2Youping Sun1, Malgorzata Klauzinska2, Robert J. Lake1,3, Joseph M. Lee2, Stefania Santopietro2,Ahmed Raafat2, David Salomon2, Robert Callahan2,* and Spyros Artavanis-Tsakonas1,4,5,*1Department of Cell Biology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115, USA2Mammary Biology and Tumorigenesis Laboratory, Center for Cancer Research, National Institutes of Health, Building 37/Room 1118A,37 Convent Drive, Bethesda, MD 20892, USA3Department of Biochemistry and Biophysics, University of Pennsylvania Medical School, Philadelphia, PA 19104, USA4Collège de France, 11 Place Marcelin Berthelot, 75231 Paris Cedex 05, France5Institut Curie, 75248, Paris, France*Authors for correspondence (callahro@mail.nih.gov; artavanis@hms.harvard.edu)

Jour

nal o

f Cel

l Sci

ence

directly affects Notch signaling through the Mdm2-dependentubiquitylation of the receptor and present evidence indicating thatthis relationship is important for the oncogenic activity of Notchboth in cell culture and in mammary tumors.

ResultsTrp53 influences the levels of the Notch 4 proteinTo probe the relationship between Notch 4 and Trp53, we comparedeither endogenous or exogenously delivered Notch 4 intracellulardomain (NICD4) steady state protein levels. Several different celllines, which have been well characterized and have mutant orwild-type TP53 genetic backgrounds, were used to test thegenerality of our observations. We first compared the endogenousNICD4 levels in TP53-deficient HCT116 human colon carcinomacells, which were generated by targeted disruption of both TP53alleles (Bunz et al., 1998), with those in the parental TP53 wild-type HCT116 cells. We found that the level of NICD4 was 20-foldhigher in HCT116 TP53-null cells (Fig. 1A, lane 2) compared withthe parental HCT116 cells (Fig. 1A, lane 1). This is consistent withthe notion that Trp53 antagonizes the expression of NICD4 andcorroborates observations involving mouse embryonic fibroblasts(MEFs) lacking Trp53 activity (Trp53–/–), where it was shown that

Notch 4 levels were increased when compared with Trp53+/+

controls (Mao et al., 2004).To examine further the relationship between Notch 4 and Trp53,

co-expression experiments were carried out in 293T/17 cells, whichcan be readily transfected. As shown in Fig. 1B, when eitherFLAG-tagged Trp53 or a V5-tagged NICD4, was individuallyexpressed, each of these proteins accumulated to readily detectablelevels (Fig. 1B, lanes 2 and 3, respectively). However, when bothTrp53 and NICD4 were simultaneously expressed, the detectablelevels of the NICD4 protein were substantially reduced (Fig. 1B,lane 4 vs lane 2) whereas levels of Trp53 remained the same (Fig.1B, lane 4 vs lane 3), suggesting that Trp53 is associated with thereduction of NICD4 protein levels.

To examine whether the observed Trp53-dependent reduction ofthe endogenous NICD4 protein levels in the HCT116 cells reflectedtranscriptional control, we compared levels of mRNA encodingNICD4 in the HCT116 parent cells versus TP53-null HCT116cells, using qRT-PCR and found no significant differences (P>0.05,Fig. 1C). This observation indicated that the striking differences inNICD4 protein levels associated with the downregulation of Trp53did not reflect Trp53-mediated transcriptional control.

NICD4 is a target of the Mdm2 E3 ligaseGiven that the level and, consequently, the activity of Trp53 arecontrolled largely by the E3-ubiquitin ligase Mdm2 (Geyer et al.,2000) and, conversely, that Mdm2 is a transcriptional target ofTrp53 (Haupt et al., 1997; Honda and Yasuda, 2000), we reasonedthat the effect of Trp53 on NICD4 could be possibly influenced byMdm2. We first examined MDM2 mRNA and protein expressionin HCT116 cells and found, as expected (Haupt et al., 1997; Hondaand Yasuda, 2000), that both were significantly lower in theHCT116 TP53-null cells compared with levels in the parental cells(Fig. 1D and data not shown). Consistent with the observationsinvolving the HCT116 cells, a comparison of endogenous NICD4protein levels in MEFs lacking Trp53 or lacking both Trp53 andMdm2 revealed that the steady-state level of NICD4 in MEFs nullfor both Trp53 and Mdm2 was increased relative to MEFs null forTrp53 alone by approximately threefold (Fig. 2A,B). Since theMdm2 E3 ligase activity depends on its RING domain (Fang et al.,2000; Honda and Yasuda, 2000), we investigated whether theobserved differences in NICD4 expression levels could be directlylinked to the ligase activity of Mdm2, by transfecting 293T/17cells with either a transgene carrying a wild-type copy of Mdm2 ora mutant form lacking the RING domain (Mdm2 DR). Fig. 2Csummarizes these results. The expression levels of HA-taggedNICD4 were reduced when co-expressed with wild-type Mdm2(Fig. 2C, lane 2 vs lane 3), whereas they were essentially unaffectedwhen co-expressed with Mdm2 DR (Fig. 2C, lane 2 vs lane 4).

This analysis was extended by transfecting a plasmid encodingwild-type Mdm2 into the MEFs null for both Trp53 and Mdm2,which displayed high NICD4 levels (see above), and resulted inthe significant reduction of NICD4 (Fig. 2D, lane 2) protein levelscompared with control cells (Fig. 2D, lane 1). Furthermore, whenH1299 cells, which endogenously express Notch 4 but do notexpress Trp53 protein were treated with shRNA targeting MDM2,NICD4 levels increased (Fig. 2E, lane 2) above levels in thecontrol (Fig. 2E, lane 1). Finally, to further probe the dependenceof NICD4 levels on Mdm2, a series of H1299 cells were transfectedwith a constant amount of plasmid encoding NICD4 and increasingamounts of a plasmid encoding Mdm2. A clear dose response wasobserved, where NICD4 levels decreased with increasing levels of

1068 Journal of Cell Science 124 (7)

Fig. 1. Trp53 antagonizes NICD4 steady-state protein levels. (A)Lysatesfrom HCT116 TP53 wild-type cells (lane 1) and HCT116 TP53-null cells(lane 2) were analyzed for NICD4 protein levels by western blot using an anti-Notch-4 antibody and an anti-a-tubulin antibody (loading control). (B)Effectsof Trp53 on NICD4 levels in transfected 293T/17 cells. Western blot analysisof lysates from 293T/17 cells mock transfected (lane 1) or transfected withV5–NICD4 (lane 2), FLAG–Trp53 (lane 3) or both expression vectors (lane4). Relative transfection efficiencies were monitored by co-transfection with aplasmid encoding GFP (lanes 2–4). (C)Relative NICD4 RNA levels inHCT116 TP53 wild-type cells and HCT116 TP53-null cells were examined byqRT-PCR. Shown are NICD4 RNA levels normalized to HPRT (hypoxanthinephophoribosyltransferase) RNA levels. (D)Relative MDM2 RNA levels wereexamined by qRT-PCR in HCT116 TP53 wild-type cells and HCT116 TP53-null cells.

Jour

nal o

f Cel

l Sci

ence

Mdm2 expression (Fig. 2F; and for densitometric evaluation, seesupplementary material Fig. S1) corroborating an antagonistic linkbetween Mdm2 and NICD4. The generality of this conclusion wascorroborated by carrying out an analogous experiment with anothercell line, 293T/17, in which we could also demonstrate theantagonism between Notch 4 and Mdm2 (data not shown).

Given that the antagonistic relationship between Mdm2 andNICD4 depends on the presence of the RING domain in Mdm2, weexamined NICD4 ubiquitylation in 293T/17 cells overexpressingeither wild-type Mdm2 or Mdm2DR (Fig. 3A). Cells expressingwild-type Mdm2 and treated with the MG132 proteasome inhibitordisplayed robust NICD4 ubiquitylation (Fig. 3A, lane 3), whereascells expressing the Mdm2DR protein did not show an appreciableincrease in ubiquitylated NICD4 above background levels (Fig.

3A, compare lanes 2 and 4). We also examined the effect ofoverexpressing Sel-10 (also known as FBXW7), another E3ubiquitin ligase reported to target NICD4 (Wu et al., 2001). Cellsexpressing Sel-10 also displayed, as expected, enhanced NICD4ubiquitylation, albeit to an apparently lower degree, than cellsexpressing Mdm2 (Fig. 3A, lane 5).

In a complementary strategy to monitor ubiquitylation of NICD4,we expressed HA-tagged NICD4 and Myc-tagged ubiquitin alongwith Mdm2 or Mdm2DR and treated cells with MG132 overnight.After immunoprecipitation with an anti-Myc antibody,immunoblotting was performed to detect HA–NICD4 expression.The result showed increased levels of higher molecular massNICD4 in Mdm2-transfected cells (Fig. 3B, lane 2) compared withMdm2DR-transfected cells (Fig. 3B, lane 3). On the basis of thisanalysis, we conclude that NICD4 is a substrate for Mdm2-mediatedubiquitylation and degradation.

Trp53 attenuates Notch 4 signalingBecause Trp53 controls the levels of Mdm2 protein, which cantarget NICD4, we expected that modulation of Trp53 should beconsequential for Notch 4 signaling. To explore this possibility, we

1069Notch–Trp53–Mdm2 interactions

Fig. 2. Mdm2 expression affects NICD4 steady state protein levels.(A)Lysates from Trp53-null MEFs (lane 1) and MEFs null for both Trp53 andMdm2 (lane 2) were analyzed for NICD4 protein levels by western blot.(B)Densitometric quantification of raw data in Fig. 2A. Plotted are NICD4levels normalized to a-tubulin levels. (C)Lysates from H1299 cells expressingNICD4-HA and either wild-type MDM2 or a mutant MDM2 protein lackingthe RING domain (Mdm2DR) were analyzed for NICD4 protein levels bywestern blot using the indicated antibodies. (D)Lysates from MEFs null forboth Trp53 and Mdm2 (lane 1) and from MEFs reconstituted with Mdm2 (lane2) were analyzed for NICD4 and MDM2 protein levels by western blot.(E)Lysates from H1299 cells expressing control shRNA (lane 1) or MDM2shRNA (lane 2) were analyzed for NICD4 protein levels by western blot usingthe indicated antibodies. (F)H1299 cells were transfected with 2mg of plasmidencoding V5-tagged NICD4 and 0.5mg a GFP expression vector, whichallowed us to monitor transfection efficiency, together with 0.2mg (lane 3),0.8mg (lane 4), 3.2mg (lane 5) and 6.4mg (lane 6) of plasmid encoding Mdm2.Equal plasmid mass for each transfection was ensured by the addition ofpcDNA3. The two characteristic MDM2 protein forms, long (L) and short (S)are indicated. Lysates were analyzed by western blot using the antibodiesindicated to the right. For a densitometric quantification of the data seesupplementary material Fig. S2.

Fig. 3. Mdm2 targets NICD4 for ubiquitylation. (A)293T/17 cellsexpressing HA-NICD4, ubiquitin and the indicated wild-type or mutant E3ligases were treated with 30mM MG-132 for 5 hours. NICD4 wasimmunoprecipitated from cell lysates with an anti-HA antibody, andimmunoprecipitates were analyzed by western blot with anti-ubiquitin (toppanel) and anti-HA (NICD4) antibodies (middle panel). Mdm2 expressionwas monitored by western blot of whole cell lysates using an anti-MDM2antibody (lower panel). (B)293T/17 cells expressing HA-NICD4, Myc-tagged ubiquitin and the indicated wild-type Mdm2 (lane 2) or the mutantMdm2 E3 ligases (lane 3) were treated with 30mM MG-132 overnight. Myc-tagged ubiquitin was immunoprecipitated from cell lysates with an anti-Mycantibody, and immunoprecipitates were analyzed by western blot with anti-HA (NICD4) antibodies (top panel). Mdm2 and Mdm2DR expression weremonitored by western blot of whole-cell lysates using an anti-Mdm2 antibody(lower panel).

Jour

nal o

f Cel

l Sci

ence

used a Notch signal reporter, HES-1–luc (Takebayashi et al., 1994),to monitor the effects of Trp53 on Notch-dependent transcriptionin H1299 cells, which are null for TP53, and in HC11 cells, inwhich both alleles of endogenous Trp53 are mutant (hypomorphic)(Merlo et al., 1994). As shown in Fig. 4A,B NICD4 expressionsignificantly stimulated the activity of the HES-1–luc reportertransfected into both cell lines. This effect was suppressed whenNICD4 was co-expressed with wild-type Trp53. Consistently, whenparental wild-type HCT116 cells were treated with the DNA-damaging agent cisplatin, which upregulates Trp53 (Vikhanskayaet al., 1999) (Fig. 4C, bottom panel), we observed downregulation

of levels of HES1 (an endogenous Notch target) mRNA as revealedby RT-PCR (Fig. 4C, top panel, lane 2 vs lane 1). This effect wasnot seen in the HCT116 TP53-null cells (Fig. 4C, top panel, lanes3 and 4).

These observations were extended with a second Notch reporterassay in HCT116 cells. We determined whether Trp53 modulationaffects Notch-induced expression of the viral TP1 promoter, usinga TP1–luc reporter assay (Strobl et al., 1997). In HCT116 TP53-null cells, NICD4 activated the TP1–luc reporter as expected(supplementary material Fig. S2A); however, TP1–luc reporteractivity was reduced to 29% when Trp53 was coexpressed(supplementary material Fig. S2A). Significantly, and consistentwith the analysis described above, we found that Mdm2 expressionreduced Notch-induced TP1 reporter activity by 42%(supplementary material Fig. S2B). Taken together, these resultsindicate that modulation of Trp53 attenuates Notch 4 signalingthrough Mdm2 and that this property is general, because it isobserved across different cell lines.

NICD4 physically interacts with Trp53 and Mdm2To gain further insight into the antagonistic relationship betweenNICD4, Trp53 and Mdm2, we sought to examine the possibilitythat these proteins physically interact, as is known to be the casebetween Trp53 and Mdm2 (Barak and Oren, 1992; Chen et al.,1993; Momand et al., 1992). We first examined the relationshipbetween Trp53 and NICD4 and included in these experimentsNICD1, which has been previously reported to interact with Trp53(Kim et al., 2007), as well as NICD3. HA-tagged forms of theintracellular domains of these Notch receptors were eitherindependently expressed or co-expressed with FLAG-tagged Trp53in 293T/17 cells (Fig. 5A). Forty-eight hours after transfection,cells were treated with MG132 for an additional 5 hours and co-immunoprecipitation assays were performed using an anti-FLAGantibody. We note that treatment with MG132 was crucial for theseexperiments. As judged by co-immunoprecipitation, interactionswere observed between Trp53 and all three Notch receptors (Fig.5A) after treatment with MG132. We examined whether the Trp53–NICD4 interaction can be corroborated by assessing endogenousprotein interactions and, indeed, we detected NICD4 inimmunoprecipitates using an anti-Trp53 antibody (Fig. 5B) inNIH3T3 cells.

To map the region(s) of NICD4 that mediate interaction withTrp53, we generated a series of deletion constructs (supplementarymaterial Fig. S3A). These HA-tagged polypeptides were expressedin 293T/17 cells with or without FLAG-tagged Trp53, andinteractions were monitored by co-immunoprecipitation. We foundthat both the Ankyrin repeats and RAM domains of NICD4 appearto be involved in the Trp53 interaction, whereas the C-terminalPEST-containing domain does not show detectable interactions(supplementary material Fig. S3B).

We also explored the possibility that Mdm2 and NICD4 couldphysically interact. Immunoprecipitation experiments using extractsof TP53-null H1299 cells, which express endogenously bothNICD4 and Mdm2, revealed interactions between these twoproteins (Fig. 5C, lane 3). These findings are consistent with thenotion that NICD4 is a direct target of the Mdm2 E3 ligase. Usingthe Notch 4 deletion mutants (supplementary material Fig. S3A),we examined which domain of Notch 4 is responsible for theinteraction between NICD4 and Mdm2. The relevant deletionconstructs were expressed in 293T/17 cells with or without Mdm2coexpression (supplementary material Fig. S3C). Interactions were

1070 Journal of Cell Science 124 (7)

Fig. 4. Trp53 modulates NICD4 signaling. (A)Luciferase assays in H1299cells (TP53 null) expressing the HES-1–luc promoter reporter (0.5mg) and thecontrol Renilla luciferase reporter (0.05mg) were either mock transfected (lane1) or transfected with expression constructs encoding NICD4 alone (lane 2),Trp53 alone (lane 3) or both. Lane 4 shows reduced NICD4 activity when bothNICD4 and Trp53 are expressed (compare lanes 2 and 4). Luciferase assayswere performed according to the manufacturer’s (Promega) protocol, aspreviously described (Sun et al., 2005a). (B)Luciferase assays of HC11 (Trp53mutant) cells containing the HES-1–luc Notch signal reporter (Takebayashi etal., 1994). Cells were mock transfected (lane 1) or transfected with expressionconstructs encoding either NICD4 (lane 2) or Trp53 (lane 3) alone or both(lane 4). (C)RT-PCR assays of HES1 mRNA levels in HCT116 TP53 wild-type cells (lanes 1 and 2) and HCT116 TP53-null cells (lanes 3 and 4), eithertreated with cisplatin (5mM) (lanes 2 and 4) for 5 hours, or untreated (lanes 1and 3). Lower panel is a western blot showing the effects of cisplatin on Trp53protein levels monitored with an anti-Trp53 antibody (Vikhanskaya et al.,1999) which, in addition to Trp53, crossreacts with another nonspecific protein(lower band), which was used as a loading control.

Jour

nal o

f Cel

l Sci

ence

detected with full-length NICD4 (construct F, supplementarymaterial Fig. S3A) and the C-terminal region (construct C,supplementary material Fig. S3A) but not with the NICD4 deletionconstruct N, which contains the RAM-Ankyrin domains, but lacksthe C-terminal region, in contrast to the NICD4–Trp53 interactions.A reciprocal experiment was performed using the wild-type Mdm2or the Mdm2DR deletion, which lacks the RING domain. Theseconstructs were co-transfected with a V5-tagged NICD4 in 293T/17cells. After 48 hours, the cells were treated with MG132 for 5hours and the lysates were immunoprecipitated with antibodiesagainst the V5 NICD4 tag. Both Mdm2 constructs displayedinteractions with NICD4, suggesting that the interaction isindependent of the RING domain (supplementary material Fig.S3D).

Trp53 suppresses NICD4-induced anchorage-independentgrowth in mammary epithelial cellsThe observations described above clearly indicate a mechanisticlink between Notch 4 and Trp53 and suggest that this Mdm2-dependent relationship could be relevant in tumorigenesis. Toexplore this possibility, we took advantage of an assay foranchorage-independent growth in soft agar, using HC11 andC57MG mammary epithelial cells that express NICD4 (Robbins etal., 1992). Both alleles of Trp53 in HC11 cells are mutated (Merloet al., 1994), whereas in C57MG cells both alleles are wild type(our unpublished data).

Introduction of a NICD4 expression vector into the HC11(Robbins et al., 1992) and C57MG cell lines confers on them theability to form colonies in soft agar (Fig. 6A,B). This is consistentwith the well-documented role of NICD4 as an oncogene in themouse mammary gland (Jhappan et al., 1992). Significantly,however, the oncogenic activity of NICD4, as revealed by the soft

1071Notch–Trp53–Mdm2 interactions

Fig. 5. Protein interactions between Trp53, Mdm2 and NICD. (A)Co-immunoprecipitation of Trp53 with different NICD paralogs. 293T/17 cellswere transfected with plasmids encoding HA-tagged NICD1 (lanes 2 and 3),NICD3 (lanes 4 and 6) or NICD4 (lanes 5 and 7) either alone (lanes 3, 6, and7) or with Trp53 (lanes 1, 2, 4 and 5). Forty-eight hours after transfection,cells were treated with 30mM MG-132 for 5 hours. Co-immunoprecipitationswere performed on cell lysates with an anti-FLAG antibody (Trp53), andprotein interactions were monitored by western blots using anti-HA and anti-FLAG (Trp53) antibodies (upper two panels). Relative levels of proteinexpression were monitored by western blot of cell lysates (lower two panels).(B)Western blot analysis of endogenous NICD4–Trp53 interaction inNIH3T3 cells treated with 30mM MG-132 for 5 hours. Immunoprecipitationswere performed with an anti-Trp53 antibody (Trp53) (lane 3) or controlserum (lane 2), and proteins were detected by western blot using the indicatedantibodies. (C)Interaction between NICD4 and Mdm2 Lysates from H1299cells (TP53-null) treated with 30mM MG-132 for 5 hours wereimmunoprecipitated with an anti-Mdm2 antibody or control serum. NICD4and Mdm2 coimmunoprecipitation was assessed by western blot usingantibodies against Mdm2 and NICD4 (see also supplementary material Fig.S1).

Fig. 6. Trp53 suppresses NICD4-induced anchorage-independent growthof mammary epithelial cells in soft agar. Representative colony formationassay for (A) HC11, HC11-NICD4 and (B) C57MG, C57MG-NICD4 cellpools. Wild-type Trp53 was introduced into the cell lines using the inducibleretroviral vector 1529-neo containing the metallothionine promoter sensitive tocadmium ions. Growth medium was supplemented with cadmium ions (cd) toinduce Trp53 expression (v is empty vector control). The originalmagnification was 40�. Numbers of counted colonies are shown in thegraphs. (C)Representative colony formation assay for HC11 cells stablyoverexpressing oncogenes FGF-3, ErbB2 and Wnt1. Wild-type Trp53 wasintroduced into cell lines through transient transfection with wt Trp53 vector.Soft agar assays were performed 48 hours after transfection. Cells were placedin six-well plates in 0.3% soft agar at a density of 30,000 cells/well. After 21days, they were visualized by overnight staining with Nitroblue Tetrazoliumand counted for size ≥0.2 mm.

Jour

nal o

f Cel

l Sci

ence

agar assay, was reduced by the cadmium (Cd2+)-induced expression(Merlo et al., 1994) of wild-type Trp53 (P<0.001) in HC11-NICD4cells (Fig. 6A) consistent with the notion that Trp53 regulates theprotein level of NICD4. Similarly, C57MG-NICD4 cells, in whichTrp53 is not mutated but is only weakly expressed, colonyformation was inhibited by the expression of exogenous wild-typeTrp53 (Fig. 6B). The ability of Trp53 to block oncogene-relatedcolony formation in HC11 cells is not universal. When weintroduced the Cd2+-inducible wild-type Trp53 retroviral vectorinto HC11 cells stably expressing the FGF-3, ErbB2 or Wnt1oncogenes, anchorage-independent growth by these cells in softagar was not blocked (Fig. 6C). Thus Trp53 is able to suppress thetumorigenic activity of NICD4, as predicted from theaforementioned analysis, but not that of FGF-3, Wnt1 or ErbB2.

Trp53 status associated with NICD4 mouse mammarytumorsTo examine the status of Trp53 locus in NICD4 mammary tumors,we determined the nucleotide sequence of exons 3–7 of the Trp53gene from mouse mammary tumors induced by NICD4 driven bythe whey acidic protein (WAP) (Michelsen et al., 2007) or theMMTV LTR promoters. The Trp53 status was initially examinedusing SSCP (single-strand conformation polymorphisms) analysis.Using this technique, a single nucleotide substitution in DNA canbe detected as a mobility shift during gel electrophoresis (indicatedwith arrows in Fig. 7A). The nucleotide sequences of amplifiedproducts derived from the Trp53 exons 3–7 from the WAP-NICD4and MMTV-NICD4 mammary tumors exhibiting different mobilitieswere determined. We found a remarkable frequency of Trp53mutations in the NICD4 tumors (41%, 6/14) and NICD1 (14%, 1/7)in comparison with that in tumors generated by the expression ofCripto-1 (0%, 0/4) or Int6 (0%, 0/7) oncogenes (Fig. 7B). Thecharacteristics of these mutations are shown in Fig. 7C. Theseresults clearly show an unexpectedly high frequency of Trp53mutations in the NICD4 tumors, strengthening the relevance of acrucial functional link between Notch 4 and Trp53 in oncogenesis.

DiscussionThe Notch pathway is one of a handful of fundamental signalingmechanisms controlling metazoan cell fate (Gerhart, 1999; Hurlbutet al., 2007). The fundamental nature of the pathway is reflectedby the striking conservation across species, as well as the pleiotropicaction across tissues and developmental processes. Molecularevidence indicates that, in spite of the numerous effects of Notchactivity, there is a unitary, basic underlying molecular mechanismthat governs Notch signaling. However, genetic studies haveuncovered a complex circuitry that is capable of modulating Notchactivity and a diversity of mechanisms that can ultimately controlsignaling at distinct cellular levels (Kankel et al., 2007).

An important and unique aspect of the Notch pathway is itsexquisite sensitivity to dosage, first revealed by the haplo-insufficientgenetic behavior of the Notch receptor and its ligands (Artavanis-Tsakonas et al., 1995; Artavanis-Tsakonas et al., 1999). Moreover,the developmental outcome of Notch signals might differ, dependingon the level of receptor activity, such that the quantity of ligand-competent receptors in a cell defines a crucial developmentalparameter. Not surprisingly, therefore, mechanisms that affect thetrafficking and the stability of the Notch receptor have emerged aspivotal signal-controlling devices (Baron et al., 2002; Fortini, 2009)and might also serve as integration nodes between Notch and othercellular processes (Mukherjee et al., 2005).

Here, we uncovered a molecular mechanism linking Notchprotein stability to oncogenic events driven by the tumor suppressorTrp53. We demonstrate that the intracellular domain of Notch 4 istargeted for ubiquitylation and hence degradation by the ubiquitinligase Mdm2. Mdm2, however, is involved in a feedbackmechanism with Trp53, being on one hand the transcriptionaltarget of Trp53 and on the other hand, a protein interaction partner(Kussie et al., 1996; Schon et al., 2002), eventually targeting theTrp53 protein for degradation through ubiquitylation (Fang et al.,2000; Haupt et al., 1997; Honda and Yasuda, 2000). The data wegathered indicate that although the Mdm2 E3 ligase can targetNotch 4 in the absence of Trp53, its presence seems to significantlyaccelerate this process, given that we found higher levels of NICD4in Trp53–/– Mdm2–/– MEFs than in Trp53–/– Mdm2+/+ MEFs. Wethus propose a model where the Trp53–Mdm2 feedback loop is

1072 Journal of Cell Science 124 (7)

Fig. 7. Trp53 status associated with NICD4 mammary tumors.(A)Representative examples of SSCP polymorphism. Exons 3–7 of Trp53were amplified by PCR, separated by 10% TBE polyacrylamide gelelectrophoresis and silver stained. Differences of mobility shift were observedamong the PCR products of samples 2 and 3 obtained from WAP-Int3(NICD4) transgenic tumors (indicated with arrows). (B)Frequencies and(C) characteristics of mutations found in all analyzed transgenic models. Themutations of Trp53 DNA binding domain status were checked in severaltransgenic models: WAP–Int3 (NICD4) (Gallahan and Callahan, 1987),MMTV LTR-Int3 (NICD4) (Jhappan et al., 1992), Wap-Int3sh (Wap-Int3short)(Raafat et al., 2004), Wap-CBF1 KO (Wap-NICD4/CBF1 knockout) (Raafat etal., 2009) Wap-Cripto-1 (Sun et al., 2005b), Wap-Int6 (Mack et al., 2007) andMMTV-NICD1 (Kiaris et al., 2004). PCR products showing different SSCPpatterns were purified by electrophoresis on 1% agarose gel, cloned into TA-cloning system or directly sequenced.

Jour

nal o

f Cel

l Sci

ence

linked to the regulation of Notch protein levels (Fig. 8). Moreover,given that our biochemical analyses support the existence ofphysical interactions between NICD4 and both Mdm2 and Trp53,our model suggests that a tripartite interaction between Notch,Mdm2 and Trp53 modulates the degradation of NICD4 and henceNICD4-mediated signaling (Fig. 8).

The inverse correlation between Trp53 expression and Notch 4protein levels was, to our knowledge, first documented by Maoand co-workers using fibroblasts lacking Trp53 (Mao et al., 2004).Our biochemical analysis indicating physical interactions not onlybetween NICD4 and Trp53 but also with the intracellular domainof other Notch receptor paralogs raises the possibility that theTrp53 and, by extension, Mdm2-directed degradation is a generalmechanism that controls Notch signalling, at least in certaindevelopmental contexts. Indeed, the general features of themechanism for the antagonistic relationship between Notch andTrp53 we propose is compatible and, in some cases, explains adiverse set of observations that have suggested links betweenNotch and Trp53 over the years. Kim and co-workers (Kim et al.,2007) have previously shown that the N-terminal region of Trp53binds to the RAM-Ank domain of NICD1. Beverly and colleaguesobserved suppression of Trp53 levels by NICD1 and suggestedthat this might reflect Mdm2-dependent events (Beverly et al.,2005). Secchiero and colleagues (Secchiero et al., 2009) foundthat, in cells lacking active Trp53, Notch1 protein levels werestable in the presence or absence of the Mdm2 and Trp53 inhibitorNutlin, consistent with the notion that binding of Trp53 to Notch1 is important for Mdm2-mediated degradation of Notch1.

Our study indicates that NICD4 physically interacts with theMdm2 ubiquitin ligase, but the notion of direct interactions betweenNotch and ubiquitin ligases is not unique, because there have beenother documented examples. The C-terminal domain of Notch 1and Notch 4 have been shown to interact with another nuclear E3ligase, Sel-10 (FBXW7) (Mao et al., 2004; Wu et al., 2001).Another example is the E3 ligase Deltex in Drosophila, whichinteracts physically with the Ankyrin domain region of Notch andresults in the ubiquitylation of the receptor (Matsuno et al., 1995).This latter example offers some noteworthy analogies with theTrp53–Mdm2–Notch tripartite mechanism we propose here. Theefficiency of Deltex to ubiquitylate Notch is highly enhancedthrough a third molecule, Kurz, which is the single Drosophilahomolog of non visual b-arrestin, which interacts physically withdeltex, and as a result, influences signaling (Mukherjee et al.,2005). The topology of this trimeric complex is different fromwhat we suggest here between Notch–Trp53 and Mdm2 in thatNotch does not seem to interact directly with Kurz. Nevertheless,the notion that sequences in the intracellular domain of Notch actas adaptors to recruit its ubiquitin ligases, whose activity, andhence effects on Notch signaling, might be modulated by a thirdmolecular partner could extend to other cellular circumstances(Mazaleyrat et al., 2003).

Notch signal modulation has profound developmental andpathogenic consequences, and the link with Trp53 is potentiallyrelevant for tumorigenesis given the importance of Trp53 in theseevents. The ultimate consequences of lower Notch receptor levelsis downregulation of the Notch signal, whereas stabilization of theNotch protein might, in the right developmental context, lead tosignal upregulation (Mukherjee et al., 2005). Here, in the contextof all the cell types we used in our in vitro experiments, wedemonstrated that the Trp53–Mdm2-mediated regulation of Notchhas direct consequences on Notch signaling, as measured by the

expression of the Notch transcriptional target HES-1. Importantly,our study revealed that the Trp53–Mdm2–Notch relationshipinfluences anchorage-independent growth in soft agar, which is ameasure of malignant transformation. Thus, the ability of wild-type Trp53 to inhibit anchorage-independent growth of HC11 andC57MG-NICD4 cells in soft agar, but not of HC11 cells expressingWnt1, FGF-3 and ErbB2, is consistent with a functionallysignificant relationship between Trp53 and NICD4. This findinghas in vivo implications on NICD4-induced mammary tumordevelopment in mice and suggests that an early event intumorigenesis is the loss or mutation of Trp53.

It is well documented that analogous Trp53 mutations in thesolid tumors of mice are far less frequent than in humans (Blackburnand Jerry, 2002). For instance, no Trp53 mutations have beenfound in MMTV-Ras (Hundley et al., 1997), MMTV-Wnt1(Donehower et al., 1995) or WAP-DES(1–3) IGF-inducedmammary tumors (Hadsell et al., 2000). Remarkably, we foundthat 41% (6/14) of the mammary tumors in NICD4 transgenicmice, as well as 14% (1/7) of mammary tumors in NICD1transgenic mice had Trp53 mutations. Although we have notidentified any Trp53 mutations in four WAP-Cripto-1 and sevenWAP-Int6sh mammary tumors, others have found loss ofheterozygosity (LOH) for Trp53 in transgenic MMTV–c-Myc andMMTV-Wnt1 mammary tumors (Blackburn and Jerry, 2002). Themechanism by which LOH for Trp53 synergizes or collaborateswith these transgenes has not been established.

The implication our findings have for human mammaryoncogenesis is yet to be determined, but the apparent generality ofthe antagonistic relationship between Notch and Mdm2 or Trp53raises some significant hypotheses. Moreover, recent evidence thatis compatible with our model indicates that expansion of stem or

1073Notch–Trp53–Mdm2 interactions

Fig. 8. A model for the Trp53-mediated downregulation of Notchsignaling. The Mdm2 E3 ubiquitin ligase is a transcriptional target of Trp53.The Trp53 protein associates with and is ubiquitylated (red dots) by Mdm2(Fang et al., 2000; Honda and Yasuda, 2000). Mdm2 can also associate withthe intracellular domain of Notch 4 (NICD4) and cause its ubiquitylation(dashed line). However, in the presence of Trp53, which can also associatewith NICD4, a trimeric complex (solid bold lines) is formed (NICD–Trp53–Mdm2), and as a result NICD4 becomes highly ubiquitylated and,subsequently, rapidly degraded. This results in a loss of Notch signaling andmight provide a selective environment for fixation of Trp53 mutations duringthe evolution of mammary tumor development in the Notch transgenicmammary tumor models.

Jour

nal o

f Cel

l Sci

ence

progenitor cells, cell populations that are crucial for carcinogenesisin the mouse mammary gland, might be influenced by Trp53through its ability to influence Notch activity (Tao et al., 2010).Notch can act as an oncogene, as demonstrated by the associationof activating mutations with T-ALL in humans (Ellisen et al.,1991; Weng et al., 2004). However, as we have argued before onthe basis of tumor models in the mouse mammary gland and theintestine (Fre et al., 2009; Kiaris et al., 2004), the oncogenicactivity of Notch, unlike what has been documented in the case ofT-ALL, might not be manifested by oncogenic Notch mutationsper se, but rather by an oncogenic synergy of Notch signals withother cellular elements. It is for this reason that the modulation ofNotch signaling through the Notch–Mdm2–Trp53 axis definedhere might be consequential in human tumorigenesis.

Materials and MethodsCell culture, retroviral production and transductionThe murine mammary epithelial cell line HC11 was maintained in RPMI-1640medium, supplemented with 10% fetal bovine serum (FBS), 5 mg/ml insulin, and10 ng/ml EGF (Invitrogen; Carlsbad, CA). The murine mammary epithelial cell lineC57MG (Jue et al., 1992) was grown in DMEM, supplemented with 10% FBS and10 mg/ml insulin. Phoenix293/Ecotropic and HEK293T/17 cells were purchasedfrom the ATCC (Mannassas, VA) and EcoPack 293T cells were purchased fromClontech (Valencia, CA). These cells were grown in DMEM medium, supplementedwith 10% FBS. HCT116 and HCT116 TP53-null cells (kindly supplied by BertVogelstein, Johns Hopkins University, Baltimore, MD) were cultured with McCoy’s5a medium with 10% FBS. H1299 cells were purchased from the ATCC (Manassas,VA) and cultured with RPMI-1640 medium, supplemented with 10% FBS. HeLacells were grown in DMEM, supplemented with 10% FBS. Wild-type, Trp53-nulland Mdm2-null MEFs (Montes de Oca Luna et al., 1995) were kindly provided byGuillermina Lozano (University of Texas M.D. Anderson Cancer Center, Houston,TX).

For the production of Trp53 and Int2/FGF3 retroviral constructs, 10 mg of vectorDNA were transfected into EcoPack 293T cells using FuGene (Roche AppliedScience; Indianapolis, IN). All other retroviral vectors were transfected intoPhoenix293/Ecotropic cells using LipoD293 DNA transfection reagent (SignaGenLaboratories; Gaithersburg, MD) according to the manufacturer’s suggestedprocedures. Viral supernatants were collected at 48 and 72 hours after transfection,pooled, filtered (0.45 mm) and stored at –80°C.

Recipient HC11 and C57MG cells were transduced with retroviral particles atapproximately 40% confluence for 8–12 hours in the presence of polybrene (5mg/ml), followed by replacement with fresh medium. Cells were selected withappropriate antibiotics 36 hours after infection. Transgene expression was confirmedby RT-PCR and immunoblotting. All viral work conformed to accepted BiosafetyLevel 2+ guidelines as described by the National Institutes of Health(http://bmbl.od.nih.gov/contents.htm).

HC11 cells were transfected with 2 mg pCEV29-ErbB2 (gift from S. Aaronson,Mount Sinai School of Medicine, New York, NY) or HA-tagged Wnt-1 (UpstateBiotech; Lake Placid, NY) using FuGene6 (Roche Applied Science) reagent in a 3:1ratio according to the manufacturer’s instructions. Cells were selected with theappropriate antibiotics under standard conditions.

Construction of Trp53 and NICD4 vectorsFLAG-tagged Trp53 (Zhao et al., 2004) obtained from Daiqing Liao (University ofFlorida, Gainsville, FL) and HA–tagged human NICD1 and human NICD3 fromLizi Wu (Wu et al., 2000), Ha-tagged Mouse NICD4 expression vectors were madethrough PCR using Pfu polymerase from Stratagene and NICD4 sequences werecloned into pcDNA3 vector (Invitrogen; Carlsbad, CA), NICD4 was also cloned intopcDNA 3.1 pEF1/V5His TOPO TA expression vector (Sun et al., 2005a) (Invitrogen).The 1529-neo retroviral vector (McGeady et al., 1989) was used to introduce thewild-type TP53 cDNA into HC11 and C57MG cells. This vector contains an internalmetallothionine (MT) promoter that can be induced by low levels of cadmiumsulfate (3 mM). Mouse Trp53 was cloned into the 1529 vector using BamHI andEcoRI restriction sites.

The murine NICD4 cDNA corresponding to a truncated Notch4 cDNA (residues4382–6043) has been described (Gallahan and Callahan, 1987; Jhappan et al., 1992).An oligonucleotide encoding hemagglutinin (HA) tag was appended to the 3� end ofNICD4 cDNA. The HA-tagged NICD4 expression vector was generated throughPCR using Pfu polymerase from Stratagene and cloned into the eukaryotic expressionvector pcDNA3. The forward primers, A1: 5�-GGAATTCCGC CACC ATGG CA -GCAGTGGGAGCTCTGGAGCCCCTGCTGC-3� was used to generate an EcoRIsite and B1: 5�-CCGCTCGAGTCAAGCGTA TCTGGAA CATCGTATGGGT T -CAGAT TTCTTACAACCGAGTTTAAG-3� to create an XhoI site and an HA tag.pc DNA3 was cut by both EcoRI and XhoI and the ligations were done as described

previously (Sun et al., 2005a). The RAM domain (4382-4861) was amplified bythe forward primer A1: 5�-GGAATTCCGCCAC CATGGCAGCAGTGGGAGC -TCTGGAGCCCCTGCTGC-3� that created a EcoRI site and the reverse primer B2:5�-CCGCTCGAGTCAAGCGTAATCTGGAACATCGTATGGCAGAACCTCCGA -TTCACACTCCTGAG-3�, which created an XhoI site as well as HA tag. TheAnkyrin repeat domain (4862–5512) was amplified by forward primer A2: 5�-CGCGGATCCGCCACCAT GGATGTGGACA CCTGTGGACCTGATGGGGTGA -CA CC CCTGATGTC-3�, which created a EcoRI site and the reverse primer B3:5�-CCGCTCGAGTC AAGCGT AATCTGGAACATCGTATGGGCCGCCCCGAG -CT CC AGCAACAGCTG-3�, which created an XhoI site as well as HA tag. TheRAM plus Ankyrin repeats domain (4382–5512) (RAM_Ank) was amplified usingprimer A1 and primer B3. The C-terminal domain (5513–6043) was amplified usingthe forward primer A3: 5�-GGAATTCCGCCACCATGCCGGGGACTGCGAGAC -CA GGCCGGGCTGG C CCCAGGAGATGTGG-3�, which created a EcoRI site andthe reverse primer B1. All NICD4 and its deletion plasmids have sequenced andverified. Mdm2 and Mdm2 RING deletion (DR) vectors were obtained from Carl G.Maki (University of Chicago).

Protein extraction, antibodies and immunoprecipitationCells were lysed as previously described (Sun et al., 2005b). The antibodies usedwere: anti-V5 (Invitrogen; 1:5000), anti-FLAG-HRP (Sigma; 1:1000), anti-Notch 4are from Upstate (Charlottesville, VA; 1:1000) and AVIVA System Biology (SanDiego, CA; 1:2000), anti-HA (Roche), anti-Mdm2 (Santa Cruz, N-20 and SMP14),anti-a-HSP70, anti-NICD4 (AVIVA, 1:4000), anti-Trp53 protein (CM5) (VectorLaboratories).

For the Notch and Trp53 interaction analysis, 293T/17 cells (1�106 cells on 60-mm-diameter plates) were transfected with 2 mg HA–NICD1, HA–NICD3, HA–NICD4 expression vectors with, or without, 2 mg FLAG–Trp53. Alternatively, forthe Notch–MDM2 interaction analysis, the cells were transfected with 2 mg HA-NICD4 mutant expression vectors with or without the addition of 2 mg Mdm2expression vector. Tranfections were performed using Lipofectamine 2000 reagent(Invitrogen) according to the manufacturer’s instruction. Seventy-two hours aftertransfection, the cells were lysed for 20 minutes with 0.5 ml lysis buffer as previouslydescribed (Sun et al., 2005a). Before lysis, the cells were treated for 5 hours with 30mM MG-132. Immunoprecipitations were carried out as previously described (Sunet al., 2005a) by incubating 1.0 mg of total protein with 30 ml anti-FLAG antibodyconjugated to resin beads (Aguila et al., 2007) overnight at 4°C. The resin waswashed four times with 0.5 ml lysis buffer and eluted with high concentration ofFLAG peptide according to the procedure from Sigma. Immunoprecipitates werevisualized by western blotting with anti-HA (Roche) or anti-FLAG horseradishperoxidase-conjugated antibody (Aguila et al., 2007).

The antibodies against Trp53 (Santa Cruz, sc-99 AC) and Mdm2 (Santa Cruz, sc-965 AC) and control mouse serum, conjugated to agarose beads (Santa Cruz, sc-2343) were used in immunoprecipitations involving NIH3T3 and H1299 cell lysates.

Western blotsCells were harvested in RIPA buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.2, 0.1%SDS, 1.0% Triton X-100, 1% sodium deoxycholate, 5 mM EDTA) supplementedwith the protease inhibitor cocktail set 1 (Calbiochem). Total protein concentrationwas determined with the BCA Protein Assay Kit (Pierce Biotechnology). Protein (50mg total) was loaded on gradient 4–20% SDS-PAGE gels and transferred tonitrocellulose membrane using the iBlot Transfer System (Invitrogen). Membraneswere blocked with blocking buffer (5% non-fat milk in TBS with 0.1% Tween20(Tris-buffered saline Tween-20, TBS/T) for 1 hour at room temperature and thenincubated with primary a-tubulin (Aguila et al., 2007) antibodies. After washingwith TBS/T (Tris-Buffered Saline tween-20) membranes were incubated for 1 hourat room temperature with the appropriate secondary antibody conjugated to HRP,diluted in TBS/T. Proteins were visualized using the ECL Western Blotting DetectionSystem (Amersham, GE Healthcare).

In vivo ubiquitylation assayIn vivo ubiquitylation assays were carried out essentially as described (Wu et al.,2001; Yang et al., 2005) with minor modifications. Briefly, 293T/17 cells or Bosc23cells were transfected with 2 mg HA-NICD4, 1 mg ubiquitin and 2 mg indicated wild-type or mutant Mdm2 E3 ligases or Sel-10 E3 ligase expression vectors, for 48hours, using Lipofectamine 2000 and then treated with MG-132 for 5 hours beforeharvesting. NICD4 was immunoprecipitated from cell lysates with an anti-HAantibody, and the immunoprecipitates were analyzed by western blot with anti-ubiquitin (Yang et al., 2005).

Quantitative real-time PCRQuantitative real-time polymerase chain reaction (qRT-PCR) was performed usingthe SYBR Green Master Mix (Bio-Rad Laboratories). The following primers wereused for qRT-PCR: Notch 4 Forward primer; 5� AGT CCA GGC CTT GCC AGAACG-3�; Notch 4 Reverse primer; 5� GTA GAA GGC ATT GGC CAG AGA G-3�;Mdm2-Forward primer; GCA AAT GTG CAA TAC CAA CAT GTC; Mdm2-Reverse primer; 5�-GCC AAA CAA ATC TCC TAG AAG ATC-3�; HPRT Forwardprimer; 5�-GACACTGGCAAAACAATGCAGAC-3� and HPRT Reverse primer;5�-CAGTTTCACTAATGACACATTCATG-3�. Normalization of NICD4 and Mdm2

1074 Journal of Cell Science 124 (7)

Jour

nal o

f Cel

l Sci

ence

mRNA levels to HPRT were done according to the manufacturer’s protocol. Mdm2vectors were purchased from Open Biosystem. Lentivirus was produced followingthe manufacturer’s protocol and viral infections were carried out according to Sunet al. (Sun et al., 2005a).

PCR, SSCP, and Trp53 nucleotide sequence analysisThe primers for Exon 3 are F, 5�-CCATCACCTCACTGCATGGACGAT-3� and R,5�-CGTGCACATAACAGACTTGGCTG-3�; exon 4 F, 5�-TACTCTCCTCCC -CTCAATAAGC-3� and R, 5�-CATCACCATCGGAGCAGCGCTC-3�; exon 5 F, 5�-GCCTGGCTCCTCCCCAGCATCTTATC-3� and R, 5�-CTCGGG TGG CTC -ATAAGGTACCACC-3�; exons 6 and 7 F, 5�-CTCTCTTTGCGCTCCCTGGGGGC-3�and R, 5�-GCCGGCTCTGAGTATACCACCATCC-3�. Amplified products werescreened for sequence variations using single strand conformation polymorphism(SSCP) analysis (Merlo et al., 1994). The PCR product was heat-denatured at 95°Cfor 5 minutes and immediately placed on ice until it was loaded onto the gel. Thedenatured products were resolved in 10% polyacrylamide gels. Gels weresubsequently fixed and stained with silver nitrate and photographed. Direct sequencingwas done on selected samples as follows: after PCR amplification, products werepurified by electrophoresis on 1% agarose gel. The DNA fragment was excised fromthe gel, purified with an Extraction Kit (QIAquick Spin; Qiagen, Hilden, Germany),and ligated into a plasmid TOPO TA Cloning (Invitrogen, Carlsbad, CA). Theconstructs were transformed into Escherichia coli strain DH5alpha and plated.Plasmid DNA from single cell clones was isolated using EcoRI to assay for an insert.The clones to be sequenced were purified with QIAprep Miniprep (Qiagen). Thesequence was obtained using one of the original primers in a sequencing reactionperformed on an ABI PRISM 310 automated DNA sequencer with the BigDyeterminator sequencing kit (Applied Biosystems, Foster City, CA). Sequences werecompared with the GenBank sequence number U94788 for the mouse Trp53 gene.

The Trp53 DNA binding domain status was checked in cellular DNA frommammary tumors of several transgenic models: WAP-Int3 (Gallahan and Callahan,1987), MMTV LTR-Int3 (Jhappan et al., 1992), WAP-Int3sh (WAP-Int3short) (Raafatet al., 2004), WAP-CBF1 KO (Wap-NICD4/CBF1 knock out) (Raafat et al., 2009),WAP-Cripto-1 (Sun et al., 2005b), WAP-Int6 (Mack et al., 2007) and MMTV-NICD1 (Kiaris et al., 2004).

RNA isolation, cDNA synthesis and RT-PCRRNA isolation, cDNA synthesis and RT-PCR were performed as previously described(Sun et al., 2005a; Sun et al., 2002). Briefly, total cellular RNA was isolated usingTRIzol (Invitrogen, Carlsbad, CA). cDNA was synthesized from 1 mg total RNA,after treatment with DNaseI (Invitrogen), using oligo(dT)12-15 primers and theSuperScript II kit, according to the manufacturer’s protocol (Invitrogen, Carlsbad,CA). Primers used were GAPDH, 5�-CCCTTCATTGACCTCAACTAC-3� and 5�-CCACCTTCTTGATGTCATCAT-3�, and HES-1, 5�-ATGAGATCAGTA CTGCGG -ATGCCATCT-3� and 5�-GCACAGAGACGGTGCTGCCATCAGACT-3� (AccessionNumber, M16006)

Colony formation in soft agarThe soft agar assay was performed as described previously (Raafat et al., 2007).Briefly, tissue culture cells in an agar mixture were seeded at 1.5�104 or 3�104

cells/well in triplicate. The plates were incubated at 37°C with 5% CO2 for 21 days.Colonies measuring 0.2 mm or more were counted using the AccuCount 1000 colonycounter (Biologics, Inc., Manassas, VA, USA). For Trp53 induction 3 mM CdSO4was added to growth media.

StatisticsQuantitative values are represented as the mean value of at least three repeats of onerepresentative experiment. All experiments were repeated at least three times. Thestatistical significance of the difference between groups was determined by theStudent t-test. Comparisons resulting in P<0.05 were considered statisticallysignificant and identified in the figures with an asterisk.

We thank our colleagues R. A. Obar, A. Mukherjee, K. G.Guruharsha and A. Louvi (Yale University) for their help. We alsothank Guillermina Lozano for providing Trp53-null, Mdm2-null MEFsand wild-type MEFs; Bert Vogelstein for supplying HCT116 TP53-null and parental cells; S. Aaronson for crucial reagents and DaiqingLiao for pcDNA3 FLAG–Trp53 expression vectors; Lizi Wu forpcDNA3 HA–NICD1 and pcDNA3 HA–NICD3; and Carl G. Makifor pcDNA3 Mdm2 and pcDNA3 Mdm2DR vectors. This researchwas supported in part by the National Institutes of Health GrantsNS26084 and CA098402 (to S.A.-T.) and partly by the IntramuralResearch Program of the NIH, National Cancer Institute, Center forCancer Research. The authors declare no competing interests. Depositedin PMC for release after 12 months.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/124/7/1067/DC1

ReferencesAguila, B., Coulbault, L., Boulouard, M., Liotaveilliota, F., Davis, A., Tsigmath, G.,

Borsodi, A., Balboni, G., Salvadori, S., Jauzac, P. et al. (2007). In vitro and in vivopharmacological profile of UFP-512, a novel selective delta-opioid receptor agonist;correlations between desensitization and tolerance. Br. J. Pharmacol. 152, 1312-1324.

Allenspach, E. J., Maillard, I., Aster, J. C. and Pear, W. S. (2002). Notch signaling incancer. Cancer Biol. Ther. 1, 466-476.

Artavanis-Tsakonas, S., Matsuno, K. and Fortini, M. E. (1995). Notch signaling.Science 268, 225-232.

Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling: cell fatecontrol and signal integration in development. Science 284, 770-776.

Barak, Y. and Oren, M. (1992). Enhanced binding of a 95 kDa protein to p53 in cellsundergoing p53-mediated growth arrest. EMBO J. 11, 2115-2121.

Baron, M., Aslam, H., Flasza, M., Fostier, M., Higgs, J. E., Mazaleyrat, S. L. andWilkin, M. B. (2002). Multiple levels of Notch signal regulation (review). Mol. Membr.Biol. 19, 27-38.

Beverly, L. J., Felsher, D. W. and Capobianco, A. J. (2005). Suppression of p53 byNotch in lymphomagenesis: implications for initiation and regression. Cancer Res. 65,7159-7168.

Blackburn, A. C. and Jerry, D. J. (2002). Knockout and transgenic mice of Trp53: whathave we learned about p53 in breast cancer? Breast Cancer Res. 4, 101-111.

Bunz, F., Dutriaux, A., Lengauer, C., Waldman, T., Zhou, S., Brown, J. P., Sedivy, J.M., Kinzler, K. W. and Vogelstein, B. (1998). Requirement for p53 and p21 to sustainG2 arrest after DNA damage. Science 282, 1497-1501.

Callahan, R. and Egan, S. E. (2004). Notch signaling in mammary development andoncogenesis. J. Mammary Gland Biol. Neoplasia 9, 145-163.

Capobianco, A. J., Zagouras, P., Blaumueller, C. M., Artavanis-Tsakonas, S. andBishop, J. M. (1997). Neoplastic transformation by truncated alleles of humanNOTCH1/TAN1 and NOTCH2. Mol. Cell. Biol. 17, 6265-6273.

Chen, J., Marechal, V. and Levine, A. J. (1993). Mapping of the p53 and mdm-2interaction domains. Mol. Cell. Biol. 13, 4107-4114.

Donehower, L. A., Godley, L. A., Aldaz, C. M., Pyle, R., Shi, Y. P., Pinkel, D., Gray,J., Bradley, A., Medina, D. and Varmus, H. E. (1995). Deficiency of p53 acceleratesmammary tumorigenesis in Wnt-1 transgenic mice and promotes chromosomalinstability. Genes Dev. 9, 882-895.

Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D. andSklar, J. (1991). TAN-1, the human homolog of the Drosophila notch gene, is brokenby chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661.

Fang, S., Jensen, J. P., Ludwig, R. L., Vousden, K. H. and Weissman, A. M. (2000).Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53. J. Biol.Chem. 275, 8945-8951.

Fortini, M. E. (2009). Notch signaling: the core pathway and its posttranslational regulation.Dev. Cell 16, 633-647.

Fre, S., Pallavi, S. K., Huyghe, M., Lae, M., Janssen, K. P., Robine, S., Artavanis-Tsakonas, S. and Louvard, D. (2009). Notch and Wnt signals cooperatively controlcell proliferation and tumorigenesis in the intestine. Proc. Natl. Acad. Sci. USA 106,6309-6314.

Gallahan, D. and Callahan, R. (1987). Mammary tumorigenesis in feral mice:identification of a new int locus in mouse mammary tumor virus (Czech II)-inducedmammary tumors. J. Virol. 61, 66-74.

Gerhart, J. (1999). 1998 Warkany lecture: signaling pathways in development. Teratology60, 226-239.

Geyer, R. K., Yu, Z. K. and Maki, C. G. (2000). The MDM2 RING-finger domain isrequired to promote p53 nuclear export. Nat. Cell Biol. 2, 569-573.

Gottlieb, T. M. and Oren, M. (1996). p53 in growth control and neoplasia. Biochim.Biophys. Acta 1287, 77-102.

Hadsell, D. L., Murphy, K. L., Bonnette, S. G., Reece, N., Laucirica, R. and Rosen,J. M. (2000). Cooperative interaction between mutant p53 and des(1-3)IGF-I acceleratesmammary tumorigenesis. Oncogene 19, 889-898.

Haupt, Y., Maya, R., Kazaz, A. and Oren, M. (1997). Mdm2 promotes the rapiddegradation of p53. Nature 387, 296-299.

Honda, R. and Yasuda, H. (2000). Activity of MDM2, a ubiquitin ligase, toward p53 oritself is dependent on the RING finger domain of the ligase. Oncogene 19, 1473-1476.

Hundley, J. E., Koester, S. K., Troyer, D. A., Hilsenbeck, S. G., Subler, M. A. andWindle, J. J. (1997). Increased tumor proliferation and genomic instability withoutdecreased apoptosis in MMTV-ras mice deficient in p53. Mol. Cell. Biol. 17, 723-731.

Hurlbut, G. D., Kankel, M. W., Lake, R. J. and Artavanis-Tsakonas, S. (2007).Crossing paths with Notch in the hyper-network. Curr. Opin. Cell Biol. 19, 166-175.

Hurlbut, G. D., Kankel, M. W. and Artavanis-Tsakonas, S. (2009). Nodal points andcomplexity of Notch-Ras signal integration. Proc. Natl. Acad. Sci. USA 106, 2218-2223.

Jhappan, C., Gallahan, D., Stahle, C., Chu, E., Smith, G. H., Merlino, G. andCallahan, R. (1992). Expression of an activated Notch-related int-3 transgene interfereswith cell differentiation and induces neoplastic transformation in mammary and salivaryglands. Genes Dev. 6, 345-355.

Jue, S. F., Bradley, R. S., Rudnicki, J. A., Varmus, H. E. and Brown, A. M. (1992).The mouse Wnt-1 gene can act via a paracrine mechanism in transformation ofmammary epithelial cells. Mol. Cell. Biol. 12, 321-328.

Kankel, M. W., Hurlbut, G. D., Upadhyay, G., Yajnik, V., Yedvobnick, B. andArtavanis-Tsakonas, S. (2007). Investigating the genetic circuitry of mastermind inDrosophila, a notch signal effector. Genetics 177, 2493-2505.

Kiaris, H., Politi, K., Grimm, L. M., Szabolcs, M., Fisher, P., Efstratiadis, A. andArtavanis-Tsakonas, S. (2004). Modulation of notch signaling elicits signature tumors

1075Notch–Trp53–Mdm2 interactions

Jour

nal o

f Cel

l Sci

ence

and inhibits hras1-induced oncogenesis in the mouse mammary epithelium. Am. J.Pathol. 165, 695-705.

Kim, S. B., Chae, G. W., Lee, J., Park, J., Tak, H., Chung, J. H., Park, T. G., Ahn, J.K. and Joe, C. O. (2007). Activated Notch1 interacts with p53 to inhibit itsphosphorylation and transactivation. Cell Death Differ. 14, 982-991.

Kopan, R., Schroeter, E. H., Weintraub, H. and Nye, J. S. (1996). Signal transductionby activated mNotch: importance of proteolytic processing and its regulation by theextracellular domain. Proc. Natl. Acad. Sci. USA 93, 1683-1688.

Kussie, P. H., Gorina, S., Marechal, V., Elenbaas, B., Moreau, J., Levine, A. J. andPavletich, N. P. (1996). Structure of the MDM2 oncoprotein bound to the p53 tumorsuppressor transactivation domain. Science 274, 948-953.

Mack, D. L., Boulanger, C. A., Callahan, R. and Smith, G. H. (2007). Expression oftruncated Int6/eIF3e in mammary alveolar epithelium leads to persistent hyperplasiaand tumorigenesis. Breast Cancer Res. 9, R42.

Mao, J. H., Perez-Losada, J., Wu, D., Delrosario, R., Tsunematsu, R., Nakayama, K.I., Brown, K., Bryson, S. and Balmain, A. (2004). Fbxw7/Cdc4 is a p53-dependent,haploinsufficient tumour suppressor gene. Nature 432, 775-779.

Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M. and Artavanis-Tsakonas,S. (1995). Deltex acts as a positive regulator of Notch signaling through interactionswith the Notch ankyrin repeats. Development 121, 2633-2644.

Mazaleyrat, S. L., Fostier, M., Wilkin, M. B., Aslam, H., Evans, D. A., Cornell, M.and Baron, M. (2003). Down-regulation of Notch target gene expression by Suppressorof deltex. Dev. Biol. 255, 363-372.

McGeady, M. L., Kerby, S., Shankar, V., Ciardiello, F., Salomon, D. and Seidman, M.(1989). Infection with a TGF-alpha retroviral vector transforms normal mouse mammaryepithelial cells but not normal rat fibroblasts. Oncogene 4, 1375-1382.

Merlo, G. R., Venesio, T., Taverna, D., Marte, B. M., Callahan, R. and Hynes, N. E.(1994). Growth suppression of normal mammary epithelial cells by wild-type p53.Oncogene 9, 443-453.

Michelsen, K., Schmid, V., Metz, J., Heusser, K., Liebel, U., Schwede, T., Spang, A.and Schwappach, B. (2007). Novel cargo-binding site in the {beta} and {delta}subunits of coatomer. J. Cell Biol. 179, 209-217.

Momand, J., Zambetti, G. P., Olson, D. C., George, D. and Levine, A. J. (1992). Themdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation. Cell 69, 1237-1245.

Montes de Oca Luna, R., Wagner, D. S. and Lozano, G. (1995). Rescue of earlyembryonic lethality in mdm2-deficient mice by deletion of p53. Nature 378, 203-206.

Mukherjee, A., Veraksa, A., Bauer, A., Rosse, C., Camonis, J. and Artavanis-Tsakonas,S. (2005). Regulation of Notch signalling by non-visual beta-arrestin. Nat. Cell Biol. 7,1191-1201.

Picksley, S. M. and Lane, D. P. (1993). The p53-mdm2 autoregulatory feedback loop: aparadigm for the regulation of growth control by p53? BioEssays 15, 689-690.

Raafat, A., Bargo, S., Anver, M. R. and Callahan, R. (2004). Mammary developmentand tumorigenesis in mice expressing a truncated human Notch4/Int3 intracellulardomain (h-Int3sh). Oncogene 23, 9401-9407.

Raafat, A., Zoltan-Jones, A., Strizzi, L., Bargo, S., Kimura, K., Salomon, D. andCallahan, R. (2007). Kit and PDGFR-alpha activities are necessary for Notch4/Int3-induced tumorigenesis. Oncogene 26, 662-672.

Raafat, A., Lawson, S., Bargo, S., Klauzinska, M., Strizzi, L., Goldhar, A. S., Buono,K., Salomon, D., Vonderhaar, B. K. and Callahan, R. (2009). Rbpj conditionalknockout reveals distinct functions of Notch4/Int3 in mammary gland development andtumorigenesis. Oncogene 28, 219-230.

Robbins, J., Blondel, B. J., Gallahan, D. and Callahan, R. (1992). Mouse mammarytumor gene int-3: a member of the notch gene family transforms mammary epithelialcells. J. Virol. 66, 2594-2599.

Schon, O., Friedler, A., Bycroft, M., Freund, S. M. and Fersht, A. R. (2002). Molecularmechanism of the interaction between MDM2 and p53. J. Mol. Biol. 323, 491-501.

Secchiero, P., Melloni, E., di Iasio, M. G., Tiribelli, M., Rimondi, E., Corallini, F.,Gattei, V. and Zauli, G. (2009). Nutlin-3 up-regulates the expression of Notch1 in bothmyeloid and lymphoid leukemic cells, as part of a negative feedback antiapoptoticmechanism. Blood 113, 4300-4308.

Smith, G. H., Gallahan, D., Diella, F., Jhappan, C., Merlino, G. and Callahan, R.(1995). Constitutive expression of a truncated INT3 gene in mouse mammary epitheliumimpairs differentiation and functional development. Cell Growth Differ. 6, 563-577.

Stifani, S., Blaumueller, C. M., Redhead, N. J., Hill, R. E. and Artavanis-Tsakonas,S. (1992). Human homologs of a Drosophila Enhancer of split gene product define anovel family of nuclear proteins. Nat. Genet. 2, 119-127.

Strobl, L. J., Hofelmayr, H., Stein, C., Marschall, G., Brielmeier, M., Laux, G.,Bornkamm, G. W. and Zimber-Strobl, U. (1997). Both Epstein-Barr viral nuclearantigen 2 (EBNA2) and activated Notch1 transactivate genes by interacting with thecellular protein RBP-J kappa. Immunobiology 198, 299-306.

Sun, Y., Nonobe, E., Kobayashi, Y., Kuraishi, T., Aoki, F., Yamamoto, K. and Sakai,S. (2002). Characterization and expression of L-amino acid oxidase of mouse milk. J.Biol. Chem. 277, 19080-19086.

Sun, Y., Lowther, W., Kato, K., Bianco, C., Kenney, N., Strizzi, L., Raafat, D., Hirota,M., Khan, N. I., Bargo, S. et al. (2005a). Notch4 intracellular domain binding toSmad3 and inhibition of the TGF-beta signaling. Oncogene 24, 5365-5374.

Sun, Y., Strizzi, L., Raafat, A., Hirota, M., Bianco, C., Feigenbaum, L., Kenney, N.,Wechselberger, C., Callahan, R. and Salomon, D. S. (2005b). Overexpression ofhuman Cripto-1 in transgenic mice delays mammary gland development anddifferentiation and induces mammary tumorigenesis. Am. J. Pathol. 167, 585-597.

Takebayashi, K., Sasai, Y., Sakai, Y., Watanabe, T., Nakanishi, S. and Kageyama, R.(1994). Structure, chromosomal locus, and promoter analysis of the gene encoding themouse helix-loop-helix factor HES-1. Negative autoregulation through the multiple Nbox elements. J. Biol. Chem. 269, 5150-5156.

Talora, C., Campese, A. F., Bellavia, D., Felli, M. P., Vacca, A., Gulino, A. andScrepanti, I. (2008). Notch signaling and diseases: an evolutionary journey from asimple beginning to complex outcomes. Biochim. Biophys. Acta 1782, 489-497.

Tao, L., Roberts, A. L., Dunphy, K. A., Bigelow, C., Yan, H. and Jerry, D. J. (2010).Repression of mammary stem/progenitor cells by P53 is mediated by Notch andseparable from apoptotic activity. Stem Cells 29, 119-127.

Vikhanskaya, F., Colella, G., Valenti, M., Parodi, S., D’Incalci, M. and Broggini, M.(1999). Cooperation between p53 and hMLH1 in a human colocarcinoma cell line inresponse to DNA damage. Clin. Cancer Res. 5, 937-941.

Vogelstein, B., Lane, D. and Levine, A. J. (2000). Surfing the p53 network. Nature 408,307-310.

Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P. T., Silverman, L. B., Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T. and Aster, J. C. (2004). Activating mutationsof NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271.

Wu, G., Lyapina, S., Das, I., Li, J., Gurney, M., Pauley, A., Chui, I., Deshaies, R. J.and Kitajewski, J. (2001). SEL-10 is an inhibitor of notch signaling that targets notchfor ubiquitin-mediated protein degradation. Mol. Cell. Biol. 21, 7403-7415.

Wu, L., Aster, J. C., Blacklow, S. C., Lake, R., Artavanis-Tsakonas, S. and Griffin, J.D. (2000). MAML1, a human homologue of Drosophila mastermind, is a transcriptionalco-activator for NOTCH receptors. Nat. Genet. 26, 484-489.

Yang, Y., Lorick, K. L., Jensen, J. P. and Weissman, A. M. (2005). Expression andevaluation of RING finger proteins. Methods Enzymol. 398, 103-112.

Zhao, L. Y., Liu, J., Sidhu, G. S., Niu, Y., Liu, Y., Wang, R. and Liao, D. (2004).Negative regulation of p53 functions by Daxx and the involvement of MDM2. J. Biol.Chem. 279, 50566-50579.

1076 Journal of Cell Science 124 (7)

Jour

nal o

f Cel

l Sci

ence