tumor and stem cell biology cancer research silencing of ... · biology, university of yamanashi,...

Tum

Sileto-EPulm

YasufNarika

Abst

Intro

Epitmechasion aenonhealinthe prby theof mes

AuthorFacultBiologyFacultyJapan;Institute5DeparInstitutand 6DToyama

CorresMaxillo1110 S273-11

doi: 10

©2010

www.a

Published OnlineFirst October 26, 2010; DOI: 10.1158/0008-5472.CAN-09-3880

Canceresearch

or and Stem Cell Biology

ncing of Autocrine Motility Factor Induces Mesenchymal-pithelial Transition and Suppression of Osteosarcoma

R

onary Metastasis

umi Niinaka1,3,4, Kiyoshi Harada1, Masahiro Fujimuro2, Masamitsu Oda1, Arayo Haga4,5, Misa Hosoki3,
zu Uzawa3, Naoya Arai3,6, Satoshi Yamaguchi3, Masashi Yamashiro3, and Avraham Raz4
ractPho

glycolyas cytcell mmaligntransitwe comousemurincells ssecretof AMof vimtermin

former epenchyma

s' Affiliatioy of Medic, Universityof Dentis

4Tumor Pro, Wayne Sttment of Dre for Healthepartment, School of

ponding Afacial Surghimokato,11; Fax: 81-

.1158/0008-

American A

acrjourna

Downloa

sphoglucose isomerase (PGI) is a multifunctional enzyme that functions in glucose metabolism as atic enzyme catalyzing an interconversion between glucose and fructose inside the cell, while it actsokine outside the cell, with properties that include autocrine motility factor (AMF)–regulating tumorotility. Overexpression of AMF/PGI induces epithelial-to-mesenchymal transition with enhancedancy. Recent studies have revealed that silencing of AMF/PGI resulted in mesenchymal-to-epithelialion (MET) of human lung fibrosarcoma cells and breast cancer cells with reduced malignancy. Here,nstructed a hammerhead ribozyme specific against GUC triplet at the position G390 in the human,, and rat AMF/PGI mRNA sequence. Mesenchymal human osteosarcoma MG-63, HS-Os-1, ande LM8 cells were stably transfected with the ribozyme specific for AMF/PGI. The stable transfectanthowed effective downregulation of AMF/PGI expression and subsequent abrogation of AMF/PGIion, which resulted in morphologic change with reduced growth, motility, and invasion. SilencingF/PGI induced MET, in which upregulation of E-cadherin and cytokeratins, as well as downregulationentin, were noted. The MET guided by AMF/PGI gene silencing induced osteosarcoma MG-63 toally differentiate into mature osteoblasts. Furthermore, MET completely suppressed the tumorand pulmonary metastasis of LM8 cells in nude mice. Thus, acquisition of malignancy might be
growth
completed in part by upregulation of AMF/PGI, and waiver of malignancy might also be controlled bydownregulation of AMF/PGI. Cancer Res; 70(22); 9483–93. ©2010 AACR.

markeepitheother;intercintercmassSev

ing gr

duction

helial-to-mesenchymal transition (EMT) is an essentialnism for the development of malignant cells for inva-nd metastasis (1). EMT is a well-documented phenom-occurring during embryonic development and woundg, as well as tumorigenesis (2). EMT was defined asocess that produces a complete loss of epithelial traits

ithelial cells accompanied by the acquisitionl characteristics in vitro, i.e., loss of epithelial

In thescriptby domesening EMacts tphoryfamilya signfactordownsof GSpathwsupprPho

ic enzglycol

ns: 1Department of Oral and Maxillofacial Surgery,ine and 2Department of Molecular and Cellularof Yamanashi, Chuo, Japan; 3Maxillofacial Surgery,

try, Tokyo Medical and Dental University, Tokyo,gression and Metastasis Program, Karmanos Cancerate University School of Medicine, Detroit, Michigan;ug and Housing Hygiene, Gifu Prefectural Researchand Environmental Science, Kakamigahara, Japan;of Oral and Maxillofacial Surgery, University ofMedicine, Toyama, Japan

uthor: Yasufumi Niinaka, Department of Oral andery, University of Yamanashi, Faculty of Medicine,Chuo, Yamanashi 409-3898, Japan. Phone: 81-55-55-273-8210; E-mail: [email protected].

5472.CAN-09-3880

ssociation for Cancer Research.

ls.org

Research. on October 1, 202cancerres.aacrjournals.org ded from

rs and gain of mesenchymal markers (3, 4). Normally,lial cells are polarized and tightly connected to eachin contrast, mesenchymal cells do not establish stableellular contacts (3, 4). During EMT, epithelial cells loseellular junctions causing dissociation from the original(5).eral growth factors and cytokines such as transform-owth factor-β (TGF-β) are known to initiate EMT (6).center of E-cadherin repression, a zinc finger tran-

ion factor Snail functions as a molecular organizerwn-modulating epithelial genes and up-modulatingchymal genes, is activated by most pathways trigger-T, and is negatively regulated by GSK-3β (7). TGF-βhrough serine/threonine kinase receptors to phos-late the cytoplasmic Smads that activate the Snail. The serine/threonine integrin-linked kinase (ILK) isaling protein stimulated by both integrins and growthreceptors. Activated ILK can directly phosphorylatetream target GSK-3β, thus resulting in the inhibitionK-3β activity, which stimulates the Wnt-β-cateninay and upregulates Snail, that in basal conditions isessed by active GSK-3β.sphoglucose isomerase (PGI) is a housekeeping cytosol-
yme of sugar metabolism that plays a key role in bothysis and gluconeogenesis pathways (8); extracellularly,
9483

0. © 2010 American Association for Cancer

http://cancerres.aacrjournals.org/

it behfactorpeptidAMFas a mcancePGI wembrytion fleukemrum aprogretransfEMTgulatiotive smesenmalignRibo

sic enwhichgle bato theribozyribozyposedin theformesequea phosequenas welusingplacebtransfdelive

(24). Tfor geapproIn t

zymeAMF/Then,osteostion o

Mate

PlasmThe

signedin Figbase pof com(OperEcoRIwerewitho2000protocof G41of G41

CellsThe

2007 fauthenfrozenmetastained

Niinaka et al.

Cance9484


aves as a cytokine that includes autocrine motility(AMF). Partial amino acid sequencing of fragmentes (9) and molecular cloning and sequencing ofhave identified PGI (10). AMF is originally identifiedajor cell motility-stimulating factor associated with

r development and progression (11). Independently,as found to be a neuroleukin promoting growth ofonic spinal and sensory neurons (12) and a matura-actor mediating differentiation of human myeloidia cells (13). The presence of aberrations in the se-nd urine is of prognostic value associated with cancerssion (14–16). Overexpression of AMF/PGI inducedormation and survival of NIH-3T3 fibroblast throughwith enhanced malignancy (17). In contrast, downre-n of AMF/PGI sensitized fibrosarcoma cells to oxida-tress to cellular senescence (18) and resulted incymal-to-epithelial transition (MET) with reducedancy (19, 20).zymes are RNA molecules with highly specific intrin-zymatic cleavage activity against target RNA sequence,can discriminate mutant sequences differing by a sin-se from their wild-type counterparts (21). After bindingRNA substrate by base pair complementation, theme cleaves the target RNA irreversibly. A hammerheadme has been identified as the smallest ribozyme com-of ∼30 nucleotides with a conserved catalytic domainsingle-stranded region and variable stem regions

d by base-pairing with basically any desired targetnces (22). The characteristic site-specific cleavage ofsphodiester bond after uridine of the triplet GUCce (23) provides a very valuable tool for gene therapyl as experimental gene targeting. A gene therapy trialanti-HIV ribozyme, the first randomized, double-blind,o-controlled, phase II autologous cell-delivered gene
er clinical trial, was carried out and indicated cell- Cente
r Res; 70(22) November 15, 2010

Research. on October 1, 202cancerres.aacrjournals.org Downloaded from

hus, a ribozyme might be one of the most reliable toolsne therapy, of which safety and feasibility of theach were already proved.he present report, we constructed a hammerhead ribo-specific against GUC triplet at the position G390 in thePGI mRNA conserved sequence for the gene targeting.we introduced the ribozyme into human and murinearcoma cells to knock down the translation and secre-f AMF/PGI.

rials and Methods

id construction and transfectionAMF-targeted hammerhead ribozyme RzG390 was de-from a comparison of AMF cDNA sequences as shown. 1. In addition, a control ribozyme mRz with a singleair mutation (A-G exchange) was prepared. Each pairplemental oligonucleotides was artificially synthesizedon), annealed together, and ligated into the BamHI/sites of pBK-CMV (Stratagene). Osteosarcoma cellstransfected with 8 μg of pBK-CMV ligated with orut Rz390G or mRz using 20 μL of Lipofectamine(Invitrogen) as recommended by the manufacturer'sols. Stable transfectants were selected by 800 μg/mL8 (Sigma) for 1 week and maintained with 100 μg/mL8.

and cell culturehuman osteosarcoma cell line MG-63 was obtained inrom the cell bank Riken Bioresource Center (routinelyticated by short tandem repeat profiling; ref. 25) andas original stocks in 2007. The human HS-Os-1 and

tatic murine osteosarcoma cell line LM8 (26) were ob-in February 2010 from the cell bank Riken Bioresource
r. A human oral squamous cell carcinoma (SCC) cell
d in 1989 (27), authenticated by

ureuennticaeriskicatean

usesistognogn90 isognco

lacehe ealytic activity.

red gene transfer to be safe and biologically active line HSC-3 was establishe

FigseqIdeastindhummoconrecrecG3recalsorepin tcat

Cancer Research


1. Comparison of AMF cDNAces and structure of ribozyme.l nucleotides are indicated bys (*), and putative GUC triplets ared in gray characters in a partialcDNA sequence in comparison withand rat. Structure of ribozymes of enzymatic core sequence,ition sites, and restriction enzymeition arms. The sequence aroundwell conserved and selected as a

ition sequence. A mutant ribozyme isnstructed by a single mutation withment of adenine (A) by guanine (G)nzymatic core sequence to lose


shortstocksDentacontaSigmaCO2 inreprodpassagitored

AntibThe

purifiebeads,prepadescriAE1/Anal anmousewere aoxidasHRP-cchased

PrepaAfte

mediuPBS a[25 m10 mm1% apnyl fludish otionedto 100Proteiusing

SDS-PAliq

mediuted onThe blnightmonoture, ffor 1revealnescenand ewas q

PhagoRan

phagoBriefly1.0% b24 hou

undermotivrsbweusingaratedorativbottom10% Faddedat 37°with aanol aunder

MTT aFor

Vybraing toper wferentend ofto eaclizingusingfor 4570 nmence w

ReverRev

descrizol reatocolsprimeFor qucompamineconsis30 secat 72°5 mincarriewere eand stand thin Tab

PulmLM

s.c. (1BALB/size wlated0.5XY2

the tulungs

Waiver of Malignancy in Osteosarcoma

www.a


tandem repeat profiling in 2005, and frozen as originalin 2005 at Maxillofacial Surgery, Tokyo Medical andl University. All cells were grown in DMEM (Sigma)ining 10% heat-inactivated fetal bovine serum (FBS;). Cultures were maintained at 37°C in an air–5%cubator at constant humidity. To ensure maximalucibility, cultures were grown for no longer than sixes after recovery from original frozen stocks and mon-to prevent Mycoplasma contamination (10).

odies and chemicalsrecombinant human AMF (rhAMF) was affinity-d by anti-AMF antibody conjugated with sepharoseand polyclonal antibodies including anti-rhAMF werered by immunization of rabbit (Takara Shuzo) asbed previously (10, 28). Mouse monoclonal antibodiesE3 to the human cytokeratins (Dako), mouse monoclo-tibody VIM-13.2 to the human vimentin (Sigma), andmonoclonal antibody 4A2C7 to E-cadherin (Invitrogen)ll purchased. The secondary antibodies horseradish per-e (HRP)–conjugated goat anti-rabbit IgG antibody andonjugated goat anti-mouse IgG antibody were pur-from Sigma.

ration of cell lysate and conditioned mediumr the cells reached their 70% to 80% confluence, them was removed. The cells were washed twice withnd lysed in 1 mL/100 mm dish of cell lysis buffermol/L Tris-HCl (pH 7.8) , 150 mmol/L NaCl,ol/L EDTA, 1% deoxycholate-Na, 1% Triton X-100,

rotinin, 1% leupeptin, 0.1 mmol/L phenylmethylsulfo-oride for cell lysate] or incubated with 5 mL/100 mmf serum-free DMEM for 48 hours to obtain condi-medium. Cell supernatants were concentrated up-fold using Amicon Ultra (30 kDa cutoff; Millipore).n concentrations of each sample were determinedBio-Rad protein assay reagent (Bio-Rad; ref. 10).

AGE and Western blottinguots of the cell lysates (25 μg) and the conditionedm (25 μg) were separated by 7.5% SDS-PAGE and blot-to polyvinylidene difluoride plus membranes (MSI).ots were blocked with 5% nonfat dry milk in PBS over-and incubated with polyclonal antibody (1:3,000) orclonal antibodies (1:1,000) for 1 hour at room tempera-ollowed by appropriate secondary antibodies (1:2,500)hour at room temperature. The labeled bands wereed by chemiluminescence using enhanced chemilumi-ce Western blotting detection reagents (Amersham)xposed to Kodak X-Omat film. Density of each banduantitated with NIH Image software (10).

kinetic track assay and invasion assaydom cell motility (chemokinetics) was measured bykinetic track assay as described previously (10, 28)., 2.0 × 103 cells were seeded on a coverslip coated with
ovine serum albumin and colloidal gold particles. Afterrs of incubation, phagokinetic tracks were visualized
mens4% pa

acrjournals.org


a microscope, and the area cleared by at least 25 loco-e cells was measured using NIH Image software (http://b.nih.gov/ij/). The in vitro invasion assay was doneTranswell cell culture chambers (Corning Costar) sep-by 8.0-μm pore filter precoated with Matrigel (Collab-e Biomedical Products) on the upper surface. Thechamber was filled with DMEM supplemented with

BS, and cell suspensions of 1 × 105 cells per well wereonto the upper chamber. After 15 hours of incubationC, the top side of the insert membrane was scrubbedcotton swab, and the bottom side was fixed with meth-nd stained with 1% H&E. Viable cells were counteda microscope. Each assay was done in triplicate.

ssaycell proliferation, an MTT assay was done using

nt MTT cell proliferation assay kit (Invitrogen) accord-the manufacturer's instructions. Briefly, 1 × 103 cellsell were plated on 96-well plates and cultured for dif-times indicated in 100 μL of culture medium. At thethe assay time, 10 μL of 12 mmol/L MTT were addedh well and then incubated at 37°C for 4 hours. Solubi-solution (SDS-HCl) was added and mixed thoroughlypipette. The microplate was incubated in air at 37°Chours in a humidified chamber. Plates were read at

on a spectrophotometric plate reader with a refer-avelength at 650 nm.

se transcription-PCR analysiserse transcription-PCR (RT-PCR) analysis was done asbed previously (10). Total RNA was extracted using Tri-gent (Invitrogen) according to the manufacturer's pro-. The cDNA was generated by using random hexamerrs and reverse transcriptase SuperScriptIII (Invitrogen).antitative evaluation of the amplified product, PCR en-ssing 20 to 35 cycles was preliminarily done to deter-the most suitable amplifications for each reaction. PCRted of appropriate cycles of denaturing at 93°C foronds, annealing at 62°C for 30 seconds and extensionC for 60 seconds with initial denaturation at 93°C forutes and final extension at 72°C for 10 minutes, wasd out using PC320 (Astek). PCR-amplified productslectrophoresed in 0.75% agarose (H14 agarose, Takara)ained with ethidium bromide. The PCR product sizee sequence of oligonucleotide primers were as shownle 1.

onary metastatic assay in vivo8parental, LM8mRz, and LM8Rz cells were inoculated× 106 per mouse) into the back space of eight femalec-nu/nu mice at 6 weeks of age, respectively. The tumoras measured every week, and tumor volume was calcu-with the following formula: tumor volume (mm3) =(X and Y being the longest and shortest diameters ofmor, respectively). Five weeks later, the s.c. tumor andwere removed to make frozen specimens. The speci-
were cut at their maximum dimensions and fixed withraformaldehyde in PBS and stained either by H&E or
Cancer Res; 70(22) November 15, 2010 9485



Table

Molec

AMFα-SMAE-cadhGAPDGSK-3ILKIntegriK1K2K3K4K5K6K7K8K13K14K15K16K17K18K19K20N-cadOCOPOsterixRunx2SlugSnailTGF-βTGF-βTGF-βTwist1Twist2VimenWnt1Wnt2Wnt2bWnt3Wnt3aWnt4Wnt5aWnt5bWnt6Wnt7aWnt7bWnt8aWnt8bWnt9aWnt9b

Niinaka et al.

Cancer R9486

D


PCR p ed in
1. List of
Size (b

1219114865620652810151156604598658697568542337337510440510999510643513581900264341316298770320335510405664451675242287287194330294273304300185196511315

es; 70(22) November

canownloaded from

rimers us

5′-GCT5′-GTG5′-GGC5′-ACG5′-GGC5′-AAG5′-AGG5′-TCT5′-ACA5′-AGC5′^GT5′-AAC5′-CTC5′-GCC5′-CTG5′-AAA5′-CAA5′-CAA5′-GCC5′-CAA5′-TCC5′-GAA5′-CAC5′-GAA5′-CTC5′-AGT5′-CTC5′-TGG5′-CCT5′-AAT5′-TGC5′-GAG5′-ATG5′-CTC5′-CGG5′-CTT5′-CTA5′-GGG5′-CAT5′-CAG5′-CTT5′-CTG5′-CTT5′-TGG5′-CTT5′-AAT5′-TCG5′-TCG5′-AGA

(C

15, 2010

cerres.aacrjourna

this study

5′-CAC5′-GGC5′-CAC5′-GGT5′-CTG5′-TGT5′-TTG5′-ACC5′-ACC5′-ACC5′-ACC5′-ACC5′-ACC5′-ACC5′-ACC5′-TTC5′-TTC5′-TTC5′-ACT5′-TTC5′-CTG5′-TTC5′-ATC5′-GTA5′-CTC5′-GGT5′-GAG5′-CTG5′-TCA5′-GGA5′-TGC5′-CTG5′-CAT5′-AAT5′-CTA5′-GCT5′-ACA5′-GAA5′-GGC5′-CTG5′-ACC5′-GTG5′-CTG5′-GGC5′-CAC5′-ACG5′-CGC5′-CTG5′-CGG

ontinued on the following page)

Research. on October 1, 2020. © 2010 Americals.org

ule
p) Forward Reverse
CCGCCATGGCCGCTCTC
AGGGTATCATCTTGGTGCC CCAAGATGTGTGACGAC ATCTTAGAAGCATTTGCGG
erin
CAGCCATGGGCCCTTGG CTTCAGCCAACCTGTTT H ACCACTTTGTCAAGCTC CTACATGGCAACTGTGA β CACAAGAAGTCAGCTATACA GTGCCCTATAGTACCGAGAA
CTTGGGGTTCATCCTCCT
GTGTAGGAAGGCCATGC n β4 GTGACTCCGAATCCGAA GGGATGTTGAGCCGATG
AAGTCAACATGAGTCGACAG
TTGTCAATGAAGGAGGCAA AAGGCATCATGAGTTGTCAG TTGTCAATGAAGGAGGCAA TCCTTACCATGAGCAGACA TTGTCAATGAAGGAGGCAA
GCCCTCCAGATGACTTCT
TTGTCGATGAAGGAGGCAA AAGCCACCATGTCTGC TTGTCGATGAAGGAGGCAA CTGGAACCATGGCCAGC TTGTCGATGAAGGAGGCAA CAGCCACCATGTCCATC TTGTCGATGAAGGAGGCAA CCTCTAACCATGTCCATC TTGTCTATGAAGGAGGCAA CAACCGGGTCATCCTGG ATGCTCAGCTGGGACTGCA TGCCAATGTCCTTCTGC ATGCTGAGCTGGGACTGCA CTCCCGGGTCATCCTGG ATGCTGAGCTGGGACTGCA AGTTCACCTCCTCCAGCTC TCTTTGTTCAGCTCCTCGGT TGCCAACATCCTGCTAC ATGCTGAGCTGGGACTGCA GCAAGGTCATTGATGACACC CTGTCCAAGGCATCACCAA CTCCAGGATTGTCCTGC ATGCTCAGCTGTGACTGCA AAGCATCTGGGCAACACTG CACTACTTCTTGCACGACTG
herin
TCGTGTCTCAGGCTCCAAG ACACTTGAGGGGCATTGTC ACACTCCTCGCCCTATTGG CTGAAAGCCGATGTGGTCAG CCAACGAAAGCCATGACCA GATGTCCTCGTCTGTAGCAT TGCGGGACTCAACAACTCTG CCATAGGGGTGTGTCATGTC ACGAGGCAAGAGTTTCACCT CCTGGGGTCTGTAATCTGAC CCAAAAAGCCAAACTAC GTGTGCTACACAGCAGC CGGAAGCCTAACTACAG AGAGACTGAAGTAGAGG
1
TACCGCTGCTGTGGCTA TGTTGTACAGGGCGAGC 2 AGGAGCGACGAAGAGTA GTATATGTGGAGGTGCC 3 AAGATGCACTTGCAAAG TGAAGCGGAAAACCTTG
GAGAGATGATGCAGGAC
GACATCTAGGTCTCCGG GCGCCATGGAGGAGGGC GTGGGACGCGGACATGG
tin
CGCCAACTACATCGACA TCAACGGCAAAGTTCTC CTTCGAGAAATCGCCCAAC GACACTCGTGCAGTACGC AATCTGCCTTTGTTTATGCCA CCGCTTTACAGCCTTCCTGC CTCATCAGCAGGGGTAGTC ACTTACACTCCAGCTTCAG CAGTACACATCTCTGGGCTC TCATCTATGGTGGTGCAGTTC TGTCCACGCCATTGCCTCAG ACCAGCATGTCTTCACCTCG AAGGAGAAGTTTGATGGTGCC GAATTTGCAGCTGCAGCGTTC CGCCCAGGTTGTAATTGAAGC CCAAAAACAGAGGTGTTATCC GAGAGTCATGCAGATAGGC CTCGTTGTTTTGCAGGTTC GGTTATGGACCCTACCAGCAT TGCAGCAGCTCGCCCATAGA GCCCGGACTCTCATGAACTG GCCTCGTTGTACTTGTCCTTG GGAGATCAAGAAGAACGCG GTTGTACTTCTCCTTCAGC AAAACTGTGGCTGTGATGGG TTCTGTAGGCACTCACGACC GGCGATTTCCAAGCAGTTTG GTAGAGATGGAGCGAAAGG
453 5′-GCCAGTTCCAGTTCCGCTTTGAG 5′-TCAGATGCTTGCCCACCTCATG239 5′-CAACCTCAAGTACAGCACCAAGT 5′-AGTCATAGCGCAGTTTCAGCAC

Cancer Research

n Association for Cancer


antibocountescopic

StatisDat

the grwas co

Resu

Supprcells bAcc

are 22ribozyof humconserribozythesiza conducedwere dand mmesenvectorby G41examilevel oby WeAMF/transfotheramongover, RAMF/PGI mand AMlar AM

Effectcell bWe

AMF/invasio

inhibiassaycally rand coassayPGI sein vitreduccontroreducemanngies wlayerparened spitrast,transfacquishapeacquirto epiRz celinhibiconflupatter

SilencIt i

TGF-βand tureduccells pwith lThus,and cytion ostrongservednot aby Wesion oK13 toRT-PC

Table PCR p ed in

Molec Size (b

Wnt10 205 5′-CTG 5′-TTCWnt10 386 5′-ACT 5′-AGGWnt11 365 5′-GAC 5′-GGGWntZEBZEB2 (SIP1) 486 5′-AGTCCATGCGAACTGCCATCTGAT 5′-CTGGACCATCTACAGAGGCTTGTA


www.a


dy. The number of lung metastatic nodules wasd microscopically, and the occupancy was also micro-ally calculated by NIH image.

tical analysisa are expressed as mean ± SD. Comparisons betweenoups were determined using unpaired t test. P < 0.05nsidered statistically significant.

lts

ession of AMF/PGI expression in MG-63y RzG390ording to the cDNA sequence of human AMF/PGI, thereGUC triplet sites, which are the target accessible formes to cleave (21–24). As shown in Fig. 1, comparisonan, mouse, and rat cDNA for AMF/PGI indicated a well-ved sequence around the GUC triplet at G390. Here, ame specific against GUC at the position G390 was syn-ed and constructed in pBK-CMV (RzG390). In addition,trol ribozyme with point mutation (mRz) was intro-. Similarly forward and reverse primers of AMF/PGIesigned in the conserved sequence to use for humanouse (Table 1). Human osteosarcoma MG-63 cells withchymal origin were transfected with RzG390, mRZ, oronly (mock). The stable transfectants were established8 selection; finally, six clones of each were obtained. Tone the efficiency for AMF/PGI silencing, we detected thef mRNA by RT-PCR and the level of protein expressionstern blot (Fig. 2A). RT-PCR showed that the level ofPGI mRNA was efficiently decreased in the ribozymeectants (Rz), compared with MG-63 parental cells andcontrols. No significant difference could be observedclones in each parental, mock, or mRz group. More-z cells showed decreased expression of endogenous

PGI at protein level by Western blot analysis. AMF/RNA expression in Rz was remarkably suppressed,F secretion was abrogated; however, half of intracellu-F/PGI was retained at the protein level (Fig. 2A).

of AMF/PGI gene silencing on tumorehaviorsfurther analyzed whether the complete abrogation of
PGI secretion influenced cell growth, motility, andn. As shown in Fig. 2B, cell growth of Rz was slightly
herin,were

acrjournals.org


ted without significance. However, phagokinetic trackrepresenting intrinsic chemokinesis in Rz was drasti-educed to 20% compared with its parental counterpartntrols. Therefore, we also carried out in vitro invasionto depict whether the complete abrogation of AMF/cretion influenced cell invasion. As shown in Fig. 2Cro invasion assay, gene silencing of AMF/PGI alsoed invasiveness to <50% compared with parental andl cells. Thus, the depletion of extracellular AMF/PGId intrinsic cell motility and invasion in an autocrineer. The cells were plated and cultured, and morpholo-ere monitored during progression from sparse mono-(Fig. 2D, top) to confluency (Fig. 2D, bottom). Thetal MG-63 cells maintained their mesenchymal elongat-ndle-shaped fibroblast-like morphology. In sharp con-the Rz cells underwent a significant morphologicormation, whereby, under sparse conditions, the cellsred a round-flattened shape, without an elongated(Fig. 2D, top). On reaching confluence, the Rz cellsed a paving stone-like appearance, which is typicalthelial monolayer (Fig. 2D, bottom). Furthermore, thels seemed to be tightly contacted and to be contact-ted as opposed to the control cells that continued atence to pile up in a typical mesenchymal growthn (data not shown).

ing of AMF/PGI leads MET in osteosarcoma cellss known that growth factors and cytokines such as, fibroblast growth factor, epidermal growth factor,mor necrosis factor-α can regulate EMT (1, 2). Thetion of cell motility and morphologic changes in Rzrompted us to examine whether they are associatedoss of mesenchymal and/or gain of epithelial markers.the expression of the intermediate filaments vimentintokeratin was tested by Western blot analysis. Reduc-f vimentin expression and concomitant broad andsignals of lower molecules of cytokeratins were ob-in Rz cells (data not shown); however, we could

ddress which cytokeratins are expressed in Rz cellsstern blot. Therefore, we further analyzed the expres-f cytokeratins K1 to K8, known as basic (Type II), andK20, known as low molecular acidic (Type I), using

R. As shown in Fig. 3A, mesenchymal markers N-cad-

1. List of
rimers us this study (Cont'd)
vimentin, ILK, andall downregulated.

Canc

0. © 2010 America

ule
p) Forward Reverse
a
CACCGCTTACAACTGGATGC TCGCGTGGATGTCTCTGTGA b GTCCCGAGGCAAGAGTTTC CTCCAGAATTGCGGTTGTG
CTCAAGACCCGATACCTGT
CCTCACTTGCAGACATAGC CTCCTGTGCTGTGAAAACAT ACACTCACACCTCTCCACGT 16 349 5′-CGG 5′-CTT
1 (δEF1) 436 5′-GTGGCCCATTACAGGCAACCAGT 5′-GCTAGGCTGCTCAAGACTGTAGT

α-smooth muscle actin (α-SMA)In contrast with mesenchymal

er Res; 70(22) November 15, 2010 9487

n Association for Cancer


markeSimilacept foing of

SilenctransdWe

relatedare traduringE-cadh

morphβ-cateTGF-βTGF-βates reActivais negformethesedownr

Figureribozym(GAPDHassay. .01, cosparsel

Niinaka et al.

Cance9488


rs, an epithelial marker E-cadherin was upregulated.rly, most cytokeratins were upregulated in Rz cells ex-r K13, K14, and K15. Thus, we concluded that silenc-AMF/PGI leads MET in osteosarcoma MG-63 cells.

ing of AMF/PGI changes signaluction to METproceeded to examine the expression of moleculesto signal transduction. Snail, Slug, Twist1, and Twist2nscription repressors that have a key role in EMT both

C, phagokinetic track assay and in vitro invasion assay. *, P < 0.05; **, P < 0y (top) and densely (bottom). Bar, 20 μm.

development and tumor progression (1, 2, 4). Of note,erin repressor Snail leads to the loss of polarity and

ZEB-1was n

r Res; 70(22) November 15, 2010


ologic change by repressing E-cadherin (7). The Wnt/nin pathway participates in EMT by activating snail (7).is well known to induce EMT, in which cooperation ofand other signaling pathways is required. TGF-β initi-ceptor phosphorylation and activates Snail family (29).ted snail induces downregulation of E-cadherin, whichatively regulated by GSK-3β (7). We, therefore, per-d RT-PCR analysis of EMT-related molecules, includingmolecules. As shown in Fig. 3B, Snail expression wasegulated in Rz cells, whereas the expressions of Slug,

mpared with control cells. D, morphology of MG-63 cells cultured

2. Effect of AMF gene silencing in human osteosarcoma MG-63 cells (Rz) compared with parental, vector only transfected (mock), and mutante transfected cells (mRz). A, expression of AMF is evaluated by RT-PCR, and the relative expression to glyceraldehyde-3-phosphate dehydrogenase) is calculated. Extracellular secretion and intracellular expression of AMF are estimated by Western blot. B, cell growth curve obtained by MTT

/δ EF-1, and ZEB-2/SIP1 were not altered. Twist1ot expressed in those cells, and Twist2 was, rather,

Cancer Research



downrcells, wcells.alteregene s

SilencdifferMG

(29) an

and m(OC; rMG-63shownexpresblast t(Runxlagen,

FigureMET infor mesMesencILK, anand cytas acidosteobWnt geMG-63osteobsuppreWnt16


www.a


egulated in Rz cells. TGF-β1 was not expressed in thosehereas TGF-β2 and TGF-β3 were downregulated in Rz

Interestingly, the expression level of GSK-3β was notd. Thus, results obtained by RT-PCR confirmed thatilencing of AMF/PGI induced MET.

ing of AMF/PGI induces MG-63 cells toentiate into osteoblasts
-63 has been reported to differentiate into osteoblastd to express E-cadherin, which maintained t
is a tr

are enhanced by AMF gene silencing.

acrjournals.org


RNA levels of alkaline phosphatase and osteocalcinef. 30). We therefore, investigated the possibility forcells to differentiate into osteoblasts by RT-PCR. Asin Fig. 3B, silencing of AMF induced MG-63 cells tos OC and osteopontin (OP). To differentiate into osteo-ranscription factor, runt-related transcription factor 22) is essential (30), which induces to produce type I col-OC, OP, and other proteins to form bone tissue. Osterix
anscription factor with zinc-finger inducing to produce
he activity OC inevitable for calcification. OC is a bone-specific protein

3. RT-PCR. Silencing of AMF leadsosteosarcoma MG-63 cells. A, PCRenchymal and epithelial markers.hymal markers: N-cadherin, vimentin,d α-SMA. Epithelial markers: E-cadherinokeratins (K1 to K8 as basic; K13 to K20ic). B, PCR for EMT-related molecules,last differentiation-related genes, andnes. Silencing of AMF induced MET incells and terminal differentiation intolasts. B, Wnt2b, Wnt5a, and Wnt9a aressed, and Wnt3, Wnt10b, Wnt11, and




and isosteobsignalferentcommosteobpresseosteobwas usuppreLack ostrongdiffereshownlatedWnt11

SilencreducThe

METintrodlines,osteos

downthe seregulathoseinhibiin vitrcantlyTheseMG-6HS-OsdiffereAMF/downWnt10Wnt5aConsemightcomaAMFcells.nude mences

Niinaka et al.

Cance9490


produced by mature osteoblast (31). In the process oflast differentiation, Runx2, Osterix, and canonical Wnting molecules inhibit mesenchymal stem cells from dif-iating into chondrocytes and adipocytes (30). After theitment to osteoblast lineage, Runx2 maintains thelasts in an immature stage, and Runx2 must be sup-d for immature osteoblasts to become fully maturelasts (31). As shown in Fig. 3B, the expression of Osterixpregulated in Rz cells, although the Runx2 was slightlyssed in the Rz390G cells compared with other lineage.f Twist gene expression in OC- and OP-expressing cellsly suggested maturation of osteoblasts (31). To date, 19nt Wnt genes are recognized in humans (32, 33). Asin Fig. 3B, Wnt2b, Wnt5a, and Wnt9a were downregu-

in Rz cells; on the other hand, Wnt3, Wnt9b, Wnt10b,, and Wnt16 were upregulated.

ing of AMF/PGI induces osteosarcoma cells toe malignancy through METse data showed that AMF/PGI gene silencing inducedin osteosarcoma MG-63 cells. Therefore, we furtheruced the ribozyme into the other osteosarcoma cell
i.e., murine metastatic osteosarcoma LM8 and humanarcoma HS-Os-1. As shown in Fig. 4A, the ribozyme
murintial to

r Res; 70(22) November 15, 2010


regulated the expression of AMF/PGI and abrogatedcretion of extracellular AMF, concomitant with down-tion of vimentin and upregulation of E-cadherin incells. The growth of both LM8 and HS-Os-1 was slightlyted as shown in Fig. 4B. Random cell motility ando invasion of both LM8 and HS-Os-1 were also signifi-suppressed by silencing of AMF/PGI (Fig. 4C and D).data were very similar to the behaviors observed in3 cells. Therefore, we further performed RT-PCR on-1 cells to characterize MET in relation to osteoblasticntiation (as was observed in MG-63 cells). Silencing ofPGI upregulated E-cadherin and cytokeratins andregulated vimentin, ILK, and N-cadherin. OC, OP,b, and Wnt11 were upregulated, whereas Wnt2b andwere commonly downregulated (data not shown).

quently, we concluded that silencing of AMF/PGIinduce MET and osteoblast differentiation in osteosar-cells. Thus, these data also suggested that silencing ofmight result in loss of malignancy in osteosarcomaTherefore, we further carried out experiments usingice to investigate whether silencing of AMF/PGI influ-

tumor growth and pulmonary metastasis of LM8. The
e osteosarcoma LM8 cells, with high metastatic poten-the lung (26), were inoculated s.c. into the back space
urerineantedpazymT-PWeexadhucess. BMTTk aay.ncin-Os-tility, and in vitro invasion.

FigmuhumtreawithriboA, RandandE-cindcellbytracassSileHSmo

Cancer Research


4. Silencing of AMF inosteosarcoma LM8 andHS-Os-1 cells. RzG390(Rz) cells are comparedrental (P) and mutatede treated (mRz) cells.CR for expression of AMFstern blot of secreted AMFpression of vimentin anderin. Gene silencing of AMFMET in osteosarcoma

, cell growth curve obtainedassay. C, phagokinetic

ssay. D, in vitro invasion*, P < 0.05; **, P < 0.01.g of AMF induces LM8 and1 cells to reduce growth,


of eightumors.c. tumens.LM8Rsized

Discu

Ovegationgrowthcellulafor anmumextracubiquitumorAMFAMF/serinedepentant fenhan(datafactorand 4osteososarcoreduceand 4the knHT108cell grof PGtumorxenogAMF/nary mlatedMETwaivercells pmetasfor gegene ttargetN-c

lated iupreguosarcoactivaknownsignalnositiphospMG-63β3 (F

and Tgulatiosupprregulathe acshortacolleasiRNAvimenlated (induceE-cadhSnail,mulatPGI mthrouTGF-βLos

in the

Figuremetastof the pAMF suoccupaSilencin


www.a


t female BALB/c-nu/nu mice at 6 weeks of age. Thesize was measured every week. Five weeks later, themor and lungs were removed to make frozen speci-In contrast to the LM8parental and LM8mRz cells,z cells neither formed tumor mass s.c. nor metasta-to the lung as shown in Fig. 5A and B, respectively.

ssion

rall gene silencing of AMF/PGI and the following abro-of AMF/PGI secretion resulted in reduction of cell, motility, invasion, and pulmonary metastasis. Intra-r enzymatic activity of intrinsic PGI is more essentialindividual cell to survive, which seems to be a mini-requirement for the cell, than to secret AMF as anellular form of AMF/PGI. PGI is observed in all cellstously, whereas secretion of AMF is observed in onlycells or activated T cells (10). Secretion pathway ofis not classic because PGI lacks signal sequences.PGI is secreted extracellularly by phosphorylation at185 by casein kinase II (34). Additionally, calcium-dent mechanism or calcium ionophores may be impor-or the AMF secretion, because calcium ionophoresced AMF secretion and EDTA-inhibited AMF secretionnot shown). Secreted AMF/PGI functions as a growthas well as a motility factor (35). As shown in Figs. 2BB, knockdown of AMF/PGI affected the growth ofarcoma cells, especially in murine metastatic oste-ma cells LM8 (Fig. 5A). Knockdown of AMF/PGI alsod intrinsic chemokinesis and in vitro invasion (Figs. 2CC and D). Funasaka and colleagues showed thatockdown of AMF/PGI expression in fibrosarcoma0 cells using small interfering RNA (siRNA) reducedowth, motility, and cell invasion. Moreover, knockdownI/AMF inhibited anchorage-independent growth ofcells and completely suppressed growth of tumor

raft in nude mice (18). Furthermore, gene silencing ofPGI completely suppressed tumor growth and pulmo-etastasis in nude mice (Fig. 5A and B). These accumu-data suggested that knockdown of AMF/PGI inducedand that the MET resulted in loss of malignancy orof malignancy, although it was suggested that cancerrobably use this MET process during the later stages oftasis (36, 37). Ribozyme provided a very valuable toolne targeting for the induction of MET, suggesting thatherapy by manipulation of EMT/MET using rybozymeing AMF/PGI might be efficient, at least in this case.adherin, vimentin, ILK, and α-SMA were all downregu-n MG-63Rz cells, and E-cadherin and cytokeratins werelated (in Fig. 3A). Thus, silencing of AMF/PGI in oste-ma MG-63 cells resulted in MET. TGF-β is known tote Snail through phosphorylation of Smads, and Snail isto suppress E-cadherin expression (36). TGF-βs alsoILK, mitogen-activated protein kinase, and phosphoi-de 3-kinase pathway, and activated ILK can directlyhorylate downstream target GSK-3β to inactivate (7).
cells do not express TGF-β1, but TGF-β2 and TGF-
ig. 3B). Silencing of AMF/PGI reduced the TGF-β2well keral (3

acrjournals.org


GF-β3 production and secretion, resulting in downre-n of Snail, which was released from the basal stage ofession of E-cadherin. In addition, GSK-3β, a negativetor of Snail, was stably expressed in MG-63 cells, andtivity of GSK-3β was also free of inhibition, because ofge of ILK and snail as shown in Fig. 3. Funasaka andgues showed that the knockdown of AMF/PGI usinginduced MET in fibrosarcoma HT1080 cells, in whichtin was downregulated and cytokeratins were upregu-18–20). Similarly, knockdown of AMF/PGI using siRNAd MET in breast cancer MDA-MB-231 cells, in whicherin and GSK-3β were upregulated, while fibronectin,and β-catenin were downregulated (20). These accu-ed data strongly suggested that knockdown of AMF/ight release the course of E-cadherin suppressiongh upregulation of GSK-3β and downregulation of, Snail, and ILK.s of malignancy in osteosarcoma cells may be involvedprocess of differentiation as well as MET, because it is

ncy rate by tumor in the lung measured 5 wk after inoculation.g of AMF suppresses pulmonary metastasis in nude mice.

5. Silencing of AMF/PGI suppresses tumor growth and pulmonaryasis in nude mice. **, P < 0.01. A, dots represent tumor volumerimary site measured and calculated every week. Silencing ofppresses tumor growth in nude mice. B, columns represent the

nown that differentiated cells are less malignant in gen-7). Wnt signals are also known to induce EMT, which




is alsoAMF/commthem,retinatric caduringprogreWnt5Wnt4over, Eupreguof WnAMF(Fig. 3cells tomightWnt10teoblanonicupreguing (40PGI wdevelohad fu

expreslencindiffere

Discl

No p

Ackn

WeUniversMasatoYoshidaMaxillo(Animasupport

Grant

Japa2179198The Teand NIH

Theof pageaccorda

Refe1. Th

me2. Ha

An3. Gre

poJ C

4. Haab

5. Ba(EM36

6. GuJ B

7. BaGlyscrBio

8. FaphNa

9. Waautase

10. Niicreas266

11. Liofac

12. Gupro

13. Xuandho199

Niinaka et al.

Cance9492


negatively regulated by GSK-3β (7). Knockdown ofPGI in osteosarcoma cells MG-63 and HS-Os-1 cellsonly reduced expression of Wnt2b and Wnt5a. AmongWnt2b functions as the stem cell factor for neural orl progenitor cells during embryogenesis and also for gas-ncer, esophageal cancer, and skin basal cell carcinomacarcinogenesis (38). Thus, Wnt2b might be involved inssion of cancer via EMT. Similarly, upregulation ofa expression concomitant with downregulation ofwas observed in mesenchymal phenotype of SCC. More-MT through overexpression of Snail in SCC resulted inlation of Wnt5a and ZEB-1 (δEF1) and downregulationt4 (39). However, MET through the knockdown of PGI/failed to downregulate ZEB-1 and upregulate Wnt4B). Silencing of AMF/PGI induced osteosarcoma MG-63upregulate Wnt10b and Wnt11 gene expression, whichbe important in differentiation because upregulation ofb was reported to increase bone mass via enhancing os-st differentiation (32) andWnt11 signals through both ca-al (β-catenin) and noncanonical pathways and waslated during osteoblast differentiation and fracture heal-). Moreover, temporal and spatial expression of AMF/as observed in bone and cartilage cells during postnatal
pment and fracture repair, inwhich immature osteocytes Rece
maturation mediator for human myeloid leukemia cells sharesmology with neuroleukin or phosphoglucose isomerase. Blood6;87:4502–6.

14. Goval79

15. Badiaisoca

16. Fileiso19

17. Tscrima24

18. Fucomasen

19. Fuphmece

20. Fumoco

21. Ce59

22. Hasp

23. KataradNu

24. Mian28

r Res; 70(22) November 15, 2010


sion of AMF/PGI was decreased markedly (41). Thus, si-g of AMFmight be involved in loss ofmalignancy throughntiation via MET.

osure of Potential Conflicts of Interest

otential conflicts of interest were disclosed.

owledgments

thank Dr. Kaoru Aida (The Third Department of Internal Medicine,ity of Yamanashi) for his technical support; Dr. Yoshio Nakano, Dr.shi Higuchi, Tomoyasu Kawasaki, Dr. Ryu-ichi Nakazawa, Dr. Chieko, Dr. Akihiro Dohi, and Dr. Ayako Miura (Department of Oral andfacial Surgery) for their clinical support; Dr. Katsushi Mukawal Research Institute, University of Yamanashi) for his technical; and V. Powell for her editing of the manuscript.

Support

n grants-in-aid 18592167 (Y. Niinaka), 20659312 (K. Harada), and3 (M. Oda); University of Yamanashi grant-in-aid project (Y. Niinaka);levision Yamanashi Science Development Fund of UTY (Y. Niinaka);grant CA-51714 (A. Raz).

costs of publication of this article were defrayed in part by the paymentcharges. This article must therefore be hereby marked advertisement innce with 18 U.S.C. Section 1734 solely to indicate this fact.

ived 10/27/2009; revised 06/22/2010; accepted 07/18/2010; published
rther differentiated toward m ature osteoblasts, and the OnlineFirst 10/26/2010.
rencesiery JP, Sleeman JP. Complex networks orchestrate epithelial-senchymal transition. Nat Rev Mol Cell Biol 2006;7:131–42.y ED. An overview of epithelio-mesenchymal transformation. Actaat 1995;154:8–20.enburg G, Hay ED. Epithelia suspended in collagen gels can loselarity and express characteristics of migrating mesenchymal cells.ell Biol 1982;95:333–9.y ED. The mesenchymal cell, its role in the embryo, and the remark-le signaling mechanisms that create it. Dev Dyn 2005;233:706–20.tes RC, Mercurio AM. The epithelial-mesenchymal transitionT) and colorectal cancer progression. Cancer Biol Ther 2005;4:

5–70.arino M. Epithelial-mesenchymal transition and tumor invasio. Intiochem Cell Biol 2007;39:2153–60.chelder RE, Yoon SO, Franci C, de Herreros AG, Mercurio AM.cogen synthase kinase-3 is an endogenous inhibitor of Snail tran-iption: implication for the epithelial-mesenchymal transition. J Celll 2005;168:29–33.ik P, Walker JI, Redmill AA, Morgan MJ. Mouse glucose-6-osphate isomerase and neuroleukin have identical 3′ sequences.ture 1988;332:455–7.tanabe H, Takehana K, Date M, Shinozaki T, Raz A. Tumor cellocrine motility factor is the neuroleukin/phosphohexose isomer-polypeptide. Cancer Res 1996;56:2960–3.

naka Y, Paku S, Haga A, Watanabe H, Raz A. Expression and se-tion of neuroleukin/phosphohexose isomerase/maturation factorautocrine motility factor by tumor cells. Cancer Res 1998;58:7–74.tta LA, Mandler R, Murano G, et al. Tumor cell autocrine motilitytor. Proc Natl Acad Sci U S A 1986;83:3302–6.rney ME, Apatoff BR, Spear GT, et al. Neuroleukin: a lymphokineduct of lectin-stimulated T cells. Science 1986;234:574–81.W, Seiter K, Feldman E, Ahmed T, Chiao JW. The differentiation

mm SA, Keevil BG, Thatcher N, Hasleton PS, Swindell RS. Theue of tumour markers in lung cancer. Br J Cancer 1988;58:7–804.umann M, Kappl A, Lang T, Brand K, Siegfried W, Paterok E. Thegnostic validity of the serum tumor marker phosphohexosemerase (PHI) in patients with gastrointestinal, kidney, and breastncer. Cancer Invest 1990;8:351–6.lla X, Molina R, Jo J, Mas E, Ballesta AM. Serum phosphohexosemerase activities in patients with colorectal cancer. Tumour Biol91;12:360–7.utsumi S, Hogan V, Nabi IR, Raz A. Overexpression of the auto-ne motility factor/phosphoglucose isomerase induces transfor-tion and survival of NIH-3T3 fibroblasts. Cancer Res 2003;63:2–9.nasaka T, Hu H, Hogan V, Raz A. Down-regultion of phosphoglu-se isomerase/autocrine motility factor expression sensitizes hu-n fibrosarcoma cells to oxidative stress leading to cellularescence. J Biol Chem 2007;282:36362–9.nasaka T, Hu H, Yanagawa T, Hogan V, Raz A. Down-regulation ofosphoglucose isomerase/autocrine motility factor results insenchymal-to-epithelial transition of human lung fibrosarcomalls. Cancer Res 2009;67:4236–43.nasaka T, Hogan V, Raz A. Phosphoglucose isomerase/autocrinetility factor mediates epithelial and mesenchymal phenotypenversions in breast cancer. Cancer Res 2009;69:5349–56.ch TR. Self-splicing of group I introns. Annu Rev Biochem 1990;:543–68.seloff J, Gerlach WL. Simple RNA enzymes with new and highlyecific endoribonuclease activities. Nature 1988;334:585–91.wasaki H, Ohkawa J, Tanishige N, et al. Selection of the bestget site for ribozyme-mediated cleavage within a fusion gene forenovirus E1A-associated 300 kDa protein (p300) and luciferase.cleic Acids Res 1996;24:3010–6.
tsuyasu RT, Merigan TC, Carr A, et al. Phase 2 gene therapy trial ofanti-HIV rebozyme in autologous CD34+ cells. Nat Med 2009;15:5–9.
Cancer Research



25. Cacel

26. Asmuthe

27. Mosubfro198

28. Niiula(AM200

29. Padiff3D

30. HaN-tiat200

31. KoRu

32. BeboMin

33. Ka(Re

34. Hamoph

35. Tserana

36. BarepNa

37. NiirecInt

38. PigE-no17

39. TaM.siono

40. FriosCh

41. Zh


www.a


brera CM, Cobo F, Nierto A, et al. Identity test: detarmination ofl line cross-contamination. Cytotechnology 2006;51:45–50.ai T, Ueda T, Itoh K, et al. Establishment and characterization of arine osteosarcoma cell line (LM8) with high metastatic potential tolung. Int J Cancer 1998;76:418–22.mose F, Araida T, Negishi A, Ichijo H, Shioda S, Sasaki S. Variantlines with different metastatic potentials selected in nude micem human oral squamous cell carcinoma. J Oral Pathol Med9;18:391–5.

naka Y, Haga A, Negishi A, Yoshimasu H, Raz A, Amagasa T. Reg-tion of cell motility via high and low affinity autocrine motility factorF) receptor in human oral squamous carcinoma cells. Oral Oncol2;38:49–55.rreno J, Buckley-Herd G, de-Hemptinne I, Hart DA. Osteoblasticerentiation, contraction, and mRNA expression in stress-relaxedcollagen I gels. Mol Cell Biochem 2008;317:21–32.ÿ E, Lemonnier J, Modrowski D, Lomri A, Lasmoles F, Marie PJ.and E-cadherin mediate early human calvaria osteoblast differen-ion promoted by bone morphogenetic protein-2. J Cell Physiol0;183:117–28.mori T. Regulation of bone development and maintenance bynx2. Front Biosci 2008;13:898–903.nnett CN, Ouyang H, Ma YL, et al. Wnt10b increases postnatalne formation by enhancing osteoblast diffenentiation. J Bone
er Res 2007;22:1924–32.toh M. WNT2B: comparative integromics and clinical applicationsview). Int J Mol Med 2005;16:1103–8.
preera16

acrjournals.org


ga A, Niinaka Y, Raz A. Phosphohexose isomerase/autocrinetility factor/neurokeukin/maturation factor is a multifunctionalosphoprotein. Biochim Biophys Acta 2000;1489:235–44.utsumi S, Yanagawa T, Shimura T, et al. Regulation of cell prolif-tion by autocrine motility factor/phosphoglucose isomerase sig-ling. J Cell Biol 2003;278:32165–72.tlle E, Sancho E, Franci C, et al. The transcription factor snail is aressor of E-cadherin gene expression in epithelial tumour cells.t Cell Biol 2000;2:84–9.naka Y, Oida S, Ishisaki A, et al. Autocrine motility factor and itseptor expressions in oral squamous cell carcinoma (SCC) cells.J Oncol 1996;9:433–8.natelli M, Ansari TW, Gunter P, et al. Loss of membranous

cadherin expression in pancreatic cancer: correlation with lymphde metastasis, high grade, and advanced stage. J Pathol 1994;4:243–8.ki M, Kamata N, Yokoyama K, Fujimoto R, Tsutsumi S, NagayamaDown-regulation of Wnt-4 and up-regulation of Wnt-5a expres-n by epithelial-mesenchymal transition in human squamous carci-ma cells. Cancer Sci 2003;94:593–7.edman MS, Oyserman SM, Hankenson KD. Wnt11 promotesteoblast maturation and mineralization through R-spondin 2. J Biolem 2009;284:14117–25.i J, Sommerfeldt DW, Rubin CT, Hadjiargyrou M. Differential ex-ssion of neuroleukin in osseous tissue and its involvement in min-
lization during osteoblast differentiation. J Bone Miner Res 2001;:1994–2004.



2010;70:9483-9493. Published OnlineFirst October 26, 2010.Cancer Res Yasufumi Niinaka, Kiyoshi Harada, Masahiro Fujimuro, et al. Osteosarcoma Pulmonary MetastasisMesenchymal-to-Epithelial Transition and Suppression of Silencing of Autocrine Motility Factor Induces

Updated version

10.1158/0008-5472.CAN-09-3880doi:

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/70/22/9483.full#ref-list-1

This article cites 41 articles, 11 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/70/22/9483.full#related-urls

This article has been cited by 2 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/70/22/9483To request permission to re-use all or part of this article, use this link

Research. on October 1, 2020. © 2010 American Association for Cancercancerres.aacrjournals.org Downloaded from


http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-09-3880

http://cancerres.aacrjournals.org/content/70/22/9483.full#ref-list-1

http://cancerres.aacrjournals.org/content/70/22/9483.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/70/22/9483


tumor and stem cell biology cancer research silencing of ... · biology, university of yamanashi,...

Documents