twe journal of 269. no. 2, january 14, 1402-1409, 1994 8 ... · nac-sernac) was synthesized...

8 1994 by The American Society for Biochemistry and Molecular Biology, Inc. TWE JOURNAL OF B I O ~ I C A L CHEMISTRY Vol. 269. No. 2, Issue of January 14, pp. 1402-1409, 1994

Printed in U.S.A.

Molecular Cloning and Expression of GalNAc ff2,6=Sialyltransferase*

(Received for publication, July 21, 1993, and in revised form, September 20, 1993)

Nobuyuki Kurosawa, Tbshiro Hamamoto, Young-Choon Lee, Takashi Nakaoka, Naoya Kojima, and Shuichi Tsuji$ From Glyco ~ o ~ e c u ~ a r ~ i o l o g ~ Frontier Research Program, The ~ n s t i ~ u ~ of Physical and e ~ ~ ~ c a l Research ~ R ~ ~ N ~ , Wako, Saitama 351-02, Japan

cDNA clones encoding GalNAc &,&sialyltransferase (EC 2.4.99.3) have been isolated from chick embryo cDNA libraries using sequence information obtained from the conserved amino acid sequence of the previously cloned enzymes. The cDNA sequence included an open reading frame coding for 866 amino acids, and the deduced amino acid sequence showed 12% identity with that of Galfll,4GlcNAc cu2,6-sialyltransferase from chick embryo. The primary structure of this enzyme suggested a putative domain structure, like that in other glycosyltransferases, consisting of a short NH,-terminal cytoplasmic domain, a signal-membrane anchor domain, a proteoiytically sensitive stem region, and a large COOH- terminal active domain. The identity of this enzyme was confirmed by the construction of a recombinant sialyltransferase in which the NHz-terminal part (232 amino acid residues) was replaced with the immunoglobulin signal sequence. The expression of this recombinant in COS-7 cells resulted in secretion of a catalytically active and soluble form of the enzyme into the medium. The expressed enzyme exhibited activity toward only asialomucin and (asialolfetuin, no significant activity being detected toward the other glycoprotein and glycolipid substrates tested. 14C-Sialylated glycols obtained from asialomucin re-sialylated with this enzyme were identical to NeuAccuZ,6-GalNAcc-o1 and GicNAcfll,3(NeuAca2,6) GalNAc-01. Synthetic GalNAc-SerNAc also served as an acceptor for cu2,6-sialylation. These results clearly showed that the expressed enzyme is GalNAc a2,g-sialyltransferase.

Sialic acids play an important role in a variety of biological processes, like cell-cell communication, cell-substrate interac- tion, adhesion, maintenance of serum glycoproteins in the cir- culation, and protein targeting (1-7). Cell surface sialic acid occurs in a variety of structures, which change in a regulated manner during development, di~erentiation, and oncogenic transformation (8,9). Very little is known about the regulation of cell surface sialyl oligosaccharides, which are involved in

Priority Areas 05261215, 04268216, and 05274106; Grant-in-aid for * This work was supported by Grants-in-aid for Scientific Research on

Scientific Research 03680139; Grant-in-aid for Encou~gement of Young Scientists 04772002; Research Grant 3A-2 for Nervous and Men- tal Disorders from the Ministry of Health and Welfare, Japan; and grants from the Naito Foundation and the Fujisawa Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduer- tisemenf” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the ~~a~~ J ~ ~ E L Data Bank with accession n u ~ ~ ~ s j X?4946. The nucleotide sequencdsl reported in this paper has been s ~ b ~ ~ f ~ e d

i TC whom correspondence should be addressed Glyco Molecular Bi- ology, Frontier Research Program, Institute of Physical and Chemical Research (RIIUZN), Wako, Saitama 351-01, Japan. Tel.: 81-48-462-1111 (ext. 6521); Fax: 81-48-462-4692.

cellular processes. Sialic acids occur at the terminal positions of the carbohydrate groups of glycoproteins and glycolipids. The transfer of sialic acid from CMP-Sia to these positions is cata- lyzed post-translationally by a family of glycosyltransferases called sialyltransferases (10, 11). More than 12 different sialyltransferases are required to synthesize all known sialyl oli- gosaccharide structures (12, 13). Three linkage patterns, Siaa2,6Gal, Siaa2,3Gal, and Siaa2,6GalNAc, are commonly found in glycoproteins 1141, and two, Siau2,3Gat and Siaa2,8Sia, occur frequently in gangliosides (15). Each of these linkages has been described in both gangliosides and glycoproteins (15-171. If a sialyltransferase needs to detect the aglycon structure beyond the carbohydrate structure for acceptor rec- ognition, there may be as much as 50 species of the enzyme. It is not clear whether the sialyltransferases for glycoproteins are different species from those for glycolipids.

Although a role of sialic acids has been proposed in the regulation of many biological phenomena, the purpose of this struc- tural diversity remains largely obscure. For understanding the meaning of the diversity and the regulatory mechanism for sialylation of glycoconjugates, it is necessary to obtain knowl- edge on the enzymes themselves and the gene structure of sia~yltransferases. So far, five s~alyltransferases have been purified, and they exhibit strict specificity for acceptor substrates (18-21). cDNAs encoding Galpl,4GlcNAc a2,6-sialyltransferase (Galp4GlcNA~-a6ST)’~~ have been cloned fmm rat liver (13), &man placenta (22), human B cell line (231, and mouse liver (24); cDNAs encoding the Galpl,3GalNAc a2,3-sialyltransferase ( ~ p 3 G a ~ A c - a 3 S T ) have been cloned from porcine submaxillary gland (25) and mouse brain (26); a Galf?l,3f4)GlcNAc a2,3-sialyltransferase (Galf?B(Q)GlcNAc- a3ST) has been cloned from rat liver (27). No identical sequences are seen among these three kinds of enzyme except for a stretch of 46 amino acids located in their active domains (28) and a few small stretches (291, tentatively named the ”sialylmotif“ by Livingstone and Paulson (30). Protein motifs are often used to identify other members of the same gene family

The abbreviations used are: Gal&4GlcNAc-a6ST, Galfil,4GlcNAc a2,6-sialyltransferase (EC 2.4.99.1); GalNAc-a6ST, GalNAc a2,6-sialyltransferase (EC 2.4.99.3); Galp3GaNAc-c-a3ST, Galp1,BGaNAc a2,3- si~yltransferase (EC 2.4.99.4); Gal f i3(4~l~Ac-a~ST, Galpl,3(4)- GlcNAc a2,3-~iaIyltransferase(EC 2.4.99.6); GalNAc-01, 2-acetamido-2- deoxygalactitol; benzyl-GalNAc, a-o-GalNAc-1-OCHZPh; SerNAc, N-acetylserine; NeuAc, N-acetylneuraminic acid; NeuGc, N-glycolyl- neuraminic acid (all sugars are of the D-configuration); CMP-NeuAc, cytidine 5’-monophospho-N-acetylneuraminic acid; Sia, NeuAc andor NeuGc; PAGE, polyacrylamide gel electrophoresis; BSM, bovine submaxillary mucin; PCR, polymerase chain reaction; bp, base paids); kb, kilobaseb).

hydrate moiety. Two ad~tional letters in the case of the si~yltransfer- Underlined part of the enzyme name indicates the acceptor carbo-

ases specify the enzyme source; for example, G ~ ~ ~ ~ G I c N A c - ~ ~ S T R ~ denotes the Galfil,4GlcNAc a2,6-sialyltransferase h m rat liver (RL, rat liver; ML, mouse liver; MB, mouse brain, HP, human placenta; PS, porcine submaxillary gland).

1402

GalNAc a2,6-Sialyltransferase 1403

(31-34). The use of oligonucleotides corresponding to a consen- sus sequence encoding the DNA-binding domain of the steroid and thyroid hormone receptor superfamily as probes has led to the isolation of cDNAs of this superfamily (31-33). Similarly, homeobox-containing genes have been isolated using degenerate oligonucleotides corresponding to the most conserved amino acid sequence from the homeodomain (34). Thus, it is reason- able to design a strategy for the cloning of cDNAs encoding new sialyltransferases by using the sequence information on the high similarity region. The related report of Kitagawa and Paulson (66) also supports this strategy.

Sialyltransferases have previously been studied in embryonic tissues of several animal species (35-41). Large amounts and many species of sialyltransferase have been found in chick embryo (3538). This suggests that many species of sialyltransferases are expressed in the chick embryonal stages, and it is expected to be possible to clone new species of sialyltransferases.

In order to study the mechanism for the production of sialyl glycoconjugates and to elucidate their biological functions, therefore, we attempted to isolate the cDNA of GalNAc a2,6- sialyltransferase (EC 2.4.99.3; GalNAc-a6ST) by using sequence information obtained for enzymes previously cloned. In this paper, we describe (i) the cloning of cDNA encoding a sialyltransferase from chick embryo using the sialyl motif and (ii) the expression and identification of the enzyme activity as that of GalNAc a2,6-~ialyltransferase.

EXPERIMENTAL PROCEDURES Materials-Fetuin, asialofetuin, bovine submaxillary mucin, al-acid

glycoprotein, galactose pl,4-N-acetylgalactosamine, CMP-NeuAc, lacto- N-tetraose, benzyl-GalNAc, N-acetyllactosamine, and Triton CF-54 were from Sigma. CMP-[14C]NeuAc (11 GBq/mmol) was from Amer- sham. N-Acetylgalactosamine pl,l-galactose was a g& from Dr. Kaji- mob (RIKEN). 2-Acetamide-2-deoxy galactosyl-a-N-acetylserine (Gal- NAc-SerNAc) was synthesized according to Grundler and Schmidt (42). NeuAca2,6-GalNAcc-SerNAc was prepared from NeuAca2,BGalNAc-Ser (MECT, Tokyo, Japan) by acetylation with anhydroacetate in pyridine- water. NeuAca2,6GalNAc-ol and GlcNAcp1,3(NeuAca2,6)GalNAc-ol were prepared from bovine submaxillary mucin according to Tsuji and Osawa (43) and identified by 270 MHz 'H and 13C NMR (44, 45). Synthetic primers were synthesized with an Applied Biosystems model 394 DNA synthesizer. Restriction endonucleases SmaI, EcoRI, BamHI, HindIII, SacI, XhoI, BglII, and PstI were from Takara (Kyoto, Japan).

Polymerase Chain Reaction (PCRtPCR was performed using degenerate primers (5' primer ST107, TGGGCCTTGGII(A/C)AGG- TGTGCTGITG; 3' primer ST205, AGGCGAATGGTAGTITITGW TIGCCCACATC) deduced from conserved regions in Sp4GlcNAc- a6STRL (13), Galp4GlcNAc-a6STHP (22), and G&p3GalNAcc-a3STPS (25). To obtaincDNA, poly(A)-rich RNA (2 pg) from 3-day-old chick embryos was incubated with an oligo(dT) primer (Pharmacia LKB Bio- technology Inc.), 1 m~ each of dATP, dCTP, dGTP, and dTTP, and 2 unitdpl RNase inhibitor (Promega) in 10 m~ Tris-HC1 (pH 8.3), 50 m~ KCl, 1.5 m~ MgCl,, and 0.001% gelatin in 50 pl for 10 min at 0 "C, and then for another 60 min at 42 "C following the addition of 100 mi- crounits of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). After heating at 94 "C for 3 min, cDNA prepared from 0.2 pg of poly(A)-rich RNA was used for the PCR experiment in a mixture comprising 10 m~ Tris-HC1 (pH 8.3), 50 m~ KCl, 1.25 m~ MgCl,, 0.001% gelatin, 200 p of each dATP, dCTP, dGTP, and dTTP, 2 units of Taq DNA polymerase (Promega), and 40 pmol of each PCR primer in 50 111. PCR amplification (35 cycles) was carried out; each cycle consisted of denaturation at 96 "C for 45 s, annealing at 50 "C for 60 8, and extension at 72 "C for 60 s. The PCR products were developed on a 3% agarose gel. The DNA fragment corresponding to 150 bp was eluted from the gel (Qiaex kit; Qiagen), blunt-ended, kinated, subcloned into the SmaI site of pUC119, and finally sequenced.

Construction of a cDNA Library-Total RNA was prepared from 6-day-old chick embryos by the guanidinium thiocyanate method, followed by centrifugation in a 5.7 M CsCl solution (46). Poly(A)-rich RNA was purified with Oligotex-dT30 (Takara), and then employed for the construction of a cDNA library using A W I I (Stratagene) and cDNA

B RV

hCEB-2020 I I

WEB-201 - FIG. 1. Restriction map for cDNA clones encoding GalNAc d , 6 -

sialyltransferase. The coding region for GalNAc a2,6-sialyltransferase is depicted as a shaded box and the noncoding region as a solid line. Schematic representations of the cDNA clones and restriction map are shown. E, EcoRI; RV, EcoRV; E', PstI; B, BglII.

synthesis (Pharmacia) kits with an oligo(dT) primer and random primers.

Screening of the cDNA Library-The amplified cDNAlibrary (1 X lo6 plaques) was screened with the chick embryo PCR fragment. The plaque-transferred filters were hybridized with 32P-radiolabeled DNA probes for 12 h at 65 "C in 5 x SSC, 0.2% SDS, 5 x Denhardt's solution, and 10 pg/ml denatured salmon sperm DNA. They were then washed twice at 65 "C for 20 min in 2 x SSC, 0.1% SDS. To obtain plasmids from the isolated phage clones, phagemid rescue was performed according to the instructions of the manufacturer of the AZAPII cloning kit (Strata- gene). cDNA inserts were excised directly as Bluescript plasmids (Stratagene).

DNA Sequence Analysis-The DNA sequences of the inserts were determined by the dideoxy chain termination method (47) using single- strand DNA as a template for T7-DNA polymerase. The sequencing reaction and electrophoresis were carried out using an AutoRead DNA sequencing kit and a DNA sequencer (Pharmacia). Single strand DNA was prepared from Escherichia coli XL-Blue (Stratagene) after super- infection with helper phage R408 (Stratagene). The sequence data were analyzed with a computer using PC/Gene (Teijin System Technology).

Northern and Southern Blot Analyses-For Northern blots, 5 pg of denatured poly(A)-rich RNks from chick embryo was size-fractionated on formaldehyde-agarose gels and then blotted onto Hybond N+ nylon membranes (Amersham Corp.). For Southern blots, 7.5 pg of genomic DNA prepared from chick embryos was digested with restriction enzymes EcoRI, BamHI, HindIII, and SacI, then size-fractionated on 0.6% agarose gels. After electrophoresis, the gels were denatured (30 min) in 0.5 N NaOH and 1.5 M NaCl, neutralized (30 min) in 0.5 M Tris-HC1 (pH 7.5) and 1.5 M NaCl, and then the DNAwas transferred onto Hybond N+ nylon membranes. Both Northern and Southern filters were prehybrid- ized in 50% formamide, 5 x SSC, 5 x Denhardt's, 0.5% SDS, and 10 pg/ml denatured salmon sperm DNA at 37 "C for 1 h, and then hybridized with a 32P-labeled DNA probe for 12 h under the same conditions as for prehybridization. The probe applied was a 0.6-kb EcoRI cDNA insert of ACEB201, which was labeled with a Multiprime labeling system (Amersham Corp.). The filters were washed twice for 10 min at 65 "C in 2 x SSC and 0.1% SDS, washed twice with 0.2 x SSC and 0.1% SDS at 65 "C for 30 min, and then exposed to Kodak XAR film for about 1 day at -70 "C.

Plasmid Construction-Standard molecular cloning techniques, as described by Maniatis et al. (46), were used.

PUGS-To express the soluble form of P-B1, a vector plasmid, PUGS, was constructed. PUGS was constructed by replacing the PstI-XhoI fragment of the Bluescript SK(+) plasmid with a 117 bp of a synthetic DNA fragment. This fragment contains 43 bp of the 5'-untranslated leader sequence of alfalfa mosaic virus (48) with a synthetic PstI site at the 5' end, followed by the mouse immunoglobulin M heavy chain signal peptide sequence (57 bp) (49), with 17 bp of a synthetic EcoRI, BglII, and XhoI cloning site a t the 3' end. The nucleotide sequence of this fragment is 5'-CTGCAGGGTITITATITITAATl"lTC"AATAC- TTCCACCATGAAATTCAGCTGGGTCATGTTCTTCCTGATGGCAGT- GG'MACAGGGGTCAATTCAGAATTCCAGATCTCGAG-3'.

pCEB-1800"cDNA insert of ACEB-3043 was partially digested with EcoRV, and a 1.8-kb fragment was subcloned into EcoRV site of pBlue- script SK(+) to generate pCEB-1800. This clone lacks 0.8 kb of 3'- untranslated region of ACEB-3043.

pcDSB-69&In order to produce a soluble form of the sialyltransferase for enzyme characterization, a fusion protein containing the putative active domain of the enzyme and the immunoglobulin signal peptide sequence was constructed in mammalian expression vector pcDSRa (50). Specifically, a putative active domain of the enzyme was generated by PCR using the 5' primer, 5'-AGGGCTGCTGAATI'CACT-

1404 GalNAc 012,6-Sialyltransferase

A (-311 CCGAGCTTCCATCTCTCCCGGGCCTCTCACT

ATGGGGTTTTTAATULGGCTTCCTAAI\WLTTCCAGAATATTCCGTTGGCTCCTTATT MetGlyPheLeuIleArqArqLeuProLy~A~pSerA~gllePh~rqTrpLeuLe~lle

T T A A C A G T C T T T T C C T T C A T C A T T A C T A G T T T T A G C G C C G C LeuThrValPheSerPheIleIleThrSerPheSerAlaLeuPheGlyHetGluLysSer

ATTTTCAGGCAGCTCAAGATTTACCAMGCATTGCACATATGCTACAAGTGGACACCCAA IlePheArgGlnLeuLysIleTyrGlnSerlleAlaHisMetLe~Gl~ValAspTh~Gl~

GATCAGCAAGGTTC~CTATTCTGCTAATGGGAGAATTTCAMGGTTGGTTTGGAGAGA AspGlnGlnGlySerAsnTyrSerAl~s~GlyA~qlleSerLysValGlyLeuG1uArg

G A C A T T G C A T G G C T C G A A C T G A A T A C T G C T G T A C A C AspIleAlaTrpLeuGluLe~A~~ThrRlaValSerThrProSerGlyGl~GlyLy~Gl~

GAGCAGAAGAAAACAGTGAAACCAGTTGCCAAGGTGGAAGAAGCCAAGGAGAMGTGACT GluGlnLysLysThrValLysProValAlaLysValAlaLy~ValGl~Gl~AlaLy~GluLysValTh~

GTGAARCCATTCCCTGAGGTGATGGGGATCAC~TACAACAGCATCAACAGCCTCTGTG ValLysProPheProGluValMetGlylleTh~AsnThrThrAl~S~~Th~AlaSe~Val

GTGGAGAGAAC~GGAGRCAACAGCGAGACCAGTTCCAGGGGTGGGGGRI\GCTGAT ValGluArgThrLysGluLysThrThrRlaArgProValP~oGlyV~lGlyGl~AlaAsp

GGWULGAGAACAACGATAGCACTTCCCAGCATWULG~GACAMGAGAAGGCGACTGTG GlyLysArgThrThrIleAlaLeuProSerMetLysGluA~pLy~Gl~Ly~AlaTh~v~l

AAI\CCATCCTTTGGGATGRGGTAGCTCATGCAMCAGCACATCCAAR~TAAACCAMG LysProSerPheGlyMecLysValAlaHisAlaAsnSerThrSerLysAspLysProLys

GCAGAAGAGCCTCCTGCATCAGTGAAAGCCATAAGACCATRAGACCTGTGACTCAGGCTGCCACAGTG AlaGluGluProProAlaSerValLysAlaIleArgProValThr~lnAlaAlaThrVal

ACAGAGAAGAAGAMCTGAGGGCTGCTGACTTCAAGACTGAGCCACAGTGGGATTTTGAT ThrGluLysLysLysLeuArqAlaAlaAspPheLysThrGluProGlnTrpAspPheAsp

A A A

GATGAGTACATACTGGATAGCTCATCTCCAGTATCGACCTGCTCTGAATCAGTGAGAGCC AspGluTyrIleLeuAspS_eKSerSerP~o~a~S~r~h_rC_ySSerGluSerValArqAla

AAGGCTGCCAAGTCTGACTGGCTGCGAGATCTTTTCCTGCCGAACATCACACTCTTCATA LysAlaAlaLysserAspTrpLeuArgAspLeuPheLeuProAsnIleThrLeuPheIle

GACAAGAGTTACTTCAATGTCAGT~GTGG~CCGCCTGGAGCATTTTGCACCTCCCTAT AspLysSerTyrPheASnValSerGluTrpAspArgLeuGluHisPheAlaProProTyr

GGCTTCATGGAGCTGRATTACTCACTGGTAGARGAAGTCATGTCACGGCTGCCTCC~T GlyPheMetGluLeuAsnTyrSerLe~ValGluGl~ValMetS~~A~qLe~P~oP~oA~~

-1

2 0 60

1 2 0 4 0

1 8 0 60

2 4 0 8 0

3 0 0 100

360 1 2 0

4 2 0 1 4 0

4 80 160

5 4 0 1 8 0

2 0 0 600

660 2 2 0

2 4 0 1 2 0

2 6 0 7 8 0

2 8 0 84 0

3 0 0 900

3 2 0 960

AlaValValGlyASnGlyGlyIleLeuAsnAsnSerGlyMetGlyGlnGluIleAspSer

CATGACTATGT-GCGGGGCTG- HisAspTyrValPheArgVa1SerGlyAlaValIleLysGlyTyrGl~Ly~A~pValGly

TCTAAAMTCTGCRGCCCTACTGGCGGCTGTACAGACCCACAACAGGAGCCCTCCTG SerLysAsnLeuGlnLysProTyrTrpArgLeuTyrA~qProTh~Th~GlyA1~L~"Le~

CTGCTGACTGCCCTGCATCTCTGTGACCGGGTGAGTGCCTATGGCTACATCACAGAAGGT LeuLeuThrAlaLeuHisLeuCysAspArgValSerAlaTy~GlyTy~lleTh~Gl~Gly

CACCAGAAGTACTCGGATCACTACTATGACAAGGAGTGGAMCGCCTGGTCTTCTACGTT HisGlnLys~yrSerAspHisTyrTyrRspLysGluTrpLy~Gl~T~pLy~A~qLe"ValPheTyrVa1

AACCATGACTTCAACTTGGAGAAGCAGGTGTGGRGGCTTCATGATGAG~CATCATG AsnHisAspPheAsnLeuGluLysGlnValTrpLysArgLe~Hi~A~pGl~A~~ll~Met

AAGCTCTACCAGAGATCCTGACAGTGTGCCGAGGGCCATTGCCTGGGAAATCTCAACAGC LysLeuTyrGlnArqSer - - -

TCAAGAGWLTGATTTGTGTCCTGGAGGTGCTGCTGTCACTCTGCTCACTGCAGGCATAAG

1 0 2 0 34 0

1 0 8 0 360

1 1 4 0 380

1 2 0 0 4 0 0

1 2 6 0 4 2 0

1 3 2 0 4 4 0

1 3 8 0 4 6 0

1 4 4 0 4 8 0

1500 500

1 5 6 0 5 2 0

1 6 2 0 54 0

1 6 8 0 560

1 1 4 0 566

1800 1 8 6 0 1 9 2 0 1 9 8 0 204 0

2 1 6 0 2 1 0 0

2 2 8 0 2 2 2 0

2 3 4 0 2 4 0 0 2 4 6 0 2 5 2 0 2 5 8 0 2 6 4 0 2 6 1 1

-40 6 0 , , , , , , , , . . , , , , , , . , , . . . , , , , , , . . , , , ,

1 100 200 300 400 500 I " " "

Amino Acid Residue

FIG. 2. Nucleotide and predicted amino acid sequences of the cDNA encoding the chick GalNAc a!2,6sialyltransferase. A, the location of the sequence of the CEBl PCR clone is ouerlined. The potential N-linked glycosylation site (asterisk), poly(A) signal (underline), clustered basic amino acids (triangles), and two stretches of an 8-amino acid sequence (dashd line) are indicated. B, analysis of the hydrophobicity of the predicted P-B1 amino acid sequence. The NH, terminus of the protein is to the le/?. Positive values indicate hydrophobic residues.

GAGCCACAG-3' (nucleotides 679-708), with a synthetic EcoRI site at the middle of the primer and a 3' universal M13 sequencing primer and pCEB-1800 as a template. The PCR product was digested with EcoRI and XhoI and then ligated into the EcoRIIXhoI site of PUGS to yield pSB-690. This resulted in in-frame fusion of the 3' end of the immunoglobulin signal sequence to the putative active domain of the enzyme. The fusion fragment was excised from pSB-630 with PstI andXhoI, and then inserted into the PstVXhoI site of expression vector pcDSRa to yield pcDSB-690. All PCR-derived inserts were verified by DNA sequencing over their entire length.

pcDSB-BGGpCEB-1800 and PUGS were digested with BgZII, and the protruding ends were filled in using the Klenow fragment of DNA polymerase. After heat denaturation of the Klenow fragment of DNA polymerase (at 94 "C for 20 min), these plasmids were digested with

XhoI. The 1.0-kb fragment from pCEB-1800 was gel-purified and subcloned into the blunt-ended BglIIIXhoI site of PUGS to yield pSB-BGL. This gave a fusion protein containing the putative active domain of the enzyme and the immunoglobulin signal peptide sequence. The PstI- XhoI fragment from pSB-BGL was subcloned into the PstIIXhoI site of pcDSRa to generate pcDSB-BGL.

plasmid DNA using the DEAE-dextran method (51). The media were Expression-COS-7 cells were transiently transfected with 5 pg of

harvested a h r 48 h of transfection and then concentrated 10 times on Centricon 30 filters (Amicon) for the enzyme assay.

For metabolic labeling, COS cells (60-mm culture dish) were washed with Met-free medium (Dulbecco's modified Eagle's medium and 2% fetal calf serum) (Life Technologies, Inc.) and then incubated for 1 h with the same media. The cells were pulse-labeled with 10 MBqIdish

GalNAc or2,6-Sialyltransferase 1405

A

FIG. 3. Southern (A) and Northern blot ( B ) analyses. A, Southern blot analysis of genomic DNA. Chicken genomic DNA was digested with EcoRI, BamHI, HindIII, and S a d . The DNAs were pro-

the 0.6-kb EcoRI fragment of ACEB-201, cessed for blotting and hybridized with

as described under Materials and Meth- ods, B, Northern blot analysis of RNAs of 6-, 8-, and 10-day-old chicks. Samples (5 pg) of poly(A)-rich RNA were electrophoresed and hvbridized with the 0.6-kb

B

EcoRI fragment of ACEB-201, as described under Materials and Methods. C, Northern blot analysis of various tissue RNAs. Samples (10 pg) of poly(A)-rich 23- RNA were electrophoresed and hybrid- 2.0- ized.

1.3-

t 4 2.2-

4.0 - 3.0 -

P-B1

.." ::::::*IL"l:::::

SB-BGL I

Key

@ Stem region Signal peptderl amino abd

0 tinker 0 Active domain

Y Potential site of Nlinked glymsyiation

FIG. 4. Schematic representation of the active domain form of the GalNAc a2,6sialyltransferase. cDNAs capable of producing a soluble form of the P-B1 protein, SB-690 and SB-BGL were constructed by replacing the wild type NH2-terminal domain with the immunoglobulin signal peptide. The amino acid sequence across the fusion junction and the amino acid sequence derived from it are shown. Num- bers indicate the amino acid residues of the P-B1 protein (Fig. 2A 1.

E ~ p r e ~ ~ S ~ ~ s protein labeling mix (Du Pont NEN) in 1.5 ml of Met-free media for 2 h. These cells were then washed with Met-free media and chased for 5 h in media without Expre56S56S label. The media containing secreted proteins were harvested, concentrated 10 times, and then subjected to SDS-PAGE followed by fluorography.

Sialyltransferase Assay-The assays with oligosaccharides and glycoproteins as acceptors were performed in the presence of 50 m~ sodium cacodylate buffer, pH 6.0,50 p~ CMP-[14ClNe~c (0.9 Bqlpmol), 1 mg/ml bovine serum albumin, 2 mg/ml acceptor substrate, and 1 pl of concentrated COS cell medium, in a final volume of 10 p1, and were incubated a t 30 "C for 2 h. At the end of the incubation period, 1 ml of the assay mixture was applied to a silica gel 60 high performance thin layer chromatography plate (Merck, Darmstadt, Germany). The plate was developed with ethano1:pyridine:l-butano1:water:acetate (100:10:10:30:3), and the radioactivity was visualized and quantified with a BAS2000 radio image analyzer (Fuji Film, Japan). The radioactivity remaining at the origin was taken as sialylated glycoprotein.

Identification of the Sialylated Products--Reduced oligosaccharides were obtained from resialylated glycoproteins by pelimination (52). Asialo-BSM (100 pg each) was sialylated with CMP-[l4C1NeuAc in pcDSB-690 COS cell medium under the same conditions as above, except that the incubation period was 12 h. The reaction was terminated with 500 pl of 1% phosphotungstic acid in 0.5 M HCl, followed by centrifugation a t 10,000 x g for 5 min. The pellets were washed once with the same phosphotungstic acid solution and once with methanol, dis-

solved in 0.5 ml of 0.05 M NaOH and 1 M NaE%H4, and then incubated 30 h at 45 "C. At the end of the incubation period, the solution was neutralized with acetic acid to pH 6 and then lyophilized. The dehydrated products were dissolved in 50 pl of water and then desalted by gel filtration on a Sephadex G-15 column (0.5 x 5 cm) equilibrated and eluted with water. The radioactive fractions were subjected to thin layer chromatography for identification of the products without further pu- rification.

RESULTS Identification and Sequence of a New Sialyltramferase cDNA

Clone-In order to obtain clones of new members of the sialyltransferase family, PCR with two degenerate oligonucleotides (ST-107 and ST-205) was performed with chick embryo cDNA as a template. A fragment of the expected size of approximately 150 bp was obtained. Among the PCR recombinants, one clone, designated CEB1, has a unique amino acid sequence distinct from the known sialylmotifs (28) of Gal4GlcNAc-cw6STRL (residues 180-2251, Gal3(4)GlcNAc-a3STRL (residues 158-203), and GalSGalNAcZSTPS (residues 144-189). The identity of the sxylmotif of CEBl with those of =4GlcNAc-a6STRL, - Gal3(4)GlcNAc-a3STRL and =3GalNAc-a3STPS is 56, 58, and 60%, respectively.

Screening of a 6-day-old chick embryo cDNA library with the cDNA insert from the CEBl allowed the identification of several cDNA clones, of which clone ACEB-3043 contained a 2.7-kb insert (Fig. 1). To obtain another overlapping clone, a random- primer cDNA library was rescreened by hybridization with the 0.8-kb EcoRI-BgZII fragment of the 5'-end of the ACEB-3043. Fifteen clones were isolated from the cDNA library. One clone, ACEBHAD contained a 220-bp insert overlapping with the 5'- end of clone ACEB-3043 for 160 bp. Together these two cDNA contain 1.7 kb of open reading frame that ends with a TGA stop codon at nucleotide 1699. A polyadenylation signal (AATAAA) 23 nucleotides upstream from the poly(A) sequence is present at the 3' end. "kanslation of this open reading frame indicates a protein (designated as P-B1) of 566 amino acids with a molecular mass of 64,781 (Fig. 2A), starting with a methionine codon at nucleotide 1 with a conventional initiation sequence (53).

The sialyltransferases so far cloned have a domain structure similar to that of other glycosyltransferases: a short NH2-terminal cytoplasmic tail, a hydrophobic signal-anchor domain, a proteolytically sensitive stem region, and a large COOH-terminal active domain (4). To determine the location of any transmembrane domain, a hydropathy plot was generated from the translated sequence according to Kyte and Doolittle (54) (Fig.

1406 GalNAc &?,6-Sialyltransferase

2 B ) . A hydropathy plot suggested that a critical hydrophobic transmembrane domain (21 residues) is located at amino acid residues 17-37.

Northern and Southern Blot Analyses-To confirm the existence of the gene, Southern blot analysis of chick genomic DNA was performed. Hybridization with the EcoRI cDNA insert of ACEB-201 gave a single band for DNA digested with EcoRI and BamHI, and two bands for Hind111 and Sac1 digests (Fig. 3A). This simple hybridization pattern indicates that the cloned cDNA is a single copy gene.

The transcription pattern during embryonic development was examined by Northern blot hybridization (Fig. 3B). Anal- ysis of RNA from 6-, 8-, and 10-day-old chick embryos revealed two RNA species of 3.0 and 2.2 kb. The 3.0-kb transcript was abundant and constantly expressed during all embryonal stages. A low level of the 2.2-kb transcript was detected in 6-day-old embryos and its expression was decreased in 8- and 10-day-old embryos. The gene expression was analyzed using 10 pg of poly(A)-rich RNA obtained from various chicken tissues: brain, heart, liver, lung, kidney, and testis. Very low levels of the 3.0- and 4.0-kb transcripts was detected on testes, while signals were scarcely detected for other tissues on 3 times lon- ger exposure than those of embryos (Fig. 3C).

Expression of a Soluble Form of the New Sialyltrans- ferase-To facilitate functional analysis of the enzyme, it was desirable to produce a soluble form of the enzyme, which, when expressed, would be secreted from the cells. To create such a soluble protein, a sequence corresponding to the putative active domain of P-B1 was fused in-frame to the immunoglobulin signal peptide sequence (55, 56). As shown in Fig. 4, SB-690 encodes a fusion protein, a signal peptide, which consists of the immunoglobulin signal sequence and a putative active domain (residues 233-566) of P-B1. SB-BGL encodes a fusion protein, an immunoglobulin signal peptide followed by 3 amino acids encoded by the linker of PUGS, and a putative active domain (residues 270-566) of P-B1. These constructs were placed in the mammalian expression vector pcDSRa to generate plasmids pcDSB-690 and pcDSB-BGL, respectively, and were then transiently expressed in COS-7 cells. Media from cells transfected with pcDSB-690 contained sialyltransferase activity, whereas media obtained from cells transfected with pcDSB-BGL had no sialyltransferase activity (Fig. 5 A ) . These results provide strong evidence that SB-690 encodes a soluble form of the active sialyltransferase. A pulse-labeling experiment revealed that COS cells transfected with pcDSB-690 secreted a single unique protein of M, 52,000 into the medium, compared with mock (i.e. pcDSRa vector alone)-transfected cells (Fig. 5B). In vitro transcription and translation of pSB-690 appeared the predicted 35-kDa band on SDS-PAGE (data not shown). This discrepancy is probably due to N-linked glycosylation sites, in addition to several potential 0-linked glycosylation sites.

Substrate Specificity-The acceptor substrate specificity of the enzyme was examined with the concentrated COS cell culture medium transfected with pcDSB-690. As shown in Table I, asialomucin, fetuin, and asialofetuin served as good substrates. Remarkably, fetuin was shown to be a better substrate than asialofetuin (57,58). Other glycoproteins, oligosaccharides, and glycolipids did not serve as acceptors, except GalNAc-SerNAc. These data suggest that the acceptor site is GalNAc directly attached to Ser or Thr residues in glycoproteins through an a-glycoside linkage.

Identity ofthe Products-Asialo-BSM were resialylated with CMP-[l4C1NeuAc in pcDSB-690 COS cell medium, and reduced, p-eliminated oligosaccharides were prepared from them. Fig. 6 shows the labeled products from asialo-BSM co-migrated with NeuAca2,6GalNAc-o1 and GlcNAcP1,3(NeuAca2,6) GalNAc-ol from native BSM in two different solvent. The third

Mock PcDSB- PCDSB- 690 BGL

+ - + - + -

B 0 03

5 5 k D a ~

36kDa-

20kDa-

COS7 cells. A, an expression vector was transfected into COS-7 cells, FIG. 5. Expression of the soluble active sialyltransferase in

and then a t 48 h post-transfection cell media were harvested, concentrated 10-fold, and subjected to analysis of sialyltransferase activity. Sialyltransferase activity was measured as described under Materials and Methods using fetuin as an acceptor substrate. Mock-transfected, pcDSB-690-transfected, and pcDSB-BGLtransfected cells were analyzed with or without fetuin. B, in a similar experiment, media from COS-7 cells, metabolically labeled with ["sS]Met/[35SlCys, were concentrated and then electrophoresed on a 12% SDS polyacrylamide gel. Molecular size standards (20 kDa, trypsin inhibitor (soybean); 36 kDa, lactate dehydrogenase (porcine muscle); and 55 kDa, glutamate dehydrogenase (bovine liver)) are indicated; the arrow indicates the protein expressed in pcDSB-690 cells but not in mock-transfected cells.

product, which migrated just behind GlcNAcp1,3 (NeuAca2,6)GalNAc-o1, is presumed to be either GalP1,3 (NeuAca2,6)GalNAc-o1 or GalNAcP1,3(NeuAca2,6)GalNA~-ol but was not identified in this experiment. The ratio of the transferred sialyl residue was 1:0.9:0.6. Sialylated GalNAc- SerNAc co-migrated with NeuAca2,6GalNAc-SerNAc in the two different solvent systems (Fig. 7). These results show that this enzyme forms the NeuAca2,6 linkage to GalNAc, which is directly attached to Ser or Thr residues in glycoproteins.

GalNAc ar2,6-Sialyltransferase 1407 TABLE I

Acceptor substrate specificity of GalNAc cr2.6-sialyltransferase

Acceptor Activity

Fetuin pmol lh l l0p l medium

142 Asialofetuin 96 crl-Acid glycoprotein 6 Asialo-crl-acid glycoprotein 4 Bovine submaxillary mucin 15 Bovine submaxillary asialo-mucin 186 Ovomucoid 7 Asialo-ovomucoid 0" Galp1,3GlcNAcpl,3Galp1,4Glc 0 Galpl,4GlcNAc 0 Galp1,BGalNAc 0 GalNAcpl,4Gal 0 Galpl,4Glc 0 Galactose 0 Ganglioside mixture 0 Ganglioside GDl. 0 GalNAc-SerNAc 4 Benzyl-GalNAc 2

A value of 0 indicates less than 1 pmoWl0 pl medium.

NeuAca2,6GalNAcol- G I c N A c ~ ~ , ~ G ~ ~ N A ~ - o ~ - )

NeuAca2.6 I

""

"" "" ""

1 2 3 1 2 3

FIG. 6. Thin layer chromatography of sialylatea oligosaccharides of glycoproteins. The products of sialylation of asialomucin were separated on TLC plates. Lane 1, NeuAca2,6GalNAc-ol; lane 2, GlcNAcpl,3(NeuAca2,6)GalNAc-ol; lane 3, reduced oligosaccharides from resialylated asialomucin. Authentic reduced oligosaccharides in lanes 1 and 2 were visualized with resorcinol stain (58), and the radioactivity in lane 3 was visualized with a radio-image analyzer. A, TLC plate developed with 1-propano1:l-butanokwater (3:1:2). B, TLC plate developed with ethano1:pyridine:l-butano1:water:acetate (100:10:10:30:3).

DISCUSSION Based on the amino acid sequence information for a highly

conserved region in the cloned sialyltransferases (28), we have isolated and characterized a cDNA encoding GalNAc a2,6-sialyltransferase (GalNAc-a6ST) from a chick embryo cDNA library. This is the first case of the cloning of a sialyltransferase that exhibits acceptor specificity for the GalNAc but not the Gal moiety. So far cloned sialyltransferases only exhibit acceptor specificity for the Gal moiety. The following evidence supports that this enzyme represents GalNAc a2,64alyltransferase, which transfers CMP-NeuAc with an a2,6 linkage onto a Gal- NAc residue 0-linked to Thr/Ser of a glycoprotein. (i) The expression of pcDSB-690 (putative active domain of P-B1 (residues 233-566)) in COS cells reveals the remarkable acceptor specificity for only the GalNAc moiety bound to S e r m r residues, while no detectable enzyme activity was found toward the other substrates tested (Table I). The purified GalNAc a2,6- sialyltransferase also forms a a2,6 linkage exclusively with (GalPl,B-)GalNAc of glycoproteins (59). (ii) The sialylated products obtained from bovine submaxillary asialomucin and Gal- NAc-SerNAc were shown to have sialic acid bound to the Gal- NAc moiety through an a2,6 linkage.

ww

/- - - /

NeuAca2,BGalNAc- / 1 * CMP-NeuAc SerNAc --t 0 - J

m *

- 1 2 1 2

(A) (B)

NAc. GalNAc-SerNAc was sialylated with CMP-[*4C]NeuAc in pcDSB- FIG. 7. Thin layer chromatography of sialylated GalNAc-Sep

690 COS cell medium and then compared with NeuAccr2,BGalNAc- SerNAc on TLC plates. Lane 1, NeuAca2,6GalNAc-SerNAc visualized with resorcinol; lane 2, 14C-sialylated GalNAc-SerNAc visualized with the radio-image analyzer. The larger radioactive spots (asterisk) in each lane 2 are CMP-NeuAc. A, TLC plate developed with ethanol: pyridine:l-butano1:water:acetate (100:10:10:30:3). B, TLC plate developed with ethanol:(O.l M) sodium borate, pH 6.0 (3:l).

Two types of GalNAc-a6ST (submaxillary gland and liver (brain)) have been reported (65), which have differing acceptor specificities. The former enzyme has the broad specificity toward GalNAc, GalPl,3GalNAc, and NeuAca2,3Ga1(31,3Gal- NAc, although the latter has specificity only toward NeuAca2,3GalPl,3GalNAc moiety of glycoproteins. The substrate-acceptor specificity shows that the cloned enzyme is similar to the former enzyme.

Examination of the acceptor site of asialomucin showed that NeuAca2,GGalNAc-SerfI'hr was the most abundant product. However, considering the ratio of glycoconjugates in bovine submaxillary asialomucin, i.e. GalNAc-Ser/Thr, GlcNAcP1,3 GalNAc-Ser/Thr, and Gal/31,3GalNA~-SerlThr amounted to 65, 25, and 5%, respectively (431, the enzyme seems to have the following acceptor preference: (GalPl,3GalNAc-Ser/Thr >) GlcNAcPl,3GalNA~-Ser/Thr > GalNAc-Ser/Thr. Sadler et al. (59) also suggested the possibil- ity that GalPl,3GalNAc-Ser/Thr is a better acceptor than GalNAc-Sermr for porcine submaxillary GalNAc a2,6-sialyltransferase. However, it is also possible that this difference in the carbohydrate chain is a result of the effects of polypeptide portions, as mentioned below. On the other hand, the facts that fetuin is preferred over asialofetuin (Table I) and that al- most all the radioactivity was released on weak alkali treat- ment (Fig. 6) indicate that NeuAca2,3GalP1,3GalNA~-Ser/Thr is a preferred substrate over GalPl,3GalNAc-Ser/Thr, as reported for calf liver (65) and rat brain GalNAc a2,6-sialyltransferase (57). However, GalNAc-a6ST described here does not exhibit the strict substrate specificity of liver or brain Gal- NAc a2,6-sialyltransferase, which does not sialylate asialofetuin or bovine submaxillary asialomucin (57, 65).

The sialylation of GalNAc-SerNAc was much slower than that of corresponding residues on asialomucin (Table I). Brock- hausen et al. (58) examined the influence of the peptide portion on the activity of GalNAc-Ser/Thr P3-galactosyltransferase using synthetic 0-glycopeptides containing GalNAc residues. They showed that a length of at least 5 amino acids is required for efficient synthetase activity. A similar effect of the peptide portion directly on GalNAc-a6ST is suggested from this obser- vation (Table I).

Comparison of the deduced amino acid sequences of GalNAc- a6ST with that of Galp4GlcNAc-aGST from the same enzyme source (chick embryo) showed 13% identity (60). There is no significant similarity between this enzyme and the other six

1408 GalNAc d,&Sialyltransferase

&@.&-&ST ~ W ~ I L N N ~ I ~ ~ ~ V I K G Y M I Y O T K T S . . . . .CDRV - Gat&(GkNAc". ~ W ~ G S C K ~ G R E I D N H I ~ N ~ ~ F ~ ~ T . . . . . CWV Gal&IGlcNAed6SI"S KCAWSSAOSLKWSMSlREIDNHDAVUKIIOAPIDWF~V6TKTT.. . . . C W V ~ G l c N A c ~ P ACAWSSAGSLK~GREIWHDAVLRFNGAPTMlFMTK~. . . . . CWV - Galb3GalNAc-a3SlTS ACAWGNSGNU(ESWOWIDSHDFYLRIIII(AP1EGFUTT. . . . . CDEV Galb3Galh'Ac"TMB RCAWGNSGNLKDSSYGPE I DSHDFVLRY(KAPTVGFUDVGSRTT. . . . . CDEV - Gal~4)GkNAc-u3STRL RCI lVGNOOYUNKSCGSRlDDW) IV I~K~EKDVOSKTT. . , . . CDEV

.*.*...**.. * **..**.*. 1. .,. *O..*. * * *

Residues Ret 33S384.. ,508-51 1 180-225.. .332-335 13 180-225.. ,332-335 24 183-228.. ,335-338 22 144-189.. ,284-287 25 138-183.. ,278-281 26 158-203.. .312-315 27

FIG. 8. The conserved region shared by the seven cloned sidyltransferases. The alignment of the conserved region was conducted for the seven protein sequences (13,22,24-29). Asterisks indicate a position in the alignment that is perkectly conserved; dots indicate a position that is well conserved.

sialyltransferases (C&lp4GlcNAc-a6STRL, GalpQGlcNAc- aGSTHP, Galp4GlcNAc-a6STML, Galp3GawAc-a3STPS, W@GalNAG3STMB, and Galp3(4~cNAc-a3STRL) (13, 22,24271, except for stretches?46 (residues 339-384) and 4 (residues 508-511) amino acids located in their active domains (Fig. 8) (28-30). Among the 50 amino acid residues shown in Fig. 8, 18 (36%) are identical and another 18 (36%) are similar.

The protein motifs of proteins with related functions are often involved in catalysis and ligand binding (61-63). The seven cloned sialyltransferases catalyze the transfer of sialic acid from CW-NeuAc with an a2,3 or a2,6 linkage to the terminal galactose of an acceptor carbohydrate to form the following sequences: NeuAca2,6Galpl,4GlcNAc- (Galp4- GlcNAc-aGST), NeuAca2,3Galpl,3GalNAcc- (Galp3GaAc- a3ST), and NeuAca2,3Galj31,3(4)GlcNAc- (Gaw3(4)GlcNAc- a3ST). The protein motif shared by all theseenzymes could principally contain either the CMP-NeuAc binding site or the Gal acceptor binding site or both. GalNAc-a6ST also has this motif, as shown in Fig. 6. If this moiety contains the acceptor binding site, it must recognize some portion of the Gal moiety other than C3 (-OH) and C2 (-OH,-NHz), for the following rea- sons. (i) The acceptor specificity shows that GalNAc-a6ST should not recognize C3-OH, because it could also transfer NeuAc to the GalNAc moiety of the Galpl,3GalNAc structure of mucin. (ii) Sialyltransferases that have this motif exhibit acceptor specificity either for the Gal or GalNAc moiety. Thus, these observations strongly suggest the sialylmotif contains the CMP-NeuAc binding site. Other sialyltransferases may be cloned by using a oligonucleotide complementary to the sialylmotif as a probe or, alternatively, by using primers complementary to this motif to amplify a specific cDNA fragment for a probe.

Of the several potential N-linked glycosylation sites in both GalNAc-a6ST and all Galp4GlcNAc-a6STs so far cloned (ie. GalP4GlcNAc-a6STRL,-HP, -ML, and -CE), one (Asn306) exists a t h e same position in homologous regions.

The amino acid sequence of GalNAc-a6ST shows the following characteristic points that have never been observed for other cloned sialyltransferases.

(i) All sialyltransferases cloned thus far are critical Type I1 membrane proteins. They have a domain structure similar to that of other glycosyl-transferases: a short NHz-terminal cytoplasmic tail, a hydrophobic signal-anchor domain, a proteolytically sensitive stem region, and a large COOH-terminal active domain. The structure of GalNAc-a6ST may be similar to those of cloned sialyltransferases but have a large stem region or intermediate region. (a) The hydropathy analysis (54) revealed the hydrophobic signal-anchor domain is from 17 to 37. ( b ) Residues 233-269 must contain some essential residues for enzyme activity, because the media from cells transfected with pcDSB-BGL had no significant activity, although the protein (33 m a ) was synthesized in an in vitro translation/ transcription system with pSB-BGL as a template. The active domain of GalNAc-a6ST is deduced to be around 233-566, which is a size comparable to that of other cloned syalyltrans- ferases. Further investigation is needed to find out whether

this large region between signal-anchor (a) and active domain ( b ) is only a long stem that enables its active domain to float in the middle of Golgi sac or whether it has other functions such as catalytic regulation. The molecular mass of P-Bl is smaller than that of purified GalNAc-a6ST from porcine submaxillary glands consists of several electrophoretic forms, the molecular weight of them were about 160,000"100,000 as estimated by SDS-PAGE (59). This discrepancy could be due to the post- translational modification, such as glycosylation.

fii) The amino acid sequences of proteins with intracellular half-lives of less than 2 h contain one or more regions (named PEST; Ref. 64) rich in proline (PI, glutamic acid (E), serine (SI, and threonine (TI residues. These PEST regions are generally, but not always, flanked by clusters containing several posi- tively charged amino acids. GalNAc-a6ST has a critical PEST region (residues 233-258). Other cloned sialyltransferases do not have this region. This may be the reason why it is diffkult to purify this enzyme to a homogeneous state and why it has never yet been cloned.

(iii) Two stretches of 8 amino acids (SSSXVSTC) were found at residues 247-254 and 330-337. A search of the GeneBank data base for other proteins revealed no sequence similarity to this sequence.

Sialyltransferases cloned thus far have been shown to exhibit remarkable tissue-specific expression, which is correlated with the existence of cell type-specific carbohydrate structures (4, 13, 25). Northern blotting indicated that the pattern of expression of GalNAc-a6ST mRNA changes during development (Fig. 3). The production of two different sizes of &As (4.0,3.0, and 2.2 kb) from the GalNAc-a6ST gene suggests that they are very likely to be generated through alternative splic- ing and alternative promoter utilization mechanisms, as observed for Galpl,4GlcNAc a2,6-sialyltransferase (Galp4Glc- NAc-a6STRL) and Galpl,3(4)GlcNAc a2,3-~ialyltransferase (Galp3(4)GlcNAc-a3STRL) (13, 27). This hypothesis is sup- p z d by the results of Southern hybridization, which showed the existence of a single copy gene for GalNAc-a6ST (Fig. 3). The size of the cDNA insert from XCEB-3043 is 2.7 kb, so it is possible that the cloned cDNA is derived from the 3.0-kb transcript, but the precise structures of the 2.2- and 4.0-kb mRNAs are not clear.

The availability of GalNAc-a6ST, in conjunction with the stage-specific control sequence and transgenic animal tech- nique, will provide further i n f o ~ a t i o n for elucidation of the biological functions of sialylglycoconjugates through alteration of the glycoconjugate expression pattern during development.

Acknowledgments-We thank Dr. James C. Paulson for valuable dis-

lication, and we thank Drs. Yoshitaka Nagai and Tomop Ogawa for cussion and giving the sialyltransferase cDNA sequences prior to pub-

support. in this work. We also thank Dr. 'ktsuya Kajimoto for the gen- emus gift of GalNAc@l,rtGal and for helpful assistance in the synthesis of GalNAc-SerNAc, and we thank Mikiko Kawasaki for technical assistance.

REFERENCES 1. Dennis, J., Walker, C., Timpl, R., and Schirrmacher, V. (1982) Nature 8M),

274-276

GalNAc (u2,6-Sialyltransferase 1409 2. Feizi, T. (1985) Nature 314, 53-57

4. Paulson, J. C., and Colley, K J. (1989) J. Biol. Chem. 284,17615-17618 3. Kornfeld, S . (1987) FMEB J. 1, 462-468

5. Schnaar, R. L. (1991) Glymbwlogy 1,477-485 6. Wasserman, P. M. (1987)Annu. Rev. Cell Biol. 3, 109-142 7. Corfield, T. (1992) Glycobiology 2, 509-521 8. Ember, S. J. (1989) Biochem. Soc. IRans. 17,23-27 9. Roos, E. (1984) Biochim. Biophys. Acta 788,263-284

10. Beyer, T. A., Sadler, J. C., Rearick, J. I., Paulson, J. C., and Hill, R. L. (1981)

11. Kornfeld, R., and Kornfeld, S. (1985)Annu. Rev. Biockm. 54,631-664 12. Broouet. P.. Baubichon-Cortav, H.. George, P., and huisot, P. (1991) Znt. J.

Adv. Enzymol. 62,23-175

B-&&rn: 23,385-389 13. Weinstein, J., Lee, E. U., McEntee, K., h i , P. H., and Paulson, J. C. (1987) J.

14. Hakomori, S. (1981) Annu. Rev. Biochem. SO, 733-764 15. Fishman, P., and Brady, R. 0. (1976) Science 194,906-915

17. Svennerholm, L. (1980) in Advances in Experimental Biology and Medicine: 16. Weigandt, H. (1967) J. Neurockm. 14,671-674

Structure and Function of Gangliosides (Svennerholm, L., Mandel, P., h e y -

18. Sadler, J. E., Rearick, J. I., Paulson, J. C., and Hill, R. L. (1979) J. Biol. Chem. fus, H., and Urban, P., eds) Vol. 125, pp. 533-544, Plenum Press, New York

264.4434-4443

Biol. Chem. ZSZ, 17735-17743

Weinskin, J., dehuza-e-Silva, U., and Paulson, J. C. (1982) J. Bwl. Chem.

Rearick, J. I., Sadler, J. E., Paulson, J. C., and Hill, R. L. (1979) J. Biol. Chen. 267. 13835-13844

19.

20.

21. Joziasse, D. H., Bergh, M. L. E., ter Hart, H. G. J., Koppen, P. L., Hooghwinkel, 254,4444-4451

22. Grundmann, U., Nerlich, C., Rein, T., and Zettlmeissl, G. (1990) Nucleic Acids G. J. M., and van den Eijnden, D. H. (1985) J. Biol. Chem. 260,49414951

23. Bast, B. J. E. G., Zhou, L.J., Freeman, G. J., Colley, K. J., Ernat, T. J., Munro, Res. 18, 667

24. Hamamoto, T., Kawasaki, M., Kurosawa, N., Nakaoka, T., Lee, Y.-C., and'buji, J. M., and Tedder, T. F. (1992) J. Cell Biol. 116,4231135

25. Gillespie, W., Kelm, S., and Paulson, J. C. (1992) J. Bid . Chem. 267, 21004- S . (1993) Bioorg. Med. Chem. 1,141-145

31nm

26. Lee, Y.-C., Kurosawa, N., Hamamotn, T., Nakaoka, T., and Tsuji, S . (1993) Eul:

27. Wen, D. X., Livingston, B. D., Medzihradszky, K F., Kelm, S., Burlingame, A. J. Biochem. 216,377485

28. Paulson, J. C., Phillips, L., Polley, M., Baum, L., Gillespie, B., Svensson, E., L., and Paulson, J. C. (1992) J . Biol. Chem. 267,21011-21019

Wen, D., Nudelman, E., Singhal, A., and Hakomori, S. (1991) Glycoconjit- gate J . 8, 145

.,IYI"

29. Drichamer, K. (1993) Glycobiology 3, 2-3 30. Livingstone, B. D., and Paulson, J. C. (1993)J. Biol. Chem. 268,11504-11507 31. Petkovitch, M., Brand, N. J., Krust, A,, and Chambon, P. (1987) Nature SO,

32. Henrich, V. C., Sliter, T. J., Lubahn, D. B., Maclntyre, A,, and Gilbert, L. I.

33. Govindan, M. V. (1990) Mol. Endocrinol. 4, 417-427

444450

(1990) Nucleic Acids Res. 18,414%4148

34. Garcia-Fernandez, J., Baguna, J., and Salo, E. (1991) Proc. Natl. A c a d . Sei.

35. Kaufman, B., Basu, S., and Roseman, S. (1968) J. BioL. Chem. 249,5804-5807 36. Den, H., KauIinan, B., McGuire, E. J., and Roseman, S. (1975) J. Biol. Chem.

37. Den, H., Kaufman, B., and Roseman, S . (1970) J. Biol. Chem. 245,6607-6615 38. Rosenberg, A., Sauer, A,, Noble, E. P., Gross, H.-J., Chang, R., and Brossmer,

39. Arce, A., Maccioni, H. F., and Caputto, R. (1966)Arch. Biochem. Biophys. 116,

40. Arce, A,, Maccioni, H. F., and Caputto. R. (1971) Biochem. J. 121,483493

42. Grundler, G., and Schmidt, R. R. (1984) Liebigs Ann. Chem. 1984 1826-1847 41. Dall'olio, F. (1990) Glycoconjugate J. 7, 301-310

43. Tsuji, T., and Osawa, T. (1986) Carbohydr: Res. 161,391402 44. Savage, A. V., Donoghue, C. M., DArcy, S . M., Koeleman. C. A. M., and van den

Eijnden, D. H. (1990) Eur. J. Biochem. 192,427-432 45. Savage, A. V., Donohue, J. J., Koeleman, C. A. M., and van den EGnden, D. H.

(1990) Eur. J. Biochem. 193, 837-843 46. Sambrook, J., kitsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

47. Sanger, F., Nicklen, S., and Coulson,A. R. (1977)Proc. Natl. Acad. Sci. U. S. A

U. S. A. 88,7338-7342

Zao, 739-746

K. (1992) J . Biol. Chen. 267, 10607-10612

52-58

" -.-" -,"- 48. 49.

50.

52. 51.

53. 54. 55. 56.

57.

58.

59. 60.

61. 62.

64. 63.

65.

66.

Jobling, S . A,, and Gehrke, L. (1987) Nature 326,622-625 Boersch-Supan, M. E., Agamal, S., White-Scharf, M. E., and Imanishi-Kari, T.

(1985) J. Exp. Med. 161, 1272-1292 Takebe, Y.. Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K, Yoshida, M.,

and Arai, N. (1988) Mol. Cell. Biol. 8, 4-72

Carlson, D. M. (1968) J. Biol. Clrem. 243,61€-626 McCutchan, J. H., and Pagano, J. S. (1968) J. Natl. Cancer Znst. 41,351357

Kozak, M. (1984) Nature 308,241-246 Kyte, J., and Doolittle, R. F. (1982) J. MOL. Biol. 167, 10S132 Jobling, S. A, and Gehrke. L. (1987) Nature 326,622425 Boersch-Supan, M. E., Agamal, S . , White-Scharf, M. E., and Imanishi-Kari, T.

Baubichon-Cortay, H., Serres-Guillaumond, M., Louisot, P., and Brcquet, P.

Brockhausen, I., Moeller, G., Men, G., Adermann, K., and Paulsen, H. (1990)

Sadler, J. E., Rearick. J. I., and Hill, R. L. (1979) J. Bid . Chem. 264,5934-5941 Kurosawa, N., Kawasaki, M., Hamamoto, T., Nakaoka, T., Lee, Y.-C., Arita, M.,

and Tsuji, S . (1994) Eur. J . Biochem., in press Hodgman, T. C. (1989) Comput. Appl. Biosci. 6, 1-13 Bairoch, A. (1990) Prosite: A Dictionary of Pmtein Sites and Patterns, 5th Ed.,

Strenberg, M. J. E. (1991) Nature 349, 111 Rogers, S., Wells, R., and Rechsteiner, M. (1986) Science 234, 364-368 Bergh, M. L. E., Hooghwinkel, G. J. M., and van den Eijnden, D. (1983) J. Bid .

Kitagawa, H., and Paulson, J. C. (1994) J . Biol. Chem. 269,1394-1401

74, 34b3--34b I

(1985) J. Exp. Med. 161,1272-1292

(1986) Carbohydl: Res. 149,209-223

Biochemistry 29, 10206-10212

University of Geneva, Geneva, Switzerland

Chem. 268,7430-7436

twe journal of 269. no. 2, january 14, 1402-1409, 1994 8 ... · nac-sernac) was synthesized...

Documents