ultrasound stimulation induces microrna expression changes that could be involved in...

ORIGINAL ARTICLE

Ultrasound stimulation induces microRNA expression changesthat could be involved in sonication-induced apoptosis

Ryohei Ogawa • Akihiro Morii • Akihiko Watanabe

Received: 29 September 2011 / Accepted: 3 March 2012 / Published online: 3 May 2012

� The Japan Society of Ultrasonics in Medicine 2012

Abstract

Purpose The purpose of this study is to investigate the

involvement of microRNAs (miRNAs) in sonication-

induced apoptosis.

Methods U937 cells derived from human leukemia were

sonicated with 1-MHz ultrasound at 0.4 W/cm2 and 10 %

duty factor for 60 s, a condition inducing apoptosis. The

total RNA was extracted from cells at various timings after

sonication and subjected to microarray and real-time PCR

for miRNA expression analyses.

Results Expression of several miRNAs was significantly

affected by sonication. For miR-424* and miR-720, whose

expressions were eminently decreased by sonication, cell

lines overexpressing these miRNAs were established.

Conversely, for miR-663B and miR-663, whose expres-

sions were eminently increased by sonication, cell lines

inhibiting these miRNA functions were established. When

these cell lines were sonicated, a cell line inhibiting miR-

663B function significantly increased sonication-induced

apoptosis, suggesting this may be involved in cellular

responses to sonication. Two genes that could induce

apoptosis, KSR2 and CREBZF, were identified as potential

target genes of miR-663B since potential target sequences

on their 30 UTR mediated to decrease expression of a

reporter gene.

Conclusion These results suggest that miRNAs may be

involved in cellular responses to ultrasound through their

expression changes caused by sonication.

Keywords MicroRNA � Apoptosis � Microarray �Expression

Introduction

Cells being sonicated are subjected to various stimulation

including mechanical, thermal, and oxidative stress [1, 2].

A cell may sense this stimulation by chemical changes and

spacial movements of molecules within or as a component

of the cell, and then convey the information to the other

parts of the cell through certain signal transduction net-

works. Receiving such information, the cell may undergo

fundamental changes to respond and adapt itself to the

stimulations. A change in gene expression would be the

most drastic and fundamental among them. By doing so,

the cell may be able to protect itself from the stimulation,

repair any damage, initiate programmed cell death, and

so on.

The microRNA (miRNA) is a low molecular weight

RNA (19–24 nucleotides in length) that does not code for

polypeptides and controls gene expression mainly by

interfering with the translation process, binding target

sequences complimentary to the miRNA seed sequence to

some extent on messenger RNAs (mRNAs). Over 1000

miRNAs have been identified in human cells, and those are

reported to be involved in many important biological pro-

cesses such as development, differentiation, cell prolifera-

tion, and cell death.

R. Ogawa (&)

Department of Radiological Sciences,

Graduate School of Medicine and Pharmaceutical Sciences

for Research, University of Toyama,

2630 Sugitani, Toyama 930-0194, Japan

e-mail: [email protected]

A. Morii � A. Watanabe

Department of Urology, Graduate School of Medicine

and Pharmaceutical Sciences for Research,

University of Toyama, Toyama, Japan

123

J Med Ultrasonics (2012) 39:207–216

DOI 10.1007/s10396-012-0364-9

Biogenesis of miRNA has been analyzed in considerable

detail. A miRNA is transcribed as a primary-miRNA (pri-

miRNA) that is a relatively long transcript, containing

multiple stem-loop structures. This transcript is cleaved by

an RNaseIII called Drosha into a precursor-miRNA (pre-

miRNA) of 60–70 nucleotides in length that contains a

double-stranded region of 21–24 nucleotides. After the

precursor is transferred to cytoplasm from the nucleus by

exportin-5, it is matured by treatment with the Dicer

complex to be a double-stranded miRNA. One strand is

selected by Argonaute proteins to form an RNA-induced

silencing complex (RISC). The single-strand miRNA

is a component that works as a guide in the complex,

searching for the target sequences through sequence

complementarity. Target sequences usually reside in its

30-untranslated region (30 UTR) of mRNA. Many target

sequences are not perfectly complimentary to miRNAs.

Even if a target sequence carries a high homology lim-

ited only to the so-called seed sequence that is a

sequence of seven nucleotides from the 2nd to 8th of the

50 side of a miRNA, interaction occurs to inhibit the

translation of a target mRNA. Thus, the range of targets

is wide. One miRNA may cover many mRNAs (usually

more than 100) and is involved in controlling expression

of all the target mRNAs, forming a unique gene regula-

tion network [3–6].

Recently, it has been reported that expression of miR-

NAs is affected by stimulation of cells and that the miR-

NAs may be involved in adaptive responses of cells to the

stimulation. For instance, ionizing radiation increases

expression of let-7 family miRNAs known as tumor sup-

pressors [7], and thermal stimulation changes expression

patterns of miRNAs that target heat shock protein genes

[8]. In addition, as in cases involving anti-cancer drugs [9]

or hypoxia [10], it was shown to modulate expression of

miRNAs whose targets could be involved in cell response

to this stimulation, suggesting that miRNAs are an integral

part of networks in adaptive responses of cells to

stimulation.

Ultrasound irradiation may lead to various kinds of

interactions with the living body depending upon the son-

ication conditions. Under certain sonication conditions, it

was reported that ultrasound induced gene expression

changes in cells [11, 12]. In addition, it also induced

apoptosis after sonication of a certain type of cell under

appropriate conditions [13]. We started this investigation

because we thought that miRNAs might also be involved in

adaptive responses of cells to ultrasound stimulation. In

this study, we examined whether miRNA expression may

be affected by sonication under conditions that could

induce apoptosis in U937 cells. In addition, we examined

whether such miRNAs could be involved in the process

leading to sonication-induced apoptosis.

Materials and methods

Cells and bacteria

A human myelomonocytic leukemia cell line, U937 (pur-

chased from Japanese Cancer Research Resource Bank),

was used in this study. The cells were maintained in RPMI

1640 medium supplemented with 10 % heat-inactivated

fetal bovine serum at 37.0 �C in humidified air with 5 %

CO2. The cells used in the experiments were in log-phase

with 23.5 h doubling time. Cell viability before treatment

was always over 95 %.

The DH5a strain of Escherichia coli (Nippon Gene Co.

Ltd., Toyama, Japan) was used for the DNA manipulation

experiments. The E. coli cells were grown in LB medium at

37 �C. All medium compositions were purchased from BD

Diagnostics (Sparks, MD, USA). DNA manipulation

experiments with E. coli were performed according to the

methods described by Sambrook and Russell [14].

Ultrasound irradiation

A dish with cells was placed on the face of the transducer

of the ultrasonic apparatus (Sonicmaster ES-2, OG Giken,

Okayama, Japan) with a resonant frequency of 1.0 MHz

and a pulse repetition frequency of 100 Hz. A duty factor

(DF) of 10 % was used in all the sonication experiments.

Sonication was conducted at intensities of 0.4 W/cm2 for

60 s with a transducer with a diameter of 5.0 cm that was

secured with a clamp attached to a metal stand to keep the

transducer facing directly upward. The dish was placed on

the center of the transducer intermediated with gel. The

spatial average/temporal average intensities for device-

indicated intensities of 0.4 W/cm2 at 10 % DF were

0.092 W/cm2, determined using an ultrasound power meter

(UPD-DT-10E, Ohmic Instruments, Easton, MD, USA).

Although a standing wave could be generated in our setup,

in this study we used device-indicated intensities since it

was almost impossible to measure the actual intensity.

When a needle-type PVDF hydrophone (FORCE Institute,

type BAS2, Copenhagen, Denmark) was used to measure

the acoustic pressure at the center of the culture dish under

exposure conditions resulting in standing waves, the pres-

sure varied around a mean value with SD of 22.9 %. The

mean and the maximum acoustic pressures were approxi-

mately 3.5 and 5 times higher than those measured when

standing waves were eliminated, respectively.

Apoptosis detection

The amount of DNA extracted from cells that had under-

gone DNA fragmentation was assayed using the method of

Sellins and Cohen [15] with a few modifications. Briefly,

208 J Med Ultrasonics (2012) 39:207–216

123

cells (3 9 106) were lysed in 200 ll of lysis buffer

(10 mM Tris, 1 mM EDTA, 0.2 % Triton X-100, pH 7.5)

and centrifuged at 130009g for 10 min. Subsequently,

each DNA sample in the supernatant and the resulting

pellet were precipitated in 12.5 % trichloroacetic acid

(TCA) at 4 �C, and quantified using the diphenylamine

reagent after hydrolysis in 5 % TCA at 90 �C for 20 min.

The percentage of fragmented DNA for each sample was

calculated as the amount of DNA in the supernatant divi-

ded by the total DNA for that sample (supernatant plus

pellet).

RNA extraction and miRNA microarray analysis

Total RNA was extracted from control cells as well as cells

exposed to ultrasound (0.4 W/cm2) 4 h post-exposure

using the miRNeasy Extraction Kit (QIAGEN Inc.,

Valencia, CA, USA). Samples were treated with DNase I

(RNase-free DNase Kit, QIAGEN Inc.) for 15 min at room

temperature during the procedure as directed in the

instructions to remove residual genomic DNA.

miRNA expression was analyzed twice using a Gene-

Chip system with a miRNA array ver. 1.0 (Affymetrix,

Santa Clara, CA, USA). Samples for array hybridization

were prepared using the FlashTag RNA Labeling Kit for

Affymetrix GeneChip miRNA Arrays (Genisphere Inc, PA,

USA) following a procedure described in the product

manual. Briefly, 1 lg of total RNA was labeled with biotin

through ligation with 3DNA dendrimer. The labeled RNA

was hybridized to the GeneChip array at 48 �C for 16 h.

The arrays were washed, stained with streptavidin–phyco-

erythrin, and scanned using a probe array scanner. The

scanned chip data were converted to digitized information

using the miRNA QC Tool application.

Quantitative real-time PCR

For evaluation of miRNA expression, quantitative real-

time PCR was performed. Total RNA was collected from

U937 cells using the miRNeasy Mini Kit (QIAGEN Inc.)

with treatment with DNase I according to the manufac-

turer’s instructions, as described above. cDNAs were syn-

thesized with the extracted RNA as templates, using the

miScript Reverse Transcription Kit (QIAGEN Inc.)

according to the manufacturer’s instructions. Gene

expression analysis was performed using the Mx3000P

QPCR System (Agillent Technologies Inc., Santa Clara,

CA, USA) with the synthesized cDNA. Quantitative PCR

measurement by real-time monitoring of SYBR Green

integration into synthesized DNA was executed during a

process of PCR: incubation at 95 �C for 15 m, and then 40

thermal cycles for reactions at 94 �C for 15 s, at 55 �C for

30 s, and at 70 �C for 30 s, followed by reactions at 55 �C

for 30 s and 95 �C for 30 s with the miScript SYBR Green

PCR Kit (QIAGEN Inc.). After the PCR process, the dis-

sociation temperature of the synthesized DNA fragment

was also determined by monitoring the release of SYBR

Green from denatured DNA for confirmation of the

integrity of the synthesized DNA fragment. The primer

used for PCR reaction was selected out of a miRNA primer

library of the miScript Primer Assay (QIAGEN Inc.). We

used 50-GAGTCAACGGATTTGGTCGT-30 and 50-TTGA

TTTTGGAGGGATCTCG-30 to detect glyceraldehyde-3-

phosphate dehydrogenase (GAPDH) expression as an inner

control with SYBR Premix Ex Taq II (Takara Bio Inc).

Relative standard curves representing several tenfold

dilutions of cDNA from a representative sample were used

for linear regression analysis for other samples.

Vector constructions

Constructions of miR-663 and miR-663B probe vectors

A dual luciferase miRNA target expression vector, pmir-

GLO (Promega Corp., Madison, WI, USA), was used for

confirmation for establishment of a miRNA function inhi-

bition cell line. In the vector, the firefly luciferase gene is

driven by the mouse PGK promoter, and the renilla lucif-

erase gene is driven by the SV40 promoter. In the 30 UTR of

the firefly luciferase gene, multiple cloning sites were

inserted so that target sequences for miRNAs could be easily

cloned. For confirmation of inhibition of miRNA function,

multi-copies of the 100 % complimentary sequence to a

miRNA whose function is inhibited were directionally

aligned and inserted to the multiple cloning sites. If a con-

structed probe vector was introduced into engineered cells of

which the corresponding miRNA function was successfully

inhibited, firefly luciferase activity increased relative to that

in wild type cells.

For confirmation of inhibition of miR-663 function, a

pair of synthesized DNAs with the sequences 50-GCGGT

CCCGCGGCGCCCCGCCTAGTG-30 and 50-AGGCGGG

GCGCCGCGGGACCGCCACT-30 were used. For confir-

mation of inhibition of miR-663B function, a pair of syn-

thesized DNAs with the sequences 50-CCTCAGGCACGG

CCGGGCCACCAGTG-30 and 50-GGTGGCCCGGCCGT

GCCTGAGGCACT30 were used. Each pair was annealed

in annealing buffer (100 mM NaCl, 50 mM Tris–Cl, pH

7.5) by boiling at 95 �C for 5 min and then gradually

cooling to room temperature. Annealed oligos were treated

with polynucleotide kinase at 37 �C for 60 min. We sim-

ilarly treated two pairs of synthesized oligonucleotides of

50-GTACGCTAGCAGTG-30 and 50-GCTAGCGTACCA

CT-30 configuring the NheI recognition site, and 50-GAAT

TCGTCGACAGTG-30 and 50-GTCGACGAATTCCAC

T-30 configuring the EcoRI site and SalI site. Either of the

J Med Ultrasonics (2012) 39:207–216 209

123

two annealed miRNA target oligonucleotides was mixed

with the NheI oligonucleotide pair and the EcoRI–SalI

oligonucleotide pair at a rate of 5 to 1 to 1 for random

ligation. As the 30 protrusions are not a palindromic com-

bination, fragments were ligated in the same direction

relative to each miRNA target sequence. Fragments gen-

erated by ligation reaction were then digested with NheI

and SalI and inserted into the NheI site and the SalI site of

pmirGLO. The vectors carrying inserts of an NheI–SalI

fragment with the EcoRI recognition site indicating the

same direction relative to the luciferase gene were chosen

for further study.

Constructions of KSR2 and CREBZF target vectors

There are four potential target sequences of miR-663B in

the 30 UTR of the kinase suppressor of the ras 2 (KSR2)

gene. A 1.6-kb fragment containing the former two target

candidates was cloned from 1 lg of genomic DNA

extracted from U937 cells by PCR using a pair of primers

of 50-ACTCTCGAGCTTGGCTATAGATGGGTTGGCCA

TG-30 (the XhoI recognition site is underlined) and 50-GG

TGCGGCCGCGACGGAGACAGACAGAGATAGAAAC-30

(the NotI recognition site is underlined). Amplified fragment

was inserted into the XhoI site and the NotI site of pmirGLO

after digestion with XhoI and NotI.

The CREB/ATF bZIP transcription factor (CREBZF)

gene carries one target sequence with a relatively conserved

homology to the miR-663B complimentary sequence. A 0.5-

kb fragment containing the target candidate was cloned from

1 lg of genomic DNA extracted from U937 cells by PCR

using a pair of primers of 50-ACTCTCGAGGAATTATGG

TGTCCTTCAGTGTAAG-30 (the XhoI recognition site is

underlined) and 50-GGTGCGGCCGCTAAGCAGGTTCA

TCACTCCAATTTG-30 (the NotI recognition site is

underlined). Amplified fragment was inserted into the XhoI

site and the NotI site of pmirGLO after digestion with XhoI

and NotI. Structures of all the constructed vectors were

confirmed by nucleotide sequence analyses.

Construction of plasmid vectors to generate recombinant

retroviruses expressing tough decoy RNAs

Tough decoy RNA, a type of miRNA sponge, was devel-

oped by Haraguchi et al. [16, 17]. It contains two target

sequences complimentary to a miRNA and efficiently

presents the target sequences in its conformation to com-

petitively block the binding of the miRNA to the target

mRNAs. We used a recombinant retrovirus vector to

establish a cell line to constitutively express a tough decoy

RNA for either miR-663 or miR-663B.

To construct retrovirus-generating vectors, annealed

synthetic DNA fragment pairs coding for tough decoy

RNAs were inserted into the BamHI and EcoRI sites of

pSIREN-RetroQ (Clonetech, Takara Bio Inc., Otsu, Japan).

The vectors were introduced into packaging cells to gen-

erate recombinant retrovirus vectors. The recombinants

were infected to U937 cells to establish cell lines to express

tough decoy RNAs for miR-663 and miR-663B that were

transcribed from the U6 promoter.

For miR-663 tough decoy RNA, the following two

synthetic fragments were used to generate a recombinant

(complimentary sequences to miR-663 are underlined):

50-GATCCGACGGCGCTAGGATCATCAACGCGGT

CCCGCGGCGCCCCGCCTCAAGTATTCTGGTCAC

AGAATACAACGCGGTCCCGCGGCGCCCCGCCTC

AAGATGATCCTAGCGCCGTCTTTTTTG-30

50-AATTCAAAAAAGACGGCGCTAGGATCATCTT

GAGGCGGGGCGCCGCGGGACCGCGTTGTATTCT

GTGACCAGAATACTTAGGCGGGGCGCCGCGGGA

CCGCGTTGATGATCCTAGCGCCGTCG-30

For miR-663B tough decoy RNA, the following two

synthetic fragments were used to generate a recombinant

(complimentary sequences to miR-663B are underlined):

50-GATCCGACGGCGCTAGGATCATCAACCCTCAG

GCACGGCCGGGCCACCCAAGTATTCTGGTCACAG

AATACAACCCTCAGGCACGGCCGGGCCACCCAAG

ATGATCCTAGCGCCGTCTTTTTTG-30

50-AATTCAAAAAAGACGGCGCTAGGATCATCTTG

GGTGGCCCGGCCGTGCCTGAGGGTTGTATTCTGT

GACCAGAATACTTGGGTGGCCCGGCCGTGCCTGA

GGGTTGATGATCCTAGCGCCGTCG-30

Construction of plasmid vectors to generate

recombinant retroviruses overexpressing a miRNA

Cell lines overexpressing miR-424*, miR-720, and miR-

663B were constructed by infecting U937 cells with

recombinant retrovirus vectors containing pre-miR-424*,

pre-miR-720, and pre-miR-663B sequences under control

of the CMV promoter, respectively. Each of the pre-miR-

NAs was amplified by PCR with U937 genomic DNA and

a specific primer pair described below. An amplified DNA

fragment was cloned into the XhoI site and the XbaI site in

pRetroQ-AcGFP1-N1 (Takara Bio Inc., Otsu, Japan) so

that the pre-miRNA could be transcribed by the CMV

promoter.

For the pre-miR-424* sequence, the following primer

set was used to amplify a 652 bp DNA fragment:

50-GACCTCGAGTTAACTTGGAGTGAAGTGGCCTA

GTC-30 (XhoI site is underlined)

50-ACATCTAGAATTCACGTCCAGTCACATATGCA

GAG-30 (XbaI site is underlined).


123

For the pre-miR-720 sequence, the following primer set

was used to amplify a 394-bp DNA fragment:

50-GACCTCGAGATCTGCTCTCCTCTGGAAGACGG

TC-30 (XhoI site is underlined)

50-ACATCTAGATGGAACTGTTTACTTTCCTGTAAC

C-30 (XbaI site is underlined).

For the pre-miR-663B sequence, the following primer

set was used to amplify a 372-bp DNA fragment:

50-GACCTCGAGGGAGGATGGATGAGAAACGAGC

AAC-30 (XhoI site is underlined)

50-ACATCTAGAACCACAGCCTAAGGCGGTGAGCC

GC-30 (XbaI site is underlined).

Transient transfection

Constructed plasmid vectors were transfected using the

Effecten reagent (QIAGEN Inc.) according to the manu-

facturer’s instructions. One and a half million cells were

washed once with prewarmed RPMI 1640 and resuspended

with 1.5 ml of the medium. An Effecten complex con-

taining 1.0 of a plasmid vector and, in some cases, 10 ng of

phRL-TK (Promega Corp.) was added to each dish. The

cells were harvested and resuspended with 5 ml of pre-

warmed RPMI 1640 medium after incubation at 37 �C for

more than 4 h and then re-incubated at 37 �C overnight. A

35-mm cell culture dish was seeded with 3.0 9 105 of the

incubated cells in 2 ml of prewarmed RPMI 1640 and then

subjected to sonication.

Recombinant retrovirus production and infection

One million AmphoPack293 cells (Takara Bio Inc.) were

seeded onto a 60-mm collagen-coated cell culture dish, and

the following day they were transfected using the CalP-

hosTM Mammalian Transfection Kit (Takara Bio Inc.)

with 10 lg of each of the constructed retrovirus-generating

vectors. The virus-containing conditioned medium was

collected 48 h after transfection and passed through a 0.45-

lm filter to remove debris. Polybrene (Sigma-Aldrich Inc.,

St. Louis, MO, USA) was added to the filtered medium at a

final concentration of 7.0 lg/ml. This prepared solution

was used as a virus source to infect 1 9 106 U937 cells.

Infected cells were concentrated by puromycin treatment at

2.0 lg/ml, to which infected cells were resistant, to

establish a stably transfected cell line.

Dual luciferase assay

At various times after sonication, cells were centrifuged,

and 300 ll of passive lysis buffer from the Dual Luciferase

Assay Kit (Promega Corp.) was added to lyse the cells after

the supernatant was removed. Cells were incubated at room

temperature for 15 min. A volume of 10 ll of cell lysate

supernatant was mixed with 50 ll of luciferase assay reagent

II from the kit to measure the luminescence generated by the

firefly luciferase, and immediately after that 50 ll of Stop &

Glow reagent from the kit was added to the mixture to measure

luminescence generated by the renilla luciferase expressed

from phRL-TK or pmrGlo. The amount of luciferase gene

expression was determined relative luminescence units

(RLU), where the value of luminescence of the firefly lucif-

erase was divided by that of the renilla luciferase expressed in

the same lysate. An increase or decrease in the luciferase

expression was expressed as fold activity, where the RLU

value of a sample from treated cells was divided by that of an

identically prepared sample without treatment.

Nucleotide sequence analyses

For confirmation of constructed plasmids, nucleotide

sequence analyses were conducted by the cycle sequence

PCR method using a Big Dye Terminator Cycle Sequencing

Ready Reaction Kit (Applied Biosystems, Foster City, CA,

USA) with pairs of appropriate primers. Briefly, a DNA

sequencing mixture containing 3.2 pmol each of a pair of

primer oligonucleotides, 500 ng of template plasmid vector

DNA, and 8 ll of premix from the kit was subjected to the

PCR reaction using a Gene Amp PCR System 9700

(Applied Biosystems). Purified reaction product was sub-

jected to 4 % polyacrylamide gel electrophoresis for

nucleotide sequencing (ABI PRISM DNA Sequencer 377,

PerkinElmer Life and Analytical Sciences, Boston, MA,

USA).

Statistical analysis

All values are expressed as means ± standard deviations.

Differences were assessed with Student’s unpaired t test.

For comparison of more than two groups, one-way analysis

of variance (ANOVA) was used. Statistical significance

was established at a value of P \ 0.05.

Results

Microarray and real-time PCR analyses of miRNA

expression in U937 cells affected by sonication

Analysis was done with total RNA extracted from U937

cells 4 h after sonication with 1-MHz ultrasound at 0.4 W/

cm2 and 10 % DF for 60 s. The change in the miRNA

expression pattern was obvious. There were four miRNAs

in which it increased to more than three times and two

miRNAs in which it decreased to less than half (Table 1).


123

Considering change rates and expression values, we then

subjected five or four miRNAs in which expression increased

or decreased in response to sonication to real-time PCR

analyses for time course analyses, respectively. As shown in

Fig. 1, though tendencies observed with the microarray

analysis were confirmed, actual values of miRNA expression

change rates were different in some cases. For instance, miR-

424* decreased to 0.4 times that observed without sonication

4 h after sonication in microarray analysis, but 0.7 times in

real-time PCR experiments. In addition, miR-663B increased

up to 6.3 times that observed without sonication 4 h after

sonication in microarray analysis, but more than 10 times in

real-time PCR experiments. One possible reason may be

attributable to the differences in data standardization. We

used GAPDH mRNA expression as a reference for stan-

dardizing samples for real-time PCR, while for microarray

analysis they employed quantile normalization for their data

standardization process. Although the effects of stimulation

on expression of GAPDH are supposed to be minimal and

quantile normalization would be countable, subtle differ-

ences cannot be completely excluded.

In cases where miRNA expression increased after son-

ication, it responded rapidly and all the examined miRNAs

reached their peak at 4 h after sonication. On the other

hand, in cases where miRNA expression decreased after

sonication, there were differences in the timing of reaching

the bottom. Though we observed only a few samples and

the causations are unknown, it would be interesting if this

phenomenon might be involved in the features of cellular

responses to sonication.

Establishing cell lines overexpressing miRNAs

or expressing tough decoy RNAs, and their effects

on sonication-induced apoptosis

Among the miRNAs analyzed by real-time PCR, we took

miR-424* and miR-720 as representatives of miRNAs

Table 1 Ultrasound induced expression changes of miRNAs in U937

cells

miRNAa Change

ratio

Relative expression

value (without sonication)

hsa-miR-424* 0.43 68.01

hsa-miR-720 0.48 270.99

hsa-miR-1244 0.54 100.86

hsa-miR-665 0.58 36.18

hsa-let-7f 0.61 94.64

hsa-miR-1301 0.64 83.27

hsa-miR-92a-1* 0.64 217.28

hsa-miR-335 0.65 26.40

hsa-miR-296-5p 0.66 28.49

hsa-miR-181a* 0.67 47.91

hsa-miR-663 6.69 24.93

hsa-miR-1246 3.90 17.13

hsa-miR-663b 3.30 14.22

hsa-miR-1308 3.18 143.15

hsa-miR-923 2.47 879.45

hsa-miR-149* 2.47 202.35

hsa-miR-638 2.42 163.32

hsa-miR-18b 1.82 45.52

hsa-miR-339-3p 1.71 31.66

hsa-miR-92b* 1.64 24.86

a The listed miRNAs showed significant expression in the relative

expression value in at least one of the before and after sonications

Fig. 1 miRNA expression affected by sonication. U937 cells were

sonicated with 1-MHz ultrasound at 0.4 W/cm2 and 10 % DF for

60 s. Total RNA was extracted at 0, 4, 12, and 24 h after sonication,

and cDNAs were synthesized for real-time PCR reactions. a MiRNAs

whose expression increased by sonication were subjected to real-time

PCR for time course experiments. Error bars are standard deviations

(n = 3). Closed circle miR-663B, closed square miR-638, closedtriangle miR-663, closed rhomboid miR-1308, cross mark miR-1246.

b miRNAs whose expression decreased by sonication were subjected

to real-time PCR for time course experiments. Error bars are standard

deviations (n = 3). Closed circle miR-720, closed square miR-424*,

closed triangle let-7f, cross mark miR-1244


123

whose expression decreased as a result of sonication.

Likewise, we took miR-663B and miR-663 as representa-

tives of miRNAs whose expression increased as a result of

sonication.

First, we established a cell line overexpressing either

miR-424* or miR-720 to cancel out the effects of their

decreased expression due to sonication. A genomic region

containing each of the pre-miRNAs was cloned under

control of the CMV promoter of pRetroQ-AcGFP1-N1.

They were introduced into packaging cells, and generated

recombinant virions were collected and infected to U937

cells to establish overexpression cell lines. They were

designated as U937/oe424* for the cell line overexpressing

miR-424* and as U937/oe720 for the cell line over-

expressing miR-720. Total RNAs were extracted out of

these cell lines and subjected to real-time PCR analyses. As

shown in Fig. 2a, U937/oe424* and U937/oe720 expres-

sion was about three times more than that of their parental

cell line.

Second, we established a cell line expressing a tough

decoy RNA against miR-663 or miR-663 B that increased

in response to sonication. A tough decoy RNA is an RNA

whose conformation presents two complimentary sequen-

ces to a miRNA and interferes with the functions of the

miRNA by competitively inhibiting its binding to target

sequences on mRNAs. Tough decoy RNAs against miR-

663 and miR-663B would cancel out functions of the

miRNAs whose expression increased after sonication.

Synthetic DNAs coding for tough decoy RNAs against

miR-663 and miR-663B were cloned under control of the

U6 promoter of pSIREN-RetroQ. Recombinant virions

were collected from transduced packaging cells with con-

structed retrovirus-generating vectors, and then they were

infected to U937 cells to establish cell lines expressing

tough decoy RNAs. They were designated U937/TD663 for

the cell line expressing a tough decoy against miR-663 and

as U937/TD663B for the cell line expressing a tough decoy

against miR-663B. We then constructed plasmid vectors

containing multiple copies of complimentary sequences to

miR-663 and miR-663B in 30 UTR of the luciferase gene in

pmirGLO to construct pmirGLO/663 and pmirGLO/663B,

respectively. To confirm the effect of tough decoy

expression, pmirGLO/663 was introduced into U937/

TD663 and pmirGLO/663B into U937/TD663B, and the

transfected cell lines were subjected to dual luciferase

assay 12 h after sonication. As shown in Fig. 2b, when

pmirGLO/663B and pmirGLO/663 were introduced into

the parental cell line, sonication decreased luciferase

activities to about 20 and 25 %, respectively. However,

when pmirGLO/663 was introduced into U937/TD663 and

pmirGLO/663B was introduced into U937/663B, sonica-

tion did not decrease the luciferase activities, but rather

increased them about 50 % as compared with those without

sonication. These results suggest that tough decoy RNAs

were expressed in the established cell lines and that they

successfully inhibited functions of miRNA-663 and miR-

663B. Thus, in these cell lines, it was expected that the

effects of increased miR-663 and miR-663B expression as

a result of sonication were counteracted by the tough decoy

RNAs.

We then sonicated all of the established cell lines and

measured their apoptosis expression. Cells were collected

and subjected to DNA fragmentation assay 12 h after

sonication with 1-MHz ultrasound at 0.4 W/cm2 and 10 %

DF for 60 s. In the case of the parental U937 cell line,

without sonication, the ratio of DNA fragmentation was

Fig. 2 Establishment of engineered cell lines. a U937 cells were

stably transfected with a recombinant retrovirus to express a pre-

miRNA, establishing an overexpression cell line. Overexpression of

miRNAs was confirmed by real-time PCR using specific primers for

miR-663B, miR-720, and miR-424*. Error bars are standard

deviations (n = 3). All miRNA expression was statistically signifi-

cant compared with that of the parental cell line. b U937 cells were

stably transfected with a recombinant retrovirus to express a tough

decoy RNA against miR-663 or miR-663B, establishing a function

inhibition cell line. Inhibition of miRNA functions was confirmed by

reporter assays with vectors containing the luciferase gene carrying

target sequences in the 30 UTR and the renilla luciferase gene. The

vectors were introduced into engineered cell lines and subjected to

dual luciferase assay 12 h after sonication. Error bars are standard

deviations (n = 3). Cont pmirGLO, 663 pmirGLO/663, 663B pmir-

GLO/663B, Parent wild type U937


123

8.5 %, and it increased to 11.3 % 12 h after sonication

(increasing ratio was 1.3). Newly established cell lines

were similarly sonicated, and DNA fragmentations were

analyzed. As shown in Fig. 3a, U937/oe424* and U937/

oe720 showed lower increasing ratios relative to the

parental cell line, though they were not significant

(increasing ratios were 1.3 (p = 0.56) and 1.2 (p = 0.58),

respectively). The tough decoy strains showed higher

increasing ratios. U937/TD663 showed an increasing ratio

of 1.6 though it was not significant (p = 0.67). U937/

TD663B showed an increasing ratio of 1.8 that was sig-

nificant (p = 0.02), suggesting that miRNA could be

involved in the cellular responses to sonication stimulation.

Speculation and examination of possible target genes

We then looked into potential target genes of miR-663B by

consulting TargetScan (http://www.targetscan.org/vert_50/,

Release 5.2, June, 2011). Eighty genes were listed as

conserved target genes. Among them, there were genes

relating to regulation of apoptosis including KSR2 (kinase

suppressor of ras 2), CREBZF (CREB/ATF bZIP tran-

scription factor), MAP3K9 (mitogen-activated protein

kinase kinase kinase 9), and PAK6 (p21 protein (Cdc42/

Rac)-activated kinase 6), etc. We suppose that the corre-

sponding targets are directly affected by miR-663B, since

inhibition of miR-663B functions resulted in an increase in

sonication-induced apoptosis, as observed in U937/

TD663B cells, and this would be caused by releasing

suppression of gene expression for inducing apoptosis.

Thus, genes including KSR2 and CREBZF were candidate

target genes involved in the increase in sonication-induced

apoptosis in U937/TD663B. To confirm the possibility, we

cloned DNA fragments containing target sequences in the

30 UTRs of KSR2 and CREBZF into the 30 UTR of the

luciferase gene in pmirGLO, constructing pmirGLO/KSR

and pmirGLO/CREBZF, respectively.

To see if the genes were actual targets of miR-663B, these

vectors were introduced into U937 cells overexpressing miR-

663B designated as U937/oe663B that was constructed sim-

ilarly to U937/oe424* and U937/oe720, as described in

Materials and Methods. Twenty-four hours and 48 h after

transfection, cells were subjected to dual luciferase assay

experiments. As shown in Fig. 3b, U937/oe663B cell lysate

transfected with pmirGLO/CREBZF showed luciferase

activities that were about 60 and 38 % of those expressed by

pmirGLO 24 and 48 h after transfection, respectively. U937/

oe663B cell lysate transfected with pmirGLO/KSR also

showed luciferase activities that were about 64 and 57 % of

those expressed by pmirGLO 24 and 48 h after transfection,

respectively. Therefore, these genes could be suppressed by

miR-663B that increased after sonication. In other words,

since the suppression of these genes by increased miR-663B

expression may be released by the tough decoy RNA against

miR-663B, it can be presumed that the functions of the genes

involve apoptosis induction.

Discussion

In this study, it was shown that miRNA expression was

affected by sonication stimulation in U937 cells. In addi-

tion, it was suggested that at least one of the miRNAs

whose expression was affected by sonication was involved

in gene expression changes for cellular responses to soni-

cation stimulation.

Sonication conditions are critical to determine the kind

of bio-effects ultrasound can induce. In this study, we

Fig. 3 Identification of miRNA involved in sonication-induced

apoptosis and its potential target genes. a Engineered cell lines

cancelling out the effects of miRNA expression changes caused by

sonication were exposed to sonication. Apoptosis ratios of those with

sonication to those without sonication were plotted. Error bars are

standard deviations (n = 3). Parent wild type U937, oe720 U937/

oe720, oe424* U937/oe424*, TD663 U937/TD663, TD663B U937/

TD663B. b Potential target genes of miR-663B were examined by

reporter assay with the luciferase gene containing target sequences in

30 UTR of candidate genes in U937 cells overexpressing miR-663B.

For evaluation, dual luciferase assay was performed 24 and 48 h after

transfection. Error bars are standard deviations (n = 3). Black barsfold activity at 24 h after transfection, gray bars fold activity at 48 h

after transfection


123

http://www.targetscan.org/vert_50/

employed a condition that could induce apoptosis in U937

cells. Sonication-induced apoptosis was shown to be rela-

ted to oxidative stress and to be suppressed in the presence

of anti-oxidants [18]. Thus, the change in miRNA

expression shown in this study may be involved in oxida-

tive stress. In 2009, Simon et al. [19] reported changes in

miRNA expression under oxidative stress conditions.

However, miRNAs whose expression was affected in this

study have almost no commonality with those found by

Simon et al. presumably due to differences in cell origin. In

addition, the complexity of cell stimulation caused by

sonication might also be involved.

In this study, we have only identified miR-663B as a

potential regulator for sonication-induced apoptosis. There

were other miRNAs whose expression was affected by

sonication and might be involved in other cellular respon-

ses. In addition, when we compared DNA fragmentation

ratios of newly established cell lines without sonication, it

was shown that only that of U937/oe720 was found to be

significantly increased (11.1 %, p = 0.017 vs. the parental

U937 without US). In other words, an increase in miR-720

expression could induce apoptosis in U937 cells. However,

it is unclear whether the decrease in miR-720 expression

caused by sonication could inhibit apoptosis or whether

artificial overexpression of miR-720 could lead to an

adverse effect on cells, such as apoptosis induction. Thus, it

remains unknown whether or not this miRNA could

be involved in cellular responses to sonication-induced

apoptosis.

In this study, we showed that miRNA expression in U937

cells was affected by ultrasound stimulation. However, we

believe that many other cell lines would also change their gene

expression profiles in response to sonication through miRNA

expression changes. In fact, we have observed miRNA expres-

sionchanges in HeLacells in response to sonication, although we

failed to detect apoptosis under similar sonication conditions.

It remains unknown whether in vivo sonication will

result in changes in the miRNA expression profile of

sonicated tissue. However, a similar phenomenon would

also most likely happen based upon a report that miRNA

expression changes played an integral role of a variety of

gene regulation networks including those that are responses

to stimulation. But one should consider the many aspects

that are significantly different from the in vitro situation.

In vivo, several biological and biochemical factors would

be available to a particular target tissue from the host,

including growth factors, cytokines, and hormones. In

addition, the way ultrasound energy is delivered to the

target tissue in vivo may significantly differ from that in

vitro. All these factors could significantly affect the

expression of miRNAs. Therefore, the type of miRNA and

the timing and degree of changes in its expression in vivo

may all be different from those of in vitro.

Applications of ultrasound for disease treatments have

progressed notably, such as HIFU, which is already in

practical use [20], and sonodynamic therapy, which is still

in the research stage [21]. In addition, there are other

examples including applications for hyperthermia using

heat generated by sonication and for gene therapy with

expression control using mechanical, chemical, or heat

stress caused by sonication [22–24]. Since sonication exerts

many kinds of bio-effects at the same time, in the case of

sonication therapy utilizing heat, other types of stresses

caused by sonication should be considered. For example, in

the case of HIFU, which is an ablation therapy for cancer,

surviving cells in the vicinity of the HIFU-treated region are

most likely to be affected by some other stresses in addition

to heat generated by sonication. Thus, such cells undergo

change in the gene expression profile and presumably

miRNAs would be involved in it, considering the results

obtained in this study. Therefore, it may be possible to

specifically augment or suppress cellular responses to bio-

effects caused by sonication by controlling a miRNA whose

expression is affected by sonication. It is not a difficult task

to determine which miRNA is affected significantly in such

cases. It is known that a miRNA regulates the expression of

many genes simultaneously. It might be a strong weapon to

control surviving cancer cells from sonication treatment if one

could take advantage of its unique property, further improving

therapies with ultrasound.

In this study, we showed that suppression of miR-663B

functions increased sonication-induced apoptosis, suggest-

ing that this miRNA could be used for modifying sonica-

tion-induced apoptosis. MiRNAs may further improve

disease therapies with ultrasound, although more studies

are still needed before a strong clinical significance for this

finding can be pronounced.

Conclusion

It was shown that miRNA expression could be affected by

sonication and that such a miRNA could be involved in

cellular responses to sonication, unveiling more complex

cellular responses to ultrasound.

Acknowledgments This research was supported by the Research

and Development Committee Program of The Japan Society of

Ultrasonics in Medicine. The authors thank Drs. Loreto B. Feril, Jr.,

and Go Kagiya for their critical reading of the manuscript.

References

1. Suslick KS. Sonochemistry. Science. 1990;247:1439–45.

2. Riesz P, Kondo T. Free radical formation induced by ultrasound

and its biological implications. Free Radic Biol Med. 1992;13:

247–70.


123

3. Lagos-Quintana M, Rauhut R, Lendeckel W, et al. Identification

of novel genes coding for small expressed RNAs. Science.

2001;294:853.

4. Lee RC, Ambros V. An extensive class of small RNAs in Cae-norhabditis elegans. Science. 2001;294:797.

5. Farazi TA, Juranek SA, Tuschl T. The growing catalog of small

RNAs and their association with distinct Argonaute/Piwi family

members. Development. 2008;135:1201–4.

6. Stefani G, Slack FJ. Small non-coding RNAs in animal devel-

opment. Nat Rev Mol Cell Biol. 2008;9:219–30.

7. Oh JS, Kim JJ, Byun JY, et al. Lin28-let7 modulates radiosen-

sitivity of human cancer cells with activation of K-Ras. Int J

Radiat Oncol Biol Phys. 2010;76:5–8.

8. Wilmink GJ, Roth CL, Ibey BL, et al. Identification of microR-

NAs associated with hyperthermia-induced cellular stress

response. Cell Stress Chaperones. 2010;15:1027–38.

9. Fornari F, Gramantieri L, Giovannini C, et al. MiR-122/cyclin G1

interaction modulates p53 activity and affects doxorubicin sen-

sitivity of human hepatocarcinoma cells. Cancer Res. 2009;69:

5761–7.

10. Kulshreshtha R, Ferracin M, Wojcik SE, et al. A microRNA

signature of hypoxia. Mol Cell Biol. 2007;27:1859–67.

11. Tabuchi Y, Kondo T, Ogawa R, et al. DNA microarray analyses

of genes elicited by ultrasound in human U937 cells. Biochem

Biophys Res Commun. 2002;290:498–503.

12. Abdollahi A, Domhan S, Jenne JW, et al. Apoptosis signals in

lymphoblasts induced by focused ultrasound. FASEB J. 2004;18:

1413–4.

13. Ashush H, Rozenszajn LA, Blass M, et al. Apoptosis induction of

human myeloid leukemic cells by ultrasound exposure. Cancer

Res. 2000;60:1014–20.

14. Sambrook J, Russell DW. Molecular cloning: a laboratory man-

ual. 3rd ed. Cold Spring Harbor: Cold Spring Harbor Laboratory

Press; 2001.

15. Sellins KS, Cohen JJ. Nuclear changes in the cytotoxic T lympho-

cyte-induced model of apoptosis. Immunol Rev. 1995;146:241–66.

16. Haraguchi T, Ozaki Y, Iba H. Vectors expressing efficient RNA

decoys achieve the long-term suppression of specific microRNA

activity in mammalian cells. Nucleic Acids Res. 2009;37:e43.

17. Ebert MS, Sharp PA. MicroRNA sponges: progress and possi-

bilities. RNA. 2010;16:2043–50.

18. Honda H, Kondo T, Zhao QL. Role of intracellular calcium ions

and reactive oxygen species in apoptosis induced by ultrasound.

Ultrasound Med Biol. 2004;30:683–92.

19. Simone NL, Soule BP, Ly D, et al. Ionizing radiation-induced

oxidative stress alters miRNA expression. PLoS ONE. 2009;4:

e6377.

20. Mason TJ. Therapeutic ultrasound an overview. Ultrason Sono-

chem. 2011;18:847–52.

21. Rosenthal I, Sostaric JZ, Riesz P. Sonodynamic therapy—a

review of the synergistic effects of drugs and ultrasound. Ultrason

Sonochem. 2004;11:349–63.

22. Ogawa R, Lee SI, Izumi H, et al. Enhancement of artificial

promoter activity by ultrasound-induced oxidative stress. Ultra-

son Sonochem. 2009;16:379–86.

23. Watanabe A, Kakutani S, Ogawa R, et al. Construction of arti-

ficial promoters sensitively responsive to sonication. J Med

Ultrason. 2009;36:9–17.

24. Eker OF, Quesson B, Rome C, et al. Combination of cell delivery

and thermoinducible transcription for in vivo spatiotemporal

control of gene expression: a feasibility study. Radiology. 2011;

258:496–504.


123

ultrasound stimulation induces microrna expression changes that could be involved in...

Documents