undergraduate dissertation: construction of growth defective mutant strains of enterococcus faecium

7/29/2019 Undergraduate Dissertation: Construction of growth defective mutant strains of Enterococcus faecium

http://slidepdf.com/reader/full/undergraduate-dissertation-construction-of-growth-defective-mutant-strains 1/48

of 48

Construction of growthdefective mutant strains of

Enterococcus faecium

BIOC3002 Research Project

Michael [email protected]

Supervisor: Dr. Sean Nair



of 48

DECLARATIONOFOWNERSHIP

BIOC3003/27 / BIOL3004/3005 Academic Year 2009-2010

This submission is a result of my own work.

All help and advice, other than that received by tutors, has been acknowledged, and primary and secondary sources of information have been properly attributed.

Should this statement prove to be untrue, I recognise the right of the Board of Examinersto recommend what action should be taken in line with the University’s regulations.

I acknowledge that the Biological Sciences and Molecular Biosciences use the Turn ItIn® plagiarism detection system and that my work may be submitted to Turn It In®.

Name in block capitals ____________________________________

Signed _________________________________________________

Dated __________________________________________________



of 48

TableofContents:

Abbreviations...................................................................................... 4

Abstract .............................................................................................. 5

Introduction......................................................................................... 6

Material and Methods....................................................................... 15

Results ............................................................................................. 23

Discussion and Future Directions..................................................... 42

References ....................................................................................... 47



of 48

Abbreviations

KAN – Kanamycin

ERY – Erythromycin

MIC – Minimum Inhibitory Concentration

BHI – Brain Heart Infusion

BHA – Brain Heart Infusion (3.7%w/v) + Agar (1.2%w/v)

THB – Todd-Hewitt Broth

NaCl – Sodium Chloride

O/N – Overnight Culture

ATc – Anhydrotetracycline

PBS -- Phosphate Buffer Saline

PCR -- Polymerase Chain Reaction

dNTPs -- Deoxynucleotide triphosphates



of 48

Abstract

Enterococcus faecium is currently one of the primary causes of nosocomial

infectionsi and has become a major burden to hospitals, due to the development

of resistance against the antimicrobials and antibiotics used to treat these

infectionsii. Research is now being directed at identifying new treatments and

approaches to prevent Enterococcal infections by using various genetic tools to

locate and identify genes that help develop and provide resistance to E. faecium.

In this study transposon mutagenesis was used to construct a library of random

mutants, which were screened for specific phenotypes such as loss of antibiotic

resistance or inability to grow on certain media incorporating stressors

encountered by the bacterium. The transposon delivery vector used in this study

was a mariner-based transposon system carried on two different plasmids, which

were introduced into the E. faecium strain E1162 via electroporation. A

transposition procedure was utilised to induce transposon mutagenesis. Once a

mutant had been identified attempts were made to locate the affected gene via

different gene amplification processes for potential sequencing and further

research. Several other experiments such as producing growth curves for E.

faecium different media and determining minimal inhibitory concentrations of

different antimicrobial agents were also carried out, to learn more about the

bacterium Enterococcus faecium.



of 48

Introduction

Enterococci were once thought to be harmless commensal bacteria found as

members of the human intestinal flora, which only very rarely showed any

pathogenic effectsiii. Today the species E. faecalis and E. faecium of the gram-

positive Enterococcus genus are emerging as two of the major causes of

nosocomial infections. Enterococci were first described and investigated at the

end of the 19th centuryiv, and have since become a source of major concern due

to the increase is the number of infections recorded and their ability to develop

different antimicrobial and antibiotic resistancesv. The discovery of a rise in

ampicillin and vancomycin resistant strains of E. faeciumvi, correlated with an

increase in nosocomial E. faecium infections recorded in hospitals throughout the

US and Europe. Enterococcal infections occur in the urinary tract and intra-

abdominal cavityvii but may also cause endocarditis, meningitis and sepsisviii in

patients with prolonged antibiotic treatment, long periods of hospitalisation and/or

weakened immune systems. The main treatment method to date has been the

use of different antibiotics, but treatments vary in their effectiveness due to

antibiotic resistance interfering with synergic therapy.

Naturally the main aim of research in this area should be to try and discover new

treatment methods against these infections, but before this can be achieved one

must first understand how E. faecium grows, survives and why it is pathogenic.

One way of achieving this is to identify specific genes, which allow certain strains



of 48

of E. faecium to grow and survive in demanding environments, but also which

genes allow them to develop antibiotic resistance. Once these genes have been

identified, further research can be focused on how the gene operates, what it

encodes and if the gene or its products can be an affective target for treatment.

There are many different methods, which can be used to investigate the role of

certain genes in an organism. The technique used in this study is known as

transposon mutagenesis. Class II Transposons are sequences of DNA, which

are able to ‘jump’ from one location to another by using a ‘cut and paste’

mechanism thanks to the enzyme transposase. In the simplest cases only two

vital structures are needed for transposition, short inverted terminal repeats

(ITRs) found at either end of a DNA sequence and a functional tpase gene. The

expression of tpase leads to the production of the transposase enzyme, which

has the ability to target, cut and ligate sequences of DNA. It functions by

recognising the ITRs, cutting and then binding both ends of the transposon to

form a ‘loop structure’. This allows the whole transposon to migrate to a different

location (e.g. different gene or chromosome), where transposase cuts the

insertion site to form staggered ends so the transposon can be inserted (‘paste’)

and ligated to the target DNA. This mechanism is found naturally in many

different organisms (including humans) and acts as a way to form genetic

variation, but has also been adopted and modified for use in research as a

genetic tool known as transposon mutagenesis.



of 48

The idea is that transposons can be used to rapidly create a large library of

different mutants, where the transposon is cut from its original location and

inserted randomly into the host genome, causing mutations to host genes.

Mutants can then be investigated and screened for a certain growth defect or

phenotype (e.g. loss of antibiotic resistance). Due to the structure of transposons,

they can be genetically modified to carry small genes (e.g. in this study an

erythromycin resistance gene: ermC ), which can act as a selective marker for

artificial selection.

Different transposons have been used in different studies depending on their

overall goal and type of organism in question. In this study the transposon should

preferentially have a high rate of transposition, insertions should occur at random

(no bias towards certain sequences) to increase the chances of different mutants

and a high frequency of single insertions. Single insertions are important

because the process of determining which single gene mutation is responsible

for the change in phenotype is more straightforward. If there were a host of

random insertions into various gene loci it would be could become very

complicated to try and identify, which gene corresponds to which phenotype. For

these reasons the Himar1 mariner transposon delivery system integrated into

plasmids pMC38 and pMC39ix, was selected as a foundation. However in this

study several important genetic modifications to the before mentioned

transposon delivery vectors (pMC38/39) have been made. Plasmids pPZ4 and

pPZ114-5 (Zhang P., 2009, Eastman Dental Institute) are derivatives of pMC38,



of 48

but expression of the tpase gene is now regulated by the anhydrotetracycline

(ATc) inducible Pxyl/tetO promoter from pKOR1x, consisting of a xyl promoter

and tet operator regulated by the Tet repressor. Point mutations to pPZ4’s

promoter have been used to prevent basal expression and increase ATc

selectivity to produce the vector pPZ114-5. Based on previous studies different

concentrations of ATc have to be used for different bacteria, due to the inhibitory

effect ATc has on bacterial growth. An excessive amount of ATc may increase

the level of transposon mutagenesis but no colonies will grow. On the other hand

too little ATc may not produce the desired rate of transposon mutagenesis, so a

balance has to be established between tpase expression and inhibiting E.

faecium growth.

Figure 1: Physical map of plasmid pPZ4/pP114-5 containing the transposon element (adapted

from Cao, et al., 2007).

pPZ4/pPZ114-5



of 48

After transposon mutagenesis has taken place and a mutant strain has been

found, the number and loci of transposon inserts must be identified so the

mutated gene can be sequenced for further research. Two different methods

were used in this study, both using the polymerase chain reaction (PCR) to

amplify the transposon flanking sequences. The transposon number and location

can be determined by amplifying the DNA sequences either side of the

transposon rather than actually amplifying the transposon allows, which only

shows if there is a transposon present in the host genome. The first method

(Kwon YM and Ricke SC, 2000) requires a ligation step before the amplification

step, where ‘Y linkers’ are ligated to fragmented genomic DNA. The

endonuclease used in this study was Taq1α because it will frequently cut due to

its common recognition site, however it is known that Taq1α does not any part of

the transposon sequence. The Y linkers have a 3’ overhang and a non-

complementary sequence on the opposite strand at the 5’ regionxi to prevent the

linker annealing with itself. The Y linker primer used to amplify the transposon

flanking sequences consists of this region of DNA, which means that the primer

cannot actually anneal to the linker at first. A transposon specific primer (Tn) is

used to select for sequences of DNA, which have the transposon sequence. This

means that in the first cycle of PCR the only fragments containing the transposon

will be amplified and DNA synthesis occurs from the end region of the of the

transposon until the end of the Y linker regions, allowing the Y linker primer to

bind to the newly synthesised region, since the Y linker primer is complementary

to the extended sequence. In the second cycle, DNA synthesis takes place from



of 48

the Y linker primer to where the transposon specific primer, producing dsDNA of

the transposon flanking sequences. The advantage of using this method is that

many different independent transposon-flanking sequences can be amplified

from a mutant. The different steps involved in this protocol are summarised in the

figure below (Figure 2).

Figure 2: Figure shows steps involved in amplifying transposon-flanking sequences using Y

linkers, Y linker primer and a transposon-specific primer (Tn). (Adapted from Kwon YM, Ricke

SC., (2000) Efficient amplification of multiple transposon-flanking sequences. J Microbiol

Methods. 2000 Aug;41(3):197.)

The second method used in this study was developed by Cao M, et al . (2007),

where a form of nested PCR (2 PCR runs, where the second round amplifies the

products from the first cycle) was used to try and identify the transposon insertion

sites by again amplifying the transposon flanking sequences. For both rounds a

combination of an arbitrary primer and a transposon specific primer was used to



of 48

amplify both ends of the fragment. The combination of different sets of primers

used is this study are shown in Figure 3 B. Arbitrary primers are oligonucleotides

synthesised to have a region with a random sequence (shown in Table 2 as N –

random nucleotide), allowing these random primers to bind at different sites on

the chromosome. These arbitrary primers point in the opposite direction to the

transposon specific primers, which means that if a combination of the two

primers are close enough together double stranded PCR product will be

synthesised. The second round of PCR is designed to only amplify the products

from the first containing transposon flanking sequences. This is achieved by

using another arbitrary primer (in this study Arb3), which consists of the same

known sequence as the arbitrary primers used in the first round (STAPHArb1 and

STAPHArb2). This means that Arb3 will most likely bind to the complementary

strands produced in the first round, which should contain the transposon flanking

sequence. The transposon specific primer points in the opposite direction to

Arb3, again allowing the amplification of double stranded PCR product, which

can be visualised by using gel electrophoresis. Through this mechanism

transposon flanking sequences are copied and amplified however this method is

thought to be not as accurate as the Y linker procedure because many products

of different lengths, which may or may not contain the transposon flanking

sequence may be produced.



of 48

A

Figure 3: A - Physical map of transposon element and transposon specific primers used to

amplify transposon-flanking sequences. (Adapted from Cao, et al., 2007). B – Different

combinations of arbitrary and transposon specific primers used in both rounds of PCR to test for

optimal results.

For selection purposes in other parts of this study it was necessary to examine

different growth properties of the species E. faecium, such as determine the

concentrations of the antibiotic kanamycin and common salt (NaCl) needed to

inhibit growth of E. faecium. The concentration at which no bacterial growth is

observed is known as the minimal inhibitory concentration. Sodium chloride

interferes with bacterial growth by increasing the osmotic stress the bacterium

has to withstandxii. Studies on other bacteria have shown that bacteria respond to

this osmotic stress by inducing the expression of genes, which result in the

synthesis of compatible solutesxiii, which protect the organism. Kanamycin on the

other hand is aminoglycoside antibiotic, which inhibits growth by interfering with

bacterial translation mechanismsxiv. The way the growth curve of E. faecium

A

B



of 48

E1162 changed in different media was also studied and the two types of media

used were BHI broth and BHI + NaCl broth.

The main aim of this study was to create a library of E. faecium E1162 mutants

using transposon mutagenesis via the Himar1 mariner transposon delivery

system, where mutants were screened for any growth defects or phenotypes on

specific growth media (e.g. BHA+NaCl) and loss of specific antimicrobial

resistance (e.g. kanamycin). Once a growth defect had been identified, attempts

were made to locate and sequence the non-functioning or mutated gene in the

mutant for use in further research.



of 48

MaterialandMethods

Bacterial strains, plasmids, and growth conditions

The strain of Enterococcus faecium used in this study was E1162, grown in

either brain heart infusion (3.7%w/v; Oxoid) or Todd-Hewitt (3.64%w/v; Oxoid)

broth or agar (1.2%w/v; Fluka Analytical) at 30°C, unless stated otherwise. The

antibiotics, kanamycin (Melford K0126) and erythromycin (Sigma-Aldrich E5389)

were used at concentrations of 1mg/ml and 40µg/ml respectively, unless stated

otherwise. The growth of Enterococci was determined by measuring the optical

density at 600nm (OD600) using 1ml cuvettes in a PharmaciaBiotech Ultraspec

2000 spectrophotometer.

Table 1: Bacterial Strains and Plasmids used in this study.

Strain / Plasmid Relevant Characteristics Reference

E. coli DH5α Cloning host Lab Stock, UCLEastman Dental Institute

E. faecium E1162 Clinical isolate of the epidemic clonal complex 17 Heikens, et al., 2008

pPZ4 pM38 derivative, promoter replaced with Pxyl/tetO

promoter from pKOR1

P. Zhang, Unpub., UCL

Eastman Dental Institute

pPZ114-5 pPZ4 derivative, higher ATc selectivity due to point

mutations (tagagt in -10 sequence replaced with

tataat)

P. Zhang, Unpub., UCL

Eastman Dental Institute

Plasmids used in this study were pPZ4 and pPZ114-5, derived from pMC38/39

(Cao, et al ., 2007). Both have the anhydrotetracycline (ATc) inducible promoter

Pxyl/tetO from pKOR1 (Bae and Schneewind, 2006), regulating transposase

gene expression. Point mutations (tagagt in -10 sequence replaced with tataat) in

pPZ114-5’s promoter region have been used to prevent basal expression and



of 48

increase ATc selectivity. This means that the plasmid pPZ114-5 should have

produced a higher number of mutants compared to pPZ4, which has a ‘leaky’

promoter. Plasmids were purified from E. coli DH5α cells using NBS Biologicals

Spin Column Miniprep kit according to the manufacturers protocol. To confirm

both plasmids were successfully purified, restriction enzyme digests using

endonuclease XbaI (New England BioLabs) were carried out following the

manufacturer’s protocol and the resulting fragments were separated via gel

electrophoresis and observed under UV light by using the Alphamanager (Alpha

Innotech). All gel electrophoresis procedures used a 1% agarose gel (Sigma-

Aldrich) with 0.1 µg/ml ethidium bromide, 2 µl of 1x loading buffer (0.05%

bromophenol blue, 5% glycerol in ddH2O) per sample and 1x Tris-Borate-EDTA

(TAE) buffer (40mM Tris-borate and 1mM EDTA) was applied at ~100 V and

100mA for 30 to 40 minutes. 1 Kb plus DNA ladder (Invitrogen; 10787-018) and

1kb DNA ladder (Promega; G5711) were used as a size reference.

Plasmid Electroporation into E1162

E. faecium cells were grown in THB at 37°C and once in stationary phase (no

change in OD600 at ~1.00) were spun down at 5000rpm for 15 min at 4°C using

the SORVALL RC5B PLUS centrifuge, resuspended in 10% glycerol and stored

at -70°C. Plasmids pPZ4 and pPZ114-5 were transformed into these

electrocompetent E1162 cells via electroporation using chilled 1ml cuvettes and

the BIO-RAD Gene Pulser II set at a voltage of 2.5 kV, capacitance of 2 µF and

resistance of 400-500 Ω. Pulsed cells were immediately resuspended in 1ml of



of 48

BHI broth and incubated at room temperature for 30 minutes and then spread

onto BHA + KAN (1mg/ml) + ERY (40µg/ml) plates to select for cells that had

taken up either plasmid. Plates were incubated at 30°C for 7 days due to slow

growth. To confirm either pPZ4 or pPZ114-5 had been successfully taken up, a

plasmid preparation was carried out using the NBS Biologicals Spin Column

Miniprep kit and appropriate protocol. Additional enzymes were used to

hydrolyse the E. faecium cell wall include 10µl of lysozyme (50mg/ml), 10µl of

lysostaphin (20mg/ml) and 10µl of mutanolysin (50mg/ml). The purification

products were then digested with the endonuclease XbaI and run on an agarose

gel. The fragments were visualized under UV light and compared to a positive

control (pPZ4+XbaI or pPZ114-5+XbaI).

Transposon Mutagenesis

Transposon mutagenesis was used to produce mutant strains of E. faecium

strain E1162. Different concentrations of anhydrotetracycline (ATc) were used to

induce the expression of promoter Pxyl/tetO. The transposition protocol was

adapted for E. faecium E1162 from Cao, et al. (2007) and Zhang (unpublished,

Eastman Dental Institute, 2009). E. faecium containing either pPZ4 or pPZ114-5

were inoculated into 10ml BHI broth, 40µg/ml erythromycin and 1mg/ml

kanamycin and incubated at 30°C overnight (O/N culture). The overnight cultures

were used to inoculate fresh BHI at a ratio of 1 in 100 into 15ml of BHI broth,

40µg/ml ERY and different ATc concentrations (1.0µg/ml, 1.5µg/ml and

2.0µg/ml). The culture was incubated at 30°C until the OD600 had reached 0.2



of 48

(2~3 hours) and then centrifuged at 5000rpm, using the Eppendorf centrifuge

5804R for 10 minutes at 21°C. Pellet was first resuspended in sterile PBS, spun

down again and then resuspended in BHI broth and 40µg/ml ERY. To remove

the plasmid from the cells the culture was then incubated at 45°C overnight,

since the origin of replication found in the plasmid ( pE194ts ori ) is temperature

sensitivexv. Temperatures above 37°C should prevent plasmid replication causing

a loss of the plasmids in E. faecium cells. The next day a 10-fold serial dilution

series was carried out, where different dilutions (neat to 10-9) were plated onto

BHA and BHA+ERY (40µg/ml) plates, which were incubated at 43°C overnight.

To check for plasmid retention single colonies were patched first onto BHA+KAN

(1mg/ml) and then BHA+ERY (40µg/ml) plates and incubated at 30°C overnight.

Identifying growth defective E. faecium clones

Replica plating was used to determine if any of the colonies from the

transposition showed any growth defective phenotype, when plated on

BHA+NaCl (7g of sodium chloride per 100ml of BHI broth) plates. A 10-fold

dilution series of the transposition culture was carried out with PBS and the 10-6

culture was plated out onto BHA plates and incubated at 37°C overnight. All

colonies from a BHA plate were then replicated onto a BHA+NaCl plate via the

Sigma Replica Plater. Once all plates were replicated, both BHA and BHA+NaCl

plates were incubated at 37°C overnight. Corresponding BHA and BHA+NaCl

plates were then compared to check for any colonies, which successfully grew on

the BHA plate but not on the BHA+NaCl plate.



of 48

Amplification of transposon-flanking sequences

Genomic DNA was obtained from potential growth defective mutant colonies by

using the Qiagen Pre-treatment for Gram-Positive Bacteria kit following the

corresponding protocol from DNeasy Blood/Tissue Handbook. The resulting DNA

concentration was measured by using a Nano-Drop Spectrophotometer ND-

1000. Restriction enzyme digests of genomic DNA were then carried out with the

endonuclease TaqIα (New England BioLabs) for 4 hours at 65°C. The digests

consisted of 2µl of TaqIα, 4µl of 10x NEBuffer 4 (New England Labs), 0.4µl of

100x Bovine Serum Albumin (BSA), 2.61µl of genomic DNA and 30.99µl of H2O.

Two different types of DNA amplification protocols were used in this experiment

via PCR using the Biometra T3000 ThermoCycler. All PCR products were run on

a 1% agarose gel to check for the presence of DNA.

Table 2: Oligonucleotides used in this study

Oligonucleotides Sequence Source

Y Linker 1 TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACAT Sigma-Aldrich

Y Linker 2 CGATGTCCCCGTACATCGTTAGAACTACTCGTACCATCCACAT Sigma-Aldrich

Y linker primer CTGCTCGAATTCAAGCTTCTSigma-Aldrich

Tn Primer GGAATCATTTGAAGGTTGGTASigma-Aldrich

STAPH Arb1 GGCCACGCGTCGACTAGTACNNNNNNNNNNGTAAT Sigma-Aldrich

STAPH Arb2 GGCCACGCGTCGACTAGTACNNNNNNNNNNGATCA Sigma-Aldrich

Arb3 GGCCACGCGTCGACTAGTSigma-Aldrich

Maq 255 CAGTACAATCTGCTCTGATGCCGCATAGTT Sigma-Aldrich

Maq 269 GCTCTGATAAATATGAACATGATGAGTGAT Sigma-Aldrich

Maq 256 TAGTTAAGCCAGCCCCGACACCCGCCAACA Sigma-Aldrich

Maq 270 TGTGAAATACCGCACAGATGCGAAGGGCGA Sigma-Aldrich



of 48

The first protocol devised by Kwon YM and Ricke SC (2000) required a ligation

step before amplification, where in a total volume of 20µl, 1µl of Y linker mixture

(Y linker 1 + Y linker 2) was ligated to 40ng of digested genomic DNA using 1µl

of T4 DNA ligase (New England BioLabs, 1unit/µl) and 2µl of 10x T4 DNA ligase

Buffer (New England BioLabs). The mixture was incubated at 14°C for a

minimum of 4 hours. PCR amplification mixture had a total volume of 50µl where,

5µl of 10x Taq PCR buffer (New England BioLabs), 1µl of Y linker primer

(350ng/µl), 1µl of Tn primer (350ng/µl), 3µl of a mix of dNTPs (10mM) and 2µl of

template DNA were initially incubated at 95°C for 2min. A hot-start was

performed where 1µl of Taq DNA polymerase (New England BioLabs; 5unit/µl)

was added at 80°C to prevent nonspecific primingxvi, followed by 30 DNA

amplification cycles of 95°C for 30s to denature the DNA, 58°C for 1 minute to

anneal primers to the template DNA and 70°C for 1 minute for the DNA

polymerase to extend the primers followed by an incubation at 70°C for 5

minutes.

The second DNA amplification protocol was designed by Cao et. al. (2007),

where two rounds of PCR are required. The first round had a total volume of 25µl

where 1µl of genomic DNA (~95 ng/µl), 1.25µl of either arbitrary primer (STAPH

Arb1 or STPAH Arb2), 1.25µl of either transposon primer (Maq255 or Maq 269),

0.5µl of dNTPs (5mM), 2.5µl of dimethyl sulphoxide (DMSO; Sigma-Aldrich),

0.25µl of Taq DNA polymerase (5unit/µl) and 2.5µl of 10x Taq PCR buffer was



of 48

incubated at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30s to

denature the DNA, 42°C for 45s to anneal primers to the template DNA and 72°C

for 1 minute for the DNA polymerase to extend the primers followed by a final

incubation at 72°C for 5 minutes. The second round of PCR had a total volume of

25µl where 5µl of template DNA (from 1st round), 1.25µl of arbitrary primer

(Arb3), 1.25µl of either transposon primer (Maq256 or Maq 270), 0.5µl of dNTPs

(5mM), 2.5µl of dimethyl sulphoxide (DMSO), 0.25µl of Taq DNA polymerase

(5unit/µl) and 2.5µl of 10x Taq PCR buffer were incubated at 95°C for 30s,

followed by 40 cycles of 95°C for 30s to denature the DNA, 45°C for 30s to

anneal primers to the template DNA and a final incubation at 72°C for 1 minute

for the DNA polymerase to extend the primers.

Determining Minimal Inhibitory Concentrations

Minimal inhibitory concentrations (MICs) of the antibiotic kanamycin (Sigma-

Aldrich) and sodium chloride (NaCl) for E. faecium were determined by using an

agar dilution method. Dilutions of kanamycin (32, 64, 128, 256, 512 and 1024

µg/ml) and NaCl (4, 5, 6, 7, 8, 9 and 10 g per 100ml of agar) were made in BHI

agar. Overnight cultures of E. faecium wild type E1162 (BHI+KAN+ERY) were

prepared and diluted 10-fold in sterile PBS and 50µl of the 10-6 dilution was

spread onto the agar plates with different kanamycin and NaCl concentrations,

along with BHI agar plates as a control. Plates were then incubated at 37°C for 3

days. Number and size of colonies was recorded and the lowest concentration



of 48

plates that showed no visible colony growth were established as the minimal

inhibitory concentration.

Comparative Growth Curves

The culture to be examined was prepared in a 10ml BHI broth overnight culture

at 30°C. The next day 30ml of the specific growth media (BHI or BHI+NaCl) for

each sample was pre-warmed to 37°C. 1 in 20 dilutions were made of the O/N

culture, so the OD600 could be measured using the PharmaciaBiotech Ultraspec

2000 spectrometer. Culture was then inoculated into the corresponding pre-

warmed media sample so the initial OD600 reading was ~0.01. Samples were

incubated at 37°C and the OD600 was measured at certain time intervals (0, 90,

130, 170, 210, 250, 290 and 330 minutes).



of 48

Results

Determining Minimal Inhibitory Concentrations

It was important to first determine the minimal inhibitory concentration of

kanamycin and sodium chloride for wild type E. faecium E1162, because these

two antimicrobials were used to select for specific colonies during different

stages of the study, such as the selective plating of transposition colonies or

selecting cells that have taken up the plasmids after electroporation. For these

selection processes to be effective, the MIC for both KAN and NaCl must be

known. For example the concentration of kanamycin used for selecting colonies

that have taken up the plasmid was 1mg/ml. E. faecium wild type is known to

have a certain level of natural resistance to kanamycin, so if the wild type was

able to grow in these conditions the selection process would be ineffective, since

both cells with and without plasmid would grow. By determining the concentration

at which the wild type does not grow, but colonies with the selective marker (e.g.

KAN resistance gene found on plasmid) do, selection was carried out. The MIC

of kanamycin and sodium chloride for E1162 was determined by growing E.

faecium on agar containing increasing concentrations of both antimicrobials. The

results for both kanamycin (Figure 2) and sodium chloride (Figure 3) minimal

inhibitory concentrations are shown in the following figures.



of 48

Figure 2: Average number of E1162 colonies per plate on increasing concentrations of kanamycin

after incubation at 37°C for 3 days. Error bars represent the standard deviation. 9 samples were

used for each kanamycin concentration.

Figure 3: Average number of E1162 colonies per plate on increasing concentrations of sodium

chloride (NaCl) after incubation at 37°C for 3 days. Error bars represent the standard deviation. 9

samples were used for each NaCl concentration.



of 48

The minimal inhibitory concentration is the concentration at which no E. faecium

colony growth is observed. This means that for E1162 wild type the MIC of

kanamycin is 256µg/ml and sodium chloride is 8g per 100ml of BHA. These

results can be used for example in the screening for uptake of plasmid, where

any concentration of kanamycin equal to or greater than 256µg/ml will inhibit the

growth of E1162 wild type.

Plasmid Electroporation into E1162

For transposon mutagenesis to be carried out it was necessary to introduce the

vectors carrying the transposon delivery system. Plasmids pPZ4 and pPZ114-5

were first purified from E. coli DH5α cells provided by Zhang P. (UCL Eastman

Dental Institute, 2009). Gel electrophoresis was then used to confirm that the

procedure was successful, by digesting the plasmids with the endonuclease XbaI

and comparing the resulting fragments to a positive control (pPZ4 MIDI + XbaI

provided by Wright J., UCL Eastman Dental Institute, 2010). By comparing the

fragments from the digestion products (Figure 4) with the positive control (Lane

6) I was able to confirm that the purified plasmids were pPZ4 (Lane 5) and

pPZ114-5 (Lane 4). Uncut plasmids (Lane 2 and 3) only form one band (larger

than 12,000bp), but when digested with XbaI both plasmids form 3 distinct bands

at ~5500bp, ~2200bp and ~1900bp.



of 48

The concentration of plasmid DNA was then measured using a

spectrophotometer, where the two samples of pPZ4 and pPZ114-5 had

concentrations of 43.2ng/µl and 94.3ng/µl respectively, which were more than

sufficient for use in electroporation. E1162 cells were prepared for

electroporation by using several washing steps to remove all salt residues.

Plasmids were then electroporated into these electrocompetent E1162 cells,

which were resuspended in 1ml BHI and different amounts of this (10µl, 50µl,

100µl and 200µl) were plated out onto BHA + KAN (1mg/ml) +ERY (40µg/ml)

plates. Plates were incubated at 30°C for 7 days to produce an array of plates

with different numbers of colonies. Cells that have taken up the plasmid were

thereby positively selected, since they should be able to grow on kanamycin and

erythromycin agar, due to the resistance genes found on the plasmids. Cells that

5,000 bp

2,000 bp

Figure 4: Gel electrophoresis photograph of

plasmid purification products and plasmid

digestions.

Lane 1: 1 kb Plus Ladder (Invitrogen)

Lane 2: pPZ114-5 uncut

Lane 3: pPZ4 uncut

Lane 4: pPZ114-5 + XbaI

Lane 5: pPZ4 + XbaI

Lane 6: Positive Control (pPZ4 MIDI – XbaI)

1 2 3 4 5 6



of 48

have not taken up the plasmid will not be able to grow because they lack these

resistance genes.

After the incubation a small number of colonies containing either pPZ4 or

pPZ114-5 were visible on some of the plates. Five colonies were selected at

random and prepared as overnight cultures in BHI + KAN (1mg/ml) +ERY

(40µg/ml), which were incubated at 30°C overnight. Of the five colonies, two

(named A1 and A2) were supposed to contain the plasmid pPZ4 and 3 (named

B1, B2 and B3) the plasmid pPZ114-5, however only 4 of the overnight cultures

successfully grew. Colony A1, which may have contained the plasmid pPZ4 did

not grow. To confirm if these clones had taken up either pPZ4 (A2) or pPZ114-5

(B1, B2 and B3), a plasmid preparation was carried out followed by a restriction

enzyme digest and gel electrophoresis (Figure 5).



of 48

1 2 3 4 5 6 7 8

2,000 bp

5,000 bp

10,000 bp

As shown in Figure 5, if bands from lanes 4, 6 and 8 corresponded to the bands

shown in the control (Lane 2), then the plasmids had been successfully taken up.

Only digested pPZ4 was used as a control this time since both plasmids in Figure

4 had shown identical bands. As in Figure 4 the control pPZ4 digested with XbaI

produced 3 distinct bands (~5,500bp, ~2,250bp and ~1,900bp). Lane 4, 6 and 8

should also have these bands if the electroporation was successful. Lane 4 had

the same 3 bands as the control, which means that the clone A2 contains the

plasmid pPZ4. However in addition to the three bands in the control, five other

distinct bands were visible (>10,000bp, ~7,000bp, ~2,500bp, ~1,500bp and

~1,400bp). It was possible that these bands corresponded to endogenous E.

Figure 5: Gel electrophoresis photograph of plasmid purification products and plasmid

digestions. A: potential pPZ4, B: potential pPZ114-5.

Lane 1: 1 kb Ladder (Promega) Lane 5: B1 uncut

Lane 2: pPZ4 + XbaI (control) Lane 6: B1 + XbaI

Lane 3: A2 uncut Lane 7: B2 uncut

Lane 4: A2 + XbaI Lane 8: B2 + XbaI

3,000 bp

1,500 bp



of 48

faecium plasmids, as the same bands were visible in Lane 6 and 8. Lane 6 and 8

did not show the 3 bands as in the control so both B1 and B2 clones didn’t taken

up the plasmid pPZ114-5. To check for any background plasmids in E1162 a

second plasmid preparation was carried out, on the wild type E1162, which had

not been electroporated, and another clone (B3) potentially containing pPZ114-5.

These preparations were digested with XbaI and run on an agarose gel (Figure

6).

E1162 digested with XbaI results in 4 distinct bands (~10,000bp, ~2,500bp,

~1,400bp and ~1,300bp). These bands most likely corresponded to some of the

bands seen in Lanes 4, 6 and 8 in Figure 5 and Lane 7 in this photograph, which

means that E. faecium does contain at least one background plasmid. When the

plasmid from clone B3 was digested three bands were visible as seen in the

1 2 3 4 5 6 7


plasmid purification products and plasmid

digestions. B: potential pPZ114-5

Lane 1: 1kb DNA ladder (Promega)

Lane 2: pPZ4 uncut

Lane 3: pPZ4 + XbaI

Lane 4: E1162 uncut

Lane 5: E1162 + XbaI

Lane 6: B3 uncut

Lane 7: B3 + XbaI

10,000 bp

3,000 bp

1,500 bp



of 48

control (Lane 3). This indicated that the clone B3 had retained the plasmid

pPZ114-5. Now that two clones (A2 and B3) had been identified, which contain

pPZ4 and pPZ144-5 respectively, transposon mutagenesis was carried out.

Transposon Mutagenesis and Mutant Library

For the transposon to jump the tpase gene has to be expressed, which is

regulated by the Pxyl/tetO promoter, which can be induced by certain

concentrations of ATc. Several different trials using increased levels of ATc were

carried out to see what effect this tetracycline analogue had on growth of E.

faeciumxvii. The concentrations of ATc used in the three trials were 1.0µg/ml,

1.5µg/ml and 2.0µg/ml, based on previous transposition experiments. However

based on optical density measurements and the time required for the cultures to

reach these measurements it seems that increasing ATc levels does have an

affect on E. faecium growth rate but not to the same extend as in other bacteria.

By doubling the ATc concentration from 1µg/ml to 2µg/ml the time taken for the

culture to reach an OD600 of ~0.2 did increase but only by 35 minutes (145

minutes for 1µg/ml, 156 minutes for 1.5µg/ml and 180 minutes for 2µg/ml). These

observations may be due to E. faecium having a certain level of resistance

against ATc, causing the growth rate to remain relatively stable. When plasmids

with the Pxyl/tetO promoter were used in the bacterium Staphylococcus aureus

the minimal inhibitory concentration of ATc was found to be 2µg/mlxviii, showing

that ATc has a significant inhibitory effect on growth in other bacteria.



of 48

The 3 transposition experiments were carried out for the two clones A2 and B3

(containing pPZ4 and pPZ114-5 respectively) with increasing levels of ATc to

induce the expression of the tpase gene causing transposon mutagenesis to take

place. It was then necessary to try and remove the transformed plasmids from

the cells, once the transposon had been integrated into the host genome for two

reasons. Firstly, because the erythromycin resistance gene found in the

transposon was to be used as a positive marker for successful insertions. If the

plasmids were still present, then even the cells where transposon mutagenesis

had not occurred would still be able to grow on BHA + ERM (40µg/ml) plates,

since the ermC gene is found on the plasmid. The second reason was to help

determine which transposon delivery vector, pPZ4 or pPZ114-5, was more

successful by comparing the ratio of colonies that only grew on BHA + ERY with

the number of colonies that grew on both media. The transposition cultures were

incubated at 45°C overnight in an attempt to try and cure the cells of the

plasmids. 10-fold serial dilution series of the transposition cultures were then

carried out and 100µl of neat to 10-9 dilutions were spread onto BHA and

BHA+ERY (40µg/ml) plates, which were incubated at 43°C overnight. All the

colonies were counted for each plate and averages were calculated (Table 3).



of 48

10-5

10-6

10-7

10-8

BHA 699.67 106.33 5.67 0.67A2

BHA+ERY 652.67 69.33 9 0

BHA 754 81.67 7.67 0B3

BHA+ERY 664 73.67 7.33 0

Table 3: Table shows average number of colonies on 10-fold transposition dilution plates from

10-5

to 10-8

for both BHA and BHA + ERY plates for clones A2 and B3. Three plates were used

for each dilution. (Neat – 10-4

and 10-9

dilution plate results not shown)

For the neat to 10-4 plates there was a lawn of bacteria, 10-5 and 10-6 plates had

a large amount of single colonies and 10-7

to 10-9

plates had either a small

amount of colonies or none at all. There were only a slight number of differences

in the number of colonies for both A2 and B3 clones between the BHA and

BHA+ERY plates, where there was an average of 40 colonies less on the BHA +

ERY plates.

Determining Growth defective E. faecium colonies

To check for plasmid retention even after the attempt to cure the cells, individual

A2 and B3 colonies were patched first onto BHA + KAN (1mg/ml) and then the

same colony was streaked onto BHA + ERY (40µg/ml) plates. Cells still

containing either plasmid were capable of growing on both KAN and ERY plates,

cells where there was no plasmid retention but transposon insertion did not occur

or the integrated transposon is not being expressed weren’t able to grow on both

types of plates. Cells in which the transposon had been successfully integrated

into the host genome and plasmids were not retained could grow on BHA + ERY



of 48

plates but not on the BHA KAN plates, since they had lost the kanamycin

resistance gene. 300 colonies were patched onto both kanamycin and

erythromycin BHA plates and then incubated at 43°C overnight. All the plates

showed growth for each individual colony on both BHA + KAN and BHA + ERY

plates. This indicates that the attempt to cure the cells from the plasmids was

unsuccessful, since all the colonies grew on 1mg/ml kanamycin plates and wild

type E1162 cannot survive on concentrations of kanamycin higher than 128µg/ml

(Figure 2). As a result of all the screened cells retaining either plasmid I decided

to assume that transposon mutagenesis had successfully occurred and test for a

mutant strain of E. faecium E1162. Colonies from the transposition were

screened for a loss of sodium chloride resistance due to the transposon

interfering with the resistance genes. Due to there being no significant difference

in number of colonies on the transposition dilution plates and the failure to

determine whether pPZ4 (culture A2) or pPZ114-5 (culture B3) had a higher

transposon mutagenesis rate I decided to carry out the rest of this study with the

clone A2 containing the plasmid pPZ4.

Colonies were screened for the loss of NaCl resistance by using replica plating.

A2 culture from the third transposition was chosen due to the high concentration

of ATc used (2µg/ml), which may have increased the rate of transposon

mutagenesis. A 10-fold dilution series was carried out and 100µl of the 10-6

dilution was spread onto 30 BHA plates and at 37°C overnight. The 10 -6 dilution

was used due to the results in table 3, where there were an average number of



of 48

106.33 colonies on BHA plates, which is ideal for replica plating. These 30 plates

represent the mutant library created by the third transposition. The library

consisted of ~1921 colonies distributed onto the 30 BHA plates. All the colonies

from each BHA plate were replicated onto BHA + NaCl (7g per 100ml of BHI

agar) plates via filter paper and both sets of plates were incubated overnight at

37°C to let the colonies grow back. The concentration of sodium chloride used for

screening (7g per 100ml of BHI agar) was chosen due to the results from the

NaCl MIC experiment (Figure 3), where it was determined that wild type E1162

cannot grow on NaCl concentrations 8g or higher. A colony that had grown on

the BHA plate but did not grow on the NaCl plate indicated that the colony had a

genetic defect causing the colony to loose some of its sodium chloride resistance

and was a mutant strain. Out of the 1912 colonies replicated only one colony was

found that grew on BHA but not on the BHA + NaCl plate. To confirm that this

specific clone named A2-28α had lost some of its NaCl resistance, the colony

was streaked onto a BHA + NaCl and then a BHA plate and incubated at 37°C

overnight. A2-28α successfully grew on BHA but not on the BHA + NaCl plate

confirming that this mutant had lost some of its NaCl resistance. To test for pPZ4

plasmid retention, the mutant A2-28α was streaked onto a BHA + ERY (40µg/ml)

and BHA + KAN (1mg/ml) plate and incubated at 37°C overnight. Both plates

showed a significant amount of colony growth, which confirmed that the plasmid

had been retained. Even though the plasmid was still present in the mutant the

next step was to try and determine how many inserts had occurred and the

location of these inserts via different DNA amplification processes.



of 48

5000 bp

200 bp

1 2 3

Amplification of transposon-flanking sequences

Genomic DNA was extracted from A2-28α (mutant strain) and the concentrations

of the two samples were measured (94.6ng/µl and 153.4ng/µl), confirming the

presence of DNA. The products from genomic DNA preparation were then

digested with the frequent cutting endonuclease TaqIα to produce a large

amount of DNA fragments with staggered ends. The two samples were run on an

agarose gel (Figure 7) to confirm the presence of DNA and determine the size of

the fragments.

When A2-28α was cut with TaqIα (Lane 2) there was a continuous band between

400bp and 200bp, which could have been due to the endonuclease TaqIα cutting

the genome very frequently because of its common recognition site. However

more bands were expected because of the size of A2-28α’s genome. Uncut A2-

28α (Lane 3) produced, an array of bands. Again a continuous band could be

seen between 500bp and 200bp. Two bands (~1,450bp and ~5,000bp) were also

visible, which may correspond to plasmid DNA that had come through the


A2-28α genomic preparation products and

digestions.

Lane 1: 1kb PLUS ladder (Invitrogen)

Lane 2: A2-28α + TaqIα

Lane 3: A2-28α uncut

12000 bp

1650 bp



of 48

5,000 bp

200 bp

1 2 3 4 5

genomic DNA preparation and clean up, since previous results confirmed there

were endogenous E1162 plasmids. The final band is larger than 12,000bp, which

probably corresponded to the uncut mutant genomic DNA. To test if some of the

bands from Lane 3 corresponded to plasmid DNA, a second preparation was

carried out where A2-28α DNA and pPZ114-5 DNA were digested with the

endonuclease XbaI and run on an agarose gel (Figure 8).

As in Figure 4, when pPZ114-5 was digested with XbaI (Lane3), three bands

were visible. The largest and brightest of the three bands (~5500bp) was also

visible when A2-28α was digested with XbaI (Lane 4), which may point towards

the hypothesis that pPZ4 plasmid DNA had come through the genomic

preparation. However the other two bands (~2200bp and ~1900bp) from Lane 2

are not visible in Lane 4, which may disprove this theory. Unlike in Figure 4 uncut

pPZ114-5 (Lane 2) produced 3 distinct bands, which may have corresponded to

different plasmid configurations. There are several different types if plasmid

Figure 8: Gel electrophoresis photograph of A2-28α genomic preparation products and

pPZ114-5 digested with XbaI.


Lane 2: pPZ114-5 uncut

Lane 3: pPZ114-5 + XbaI

Lane 4: A2-28α + XbaI

Lane 5: A2-28α uncut

12,000 bp

2,000 bp



of 48

configurations, which are known to affect their migration in gel electrophoresisxix.

Thawing and refreezing of the pPZ114-5 DNA sample could have caused the

plasmids to change their topological structure and the three bands could have

corresponded to the same plasmid in linear, supercoiled and relaxed circular

conformations or the same plasmid with different degrees of supercoiling. One of

the conformations produced a band larger than 12,000bp, which matched the

uncut pPZ114-5 band seen in Figure 4 Lane 2. Uncut A2-28α (Lane 5) produced

two bands at (~8,000bp and ~1,200kb) and a continuous band between 400bp

and 200bp just like in Lane 4 and Lanes 2 and 3 in Figure 7. The band at

~8,000kb may have corresponded to one of the uncut pPZ114-5 conformations,

however the other two bands aren’t visible. This means that the results obtained

from Figure 8 were inconclusive as to whether any pPZ4 DNA had come through

the genomic prep.

To test whether there was a transposon element in any of the fragments, and if

so, attempt to try determine the number and locations of transposons, a DNA

amplification protocol utilising Y linkers was carried out using PCR. First a

ligation step was required where a mixture of Y linkers (Y linker 1 + 2 shown in

Table 2) was ligated to the fragmented A2-28α DNA using the enzyme T4 DNA

ligase. PCR was then carried out using a Y linker primer and the transposon

specific Tn primer (Table 2) to try and amplify the transposon flanking

sequences. Gel electrophoresis was carried out for the DNA amplification

products to confirm if DNA had been amplified. However the gel photograph (not



of 48

650 bp

1 2 3 4 5

shown) did not produce any bands, which indicated that the DNA amplification

procedure was unsuccessful, even after a second trial.

Since the Y linker DNA amplification method did not produce any results a

second technique was used. The procedure used a form of nested PCR where in

two rounds of PCR a combination of arbitrary and transposon specific primers

were used to try and amplify the transposon flanking sequences. In the first

round of PCR the product from the mutant genomic digest were mixed with a

combination of one arbitrary primer: STAPHArb1 or STAPH Arb2 and one

transposon specific primer: Marq 255 or Marq 269 (see Figure 3 B for

combinations used). 30 cycles of DNA amplification were then carried out and

the PCR products were examined using gel electrophoresis (Figure 9).

Figure 9 shows the results for the 4 different combinations of primers used. The

PCR product using the combination of primers STAPHArb1 and Marq269

produced the only visible band (~600bp). All the other combinations did not

produce a single band, however this didn’t mean that the DNA amplification had


products from first PCR round using the

arbitrary + transposon specific primer method.


Lane 2: STAPH Arb1 + Marq 255






of 48

650 bp


products from second PCR round using the

arbitrary + transposon specific primer method.

Lanes 2 to 5 correspond to the samples from

the first PCR round Figure 9, Lanes 2 to 5.


Lane 2: Arb3 + Marq 256




300 bp

1 2 3 4 5

been unsuccessful. IT could have been possible that there simply wasn’t a large

enough quantity of DNA present after the first round to produce a visible band.

So for each sample the second round of PCR was carried out, which was

designed to amplify the products from the first round, potentially containing the

transposon flanking sequence. Again a combination of the arbitrary primer Arb3

and either transposon specific primer Marq 256 or Marq 270 was used and the

products were examined by gel electrophoresis (Figure 10).

Lanes 2, 3 and 4 produced an array of visible bands, however Lane 5 (containing

1st: STAPH Arb2 + Marq 269 2

nd: Arb3 + Marq 270) did not produce any bands,

which could indicate that there either there wasn’t enough DNA, which is unlikely

since there were a total of 70 DNA amplification cycles, or more likely that the

combination of primers used didn’t produce any double stranded PCR products,

possibly due to primer locations for fragment length. All the bands produced in

Lanes 2, 3 and 4 could have potentially been sequences of DNA containing the

transposon flanking sequence, but by just inspecting the gel there was no way to

know without further research.



of 48

Comparative Growth Curves

Growth curves of E1162 (wild type) and A2-28α (mutant) were produced by

inoculating a certain amount of culture into different samples of fresh BHI or BHI

+ NaCl (6x30ml of BHI and 6x 30ml of BHI + NaCl), so that the initial OD600

reading was ~0.01. The volume of culture inoculated was calculated by

multiplying the desired OD600 of ~0.01 by the final volume of fresh BHI and then

dividing the result by the measured OD600 (

C .Volume(i)=

OD600(d )×C .Volume(d )

OD600 ( i )

,

C.Volume – Culture Volume, i –initial and d - desired). The samples were

incubated at 37°C and measuring the optical density of each sample at specific

time points shown in Figure 7.

Figure 7: Growth curves for E1162 (wild type) and A2-28α (mutant) in BHI broth at 37°C using the

average OD600 readings from triplicate samples. Error bars represent the standard deviation.



of 48

The four main phases of a bacterial growth curve are clearly shown in both

samples. The lag phase from 0 to 150 minutes where there is very little increase

in optical density, while the bacteria adjust to their new environmentxx. During the

exponential phase (150 to 350 min) the bacteria start to double at a constant

ratexxi, causing an exponential growth in the number of bacteria. Slowly the

growth rate will decrease and stop altogether, which is known as the stationary

phase (~350-370 min). Eventually the optical density will start to decrease as the

number of bacteria decreases, which is known as the death phase. There is very

little difference in growth rate and phase times between E1162 and A2-28α

,

which indicates that the mutation is not affecting the mutant’s growth in BHI

broth.

When the two cultures were grown in BHA + NaCl (7g per 100ml of BHI broth)

broth the lag phase lasted so long that no further measurements were made. For

example, even after 330 minutes incubation at 37°C the OD600 for E1162 had

only risen from 0.009 to 0.017.



of 48

DiscussionandFutureDirections

Construction of E. faecium mutant A2-28

In this study transposon mutagenesis was used to create a library of E. faecium

E1162 mutants, by using the Himar1 mariner transposon delivery, which had

been integrated into the two plasmids pPZ4 and pPZ114-5. These two plasmids

were successfully electroporated into the E. faecium wild type (Figures 5 and 6)

and gel electrophoresis revealed that E1162 contains endogenous plasmids.

Research into these plasmids as well as genomic DNA and their potential

functions could reveal what gives this strain some of its characteristics, such as

resistance to external stressors or antimicrobial agents. Once the two clones A2

and B3 containing pPZ4 and pPZ114-5 respectively, had been identified a

transposition procedure was used to produce the library with mutants. However

the size of library created in this study was relatively small, with only around 1921

clones. This meant that the amount of specific growth defective mutants

produced was likely to be very small, since the rate of transposon insertion is

thought to be very low added with the small probability of the transposon actually

being inserted into the gene affecting the screened phenotype. A larger mutant

library could have yielded more growth defective mutants and more reliable

results.



of 48

To identify the concentration of the antibiotic kanamycin needed for colony

selection and the level of salt needed to inhibit E1162 wild type growth, the

minimal inhibitory concentration for both substances was successfully

determined. As reported in previous studies wild type E. faecium is resistant to

very high concentrations of kanamycin (concentrations equal or smaller than

128µg/ml) and can successfully grow in environments containing high levels of

NaCl. However the method used to determine the MIC in this study differs from

the protocol used in many other studiesxxii. The time and temperature, at which

the bacteria were incubated and left to grow was altered, which may affect the

final results.

Selective plating of transposon mutagenesis colonies showed that the high

temperature incubation step designed to remove the plasmids from the cells by

inhibiting their replication, was unsuccessful. This meant that the rate of

transposon insertion could not be determined or compared between pPZ4 and

pPZ114-5 because selective plating would have been ineffective, due to the

plasmids carrying the selective marker used to select for a transposon insert.

Despite the plasmids having been retained by the cells the library was screened

for colonies that showed a loss in the ability to grow on media containing high

concentrations of salt. The library could not be screened for the loss of

kanamycin resistance since the plasmids, which carry a kanamycin resistance

gene, could not be removed from the cells. Attempts should be made to try and

optimize the transposition procedure for E. faecium E1162, especially the



of 48

mechanism by which the bacteria should be cured from the cells, which was

important for so many parts of this study. In the whole library only one growth

mutant was identified to have lost a certain degree of its NaCl resistance, which

may have indicated that very few transposon insertions were made by this

transposon delivery system, since a high insertion rate may have produced a

larger percentage of mutants. However this is only speculation due to the before

mentioned plasmid retention and further work needs to be carried out to

determine the insertion rate for this system in E. faecium.

Identification and amplification of Transposon

A DNA amplification procedure utilising Y linkers was unsuccessful in trying to

locate the position of the transposon in the genome and determine how many

inserts have taken place. Although the main cause could not be determined one

simple reason could have been incomplete digestion of the mutant genome. The

Y linker method does not produce any results if the fragment containing the

transposon is to long. When investigated by gel electrophoresis A2-28α genomic

DNA showed a lack of predicted bands. This may however have been due to the

high cutting frequency of the endonuclease used, which would invalidate the

previous hypothesis. Previous experiments using the Himar1 mariner transposon

delivery have confirmed that the endonuclease TaqIα does not interfere with

amplification because most if not all of the transposon sequences are left uncut.

The protocol could be optimised for E. faecium by carrying out different PCR



of 48

trails several times with different annealing and extension temperatures or maybe

a different DNA polymerase to try and produce some PCR products.

A second procedure was used to try and amplify the transposon flanking

sequences. A combination of arbitrary primers and transposon specific primers in

two rounds of PCR produced an array of different bands, which may or may not

have contained the desired transposon flanking sequences. It is possible for

different bands to have contained the transposon flanking sequence since the

arbitrary primers used would have bound to different locations on mutant

genome. If several of these primers were close enough to the transposon specific

primer then several different strands of DNA will be produced but all containing

the transposon flanking sequence. Of course it was also possible that both types

of primers actually had annealed to the plasmid and amplified the transposon

flanking sequences from pPZ4, since previous results confirmed that pPZ4 had

been retained in the cells. Some of the bands may not have even contained the

desired sequence if the primers annealed to sequences, which were not 100%

complementary. Even though this is extremely unlikely there were a total of 70

DNA amplification cycles, which increases the chance of this occurring. Even if it

only happened once, that undesired sequence would then be amplified and

shown on the gel. Most likely there was a combination of all these possible

scenarios to produce all the different types of bands. Due to not knowing, which

band definitely contained the transposon flanking sequence the PCR products

could not be sequenced. This means the exact location of the transposon



of 48

causing the growth defect in A2-28α could not be determined and the gene

responsible for at least some of E. faecium’s ability to deal with high salt levels

could not be located without further research. The method used in this study

used unusually low annealing temperatures, which may have had some effects

on the PCR products. Again by carrying out several trials with different annealing

and extension temperatures, more reliable results may have been produced.

This study has shown that the Himar1 mariner transposon delivery can

successfully be used to carry out transposon mutagenesis and create a library of

E. faecium mutants. However the tools and methods used to screen for the

location of these inserts need to optimised for the bacterium in question, so that

further research can be carried out into which genes produced the screened

phenotype.



of 48

References

iChou YY, Lin TY, Lin JC, Wang NC, Peng MY, Chang FY. (2008) Vancomycin-resistant

enterococcal bacteremia: comparison of clinical features and outcome betweenEnterococcus faecium and Enterococcus faecalis., J Microbiol Immunol Infect. 2008 Apr;41(2):124-9.

iiMurdoch DR, Mirrett S, Harrell LJ, Monahan JS, Reller LB. (2002) Sequential emergence of

antibiotic resistance in enterococcal bloodstream isolates over 25 years. Antimicrob AgentsChemother. 2002 Nov;46(11):3676-8.

iiiMoellering RC. (1992) Emergence of Enterococcus as a significant pathogen. Clin Infect

Dis 1992; 14: 1173–178.

ivMaccallum WG, Hastings TW. (1899) A case of acute endocarditis caused by micrococcus

zymogens (NOV. Spec), with a description of the microorganism. J Exp Med. 1899 Sep

1;4(5-6):521-534.

vWillems RJ, Top J, van Santen M, Robinson DA, Coque TM, Baquero F, Grundmann H, Bonten

MJ. (2005) Global spread of vancomycin-resistant Enterococcus faecium from distinctnosocomial genetic complex. Emerg Infect Dis. 2005 Jun;11(6):821-8.

viIwen PC, Kelly DM, Linder J, et al. (1997) Change in prevalence and antibiotic resistance

of Enterococcus species isolated from blood cultures over an 8-year period . Antimicrob Agents Chemother 1997;41:494-5.

viiBonten MJ, Willems R, Weinstein RA. Vancomycin-resistant enterococci: why are they

here, and where do they come from? Lancet Infect Dis. 2001 Dec;1(5):314-25.

viiiMurray BE. (2000) Vancomycin-resistant enterococcal infections. N Engl J Med. 2000 Mar

9;342(10):710-21.

ixCao M, Bitar AP, Marquis H. (2007) A mariner-based transposition system for Listeria

monocytogenes. Appl Environ Microbiol. 2007 Apr;73(8):2758-61. Epub 2007 Feb 16.

xBae T, Schneewind O. (2005) Allelic replacement in Staphylococcus aureus with inducible

counter-selection. Plasmid. 2006 Jan;55(1):58-63. Epub 2005 Jul 26.

xiKwon YM, Ricke SC., (2000) Efficient amplification of multiple transposon-flanking

sequences. J Microbiol Methods. 2000 Aug;41(3):195-9.

xiiVijaranakul U, Nadakavukaren MJ, Bayles DO, Wilkinson BJ, Jayaswal RK. (1997)

Characterization of an NaCl-sensitive Staphylococcus aureus mutant and rescue of theNaCl-sensitive phenotype by glycine betaine but not by other compatible solutes. ApplEnviron Microbiol. 1997 May;63(5):1889-97.



xiiiVijaranakul U, Nadakavukaren MJ, Bayles DO, Wilkinson BJ, Jayaswal RK. (1997)

Characterization of an NaCl-sensitive Staphylococcus aureus mutant and rescue of theNaCl-sensitive phenotype by glycine betaine but not by other compatible solutes. ApplEnviron Microbiol. 1997 May;63(5):1889-97.

xiv

Xiong XP, Wang C, Ye MZ, Yang TC, Peng XX, Li H. (2010) Differentially Expressed Outer Membrane Proteins of Vibrio alginolyticus in Response to Six Types of Antibiotics. Mar Biotechnol (NY). 2010 Mar 9.

xvVillafane R, Bechhofer DH, Narayanan CS, Dubnau D. (1987) Replication control genes of

plasmid pE194. J Bacteriol. 1987 Oct;169(10):4822-9.

xviKwon YM, Ricke SC. (2000) Efficient amplification of multiple transposon-flanking

sequences. J Microbiol Methods. 2000 Aug;41(3):195-9.

xviiBae T, Schneewind O. (2005) Allelic replacement in Staphylococcus aureus with

inducible counter-selection. Plasmid. 2006 Jan;55(1):58-63. Epub 2005 Jul 26.

xviiiBae T, Schneewind O. (2005) Allelic replacement in Staphylococcus aureus with

inducible counter-selection. Plasmid. 2006 Jan;55(1):58-63. Epub 2005 Jul 26.

xixSummers K. (1996) The biology of Plasmids, Blackwell Science Ltd., p.15

xxSingleton P. (2004) Bacteria in Biology, Biotechnology and Medicine, 6

thed., John Wiley

and Sons, p.63-65

xxiSingleton P. (2004) Bacteria in Biology, Biotechnology and Medicine, 6

thed., John Wiley

and Sons, p.63-65

xxiiWiegand I, Hilpert K, Hancock RE. (2008) Agar and broth dilution methods to determine

the minimal inhibitory concentration (MIC) of antimicrobial substances.

Nat Protoc. 2008;3(2):163-75.

undergraduate dissertation: construction of growth defective mutant strains of enterococcus faecium

Documents