understanding sensitivity and resistance to lsd1 ...€¦ · lien provez understanding sensitivity...

UNDERSTANDING SENSITIVITY AND

RESISTANCE TO LSD1 INHIBITION IN

T-CELL ACUTE LYMPHOBLASTIC

LEUKEMIA

Lien Provez Student number: 01406047

Supervisor: Prof. Dr. Ir. Pieter Van Vlierberghe

A dissertation submitted to Ghent University in partial fulfilment of the requirements for the degree of

Master of Science in the Biomedical Sciences.

Academic year: 2018 – 2019

Lien Provez Understanding sensitivity and resistance to LSD1 inhibition in T-ALL

ACKNOWLEDGEMENT

The completion of my master’s dissertation has been both a fear and a dream since I

started my education in Biomedical Sciences at Ghent University. This fear turned out to be

justified, because the greatest lesson I learned during the past two years is that research

always involves trial and error (lots of error). Luckily, I also experienced some successes,

which brought me closer to the dream of this project, optimizing the treatment of T-ALL.

Overcoming this challenge could not have been possible without the participation and

assistance of so many people whose names are mentioned below.

It is a great pleasure to acknowledge my deepest thanks and gratitude to Prof. Dr.

Pieter Van Vlierberghe for his encouraging guidance and for suggesting the topic of this essay,

which gave me the opportunity to do research about a cancer disease often diagnosed in

children (after science, my second great interest). It was an honor to work under his

supervision.

Also, I am ineffably grateful to Dr. Sofie Peirs for her outstanding counseling and

helping me grow as an independent, critical researcher. I would also like to thank Maaike Van

Trimpont, Renate De Smedt, Béatrice Lintermans and all the other members of the research

group of P. Van Vlierberghe for their endless support during my project. Thank you all for

answering my ton of (not always intelligent) questions and encouraging me instead of

complaining. The research group of Maarten Dhaenens also deserves to be acknowledged for

our pleasant collaboration. A big thank you is in order to Françoise Sanderse, my partner in

crime, and Nina Lambrechts, who always were ready for a great talk and a good laugh, making

the lab an enjoyable working place.

Finally, I wish to present my special thanks and love to my fantastic parents and sister,

my partner Wannes and all my relatives and friends, who in one way or another shared their

support, either emotionally, financially or physically. Without their unconditional support I

wouldn’t be able to proudly present you my master’s dissertation. Thanks for always believing

in me.

Thanking you

Lien Provez


TABLE OF CONTENTS

ABSTRACT ............................................................................................................................................. 1

INTRODUCTION ..................................................................................................................................... 2

PART I Description of T-cell acute lymphoblastic leukemia (T-ALL) ............................................... 2

1.1 Different types of leukemia ........................................................................................................ 2

1.2 Epidemiology ............................................................................................................................. 3

1.3 Origin and subgroups of T-ALL ................................................................................................. 3

1.4 Diagnosis and clinical characteristics ........................................................................................ 5

1.5 Current treatment of T-ALL........................................................................................................ 5

1.6 Prognosis ................................................................................................................................... 5

1.7 Genetic landscape of T-ALL and possible therapies ................................................................. 5

1.8 Epigenetic landscape of T-ALL and possible therapies ............................................................ 6

PART II Lysine-specific demethylase 1 as therapeutic target in T-ALL ............................................ 8

2.1 Structure and function of Lysine-specific demethylase 1 (LSD1) ............................................. 8

2.2 Discovery of LSD1 as therapeutic target in T-ALL .................................................................. 10

2.3 LSD1 inhibition in T-ALL .......................................................................................................... 12

PART III Research objectives .......................................................................................................... 14

3.1 Combination therapy of LSD1 inhibition and targeted therapies ............................................. 14

3.2 Molecular biology of LSD1 and LSD1 inhibition in T-ALL ....................................................... 15

3.3 Histone epigenetics in T-ALL cell lines .................................................................................... 15

MATERIALS AND METHODS .............................................................................................................. 16

1. Cell culture ..................................................................................................................................... 16

2. IC50 determination and combination therapies of GSK2879552 and targeted therapies .............. 16

2.1 Treatment of cells with dilution series of the targeted therapies ............................................. 16

2.2 CellTiter-Glo Viability assay and IC50 calculation .................................................................... 16

2.3 Combination therapies ............................................................................................................. 16

3. ChIP-sequencing of H3K27ac in LOUCY with spike-in ................................................................. 17

3.1 Treatment and crosslinking of LOUCY cells............................................................................ 17

3.2 RNA isolation, cDNA synthesis and RT-qPCR........................................................................ 17

3.3 Nuclei preparation ................................................................................................................... 18

3.4 Shearing via sonication with Bioruptor Pico Sonication system .............................................. 18

3.5 Addition of spike-in and chromatin immunoprecipitation (ChIP) ............................................. 18

3.6 Preparation, addition and washing of the beads ..................................................................... 18

3.7 DNA isolation ........................................................................................................................... 18

3.8 Western blot ............................................................................................................................ 19

3.9 Library prep and sequencing ................................................................................................... 19

4. Studying interactions with LSD1 via immunoprecipitation (IP) ...................................................... 20

4.1 IP on RIPA lysates ................................................................................................................... 20

4.2 IP on nuclear extracts .............................................................................................................. 20

4.3 Western blot after IP ................................................................................................................ 20

5. Mass spectrometry of histones ...................................................................................................... 21

5.1 Collection of T-ALL cells .......................................................................................................... 21

5.2 Histone extraction from T-ALL cells ........................................................................................ 21

5.3 Propionylation and trypsin digest ............................................................................................ 21

5.4 Mass spectrometry .................................................................................................................. 22

5.5 Data analysis ........................................................................................................................... 22

6. Knock down of GFI1 and GFI1b in LOUCY................................................................................... 22

6.1 Transformation ........................................................................................................................ 22


6.2 Preparation and testing of plasmids ........................................................................................ 23

6.3 Transfection ............................................................................................................................. 23

6.4 Transduction ............................................................................................................................ 23

6.5 Evaluation of GFI1 and GFI1b expression via western blot .................................................... 23

7. LSD1 inhibition followed by RT-qPCR and western blot for DNMT1 ............................................ 24

7.1 Treatment of T-ALL cell lines with 100 nM LSD1i or DMSO ................................................... 24

7.2 RNA isolation, cDNA synthesis and RT-qPCR........................................................................ 24

7.3 Protein extraction and concentration measurement ................................................................ 24

7.4 Western blot against DNMT1 .................................................................................................. 24

8. Studying PU.1 and C/EBP expression in T-ALL cell lines .......................................................... 24

8.1 RT-qPCR against PU.1 and C/EBP of cells in steady state.................................................. 24

8.2 LSD1 inhibition followed by qPCR against PU.1 ..................................................................... 25

8.3 Western blot against PU.1 of cells in steady state and after LSD1 inhibition ......................... 25

9. Statistical analysis ......................................................................................................................... 25

9.1 Statistical significance ............................................................................................................. 25

9.2 Standard deviation ................................................................................................................... 25

RESULTS .............................................................................................................................................. 26

PART I Combination therapy of LSD1 inhibition and targeted therapies ....................................... 26

1.1 IC50 of targeted therapies ........................................................................................................ 26

1.2 Combination therapies in LOUCY ........................................................................................... 26

PART II Molecular biology of LSD1 and LSD1 inhibition in T-ALL ................................................. 28

2.1 Protein interaction between LSD1 and IKZF1 or GFI1 ............................................................ 28

2.2 Knock down of GFI1 and GFI1b in LOUCY ............................................................................. 29

2.3 Influence of LSD1 inhibition on DNMT .................................................................................... 30

2.4 PU.1 and C/EBP expression in T-ALL cell lines ................................................................... 31

PART III Histone epigenetics in T-ALL cell lines .............................................................................. 33

3.1 ChIP-sequencing of H3K27ac in LOUCY after LSD1 inhibition .............................................. 33

3.2 Mass spectrometry of histones ................................................................................................ 34

DISCUSSION ........................................................................................................................................ 36

PART I Combination therapy of LSD1 inhibition and targeted therapies ....................................... 36

PART II Molecular biology of LSD1 and LSD1 inhibition in T-ALL ................................................. 36

PART III Histone epigenetics in T-ALL cell lines .............................................................................. 38

GENERAL CONCLUSION .................................................................................................................... 39

REFERENCES ...................................................................................................................................... 40

ADDENDUM ..............................................................................................................................................

List of abbreviations ...............................................................................................................................

Supplemental figures .............................................................................................................................

Supplemental tables ..............................................................................................................................

Poster ....................................................................................................................................................


1

ABSTRACT

T-cell acute lymphoblastic leukemia (T-ALL) is a rare and aggressive cancer of precursor T-cells for which more effective and less toxic therapies are needed. Lysine-specific demethylase 1 (LSD1) was described as a potential targeted therapy for T-ALL. Therefore, this research is focused on (1) developing combination therapies with the LSD1 inhibitor GSK2879552, (2) understanding the molecular biology of LSD1 and LSD1 inhibition and (3) unraveling the histone epigenetics, which are influenced by LSD1, in T-ALL cell lines. For the first objective, IC50’s of targeted therapies were determined and different combination therapies with the LSD1 inhibitor were tested in LOUCY cells. Strong synergism was observed between ABT-263, a BCL-2 inhibitor, and GSK2879552. With ABT-199, Romidepsin and Ruxolitinib synergism was also present. For the second objective, the presence and interactions with LSD1 of different transcription factors were studied. No interactions between LSD1 and IKZF1 or GFI1 were

observed via immunoprecipitation. C/EBP is not present in T-ALL cell lines and PU.1 is only expressed in LOUCY cells. LSD1 inhibition has no influence on the expression of PU.1 or the stability of DNMT1. For the third goal, a T-ALL cell line panel was prepared for mass spectrometry to compare histone modifications between LSD1i sensitive and resistant cell lines. Histone extraction was optimized by use of the direct acid extraction method. H3K27ac ChIP sequencing and knock down of GFI1(b) was performed in LOUCY cells, but no results could be obtained. Further research is needed to optimize the use of the LSD1 inhibitor in T-ALL.


2

INTRODUCTION

PART I Description of T-cell acute lymphoblastic leukemia (T-ALL)

1.1 Different types of leukemia

Leukemia is a blood cancer which results in high numbers of abnormal white blood cells. White blood cells are derived from hematopoietic stem cells (HSC) in the bone marrow and form a part of the immune system. Depending on the type of cell that becomes malignant and how fast the disease progresses, different types of leukemia are determined. There are four main types of leukemia (Figure 1). The first two are chronic leukemias, which advance slowly and do not exhibit symptoms in early stages: chronic myeloid leukemia (CML) is associated with the abnormal Philadelphia chromosome leading to an accumulation of myeloid cells [1], while chronic lymphocytic leukemia (CLL) develops when too many abnormal B cells grow and crowd out the normal blood cells [2]. The other two are acute leukemias, which develop rapidly and may cause a sudden onset of symptoms: acute myeloid leukemia (AML) occurs when myoblasts grow rapid in the bone marrow [3], while acute lymphoblastic leukemia (ALL) develops when too many abnormal immature lymphocytes (lymphoblasts) grow and accumulate in the bone marrow. Of the latter, two forms can occur: either too many B-cell lymphoblasts are present in the blood and bone marrow (B-ALL) or too many T-cell lymphoblasts are found (T-ALL) [4].

Figure 1. Diagram showing the cells from which the four main types of leukemia can develop. HSCs in the bone marrow can differentiate into blood cells. During the differentiations of HSCs, the cells gain cluster of differentiation (CD) cell surface markers. Lymphoid stem cell progenitors can further develop towards B- or T-lymphocytes. B-lymphocytes mature in the bone marrow and play a role in the adaptive, humoral immune system by secreting antibodies. T-lymphocytes mature in the thymus and play a central role in the cell-mediated immunity. ALL develops from lymphoid blasts, CLL develops from B-lymphocytes. Myeloid stem cell progenitors can further develop towards monocytes and granulocytes. CML develops from early myeloid stem cell progenitors, while AML develops from myeloid cells further along in the maturation process. Figure adapted from a graphic created by Cancer Research UK.


3

1.2 Epidemiology

Leukemia is the 11th most common cancer worldwide. Approximately 1.5% of people will be diagnosed with leukemia at some point during their lifetime. According to data established in 2015, the age at which leukemia is diagnosed peaks around 85 [5]. From 2007 to 2013, this blood cancer had a five-year survival rate of 63,7% [6]. Leukemia is with 34% of diagnosed cancers the most common cancer in children under 15 years old [7]. ALL is responsible for 79% of the leukemias diagnosed in children, AML is responsible for 14%. According to the national cancer institute, the five-year survival rate for children with ALL is 85%. In Belgium 10 to 15 children are diagnosed with T-ALL each year [8] with a prevalence peak at the age of 5 [7]. T-ALL is twice as prevalent in males as in females [9]. T-ALL accounts for about 15% of childhood and 25% of adult ALL cases [10]. Factors that may increase the risk of developing leukemia include ionizing radiation, smoking, exposure to certain chemicals and genetic disorders [5].

1.3 Origin and subgroups of T-ALL

T-cell acute lymphoblastic leukemia is an aggressive type of leukemia in which precursor T-cells become malignant. Depending on the developmental stage at which the T-cell progenitor cells arrest, T-ALL can be subdivided in clinically relevant subtypes with unique gene expression signatures and different T-cell markers [11].

Normal T-cell development

T-cells are derived from hematopoietic stem cells in the bone marrow (BM). The T-cell progenitors migrate to the thymus, where they will undergo a maturation process (Figure 2) [12]. Those thymus seeding progenitors (TSPs) undergo a series of developmental stages, each with different expressed surface markers, like the cluster of differentiation (CD) cell surface markers. The hematopoietic progenitor cells (HPC) are characterized by the expression of CD34. Developing thymocytes interact with the thymus stromal cells and undergo multiple selection processes. Early developing thymocytes are double negative (DN), which means they lack the expression of CD4 and CD8. These uncommitted early T-cell progenitors are characterized by CD34+CD1a- (Figure 2B). CD34+CD1a- cells are divided in 3 subpopulations depending on their CD7 expression. CD34+CD1a-CD7- are the most immature cells that still have the potential to generate lymphoid, myeloid and erythroid cells. The CD34+CD1a-CD7INT subpopulation only has lymphoid potential. The CD34+CD1a-CD7HIGH subset consists of T/NK progenitors and those are not present in the BM. Next, the CD5 marker is upregulated followed by CD1a expression (Figure 2C). T-cell progenitors that express CD1a are T-cell committed, which means that they can no longer evolve into another blood cell type.

These cells undergo -selection, which selects the cells that have successfully rearranged

their T-cell receptor (TCR) chain locus (Figure 2E). This chain pairs with the pre-T chain,

forming a pre-TCR which can bind to CD3 molecules. After -selection cells are characterized by expression of CD28 and NOTCH dependent proliferation. The pre-TCR complex leads to further differentiation by expression of CD4 and CD8 (Figure 2F). These double positive (DP)

cells rearrange their TCR- chain loci to form an -TCR (Figure 2G). DP cells undergo a positive selection in the cortex by interacting with self-antigens. An appropriate affinity between the antigens and the major histocompatibility complex leads to survival of the cell. The thymocytes migrate to the medulla where they undergo a negative selection, meaning that the thymocytes that interact too strongly with antigens presented by antigen presenting cells undergo apoptosis. Downregulation of either co-receptor, produces CD4 or CD8 single positive cells (SP) (Figure 2H). These SP cells can further differentiate in the lymph node towards CD4+

T helper cells or CD8+ cytotoxic T-cells. A smaller part of the thymocytes will undergo TCR-/ rearrangements (Figure 2I) [12].


4

Figure 3. Association between the genetic T-ALL subgroups and their arrest during T-cell development. Figure based on data and figures from [12,15].

Link between T-cell development and T-ALL subgroups

A first way to classify the T-ALLs is by their immunophenotypic profile. One group of T-ALLs are early immature T-ALLs with arrest at the earliest stages of T-cell differentiation. They are associated with DN cells. Secondly, arrest at the early stage of cortical thymocyte maturation leads to CD1a+CD4+CD8+ cells with high NOTCH1 expression and frequent CDKN2A deletions. A third group is associated with a more mature late cortical thymocyte immunophenotype, often characterized by TAL1 oncogene activation and CD4+CD8+CD3+

cells [11].

A second way to classify T-ALL is by the activation of transcription factor oncogenes. Six molecular subgroups were determined [13–16], according to their descending frequencies: TAL/LIM domain only (LMO), T-cell leukemia homeobox 3 (TLX3), the proliferative cluster, early immature T-ALL, homeobox A cluster (HOXA) and T-cell leukemia homeobox 1 (TLX1). In the LMO subgroup, a high expression of LMO1/2/3 and TAL1/2 is seen as a result of translocations. An increased expression of LMO2 is also seen in the early immature T-ALLs, together with high levels of LYL1 and MEF2C. The TLX1 and TLX3 subgroup show an activation of respectively TLX1 and TLX3 by genetic rearrangements. Genetic rearrangements also cause an aberrant expression of HOXA in the HOXA cluster. The proliferative cluster shows a higher expression of proliferative genes and ectopic expression of NKX2-1/2. These subtypes can be linked to arrest at a particular stage of T-cell development (Figure 3).

Figure 2. T-cell development, showing the different CD surface markers expressed at different stages of maturation. TSPs travel from the bone marrow to the thymus where they undergo different selection processes mediated by their interaction with the thymus stromal cells. At first, T-cell progenitors are double negative for CD4 and CD8. Expression of CD1a indicates T-cell commitment. TCR rearrangements take place during the differentiation process, followed by positive and negative selections to determine whether the T-cells become CD4 or CD8 positive. Figure from [12].


5

1.4 Diagnosis and clinical characteristics

T-ALL patients are diagnosed with diffuse infiltration of immature T-cell lymphoblasts in the bone marrow, high white blood cell counts and frequent infiltration of the nervous system.

Clinical characteristics are an elevated white blood cell count, neutropenia, thrombocytopenia, anemia and mediastinal thymic masses. Symptoms are bruising, bleeding, tiredness, pallor and infections [17].

1.5 Current treatment of T-ALL

Because of the body-wide distribution of the malignant cells there are no surgical options. Currently, intensified chemotherapy is administered to treat T-ALL. In children this therapy can take up until 3 years. Multi-agent chemotherapy consists of three phases: remission induction, intensification and maintenance therapy. Remission induction aims to kill most tumor cells. This phase may include agents like dexamethasone, vincristine and asparaginase. The further reduction of tumor burden is done by intensification of multi-drug combinations that may include vincristine, etoposide and cyclophosphamide. The goal of the third phase, the maintenance therapy, is to kill any residual cells by using agents like methotrexate and mercaptopurine [18]. Allogeneic hematopoietic stem cell transplantation (allo-HSCT) may be appropriate for patients who are in remission to help restore the patient’s bone marrow. These stem cells restore the immune system and stimulate the growth of new bone marrow [19].

Older T-ALL patients do not always tolerate intensified chemotherapy. Therefore, they receive targeted therapies, supportive care and stem cell transplantations [20].

Chemotherapies used nowadays are not specific and will therefore not only kill cancer cells. Side effects of chemotherapy frequently occur and include constipation, neurological dysfunction, hypertension, pancreatitis, mucositis, renal dysfunction, hyperglycemia and hypotension [21].

Chimeric antigen receptor (CAR) T-cells emerge as promising immune therapy in hematological malignancies. In 2017 the first CAR T-cell therapy was FDA approved for children with B-ALL. CD5 and CD7 CAR T-cells are in clinical trials for T-ALL [22,23].

1.6 Prognosis

The survival rates of childhood T-ALL are about 85% [24], while in adults the five-year survival rate is only about 40% [25]. Although the current therapies cure many patients, there are still many side effects and about 15% of pediatric and 40% of adult T-ALL patients still relapse with poor five-year survival perspectives of 7-23% [10,26]. High-risk relapse patients are treated with multidrug chemotherapy and will often receive a HSCT [26].

1.7 Genetic landscape of T-ALL and possible therapies

A broad spectrum of genetic alterations in pathways responsible for normal thymocyte development is present in T-ALL. An activating NOTCH1 mutation is present in 50% of T-ALL cases [27]. Deletion of the CDKN2A/CDKN2B loci is seen in more than 70% of T-ALL cases [28]. These loci encode for cell cycle regulators p16/INK4A and p14/ARF that act as tumor suppressors. Furthermore, activation of oncogenic signaling pathways (e.g., JAK/STAT, PI3K/AKT and RAS) and oncogenic transcription factors (e.g., MYC and MYB) are frequently


6

seen. Also, ABL1, a tyrosine kinase, is frequently activated by genomic rearrangements [29]. Fusions of the SPI1 gene, encoding for the PU.1 transcription factor which plays a role in hematopoietic differentiation [30], is recurrent in high-risk pediatric T-ALL and leads to cell proliferation and maturation block [31].

Different opportunities are present to target these genetic alterations. For instance, the

NOTCH1 pathway can be inhibited via antibodies against NOTCH1 and -secretase inhibitors [32]. The JAK/STAT pathway can be targeted via JAK inhibitors like Ruxolitinib [33]. The PI3K/AKT pathway can be inhibited via PI3K, AKT or mTOR inhibitors like Rapamycin [34]. MEK and ERK inhibitors are able to deactivate the RAS pathways [35]. The tyrosine kinase ABL1 can be silenced via ABL1 inhibitors like Imatinib [36].

1.8 Epigenetic landscape of T-ALL and possible therapies

The transcriptional regulation is determined by the chromatin structure, which can be changed by histone modifications and DNA methylation. Euchromatin is the open form of chromatin, allowing the recruitment of transcription factors and therefore active gene transcription [37]. Heterochromatin is the closed form of chromatin and associated with gene silencing. T-ALL has a high frequency of mutations in epigenetic regulators [38] which promotes aberrant gene expression contributing to cellular transformation.

DNA methylation and demethylation

Hypomethylation of CpG-poor DNA regions triggers chromosomal instability, while hypermethylation of CpG-rich promotor regions decreases the expression of tumor suppressor genes (TSG). DNA methylation is mediated by DNA methyltransferases (DNMTs) DNMT1/3A/3B (Figure 4). DNMT3A/3B are de novo-type DNMTs which establish methylation patterns of genomic DNA at an early stage of embryogenesis. DNMT1 collaborates with Uhrf1 to maintain the methylation patterns during replication [39]. Mutations in DNMT3A [40] and aberrant transcripts of DNMT3B [41] are identified in T-ALL. DNMT3A, a tumor suppressor necessary for normal T-cell development, is mutated in 19% of adult human T-ALL cases [42,43]. DNA methyltransferase inhibitors such as Decitabine are able to block the activity of DNMT and thereby induce hypomethylation of DNA [44]. DNA demethylation is mediated by the Ten-Eleven Translocation (TET) family of proteins that catalyze the conversion of methylated cytosines into hydroxymethyl-cytosines. The TET proteins can be mutated in T-ALL [45]. Mutations in isocitrate dehydrogenases (IDH) induce the production of oncometabolite 2-hydroxyglutarate which inhibits the activity of TET [46].

Figure 4. DNA methylation is mediated by DNMTs. Methylated CpG-islands at promotors are associated with gene silencing of TSGs. Methylation of the gene body is associated with active transcription. Figure based on [46].


7

Histone post translational modifications

Nucleosomes are responsible for the packaging of DNA into chromatin. Each nucleosome consists of 8 histone proteins. These nucleosomes can be organized in euchromatin or heterochromatin. Post-translational modifications (PTM) of histones lead to the recruitment of specific effector proteins necessary for DNA-templated processes. Histone modifications may also have a direct influence on the chromatin structure by affecting their interaction with other histones, DNA and chaperones [47]. The majority of PTMs is found in the flexible tail domains of histones (Figure 5). They can regulate the nucleosome mobility. For example, histone 3 lysine 4 (H3K4) methylation is associated with transcriptionally active euchromatin while methylation of H3K9 and H3K27 is associated with inactive gene promotors in heterochromatin [48,49]. The polycomb repressive complex 2 (PRC2) is a tumor suppressor which mediates H3K27 methylation leading to gene repression. Loss-of-function mutations and deletions of PRC2 are seen in T-ALL [46]. Also, H3K27 demethylase-complexes can be mutated in T-ALL [50,51]. Besides methylation and demethylation, acetylation and deacetylation of histones play an important role in the regulation of gene expression. Acetylation of histones by histone acetyltransferases (HATs) promotes gene transcription [52], while histone deacetylases (HDACs) are responsible for tightening the chromosome structures at promoter sites to down regulate gene transcription [52,53]. For example, acetylation of H3K4 and H3K16 activates gene transcription [54]. H3K27ac is the antagonism of H3K27me3 and H3K9ac of methylated H3K9. Therefore, both H3K27ac and H3K9ac are associated with active transcription [55]. H3K9ac, H3K14ac and H3K4me3 are the hallmarks of active gene promotors [56]. Active enhancers are typically characterized by H3K4me1 and H3K27ac [57].

Figure 5. Post translational histone modifications mediate gene expression. Heterochromatin (red) is among others associated with de-acetylation of histones and lysine methylation of H3K9 and H3K27, indicating repression of transcription. Euchromatin (green) is associated with PTMs such as acetylation of histones and methylation of H3K4. Figure adapted from [58].


8

PART II Lysine-specific demethylase 1 as therapeutic target in T-ALL

2.1 Structure and function of Lysine-specific demethylase 1 (LSD1)

Structure of LSD1

LSD1 (alias KDM1A) is a protein of 852 amino acids, encoded by the LSD1 gene on chromosome 1. The LSD1 protein has 3 main domains (Figure 6). A first domain is the N-

terminal small -helical domain (SWIRM) which is responsible for the stability of the protein. SWIRM packs together through wide-ranging interactions with the C-terminal amine oxidase like (AOL) domain [59]. This AOL domain has 20% sequence similarity with the flavin adenine dinucleotide (FAD)-dependent monoamine oxidase (MAO) and polyamine oxidase (PAO) domains, including the FAD-binding sites. Special for the AOL domain is a big acid motif at the catalytic domain which allows specific binding of LSD1 to the histone 3 (H3) tail [60]. At the cross point of the FAD- and substrate-binding subdomains the active center of LSD1 is located. The third domain is the Tower domain, which enables docking of LSD1-interacting proteins like the corepressor for RE1‐silencing transcription factor (CoREST), the carboxyl‐terminal binding protein 1 (CtBP1) and histone deacetylases (HDAC1/2). LSD1 is closely related with CoREST, which is required for the demethylase activity in nucleosomes [59,61]. The flexibility of the protein is crucial for the demethylase activity of LSD1. Therefore, targeting this flexibility is a possible therapy against LSD1 [59].

Figure 6. Overview of the LSD1 structure. The SWIRM domain is displayed in green, the AOL domain is in blue (FAD-binding subdomain in dark blue, substrate-binding subdomain in cyan), the substrate‐binding domain and the Tower domain are in yellow. Figure from [60].

Function of LSD1 in different cell types

LSD1 has multiple roles in mammalian biology. It is a chromatin modifier able to program and reprogram the cellular state by altering transcription through modifications of histone tails. In embryonic stem cells LSD1 is responsible for the balance between self-renewal and differentiation of pluripotent stem cells, by regulating the balance between H3K4 and H3K27 methylation at regulatory regions of developmental genes [62]. Murine LSD1 knockouts exhibit embryonic lethality [63]. LSD1 is also a key player in the formation of hemangioblasts through downregulation of Etv2 [64] and gets recruited by growth-factor independent 1 (GFI1) for the generation of hematopoietic stem cells [65]. By the recruitment of LSD1 to RE1 sites pluripotent stem cells evolve in neural stem cells and the disassembly of the LSD1/RCOR1 complex induces progenitors to develop into mature neurons [66,67]. Furthermore, LSD1 plays also a role in the differentiation of endocrine cells [63] and the oocyte progression [68].


9

LSD1 as an epigenetic regulator in transcription

Recently, it has been shown that epigenetic changes play an important role during cancer etiology. Among these epigenetic changes are histone posttranslational modifications, which influence the chromatin structure and therefore the binding of proteins to regulate gene expression. LSD1 is a FAD-dependent MAO that removes methyl groups from histones and in that way contributes to epigenetic posttranslational modifications. LSD1 catalyzes the demethylation of mono- and dimethylated lysine 4 and 9 on histone 3 (H3K4 and H3K9). This enzymatic activity is regulated by the SWIRM domain and AOL of LSD1. Via its Tower domain, LSD1 interacts with CoREST and NuRD for the demethylation of H3K4 [69]. By demethylating H3K4, LSD1 acts as a co-repressor [70]. H3K4me2/me3 on promoters is associated with active transcription while H3K4me1 is present on active or inactive enhancers, depending on their binding partner [70]. When demethylating H3K9 the Tower domain interacts with an androgen (AR) or estrogen receptor (ER). LSD1 then acts as a co-activator (Figure 7).

Figure 7. Histone demethylase activity of LSD1 (KDM1A). The SWIRM domain and AOD are together responsible for the enzymatic activity while the TOWER domain is involved in protein interactions. Although H3K4me1 and me2 are the primary substrates, LSD1 can also demethylate H3K9me1 and me2 when it is bound to the AR or ER. Therefore, LSD1 can act as a transcriptional co-repressor or co-activator, depending on its substrate and interaction partners. Figure from [125].


10

LSD1 can also demethylate non-histone substrates, such as DNA methyltransferase 1 (DNMT1) [71]. DNMT1 is a maintenance enzyme that transfers a methyl group to the cytosine base. When DNMT1 is demethylated by LSD1, it becomes more stable. This contributes to methylation of the DNA (Figure 8) [72]. DNA methylation at a promoter site decreases the gene expression. Although cancer cells typically exhibit less DNA methylation activity, hypermethylation often occurs to inactivate tumor-suppressor genes [73].

Gfi1 and Gfi1b are zinc-finger proto-oncogenes with a transcriptional repressor function necessary for multilineage blood cell development [74]. They can recruit HDACs and demethylases to remove transcription-promoting modifications [75]. LSD1 and CoRest are able to associate with GFI1(b) via its SNAG repression domain [76], which mimics the histone tail to bind the MAO domain [77]. This complex is recruited by GFI1(b) to target gene promotors. GFI1(b) is able to recruit LSD1 towards PU.1 target genes, resulting in gene repression [78].

2.2 Discovery of LSD1 as therapeutic target in T-ALL

Zinc finger E-box binding homeobox 2 (ZEB2) as oncogene in T-ALL

In order to develop more effective and less toxic anti-leukemic drugs, an improved understanding of the molecular mechanisms that play a role in T-ALL is needed. One of the recently identified oncogenic drivers of T-ALL is ZEB2 [79]. Multiple mechanisms are responsible for ZEB2 overexpression in immature T-ALL patients. For instance, a rare but recurrent translocation breakpoint within immediate proximity of the ZEB2 locus leads to higher expression of ZEB2 which mediates enhanced tumor-initiating potential and IL-7 receptor signaling [79]. Another mechanism can be the overexpression of FOXM1 which indirectly upregulates the Zeb family expression by downregulation of miR-200 [80–82]. The increased expression of ZEB2 is characteristic for immature T-ALL patients. Overexpression of Zeb2 in a transgenic mouse model leads to the development of leukemia with immature T-ALL characteristics [79]. This confirms that ZEB2 can play a role as oncogenic driver in T-ALL.

ZEB2 is a Zinc finger E-Box binding homeobox transcription factor. Although the Zinc finger domains are essential to recognize bipartite E-box motifs, the domains outside the Zinc finger clusters are responsible for recruiting tissue-specific co-activators and -repressors [83]. Since

Figure 8. The role of LSD1 in coordinating DNA methylation. LSD1 is able to demethylate DNMT1, leading to a more stable form of the DNA methyltransferase. Demethylated DNMT1 increases cytosine methylation, mediating transcriptional repression. Figure adapted from [126].


11

ZEB2 is a transcription factor and therefore hard to target, identification and targeting of essential interaction partners could lead to other treatment options for T-ALL. After performing pull down and mass spectrometry experiments, LSD1 was identified as an interaction partner of ZEB2 in T-ALL [84].

LSD1 as therapeutic target in different cancers

LSD1 is upregulated in various cancers [69], which leads to gain of self-renewal capacity trough chromatin modifications [85,86]. Among other cancers with increased LSD1 expression are AML, MCL [87], prostate cancer [88], bladder cancer [89] and neuroblastoma [90]. When LSD1 is inhibited, AML cells are forced into a differentiation program with loss of self-renewal capacity [91]. Therefore, LSD1 inhibition is considered as a therapeutic strategy in different cancers such as AML [92], MLL [93], GFI1-activated medulloblastoma [94] and small cell lung carcinoma (SCLC) [95]. An overview of LSD1 inhibitors currently tested in clinical trials is given in Table 1.

Table 1. Overview of LSD1 inhibitors in clinical trials. Phase 1 studies for GSK2879552 were terminated due to unfavorable risk benefits. Clinicaltrials.gov was consulted on 4/11/2018, clinicaltrialsregister.eu was consulted on 29/01/2019 [59,96,97].

Although the development of irreversible LSD1 inhibitors has been more successful than the development of reversible inhibitors, reversible inhibitors may alleviate some side effects of irreversible compounds. Irreversible inhibitors like tranylcypromine derivates have not only long-lasting effects on the LSD1 target but also off-target effects [98]. However, only the irreversible tranylcypromine derivates seem to be capable of inducing differentiation response in AML [78].

Mechanistic effects of LSD1 inhibition

Since LSD1 is structurally related to MAO-A/B proteins, inactivators of MAO-A/B (for example: tranylcypromine) seemed promising therapeutics. Structural and mass spectrometry studies showed an irreversible covalent construct between tranylcypromine (TCP) and FAD in LSD1 forming a tetracyclic adduct [98]. However, the phenyl ring of the TCP-FAD complex does not form extensive interactions with active-site residues encouraging the development of more potent inhibitors [99]. Tranylcypromine derivatives are small molecular inhibitors made to be more selective for demethylases. They are effective and show a synergistic activity with antileukemic drugs [100].

LSD1 and CoRest can form a complex with GFI1(b) to down regulate gene promotors (Figure 9A). Different LSD1 inhibitors are found to disrupt the interaction between LSD1 and GFI1(b) in AML. The physical separation of LSD1/CoRest from GFI1(b) by both reversible and irreversible LSD1 inhibitors leads to H3K4me2 accumulation on LSD1 target genes and elevated acetylation of GFI1(b) target genes inducing enhancer activation (Figure 9B).

COMPOUND CLINICAL TRIAL STAGE WORKING MECHANISM

GSK2879552 Phase 2 in MDS with and without Azacitidine Terminated phase 1 in relapsed SCLC Terminated phase 1 in AML

Tranylcypromine derivative (irreversible)

Tranylcypromine Phase 1 in AML Phase 2 in MDS

MAO inhibitor, covalent adduct with FAD (irreversible)

IMG-7289 Phase 1 in AML and MDS Tranylcypromine derivative (irreversible)

INCB059872 Phase 1 in EWS Phase1/2 in advanced malignancies

FAD-directed (irreversible)

SP-2577 Phase 1 in relapsed EWS Benzohydrazide analog (reversible)

ORY-1001 Pilot study in AML and SCLC Phase 1 in AL

Tranylcypromine derivative (irreversible)


12

ORY-1001, T-3775440 and OG86 initiate blast differentiation in AML [101–103]. ORY-1001 also targets the subpopulation of leukemic stem cells and OG86 impairs proliferation. TCP derivatives are therefore able to reactivate PU.1 target genes, which results in differentiation

[78]. PU.1 and C/EBP motif signatures characterize regions with increased chromatin

accessibility after LSD1 inhibition. Interestingly, when the expression of PU.1 or C/EBP is dysregulated, AML cells become resistant to LSD1 inhibition [104].

Benzohydrazide analogs are reversible drugs and are able to disrupt the interaction between CoREST and LSD1 [98,105].

LSD1 inhibition through ORY-1001 was found to activate the NOTCH pathway in SCLC and thereby downregulate tumorigenesis. It was found that LSD1 binds the NOTCH1 locus to suppress NOTCH1 expression and its downstream signaling [106]. In T-ALL, NOTCH1 assembles a multifunctional complex with LSD1. LSD1 is a component of the CSL-repressor complex and the NOTCH1-activation complex [107].

2.3 LSD1 inhibition in T-ALL

Sensitivity to the LSD1 inhibitor GSK2879552 is seen in 30% of tested T-ALL cell lines [84]. Cancer cell lines with high ZEB2 levels (LOUCY and PEER) are sensitive to the LSD1 inhibitor, but cell lines without high ZEB2 levels (HSB-2 and RPMI-8402) can also be sensitive. The in vitro sensitivity to LSD1 inhibition (Figure 10A) is higher than the in vivo sensitivity (Figure 10B). When sensitive human T-ALL cell lines were injected in NSG mice and treated with

Figure 9. The effect of the GFI1/LSD1 complex and its inhibition on gene expression. (A) GFI1 is able to recruit the LSD1/CoRest complex towards enhancers via its SNAG domain, inducing repression of PU.1 (SPI1) regulated genes. (B) Different LSD1 inhibitors are able to physically separate LSD1 from GFI1, which leads to an increased enhancer acetylation and transcription of PU.1 target genes. Figure adapted from [103].


13

GSK2879552, a decrease of malignant cells was seen in the blood. However, no changes in spleen weight were observed. In vivo, the leukemic cells interact with their cancer microenvironment which might influence the sensitivity to drugs. When interleukin 7 (IL7), a JAK/STAT ligand, was added to the medium of sensitive Zeb2-overexpressing mouse T-ALL cell lines, a decrease in sensitivity to LSD1 inhibition was seen in vitro (Figure 10C). Combination with different chemotherapies and GSK2879552 were tested in the lab. Synergism between GSK2879552 and dexamethasone has been observed in vitro (unpublished).

A

C

B

Figure 10. In vitro and in vivo LSD1 inhibition in T-ALL cell lines. (A) Cell viability of human T-ALL cell lines after 12 days of treatment with the LSD1 inhibitor GSK2879552. Cell lines indicated in red are sensitive to the inhibitor. (B) Cell viability of murine T-ALL cell lines with (red) or without (blue) Zeb2 overexpression after treatment with the LSD1 inhibitor with or without exogenous IL7. (C) Percentage leukemia cells and percentage spleen/body weight after administration of the LSD1 inhibitor (red) or DMSO (blue) in NSG mice xenotransplanted with a human T-ALL cell line. Figures from [84].


14

PART III Research objectives

3.1 Combination therapy of LSD1 inhibition and targeted therapies

The combination of LSD1 inhibition and standard chemotherapeutic agents may be the easiest way to find a combination that rapidly can be translated to the hospital, because both are already applied or in clinical trial. However, it might also be interesting to study the effectiveness of the combination of LSD1 inhibition and another targeted therapy. An extended survival in PDX mouse models of AML was seen after combination of ORY-1001, a LSD1 inhibitor, and standard-of-care drugs or epigenetic inhibitors [102]. In this research project, the combination between the LSD1 inhibitor GSK2879552 and five rationally chosen targeted drugs will be tested on T-ALL cell lines (Figure 11).

A

B

C

Figure 11. Working mechanism of targeted therapies. (A) Decitabine inhibits DNA methyltransferase (DNMT). (i) Decitabine (DAC) is a cytidine analog. (ii) In the absence of DAC, DNMT will be able to hypermethylate the DNA and the cancer can further develop. (iii) When DAC is present, it will be incorporated in the DNA during replication. This DAC can bind DNMT irreversibly and in that way inhibit the DNA methylation process. Figure adjusted from [45]. (B) HDACi improves transcriptional activity. HDAC inhibitors are able to promote acetylation of histones, leading to an increase in cell death and a decrease in proliferation and migration. Figure from [127]. (C) Effect of ABT-199, ABT-263 and Ruxolitinib on apoptosis. Ruxolitinib inhibits the JAK/STAT pathway and thereby indirectly induces apoptosis, while ABT-199 and ABT-263 directly induce apoptosis by inhibiting anti-apoptotic proteins like BCL-2 and BCL-XL. Figure based on [111,113,115].


15

A first targeted drug that will be evaluated in combination with GSK2879552 is Decitabine. This epigenetic drug is a hypomethylating agent with DNA methyltransferase (DNMT) inhibitor capacity. Decitabine is a cytidine analog and can as such incorporate itself into the DNA chain and irreversibly bind to a DNMT. This avoids hypermethylation of the DNA, which is critical for the development of cancer cells (Figure 11A) [108]. Decitabine has already shown clinical activity in AML [44] and a synergistic link between DNMT inhibition and LSD1 inhibition has been reported [72].

Romidepsin is a selective inhibitor of HDAC and will also be evaluated in combination with the LSD1 inhibitor. Both HDAC1 and HDAC2 form a complex with LSD1. Romidepsin binds to HDAC and treatment results in enhanced histone acetylation and active transcription of genes (Figure 11B) [109]. HDAC inhibitors have already shown clinical activity in ALL [110] and Romidepsin is already FDA approved for cutaneous T-cell lymphoma.

The other three targeted drugs that will be combined with GSK2879552 are ABT-199 (Venetoclax), ABT-263 (Navitoclax) and Ruxolitinib, all leading to the induction of apoptosis (Figure 11C). ABT-199 and ABT-263 inhibit anti-apoptotic protein(s) of the BCL-2 family members, respectively only BCL-2 and both BCL-2 and BCL-XL [111]. Both inhibitors are included because only one of the GSK2879552-sensitive human T-ALL cell lines (LOUCY) is sensitive to ABT-199, while more mature T-ALL cell lines are more sensitive to ABT-263 [112]. ABT-199 is already been shown to have clinical activity in T-ALL [113]. Venetoclax and Navitoclax are both tested in clinical trials for ALL patients. Activation of JAK-STAT pathway by IL7R is needed to maintain growth, proliferation and survival of early T-cell progenitor cells [114]. In T-ALL, hyperactivation of the IL7R-JAK-STAT pathway occurs frequently and might be responsible for a decreased sensitivity to LSD1 inhibition. When the JAK/STAT pathway is activated, BCL-2 and BCL-XL expression can be upregulated. By inhibiting JAK via Ruxolitinib, the activation of the JAK-STAT pathway cannot occur, the pathway has no negative influence on the LSD1 inhibition and therefore the proliferation and survival of the T-ALL cells will be decreased [115].

3.2 Molecular biology of LSD1 and LSD1 inhibition in T-ALL

Another aspect of this research is to better understand why some cell lines are sensitive to LSD1 inhibition and others not. Therefore, acquiring a better comprehension of the molecular biology of LSD1 and LSD1 inhibition in T-ALL cells is necessary. Interactions between LSD1 and proteins of interest were studied via IP and western blot. A first interaction of interest is based on the results of a mass spectrometry where interaction between LSD1 and IKZF1 (Ikaros), a transcription factor that plays a role in T-ALL, was observed in nuclear extracts of PEER cells. The interaction between LSD1 and GFI1(b) and PU.1 was also studied, based on the differentiation-inhibiting LSD1-dependent role of GFI1 of PU.1 target genes in medulloblastoma [94] and AML [103]. Lastly, the influence of LSD1 inhibition on the stability of DNMT1 was tested via western blot, based on the mechanistic link between these proteins [71].

3.3 Histone epigenetics in T-ALL cell lines

First, the differences in genome-wide presence of H3K27ac between treatment with the LSD1i versus vehicle was explored by chromatin immunoprecipitation (ChIP) sequencing to discover differences in activated genes. Next, to detect differences in histone epigenetics between LSD1i sensitive and resistant T-ALL cell lines in steady state, mass spectrometry was performed on multiple T-ALL cell lines to obtain an unbiased look of all histone modifications.


16

MATERIALS AND METHODS

1. Cell culture

T-ALL cell lines (DSMZ) were grown in RPMI-1640 medium (Gibco: 52400041) supplemented with 10% (HEK293T, HSB-2, JURKAT, LOUCY, MOLT-16, MOLM-13, RPMI-8402) or 20% (ALL-SIL, HPB-ALL, PEER, TALL-1) heat-inactivated fetal bovine serum (FCS) (Bovogen Biologicals: SFBS), penicillin (100 U/ml)-streptomycin (100 μg/ml) (Gibco: 15140-148) and 2 mM L-glutamin (Gibco: 25030024) and incubated at 37°C with 5% CO2 and 95% humidity.

2. IC50 determination and combination therapies of GSK2879552 and targeted

therapies

2.1 Treatment of cells with dilution series of the targeted therapies To determine the IC50 of ABT-199 (MedChem express: HY-155531), ABT-263 (MedChem Express: HY-10087), Romidepsin (Selleck chemicals: S3020) and Ruxolitinib (MedChem Express: HY-50858), a concentration series for each compound was tested on four human T-ALL cell lines (HSB-2, LOUCY, PEER, RPMI-8402) that are sensitive to GSK2879552 (MedChem Express: HY-18632). The compounds were dissolved in DMSO and diluted in medium. Cells were seeded in white Nunc F96 MicroWell plates (ThermoFisher: 136101). For LOUCY, PEER and RPMI-8402 25 000 cells and for HSB-2 50 000 cells were added in each

well in 95 l complete RPMI-1640 medium with 10% FCS. To each well, 5 l of the correct DMSO (0 nM point) or compound concentration was added. For each cell line, the dilution series of the compounds were optimized in order to center the concentration around the IC50. The percentage DMSO was equal in each concentration point. Two wells with only medium (blank control) were also included in each plate. For each cell line, each concentration point was tested twice in the same plate (technical replicates). At least three biological replicates were performed (experiment was repeated on different days).

2.2 CellTiter-Glo Viability assay and IC50 calculation After a treatment of 72 hours, the cell viability was read out via the CellTiter-Glo® Luminescent

Cell Viability Assay (Promega: G7573). 50 l of the CellTiter-Glo reagents, which contains luciferin and luciferase, was added to each well before the plate was shaked for 2 minutes. 10 minutes later, the GloMax® Discover Multimode Microplate Reader (Promega) was used to detect a luminescent signal that is in proportion to the amount of released ATP. The IC50 was determined via the software GraphPad. Concentrations were transformed to logarithms (log 10). For the XY analyses, a nonlinear regression (curve fit) equation was used, namely dose-response – stimulation: log(agonist) vs normalized response – variable slope.

2.3 Combination therapies LOUCY and PEER were treated with a 2-fold dilution series of GSK2879552 (from 4 times the IC50 until 0.125 times the IC50) for 12 days. It was previously reported that an effect on the viability of cells treated with the LSD1 inhibitor is only seen after 12 days of treatment. Therefore, treatment with GSK2879552 was initiated first. Every two or three days, the cells were split at a ratio based on the cell count in the DMSO-treated control. Fresh RPMI-1640

medium (with 10% FCS for LOUCY, 20% FCS for PEER) and 10 l compound were added in

a 24-well plate (FALCON: 353047) with a total volume of 950 l. At day 8 (for the combinations with Decitabine) or day 9 (for the combinations with ABT-199 (only in LOUCY), ABT-263, Romidepsin and Ruxolitinib), cells were seeded in a white Nunc F96 MicroWell plate. To evaluate the synergism between GSK2879552 and the targeted therapies, a part of the cells was further treated with the dilution series of GSK2879552 alone, a part of the cells (treated with DMSO during the previous days) was treated with a dilution series of the targeted therapy


17

alone and a part of the cells received both GSK2879552 and the targeted therapy. A 2-fold dilution series centered around the IC50 was used for the targeted drugs. The combinations were added at the constant ratio of the IC50’s. Two technical replications were performed. Only one biological replication was performed successfully. At day 12, the viability in each well was read out via a CellTiter-Glo Viability Assay. Next, the combination index between GSK28798552 and each of the targeted therapies was calculated via the Chou-Talalay method in CalcuSyn. A combination index lower than one, indicates synergism between the two drugs. Different gradations of synergism can be determined: 0.0 < CI < 0.1 – very strong synergism, 0.1 < CI < 0.3 – strong synergism, 0.3 < CI < 0.7 – synergism, 0.7 < CI < 0.85 – moderate synergism, 0.85 < CI < 0.9 – slight synergism, 0.9 < CI < 1 – nearly additive.

3. ChIP-sequencing of H3K27ac in LOUCY with spike-in

Chromatin immunoprecipitation (ChIP) sequencing of H3K27ac was performed on LOUCY cells which either received the LSD1 inhibitor GSK2879552 or DMSO. Spike-in chromatin was added for data normalization. Incubation, rotation and centrifugation of samples were performed at 4°C when not mentioned differently.

3.1 Treatment and crosslinking of LOUCY cells

LOUCY cells (0.7 x 106 cells/ml) were treated with 100nM GSK2879552 (DMSO as solvent) or an equal amount of DMSO. After 48 hours incubation, 12 million cells from each treatment condition were collected by centrifuging at 1000 rpm for 5 minutes at room temperature (RT)

and resuspended in 2.5 ml complete medium. Cells were fixed by adding 166.6 l of the methanol-free 16% formaldehyde solution (Thermo Fisher: 28908), followed by rocking the

cells for 7 minutes at RT to allow efficient crosslinking. By adding 141.4 l of 2.5 M glycine (Merck: G8790), the crosslinking reaction is quenched, making the pH indicator in the medium turn yellow. After rocking the cells 5 minutes at RT and spinning down the cells at 1000 rpm for 5 minutes at RT the supernatant is aspirated. Cells were washed twice in 5 ml cold PBS and spun down at 2600 rpm for 5 minutes before the PBS was aspirated and the cell pellet was snap frozen at -150°C and stored at -80°C. Three biological replicates were performed.

3.2 RNA isolation, cDNA synthesis and RT-qPCR

After the 48 hours treatment, a small part of the cells was collected to confirm whether

treatment had an effect on gene expression. Cell pellets were resuspended in 350 l RLT

buffer and 3.5 l -mercaptoethanol (Merck: M3148) and stored at -80°C until RNA isolation was performed with the RNeasy® Plus Mini Kit (Qiagen: 74134). For cDNA synthesis 500 ng RNA was converted to cDNA with the iScript Advanced cDNA Synthesis Kit (Bio-Rad: 172-

5038). cDNA was diluted to 2.5 ng/l before qPCR was performed. For each target gene, a

mastermix of the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad: 172-5265) and the forward and reverse primer was made (10:1:1 ratio). Primers against three genes of interest (CD11b, GFI1, MN1) and five reference genes (HMBS, RPL13A, SDHA, TBP, UBC) were used

(Supplemental table 1). To perform qPCR a white LightCycler 480 Multiwell Plate 384

(Roche: 04 729 749 001) was filled by adding 2 l cDNA (5 ng) to 3 l mastermix. Each gene

was analyzed in duplicate in each sample. The qPCR was run on the LightCycler 480 instrument (Roche) and qBase+ software (Biogazelle) was used to select stable reference genes and to analyze the expression data. Two stable reference genes are sufficient for accurate normalization. However, cancer cells have more variation in their expression and therefore a minimum of three stable reference genes is preferred. The geNorm M value should be below 0.5 and the coefficient of variation (CV) on the normalized relative quantities (NRQ) for the reference assays should be below 0.2 [116].


18

3.3 Nuclei preparation

Nuclei preparation was performed on 12 x 106 crosslinked cells using the truChIP® Chromatin Shearing Kit (Covaris: PN 520154) reagents. Nuclei were resuspended in 1 ml of shearing buffer D3 and kept on ice until shearing.

3.4 Shearing via sonication with Bioruptor Pico Sonication system

First a time-course sonication experiment with the Bioruptor Pico Sonication system (Diagenode) was performed to optimize the amount of sonication cycles. Nuclei preparation of 30 million crosslinked LOUCY cells treated with DMSO was carried out as mentioned above. In a first experiment 5, 10 and 15 sonication cycles 30’’ ON/30’’ OFF were tested. In a next experiment 10, 11, 12, 13, 14 and 15 sonication cycles were done. Samples underwent reverse crosslinking, proteinase K (Merck: P2308) and RNase A (Qiagen: 19101) treatment and were

then analyzed on the Fragment Analyzer (Advanced Analytic Technologies) with the High Sensitivity Small Fragment Analysis Kit 50 bp – 1500 bp (Agilent Technologies: DNF-477-0500). The number of fragments with the desired size (100 – 500 bp) was largest after 13 sonication cycles 30’’ ON/30’’ OFF. Therefore, 13 sonication cycles were performed for the

ChIP-seq experiment. Each sample was subdivided in 4 times 250 l containing 3 million cells for the shearing.

3.5 Addition of spike-in and chromatin immunoprecipitation (ChIP)

The sonicated chromatin of 1 million cells was collected to use as input sample for western blot. To each sample of the remaining 11 million cells 308 ng spike-in chromatin (Active Motif: 53083) was added. 1 million cells were collected as DNA input and stored at -20°C. To the

remaining samples of 10 million cells, 10 l effective Pierce Protein A UltraLink Resin beads (Thermo Fisher: 53133) were added to clear the lysate from non-specific binding proteins. Effective beads were obtained after washing them 5 times with 1 ml RIPA lysis buffer (0.5% sodium deoxycholate, 150 mM NaCl, 5% of 1 M TrisHCl, 0.1% of 10% SDS solution and 1% of 10% NP-40, extended to 100% with distillated H2O) containing Complete Protease

Inhibitor Cocktail (Roche: 11697498001) and resuspending them in 60 l RIPA buffer. Samples were incubated for 2 hours in 4°C while rotating. Next, samples were centrifugated for 1 minute

at 1000 rpm and supernatants were collected for ChIP. For ChIP, 2 g of the anti-H3K27ac

antibody (Ab) (Abcam: ab4729) and 4 g of the spike-in Ab (Active Motif: 61686) were added to the samples. To allow binding of the antibody to its protein of interest, the samples were rotated overnight at 4°C.

3.6 Preparation, addition and washing of the beads

For each ChIP on 10 million cells, 10 l effective beads were added. Effective beads were obtained after washing them 4 times with 1 ml RIPA buffer containing Complete Protease

Inhibitor Cocktail, adding 500 l RIPA buffer with 1 g/l BSA (Merck: A7030) followed by rotation for 2 hours to block the beads and a final wash with 1 ml RIPA. Samples were incubated with the beads for 2 hours on the rotator. Supernatant was removed after centrifuging the samples for 1 minute at 1000 rpm. Beads were resuspended in 1 ml of RIPA

buffer with protease inhibitors and washed 5 times with RIPA buffer. Finally, 120 l ChIP elution buffer (50 mM Tris-HCl, 10 mM EDTA, 1% SDS, extended to 100% with distillated H20) was

added to each sample. 20 l bead suspension was collected as ChIP control sample for the western blot.

3.7 DNA isolation

For the DNA input samples (50 l), 150 l ChIP elution buffer was added. The samples were incubated at 65°C overnight to promote reverse crosslinking of the DNA and stored at -20°C.

For the DNA ChIP samples, an extra 100 l of ChIP elution buffer was added and samples were incubated at 65°C for 15 minutes while vortexing every 2 minutes to eluate the chromatin

from the beads. After centrifugation for 1 minute at 16 000 g, 200 l elution buffer was added to the pellet. Samples were incubated at 65°C overnight to reverse the crosslinking and stored


19

at -20°C. 200 l TE buffer (10 nM Tris-HCl, 10 mM EDTA, 1% SDS, extended to 100% with H2O) was added to the DNA input and ChIP samples to dilute SDS in elution buffer. RNAse A was added in a final concentration of 0.2 ml/ml and samples were incubated for 2 hours at

37°C. Next, proteinase K was added to a final concentration of 0.2 g/ml and samples were incubated for 2 hours at 55°C. DNA isolation was performed via the Chromatin IP DNA Purification Kit (Active Motif: 58002).

DNA concentration was measured with the Qubit dsDNA High Sensitive Assay Kit (Thermo Fisher: Q32851). The size of the DNA in the input samples was measured via the Fragment

Analyzer to check the sonication.

3.8 Western blot

For the input samples, 1 million cells were collected after shearing and stored in -20°C. Later, input samples were mixed with the ChIP elution buffer at a 1:3 ratio and incubated overnight

at 65°C to reverse the crosslinking of proteins. 5x Laemmli buffer with -mercaptoethanol was added to the samples in a 1:4 ratio and incubated for 10 minutes at 95°C for denaturation. For the IP control samples, bead suspension was mixed with Laemmli buffer (40% 5x Laemmli,

55% RIPA, 5% -mercaptoethanol) at a 1:1 ratio. After 10 minutes incubation at 95°C in a shaking thermomixer to denature and eluate the proteins from the beads, samples were incubated overnight at 65°C to reverse the crosslinking of the proteins and stored in -20°C. To

perform gel electrophoresis, 20 l of the samples was loaded on the 10% Mini-PROTEAN

TGX Precast Protein Gels (Bio-Rad: 4561033) and 4 l of the Page Ruler Plus Prestained protein ladder (Perbio: 26620). To identify H3K27ac, the anti-H3K27ac antibody was added to the blot (1/1000 in 5% BSA/TBST) and incubated overnight. To visualize the spike-in chromatin, the spike-in antibody (1/1000 in 5% BSA/TBST) was added to the blot and incubated overnight. Both blots were visualized on the Amersham Imager 680 (GE healthcare) after addition of anti-rabbit HRP-linked antibody (Cell Signaling: 7074S, 1/25 000 in 5% BSA/TBST) via SuperSignal West Dura Extended Duration Substrate (ThermoFisher: 34075).

3.9 Library prep and sequencing

Library prep was performed on 50 ng DNA of each sample via the NEBNext Ultra DNA library

prep kit for Illumina (BioLabs: E7370) with the aid of NEBNext Multiplex Oligos for Illumina (BioLabs: E7335S) and AMPURE XP Beads (Beckman Coulter: A63881). NEBNext End Prep was followed by adaptor ligation and cleanup of the adaptor-ligated DNA without size selection. Adaptor-ligated DNA was enriched via 8 PCR cycli and the PCR reaction underwent cleanup.

1 l of the DNA was added to 1.5 l H2O for analysis with the Fragment Analyzer. Pippin

Prep was performed with Dye-Free, 2% Agarose Gel Cassettes (Sage Science: CDF2010) to select DNA fragments between 200 – 600 bp. Next, glycogen precipitation was performed

to precipitate the DNA. 40 l of the Pippin Prep elution sample was mixed with 2 l glycogen

(Invitrogen: 10814-010), 30 l 3 M NaOAc (Merck: S-2889) and an excess of chilled EtOH (VWR: 20821.296), followed by centrifuging the samples for 15 minutes at 4°C at 20 000 g.

The pellet was washed with 500 l 70% EtOH and centrifuged for 2 minutes at RT at 20 000

g. By placing the tubes in a 37°C heatblock, pellets were dried before resuspension in 10 l 10 mM Tris-HCl (MP Biomedicals: 819623, Merck: 1.09057) pH 8. Single-end sequencing was performed by NXTGNT on fragments with size 200 – 600 bp by the NextSeq500 (Illumina) with the High Output Kit v2 (75 cycles, Illumina: FC-404-2005). The FASTQ file generated by sequencing was analyzed. After QC with fastQC, reads were aligned to human hg38 and Drosophila melanogaster BDGP6 using STAR v2.4.2a with --outFilterMultimapNmax 1 to filter out multimapping reads and --alignIntronMax 1 to suppress splice awareness. Peak calling was performed with MACS2 using input as control.


20

4. Studying interactions with LSD1 via immunoprecipitation (IP)

4.1 IP on RIPA lysates

10 x 106 cells from HPB-ALL, JURKAT, LOUCY and PEER were lysed by adding 1 ml of the RIPA buffer containing protease inhibitors and rotating the samples for 1 hour at 4°C. After centrifuging the samples for 10 minutes at 8000 g, the supernatants were transferred to a new

Eppendorf tube. 400 l supernatant of each sample was mixed with 4 l of anti-LSD1 Ab

(Abcam: 17721) and 400 l was mixed with 4 l rabbit (DA1E) mAB IgG XP Isotype Control (Cell Signaling: 3900) as negative control. The remaining supernatants was stored at -80°C.

After washing the Protein A beads four times with RIPA buffer, 20 l of effective beads was added to the samples. Samples were rotated overnight at 4°C. After centrifugation for 1 minute

at 1000 rpm, supernatants were discarded. For denaturation, 40 l of denaturation buffer (5x

Laemmli and -mercaptoethanol, 7:1 ratio) was added to the IP pellet and to 40 l of the lysate collected before IP. Samples were shaked for 10 minutes at 95°C.

4.2 IP on nuclear extracts

Pellets of 100 x 106 PEER, HSB-2 and RPMI-8402 cells were washed with 10 ml PBS. After spinning down the cells for 5 minutes at 4°C at 1100 rpm, the pellets were resuspended in 3 ml buffer A (10 mM Hepes 7.6, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT and protease inhibitor) and incubated 10 minutes on ice. After spinning down the cells for 10 minutes at 3000 rpm, the pellets were resuspended in 3 ml buffer A. The cell suspensions received 10 strokes with pestle A in the Dounce Homogenizer. After centrifugation, 2 ml supernatant was kept on ice as cytoplasmic fraction and the pellets were resuspended in 3 ml buffer C (20 mM Hepes 7.6, 20% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT and protease inhibitor). The cell suspensions received 10 strokes with pestle B in the Dounce Homogenizer. The suspensions were rotated for 30 minutes at 4°C. After centrifugation for 15 minutes at 13000 rpm, nuclear extracts (NXT) were found in the supernatant. The nuclear pellets are

saved as a control. After incubating the Slide-A-Lyzer dialysis cassettes (Thermo Fisher) in buffer D (20 mM Hepes 7.6, 20% glycerol, 100 mM KCL, 1.5 mM MgCl2, 0.3 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF and sodium meta bisulfite), the NXT were injected into the cassettes. For dialysis, the cassettes were incubated two times for 2 hours in buffer D at 4°C. After spinning the dialyzed NXT for 15 minutes at 13000 rpm, the supernatants were collected for immunoprecipitation.

After washing Protein A beads four times with 1 ml of buffer C-100* (20 mM Hepes 7.6, 20% glycerol, 100 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.02% NP40, 0.5 mM DTT and protease

inhibitor), 250 l of NXT were combined with 20 l effective beads and 2.5 l anti-LSD1 Ab,

0.5 l anti-IgG Ab (Cell Signaling: 7076S), 7.5 l anti-Ikaros Ab (Bioké: 14859S), 8 l anti-GFI1

Ab (Santa Cruz: sc-376949) or 8 l anti-GFI1b Ab (Cell Signaling: 5849S) wherefore IP was performed on 17 x 106 cells. Samples were incubated overnight at 4°C. After spinning for 1 minute at 1000 rpm, the pellets were washed four times with 1 ml buffer C-100*. For

denaturation, 40 l of denaturation buffer was added to the bead pellets and 10 l was added

to 40 l of the cytoplasmic fraction and to the NXT. Samples were incubated for 10 minutes at 95°C.

4.3 Western blot after IP

10% Protein Gels were loaded with 25 l of the samples and 4 l of the Page Ruler Plus Prestained protein ladder. Gel electrophoresis was performed at 100V. Next, the gels were blotted on a nitrocellulose membrane (Bio-Rad: 1620233) at 100V. The primary antibodies, in which the blots were shaked overnight at 4°C, were anti-LSD1 Ab (1/100 in 5% milk/TBST), anti-Ikaros Ab (1/1000 in 5% milk/TBST), anti-GFI1 (1/100 in 5% milk/TBST) and anti-IKZF1 Ab (1/1000 in 5% milk/TBST). After three times washing with TBST buffer, the secondary antibody was added and incubated for 1 hour on shaker at RT. As secondary antibody VeriBlot-


21

rabbit-HRP (Abcam: ab131366, 1/2000 5% milk/TBST) or VeriBlot-anti-mouse-HRP (Abcam:

ab131368, 1/2000 5% milk/TBST) was used. The blots were developed with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher: 34096).

5. Mass spectrometry of histones

Incubation, rotation and centrifugation of samples was performed at 4°C when not mentioned differently.

5.1 Collection of T-ALL cells

To compile a T-ALL cell line panel for histone extraction, pellets of 4 x 106 cells for four LSD1 inhibition sensitive cell lines (HSB-2, LOUCY, PEER, RPMI-8402) and four LSD1 inhibition resistant cell lines (HPB-ALL, JURKAT, MOLT-16, TALL-1) were collected. Collection was performed 24 hours after seeding the cells at 1 million cells/ml in fresh complete RPMI-1640 medium with 10% FCS. Cells were centrifuged (1500 rpm, 5 minutes) and washed with 1 ml cold PBS. The pellets were snap frozen at -150°C and stored at -80°C. Six biological replicates of each cell line were collected.

5.2 Histone extraction from T-ALL cells

Two protocols for histone extraction (optimized by the research group of prof. Deforce), hypotonic lysis buffer (HLB) extraction and direct acid (DA) extraction, were tested. For the

HLB extraction protocol, 400 l of HLB (10 nM Tris, 1 mM KCl, 1.5 mM MgCl2.6H2O, 1 mM DTT) was added to a cell pellet containing 2 x 106 cells. The samples were rotated for 30 minutes to promote lysis of cell membranes and centrifuged at 10 000 g for 10 minutes. Then

the pellet was resuspended in 250 l 0.4N HCl by soft pipetting and incubated for 30 minutes in a rotator to promote lysis of nuclei and solubilization of histones. For the DA protocol, a pellet

of 2 x 106 cells was immediately resuspended in 250 l 0.4N HCl (Millipore: UN1789) by soft pipetting and incubated for 2 hours in a rotator to promote lysis of nuclei and solubilization of histones. For the next steps, samples from both extraction protocols were handled the same

way. After a 10 minutes spin at 16 000 g, 120 l of TCA (Merck: T6399-100G) was added drop

by drop to 240 l supernatant to promote precipitation of histones. This solution was incubated on ice for 30 minutes before histones were pelleted by spinning for 10 minutes at 16000 g. The

pellets were washed twice with 150 l ice-cold acetone and after drying at RT in a CentriVap

(Labconco) or Concentrater Plus (Eppendorf) they were resuspended in 100 l Milli-Q

(Millipore) water. 20 l was collected for gel electrophoresis and the remaining solution was dried again. Gel electrophoresis of the samples from both conditions was performed to quantify

extracted histones. 0.4 x 106 cells were resuspended in 10 l Laemmli buffer and 1 l -

mercaptoethanol, followed by incubation for 10 minutes at 95°C. Samples and 2 g of bovine

histones (Roche: 10223565001) were loaded on a 18% Criterion Tris-HCl gel (Bio-Rad:

3450024) or 9-16% Mini-PROTEAN TGX Precast Protein Gel (Bio-Rad: 456-1103). Gel electrophoresis was performed on 200V. Afterwards the gel was incubated in fixation-solution (7% acetic acid, 10% methanol, extended to 100% with Milli-Q water) for 10 minutes, washed three times in Milli-Q water and incubated overnight in SyproRuby (Merck: S4942-200ML). VersaDoc (Bio-Rad) was used to visualize the gel. It showed that histone extraction was efficient via the shorter DA extraction method which minimizes the time frame wherein residual activity of epigenetic mediators can change the histone fingerprint. Therefore, following histone extractions were performed via the DA method.

5.3 Propionylation and trypsin digest

For the first propionylation, 20 l of 1 M TEAB (Merck: T7408) and 20 l of the propionylation reagent (HPLC grade 2-propanol (Biosolve: 162606):propionic anhydride (Merck: 240311) in

a 75:5 ratio) was added to the dried histones. After 30 minutes incubation at RT, 20 l H2O


22

was added and the samples were incubated for 30 minutes at 37°C. Next, the samples were

vacuum dried. Trypsin digest was performed by adding 50 l of a mixture containing 500 mM

TEAB, 1 mM CaCl2, 5% ACN and 0,1 g trypsin (Promega: V5111, 0.1 g/l in 0.5 M TEAB)

per 2 g extracted histones, followed by overnight incubation at 37°C and vacuum drying. Next, a second propionylation was performed. Finally, reversing overpropionylation was done by

adding 50 l of 0.5 M NH20H and 15 l of NH40H (pH = 12). After 20 minutes incubation at

RT, pH was adjusted by adding 30 l of 100% formic acid. The samples were vacuum dried.

5.4 Mass spectrometry

The mass spectrometry was performed by the lab of prof. Deforce on the Eksigent LC425 – Micro LC (AB Sciex) and Q-TOF TripleTOF 5600+ (AB Sciex) equipment.

The histone extracts were dissolved in 0.1% formic acid in HPLC grade water (Merck:

V270733). 50 fmole of Beta-Galactosidase (Sciex: 4333606) and MassPREP Digestion Standard Mix 2 (Waters: 186002866) were spiked into each sample, as internal standard. A quality control was created by mixing a fixed amount of each sample. The peptides were separated on a microLC YMC Triart C18 column (internal diameter: 300 μm, length: 15 cm, particle size: 3 μm) at a flow rate of 5 μl/min by means of trap-elute injection on a YMC Triart C18 guard column (internal diameter: 500 μm, length: 5 mm, particle size: 3 μm). Gradient elution was performed with buffer A, consisting of 0.1% formic acid (FA) and 3% DMSO in HPLC water and buffer B containing 100% acetonitrile spiked with 0.1% FA. DDA acquisition was performed by injecting approximately 2 µg of histone extract. MS1 spectra were collected at 400-1250 mass over charge ratio (m/z) for 250 ms, while MS2 spectra were collected at 65-2000 m/z for 200 ms. After MS1, the 20 most intense precursors with charge states 2-5 and a spectral count of 300 counts/s were selected for fragmentation. After fragmentation, a dynamic exclusion was implemented to prevent reselection of precursor ions for 10 seconds.

5.5 Data analysis

Progenesis QI for proteomics (Nonlinear Dynamics) was used for the data analysis. The software automatically performs peak picking and feature alignment for the retention time dimension. In the subsection “identify peptides”, tandem MS spectra of rank 3 or lower were exported as Mascot Generic Format (mgf). Subsequently, these .mgf’s were searched with Mascot, a database search algorithm, against a swissprot reviewed human .fasta database. Propionyl on lysine and the protein N-term were set as fixed modifications respectively. Furthermore, acetyl, dimethyl, trimethyl, butyryl and formyl on lysine residues were set as variable modifications. Arg-C was used as enzyme specificity and no missed cleavages were allowed.

6. Knock down of GFI1 and GFI1b in LOUCY

6.1 Transformation

Lentiviral MISSION vectors (Merck) that express a shRNA were used (Supplemental table 2). The puromycin resistance marker was replaced by GFP. Each plasmid DNA (50 - 100 ng

in 1 l) was added to 25 l of the E. coli Stabl3 bacteria from NEB Stable kit (BioLabs: C3040I) and tubes were tapped to make sure the vectors were near the cells. To open the membrane, the mix was first incubated on ice for 30 minutes followed by 30 seconds in a warm water bad at 42°C. By keeping the mix for 5 minutes on ice, membranes were closed again.

950 l LB broth medium (VWR: 84649.0500) was added and the mix was shaked for minimum

1 hour at 37°C. 50 l was plated on LB/agar plates (Lennox: 240110) with 100 g/ml ampicillin and plates were incubated overnight at 37°C. One colony was picked and prepped in LB medium. Glycerol stocks were made by adding 1 ml LB medium with bacteria to 1 ml glycerol


23

(50% glycerol (Merck: 1.04094), 50% Sigma water) in cryogenic vials (ThermoFisher: 5000-0012) and stored at -80°C.

6.2 Preparation and testing of plasmids

Each plasmid was grown up by adding 9 l of a glycerol stock to LB medium (100 ml for high copy plasmids and 200 ml for low copy plasmids) with 1/1000 ampicillin. Falcons were shaked for 16 hours at 37°C. After centrifugation for 15 minutes at 4000 rpm at 4°C, pellets were purified by midiprep via the plasmid plus kit (QIAGEN: 12945). DNA concentrations were measured via the Nanodrop and plasmids were stored at -20°C. Lentiviral transfection of hairpin plasmids was tested in HEK293T cells. For each prepped plasmid 0.3 x 106 HEK cells were seeded in 2 ml 10% RPMI-1640 medium in a 6-well plate (FALCON: 353046). The

medium was refreshed the next day at least 1 hour before transfection. 3 g DNA of each

target vector was diluted with a NaCl solution until a volume of 100 l and mixed with 100 l of a solution of jet-PEI and NaCl (Polyplus: 101-10N and 702-50, 6:94 ratio). After 30 minutes incubation at RT, complexes were formed and the mix was added drop by drop to the cells. On the next day it was checked whether the HEK cells were GFP positive.

6.3 Transfection

For each construct, HEK cells were seeded four times in 10 cm TC-treated culture dishes (CORNING: 430167) at a density of 2 x 106 cells in 10 ml. After two days, the medium was

refreshed at least one hour before transfection. For each dish, 1.5 g p8.91, 6 g pCMV and

7.5 g target vector was mixed and diluted with NaCl to a total volume of 250 l. To each mix

250 l of a jet-PEI/NaCl solution (1:24 ratio) was added and this was incubated at RT for 30 minutes. Afterwards this solution was added drop by drop to the HEK cells and incubated overnight in a 5% CO2 incubator. Next day, it was checked whether the cells were GFP positive and the medium was refreshed. On the following day, supernatants were collected on ice and

centrifugated for 10 minutes at 4°C on 1700 rpm. To concentrate the virus, cold PEG-it virus Precipitation Solution (System Biosciences: LV810A-1) was added to the supernatants (1:4 ratio) and refrigerated at least overnight. These solutions were centrifugated for 30 minutes at 4°C on 1500 g and pellets were resuspended in 1/10 of the original volume cold medium.

6.4 Transduction

For each construct 4 wells from a 6-well plate were filled with 1 ml LOUCY cells (2 million cells) mixed with 1/250 volume polybrene (Merck: H9268-5G, diluted to 4 mg/ml). 1 ml virus was added to each well of cells. Plates were centrifuged for 90 minutes at 32°C on 2300 rpm and incubated in a 5% CO2 incubator overnight. Wells from the same construct were pooled and centrifugated for 5 minutes at 1500 rpm. Pellets were resuspended in double volume medium

and incubated in cell culture flasks. From each construct, 200 l of cells was measured on the

BD LSR II (Biosciences). Via the BD FACSDIVA software, living, single cells were gated and tested if they were GFP positive. After three days, cells were centrifuged and pellets were washed twice with PBS before cells were resuspended in FACS buffer (PBS with 2% FCS and 0.5 mM EDTA) to obtain 10 to 20 x 106 cells/ml in Polypropylene Round-Bottom Tubes (Falcon:

352063). Via the BD FACSDIVA software, living, single cells were gated and GFP positive

cells were sorted with the BD FACSAria IIIu (Biosciences).

6.5 Evaluation of GFI1 and GFI1b expression via western blot

Total lysis was performed on cell pellets of 0.4 x 106 cells (shGFI1 66 and shGFI1 67) or 0.6 x

106 cells (shGFI1b 78) by adding lysis buffer and -mercaptoethanol (1/40 -mercaptoethanol, 62,5mM TrisHCl pH 6,8, 2% SDS, 10% glycerol, 0,1% Broomfenolblue). Proteins were loaded

on 10% Mini-PROTEAN TGX Precast Protein Gels. For western blot, the anti-GFI1 (1/200 in 5% milk/TBST), anti-GFI1b (1/1000 in 5% milk/TBST), anti-mouse HRP-linked (Cell Signaling: 7076S, 1/10000 in 5% milk/TBST) and anti-rabbit HRP-linked (1/10000 in 5% milk/TBST) antibodies were used. Vinculin (Merck: V9131, 1/5000 in 5% milk/TBST) was used as loading control.


24

7. LSD1 inhibition followed by RT-qPCR and western blot for DNMT1

7.1 Treatment of T-ALL cell lines with 100 nM LSD1i or DMSO

HSB-2, LOUCY, PEER and RPMI-8402 cells were seeded in 16 ml RPMI-1640 medium with 10% FCS at 0.7 x 106 cells/ml (HSB-2 and LOUCY), 0.9 x 106 cells/ml (PEER) or 0.5 x 106 cells/ml (RPMI-8402). Half of the cells was treated with 100 nM of GSK1879552 (solvent DMSO) and the other half with an equal amount of DMSO. After 72 hours, 8 million cells from each treatment condition were collected via centrifugation (1500 rpm, 5 minutes). The pellets were washed with 2 ml PBS and stored at -80°C. The remaining cells in culture were subcultured in fresh medium at their start seeding density (in 5 ml medium) and fresh DMSO or 100 nM LSD1i was added. After another 72 hours (total 144 hours), these cells were also collected.

7.2 RNA isolation, cDNA synthesis and RT-qPCR

RNA of 4 million cells was isolated with the RNeasy® Plus Mini Kit and 500 ng RNA was converted to cDNA with the iScript Advanced cDNA Synthesis Kit. RT-qPCR was performed as mentioned before (3.2 RNA isolation, cDNA synthesis and RT-qPCR). Primers against the genes of interest (DNMT1) and five reference genes (HMBS, HpRT1, RPL13A, TBP, UBC) were used (Supplemental table 1).

7.3 Protein extraction and concentration measurement

For the protein extraction, 200 l of RIPA lysis buffer with Complete Mini-Protease Inhibitor Cocktail (Roche: 11836153001) was added to each pellet of 4 x 106 cells on ice. To ensure complete lysis, samples were rotated for 1 hour at 4°C. After centrifugation of the lysates for 10 minutes at 4°C at 8000 g, the supernatants were stored at -80°C. Protein concentrations

were measured via the BCA Protein Assay Kit (Abcam: ab102536) and the GloMax Discover Multimode Microplate Reader (Promega).

7.4 Western blot against DNMT1

Isoforms of DNMT1 are rather large, therefore a 4-15% Mini-PROTEAN TGX Precast Protein Gel (Bio-Rad: 4561086) was used. For each sample, an equal amount of protein was loaded and gel electrophoresis was performed at 100V. Next, the gels were blotted on a nitrocellulose membrane at 100V. Blots were shaked overnight at 4°C with the DNMT1 Ab (Active Motif: 39204, 1/1000 in 5% milk/TBST). As secondary antibody, the anti-mouse HRP-linked Ab (1/10 000 in 5% milk/TBST, 1-hour incubation) was used. Blots were visualized via

the SuperSignal West Dura Extended Duration Substrate. The loading control -actin (Merck: A2228, 1/2000 in 5% milk/TBST, mouse) was used to normalize the quantifications to rule out loading differences. Three biological replicates were performed.

8. Studying PU.1 and C/EBP expression in T-ALL cell lines

8.1 RT-qPCR against PU.1 and C/EBP of cells in steady state

The real time quantitative polymerase chain reaction (RT-qPCR) was used to determine the

mRNA expression of PU.1 and C/EBP DNA sequences in multiple cell lines. RT-qPCR was performed as mentioned before (3.2 RNA isolation, cDNA synthesis and RT-qPCR). Primers

for genes of interest (PU.1 and C/EBP) and five reference genes (HMBS, RPL13A, YWHAZ, TBP, UBC) were used (Supplemental table 1). Four technical replicates were performed.


25

8.2 LSD1 inhibition followed by qPCR against PU.1

T-ALL cell lines were treated with either 0 nM or 100 nM LSD1 inhibitor and cell pellets were collected after 72 hours and 144 hours as mentioned before (7.1 Treatment of T-ALL cell lines with 100 nM LSD1i or DMSO). The RT-qPCR with PU.1 as gene of interest was performed as mentioned before (3.2 RNA isolation, cDNA synthesis and RT-qPCR) and five reference genes (HMBS, HpRT1, RPL13A, TBP, UBC) were used (Supplemental table 1).

8.3 Western blot against PU.1 of cells in steady state and after LSD1 inhibition

Pellets were collected from cell lines in steady state or after LSD1 inhibition as mentioned before (7.1 Treatment of T-ALL cell lines with 100 nM LSD1i or DMSO). After total lysis of the

pellets, gel electrophoresis was performed on 10% Mini-PROTEAN TGX Precast Protein Gels. Western blot against PU.1 was carried out as mentioned above (3.8 Western blot, 7.4 Western blot against DNMT1) with the anti-PU.1 Ab (Cell Signaling: 2266, 1/1000 in 5% milk/TBST) as primary Ab and anti-rabbit HRP-linked Ab (1/10000 in 5% milk/TBST) as secondary Ab. The loading controls vinculin (1/5000 in 5% milk/TBST) or tubulin (Merck: T5168, 1/5000 in 5% milk/TBST) were used to normalize the quantifications to rule out loading differences. Three biological replicates were performed.

9. Statistical analysis

9.1 Statistical significance

The significance of quantifications of western blots and RT-qPCR was determined if three biological replicates were performed. In the experiments two conditions, cells treated with

DMSO and cells treated with the LSD1 inhibitor, were compared. Via RStudio it was determined if conditions differ statistically significant. First, the normality for each condition was checked via the Shapiro-Wilk test. All data was normally distributed. Therefore, a two-sided, parametric student’s t-test could be carried out to compare the conditions. If the calculated P-value was smaller than 0.05, the null hypothesis, which states there is no difference between the two conditions, is disapproved and the difference between the two conditions is statistically significant.

9.2 Standard deviation

When multiple technical replicates were performed, the average of the standard deviation (SD) was calculated by use of following error propagation:

n

xSD

zSD

n

i

i

1

2


26

RESULTS

PART I Combination therapy of LSD1 inhibition and targeted therapies

1.1 IC50 of targeted therapies

Determination of IC50 for ABT-199, ABT-263, Ruxolitinib and Romidepsin in T-ALL cells

The IC50 of some targeted therapies was determined in T-ALL cell lines that are sensitive for LSD1 inhibition so that combination therapies with the LSD1 inhibitor (GSK2879552) could be evaluated. Therefore, multiple biological replicates were performed in which cells were treated with a dilution series of the targeted therapy. IC50 values for ABT-263, Romidepsin and Ruxolitinib were determined in LOUCY, PEER, HSB-2 and RPMI-8402 (Table 2). The IC50 for ABT-199 was only determined in LOUCY due to the low sensitivity to ABT-199 in other cell lines [113]. IC50 values for Decitabine and GSK2879552 were previously determined in the lab of P. Van Vlierberghe.

Table 2. IC50 determinations of targeted therapies in LSD1i sensitive T-ALL cell lines. IC50 determinations were performed via GraphPad, based on at least three independent biological replicates of experiments determining the effect of 72 hours treatment on the cell viability (Supplemental figure 1). Standard deviations are given between brackets.

1.2 Combination therapies in LOUCY

Synergism between the LSD1i and ABT-199, ABT-263, Ruxolitinib and Romidepsin

To determine the effectiveness of combining the LSD1 inhibitor and ABT-199, ABT-263, Ruxolitinib or Romidepsin, combination therapies were tested on LOUCY cells. The combination of the LSD1 inhibitor and ABT-199 has, with a CI of 0.90, a slight synergistic effect (Figure 12A). For the LSD1 inhibitor and ABT-263 a combination index (CI) of 0.03 was measured, indicating a very strong synergism between the two drugs (Figure 12B). For Romidepsin and Ruxolitinib a CI of respectively 0.73 and 0.76 was measured (Figure 12C and D), what corresponds to a moderate synergism. ABT-263 showed a constant synergism for all concentrations, while the other targeted drugs worked more synergistic in higher concentrations.

COMPOUND HSB-2 LOUCY PEER RPMI-8402

ABT-199 / 19.93 nM (5.70) / /

ABT-263 89.43 nM (67.02) 24.46 nM (5.90) 108.53 nM

(48.20) 187.24 nM

(83.68)

Decitabine / 67.50 nM (1.20) 31.7 nM (1.10) /

GSK2879552 / 215.63 nM

(98.70) 12.66 nM (4.90) 74.28 nM (48.65)

Romidepsin 0.48 nM (0.16) 0.25 nM (0.06) 0.204 nM (0.03) 0.5104 nM (0.17)

Ruxolitinib 7.74 µM (2.78) 12.71 µM (2.30) 28.83 µM (5.80) 33.58 µM (8.53)


27

r = 0.9 CI (ED50-ED75-ED90) = 0.90

0 65 130 260 520 1040 GSK2879552 (nM)

0 6.25 12.5 25 50 100 ABT-199 (nM)

A

r = 0.7 CI (ED50-ED75-ED90) = 0.03

0 65 130 260 520 1040 GSK2879552 (nM)

0 6.25 12.5 25 50 100 ABT-263 (nM)

B

r = 0.8 CI (ED50-ED75-ED90) = 0.73

0 65 130 260 520 1040 GSK2879552 (nM)

0 0.0625 0.125 0.25 0.5 1 Romidepsin (nM)

C

r = 0.8 CI (ED50-ED75-ED90) = 0.76

0 65 130 260 520 1040 GSK2879552 (nM)

0 2.5 5 10 20 40 Ruxolitinib (M)

D

Figure 12. Relative cell viability curves of synergistic combination therapies in LOUCY cells. Relative cell viabilities are plotted to the drug concentration. Combination indexes (CI) were determined via CalcuSyn. (A) The combination of the LSD1 inhibitor and ABT-199 shows a slight synergism. (B) The combination of the LSD1 inhibitor and ABT-263 shows a very strong synergism. (C) The combination of the LSD1 inhibitor and Romidepsin shows a moderate synergism. (D) The combination of the LSD1 inhibitor and Ruxolitinib shows a moderate synergism.


28

PART II Molecular biology of LSD1 and LSD1 inhibition in T-ALL

2.1 Protein interaction between LSD1 and IKZF1 or GFI1

LSD1 seems not to interact with the nuclear protein IKZF1 in T-ALL cell lines

Because interaction of IKZF1 and LSD1 was detected in mass spectrometry, confirmation via immunoprecipitation and western blot was desirable. However, when an IP for LSD1 was performed on RIPA lysates of four T-ALL cell lines, no co-immunoprecipitation of IKZF1 was observed (Figure 13A). Because both LSD1 and IKZF1 are DNA-binding proteins, IP was also carried out on nuclear extracts of three T-ALL cell lines. Western blot after IP confirmed that IKZF1 is only present in the nuclear extracts, but no interaction between IKZF1 and LSD1 was detected (Figure 13B).

LSD1 and GFI1 interaction could not be confirmed in LSD1i sensitive T-ALL cell lines

Because LSD1 and GFI1 are interaction partners in AML, this interaction was investigated in three T-ALL cell lines via immunoprecipitation of nuclear extracts and western blot. Interaction between LSD1 and GFI1 could not be confirmed in the PEER, HSB-2 and RPMI-8402 cell lines (Figure 13C).

90 kDa -

IKZF1

LSD1

57 kDa -

LOUCY HPB-ALL JURKAT PEER A

HSB-2 RPMI-8402

90 kDa -

IKZF1

LSD1

57 kDa -

PEER B

HSB-2 RPMI-8402

90 kDa -

GFI1

LSD1

45 kDa -

PEER C

Figure 13. No co-immunoprecipitation of LSD1 and IKZF1 or GFI1. (A) Western blot against LSD1 (90 kDa) and IKZF1 (57 kDa) after IP on RIPA lysates. IKZF1 is present in the lysate, but not in IP of LSD1. (B) Western blot against LSD1 and IKZF1 after IP on nuclear extracts. IKZF1 is present in the nuclear extracts, but not in IP of LSD1 or the cytoplasm. (C) Western blot against LSD1 (90 kDa) and GFI1 (45 kDa) after IP on nuclear extracts. GFI1 is present in the cytoplasm and NXT, but not in IP LSD1. In PEER a low signal of LSD1 is observed for IP GFI1 and GFI1b, however this signal is also present in IP IgG and cannot be confirmed by a GFI1 signal for IP LSD1. For HSB-2 and RPMI-8402 a representative of three replicates is shown.


29

2.2 Knock down of GFI1 and GFI1b in LOUCY

Knock down of GFI1 and GFI1b was inefficient

To check if the presence of GFI1 and GFI1b is necessary for LSD1 inhibition sensitivity in LOUCY cells, knock down of these proteins was performed. Four different constructs for GFI1 and GFI1b together with one scrambled construct were used for transduction experiments. Lentiviral transfection ability of the hairpin plasmids was tested in HEK cells. The hairpins contain a GFP sequence which permits to control the transfection efficiency by observing a green signal under the microscope. For each plasmid a green signal was observed, indicating the hairpin plasmids are capable of lentiviral transfection. LOUCY cells were transduced with these hairpins and packaging plasmids and sorted afterwards. However, while sorting the transduced LOUCY cells, low transduction efficiency was seen (Figure 14A). For shGFI1 66, shGFI1 67 and shGFI1b 78, sufficient cells were sorted to check knock down on protein level (Figure 14B and D). Due to a technical mistake, no cells were sorted for SHC002. No meaningful changes in protein level were observed between the transduced LOUCY cells and parental LOUCY cells, indicating the knock down was not efficient (Figure 14C and E).

PLASMID CONSTRUCT

shGFI1 65

shGFI1 66

shGFI1 67

shGFI1 68

shGFI1b 78

shGFI1b 79

shGFI1b 80

shGFI1b 81

SHC002

TRANSDUCTION EFFICIENCY

0.2% 6.5% 4.0% 0.0% 6% 0.0% 0.0% 0.0% 12.7%

55 kDa -

Vinculin

GFI1

Normalized

value GFI1

0.82 0.82 0.71

35 kDa -

Vinculin

GFI1b

Normalized

value GFI1b

1.78 1.98

Figure 14. Knock down of GFI1 and GFI1b constructs not efficient. (A) Transduction efficiency of GFI1 and GFI1b constructs. Cells were sorted on positivity for GFP via FACSAria after gating for living, single cells (Supplemental figure 2). (B) Western blot of GFI1 (55 kDa) in transduced and parental LOUCY cells with vinculin (117 kDa) as loading control. Intensity of loaded samples was measured via Fiji and amount of proteins was normalized for vinculin. (C) The amount of GFI1 proteins relative to the parental cells is plotted. No decrease in protein level is observed. (D and E) The same goes for GFI1b (35 kDa). Only a 10% decrease in protein level is observed.

B

C

D

E

117 kDa -

117 kDa -

A


30

2.3 Influence of LSD1 inhibition on DNMT1

LSD1 inhibition has no influence on DNMT1 stability

Because LSD1 is able to demethylate and thereby stabilize DNMT1, the influence of LSD1 inhibition on the DNMT1 stability was examined via RT-qPCR and WB of T-ALL cells treated with DMSO or the LSD1 inhibitor for 72 or 144 hours. No repeatable changes in RNA level of DNMT1 were measured between control and LSD1 treatment in the different cell lines (Figure 15A). These findings were confirmed on protein level (Figure 15B) which shows no significant decrease or increase after LSD1 treatment. This data suggests that, although LSD1 has a direct influence on the stability of DNMT1, LSD1 inhibition has no reproducible effect on DNMT1 stability in T-ALL.

Figure 15. LSD1 inhibition has no influence on level of DNMT1. (A) DNMT1 expression measured with RT-qPCR in T-ALL cell lines after LSD1 treatment for 72 or 144 hours with 100 nM LSD1 inhibitor (red) or DMSO (blue). The graph shows the average of the relative CNRQ values to cells treated with DMSO and corresponding SE as calculated with qBase+ of two biological replicates (Supplemental figure 3). (B) Western blot against DNMT1 after LSD1 treatment was carried out. The intensity of the most present

isoform, representative for all isoforms, was measured via Fiji and normalized to -actin. The average amount of DNMT1 protein of three biological replicates (Supplemental figure 4) and their SE are plotted. No SE is plotted for HSB-2 because only one biological replicate was performed in this cell line. Changes between DMSO and LSD1 inhibitor treatment are not significant (ns) (LOUCY 72h: P = 0.8417, LOUCY 144h: P = 0.9398, PEER 72h: P = 0.4305, PEER 144h: P = 0.2578, RPMI-8402 72h: P = 0.3629, RPMI-8402 144h: P = 0.1769, 2-sided t test).

A

B

ns ns

ns ns ns ns


31

2.4 PU.1 and C/EBP expression in T-ALL cell lines

PU.1 is expressed in the immature T-ALL cell line LOUCY

When expression of CEBP or PU.1 is dysregulated, AML cells become resistant to LSD1 inhibition. Therefore, their expression was evaluated in sensitive and resistant T-ALL cell lines

in steady state and after LSD1 inhibition. On RNA level no expression of CEBP was observed in tested T-ALL cell lines and only the immature cell line LOUCY expressed SPI1, encoding PU.1 (Figure 16A and B). The tested AML cell lines were positive for both transcripts. The presence of the PU.1 protein in LOUCY was confirmed via western blot (Figure 16C).

Figure 16. PU.1 is present in the immature T-ALL cell line LOUCY. (A) CEBP expression measured with RT-qPCR in a panel of T-ALL and AML cell lines. The graph shows the CNRQ values and corresponding SE as calculated with qBase+ representative for four technical replicates (Supplemental figure 5). (B) SPI1 expression measured with RT-qPCR in a panel of T-ALL and AML cell lines. The graph shows the CNRQ values and corresponding SE as calculated with qBase+ representative for four technical replicates (Supplemental figure 5). (C) Western blot of PU.1 (42 kDa) in steady state T-ALL and AML cell lines with tubulin (55 kDa) as the loading control. PU.1 is only expressed in the AML and LOUCY cell lines.

AML Sensitive

T-ALL

Resistant

T-ALL

A

Tubulin

PU.1 42 kDa -

AML

Sensitive

T-ALL

Resistant

T-ALL C

AML Sensitive

T-ALL

Resistant

T-ALL

B

55 kDa -


32

LSD1 inhibition has no influence on PU.1 expression

Based on the reactivation of PU.1 target genes after LSD1 inhibition in AML, the influence of LSD1 inhibition on PU.1 expression itself was examined via RT-qPCR and WB. Because PU.1 is only present in LOUCY cells, PU.1 expression after LSD1 treatment was only studied in this cell line. No repeatable changes in mRNA level of SPI1 were measured between DMSO control and LSD1 treatment (Figure 17A). On protein level no significant changes were observed (Figure 17B). This data suggests that, although LSD1 inhibition upregulates the expression of PU.1 target genes, LSD1 treatment has no influence on PU.1 expression itself.

A

B

Figure 17. LSD1 inhibition has no influence on PU.1 expression. (A) SPI1 expression measured with RT-qPCR in LOUCY cells after LSD1 treatment for 72 or 144 hours with 100 nM LSD1 inhibitor (red) or a DMSO control (blue). The graph shows the average of the CNRQ values relative to the DMSO control and corresponding SE as calculated with qBase+ of two biological replicates (Supplemental figure 6). (B) Western blot against PU.1 after LSD1 treatment was carried out. The intensity was measured via Fiji and normalized to the loading control vinculin. The average amount of PU.1 protein of three biological replicates (Supplemental figure 7) and their SE are plotted. The difference in PU.1 protein is not significant after 72 h (P = 0.7426, 2-sided t test) or 144h (P = 0.2779, 2-sided t test) LSD1 inhibition.

ns ns


33

PART III Histone epigenetics in T-ALL cell lines

3.1 ChIP-sequencing of H3K27ac in LOUCY after LSD1 inhibition

LSD1 inhibition influences gene expression

To evaluate if LSD1 inhibitor treatment was successful, we used gene expression analysis of previously established LSD1 target genes, i.e. CD11b, GFI1 [84] and MN1 [117]. As expected, LSD1 treatment of LOUCY cells (100 nM for 48 hours) resulted in a significant increase of CD11b (P = 0.04688) and GFI1 (P = 0.01156) expression, while MN1 levels (P = 0.3227) slightly decreases (Figure 18).

LOUCY cells need 13 sonication cycles for fragments between 100 – 500 bp

A time-course sonication experiment was performed on crosslinked LOUCY cells to optimize the amount of sonication cycles needed for DNA fragments between 100 – 500 bp. In a first experiment, 5, 10 and 15 sonication cycles were tested to get a rough idea on the amount of

sonication cycles needed. Because fragment sizes were too large (1000 bp) after 10 cycles

but too small after 15 cycles (100 bp) (Supplemental figure 8), we subsequently performed an additional experiment using 10, 11, 12, 13, 14 and 15 sonication cycles. The number of fragments with the desired size was optimal after 13 sonication cycles 30’’ ON/30’’ OFF (Supplemental figure 9). Therefore, 13 sonication cycles were performed for the ChIP-sequencing experiment.

Figure 18. LSD1 treatment influences the gene expression. CD11b, GFI1 and MN1 expression was measured with RT-qPCR in LOUCY cells treated with either 100 nM LSD1 inhibitor (red) or DMSO (blue) for 48 hours. Three biological replicates were performed. The graph shows the calibrated normalized relative quantities (CNRQ) values and corresponding standard errors (SE) calculated with qBase+. M values were lower than 0.5 and CV values were lower than 0.2. The gene expression was standardized against HMBS, RPL13A, SDHA, TBP and UBC. The gene expression of CD11b (P = 0.04688, 2-sided t test) and GFI1 (P = 0.01156, 2-sided t test) significantly increased after LSD1 treatment. A decrease in MN1 expression was observed but was not significant (P = 0.3227, 2-sided t test).

* *

* P < 0.05 (2-sided t test)

ns


34

Successful H3K27ac immunoprecipitation

To isolate the DNA linked to H3K27ac, ChIP was performed on cells treated with the LSD1 inhibitor or DMSO. This IP was confirmed via western blot for H3K27ac (Figure 19) and measurement of the DNA concentration. The DNA concentration measured in ChIP samples was about twenty times lower compared to the input samples. To allow normalization during sequencing analysis, spike-in chromatin was added to the sheared DNA and was also immunoprecipitated.

Sequence size between 200 – 600 bp after library preparation

To multiply the DNA of interest, library preparation was carried out. This includes a PCR step that can lead to primer dimers. By measuring the fragments after library prep via the Fragment Analyzer, we confirmed that the size of the fragments was between 200 – 600 bp and showed that the number of formed primer dimers was low (Supplemental figure 11). Given this, no size selection had to be carried out.

Sequencing analysis indicates failed experiment

After library preparation, the samples were sequenced on an Illumina device in the NXTGNT core facility. However, when sequences were aligned against Homo sapiens chromatin or Drosophila chromatin, only a low number of Drosophila spike-in reads was found. In addition, peak calling also revealed that only a very limited number of human H3K27ac peaks were detected in our samples. Unfortunately, this result suggests that, despite our in-depth validations as shown above, this ChIP sequencing experiment was unsuccessful (Supplemental figure 12).

3.2 Mass spectrometry of histones

Yield of histones larger via the DA extraction method

In order to compare the DA and HLB histone extraction methods, the number of histones extracted via both methods on PEER cells was compared via quantification of gel electrophoresis (Figure 20). Histones were extracted from 2 million cells, of which 400 000

cells were loaded on gel electrophoresis together with 2 g of bovine histones. This made it possible to make a good quantification of the number of histones extracted via the two

methods. With the HLB extraction method an average of 5,64 g (SD: 1,28) of histones was

extracted, while via the DA extraction method an average of 7,06 g (SD: 1,44) of histones was extracted. Therefore, it can be concluded that histone extraction of T-ALL cell lines can be efficiently performed via the DA extraction method. Advantages of this shorter method are the limited technical variations and changes in epigenetics. After analyzing the PEER samples via mass spectrometry 184 histones were annotated via Mascot with a total coverage of 59% for histone 3 and 66% for histone 4.

Figure 19. Conformation of IP for H3K27ac. Western blot after IP for H3K27ac (17 kDa) in LOUCY cells after LSD1 inhibition or DMSO treatment. The H3K27ac protein was also visualized in input samples after sonication (Supplemental figure 10).

17 kDa - H3K27ac


35

Confirmation of histone extraction from T-ALL cell line panel

To compare histone epigenetics between LSD1 inhibition sensitive and resistant T-ALL cell lines, a T-ALL cell line panel was put together and histones were extracted via the DA extraction method. To confirm extraction, histones were put on gel electrophoresis and quantified based on the amount of loaded bovine histones (Figure 21). For all samples about

10 g histones were extracted and were further prepared for mass spectrometry which will be

carried out by the lab of M. Dhaenens. For this a minimum of 1 g histones will be needed.

B

A

Figure 20. Histone extraction via DA method is more efficient than via HLB method. (A) Gel

electrophoresis of extracted histones in PEER cells with 2 g bovine histones loaded for quantification. Four replicates of both extraction methods were loaded. (B) Quantification of extracted histones, based on the known amount of loaded bovine histones. Intensity of loaded samples was measured via Fiji.

Figure 21. Number of histones extracted via the DA extraction method for the T-ALL cell line panel. After DA extraction, samples were loaded on gel electrophoresis and intensity of loaded samples was measured via Fiji. Quantification of total extracted histones was based on the known amount of loaded bovine histones and known number of loaded cells. Six replicates were performed for each cell line.


36

DISCUSSION

PART I Combination therapy of LSD1 inhibition and targeted therapies

A first research objective of this project was to test the combination between the LSD1 inhibitor GSK2879552 and five rationally chosen targeted drugs on T-ALL cell lines. Synergism between LSD1 inhibition and standard-of-care drugs or epigenetic inhibitors had already been observed in AML [102]. First, the IC50’s of the targeted drugs were determined in the LSD1 inhibition sensitive T-ALL cell lines (HSB-2, LOUCY, PEER, RPMI-8402). Next, combination therapies with the LSD1 inhibitor and ABT-199, ABT-263, Decitabine, Romidepsin or Ruxolitinib were performed. Although multiple biological replicates were performed in LOUCY and PEER cells, only one replicate in LOUCY cells could be brought into account when calculating the synergism. In the four other replicates, deviating cell viabilities were read out for the control wells and PEER cells were dead before the end of the experiment. This could indicate experimental mistakes were made during the protocol or something was wrong with the newly made dilution of the LSD1 compound. To exclude the latter, the mRNA expression of cells treated with the newly diluted LSD1 inhibitor was compared to the expression of cells treated with the vehicle. An increase of CD11b and GFI1 expression and a slight decrease of MN1 expression were observed in LOUCY cells (Supplemental figure 13), indicating that the LSD1 inhibitor influenced the gene expression as expected. Therefore, different aspects of the protocol should be revisited. For instance, the IC50 of the LSD1 inhibitor should be recalculated and the seeding density of the T-ALL cells should be reconsidered. It should also be kept in mind that this protocol demands 12 days of precision work in which mistakes may easily be made. For the successful biological replicate in LOUCY cells, a very strong synergism was measured between the LSD1 inhibitor and ABT-263 (CI < 0.1). This synergism was constant for all concentrations. ABT-199, Romidepsin and Ruxolitinib showed also synergism with the LSD1 inhibitor, especially in higher concentrations. Although both ABT-263 and ABT-199 are BCL-2 inhibitors, ABT-263 shows a very strong synergism with the LSD1 inhibitor, while the synergism between the LSD1 inhibitor and ABT-199 is slight. The reason of this difference in synergistic effect can be that ABT-263 also inhibits BCL-XL, another anti-apoptotic protein, while ABT-199 only inhibits BCL-2 [111]. For Decitabine, a DNMT inhibitor, no effect could be calculated due to failure of experiments. However, combined inhibition of DNMT and LSD1 has been proven synergistic in cancer cells [72]. An extra targeted therapy that should be considered in the future is EZH2 inhibition. Although loss of EZH2 is shown to induce chemo resistance in T-ALL [118], its expression can also be upregulated in T-ALL [119]. A synergistic effect between EZH2 and LSD1 inhibition was previously shown in AML [120], making it a suitable molecular target to test in combination therapies with the LSD1 inhibitor in the different T-ALL cell lines. Once synergism between the LSD1 inhibitor and other targeted therapies can be confirmed in LOUCY cells and successfully tested in other T-ALL cell lines, the drug combinations with the strongest synergistic effects can be tested in vivo in xenograft mice models. If a longer survival rate can be observed in mice treated with the combination therapy, it may be a promising combination treatment for T-ALL patients.

PART II Molecular biology of LSD1 and LSD1 inhibition in T-ALL

A second objective of this research was to better understand why some T-ALL cell lines are sensitive to LSD1 inhibition and others not. Therefore, acquiring a better comprehension of the molecular biology of LSD1 and LSD1 inhibition in T-ALL cells is necessary.

First, interactions between LSD1 and proteins of interest were studied via IP and western blot. A first interaction of interest is based on the results of a mass spectrometry where interaction between LSD1 and IKZF1 (Ikaros), a transcription factor that plays a role in T-ALL, was


37

observed in nuclear extracts of PEER cells. However, this interaction could not be confirmed via IP in multiple T-ALL cell lines. A second interaction of interest, i.e. LSD1 and GFI1, is studied based on its presence in AML. This interaction was not seen in LSD1 sensitive T-ALL cell lines. However, it was not yet tested on the LOUCY cell line. Based on the assumption that the LOUCY cell line resembles AML the most, the interaction between GFI1(b) and LSD1 should still be studied in the LOUCY cell line. Certainly since it is the enzymatic interaction between LSD1 and GFI1(b) that is influenced by LSD1 inhibition in AML, leading to activation of enhancers close to genes controlling differentiation [121,122]. Since GFI1b is only present in the LOUCY cell line, as demonstrated before by our lab (data not published), a hypothesis could be that the LSD1 inhibition sensitivity of LOUCY cells is due to the presence of the interaction of GFI1(b) and LSD1 which is disrupted by LSD1 inhibition, just as it is in AML.

To check if the presence of GFI1 and GFI1b is necessary for LSD1 inhibition sensitivity in LOUCY cells, knock down of these proteins was carried out. When the amount of protein in transduced cells was compared to parental LOUCY cells, the knock down of the GFI1 and GFI1b mRNA seemed inefficient. If knock down would have been successful, it would have been visible on the western blot that was carried out four days after the transduction, since the half-life of the GFI1 protein is about 2 hours [123]. The lentiviral transfection of the hairpin plasmids was successfully tested. However, the inefficient knock down can be ascribed to several other aspects including inefficient packaging or envelope plasmids, ineffective short hairpins and the absence of a scrambled hairpin in the western blot. When repeating this experiment, it would be recommended to sequence the plasmids after MidiPrep to make sure the plasmid sequences overlap with the mRNA of interest. A different prep of packaging and envelope plasmids can also be used. As an alternative for transduction, knock down of GFI1 and GFI1b can also be performed by electroporation of the cells, as has already been done successfully for GFI1 by Volpe et al. [124]. However, once the LOUCY cells are successfully knocked down for GFI1 and GFI1b, they can be treated with the LSD1 inhibitor to check if GFI1 or GFI1b is necessary for the sensitivity to LSD1 inhibition, as it is in AML [121].

Next, the influence of LSD1 inhibition on the stability of DNMT1 was tested via western blot, based on the mechanistic link between these proteins [71]. LSD1 is able to demethylate and thereby stabilize DNMT1. Contrary to expectations, no reproducible effect of LSD1 inhibition was observed on DNMT1 stability. However, this result could be explained by the recent findings of Vinyard et al. [121], claiming that LSD1 inhibition has no influence on the demethylating activity of LSD1 in AML. The same could apply in T-ALL, in which case it could be declared that LSD1 inhibition has no influence on DNMT1 stability. These findings could be further investigated by performing a co-immunoprecipitation of LSD1 and DNMT1 before and after treatment with the LSD1 inhibitor.

Lastly, the presence of PU.1 and C/EBP in steady state and after LSD1 inhibition in T-ALL cell lines was studied, based on the role these transcription factors play in the response on LSD1 inhibition in AML. LSD1 inhibition interferes with GFI1-mediated repression of PU.1 target

genes and induces differentiation in AML by reactivation of PU.1- and C.EBP-dependent

enhancers. However, C/EBP was not present in steady state T-ALL cell lines and PU.1 is only expressed in LOUCY cells. Its expression is also not influenced by LSD1 inhibition, just as it was found in AML [104]. Further investigations of the role of PU.1 in LOUCY after LSD1 treatment could include characterizing the regions of altered chromatin accessibility and ChIP sequencing to identify sites of PU.1 and LSD1 occupancy. By downregulating PU.1, it could be checked if LSD1 inhibitor-induced changes in chromatin accessibility are PU.1 dependent.

A different way in which the differences between LSD1 inhibition sensitive and resistance cell lines can be compared, is by putting sensitive cell lines under compound stress for a while, leading to sensitive cell lines becoming resistant to LSD1 inhibition. Analyzing the changes that the cell lines had to undergo before they are able to grow in the presence of the inhibitor, could possibly help to better understand which factors are important in the determination of the sensitivity to the LSD1 inhibitor. In addition, by studying how cells can acquire resistance to


38

LSD1 inhibition, new therapeutic strategies can be developed to overcome or prevent the development of resistance.

PART III Histone epigenetics in T-ALL cell lines

First, the differences in genome-wide presence of H3K27ac between treatment with the LSD1 inhibitor versus the vehicle was explored by chromatin immunoprecipitation (ChIP) sequencing. Although western blot confirmed the IP, the ChIP sequencing experiment failed. Therefore, a different technique like the micrococcal nuclease based enzymatic ChIP method (Cell Signaling) can be tried next time. Analyzing H3K27ac ChIP sequencing could give an idea of which genes are differentially expressed after LSD1 treatment. A positive correlation of increased gene expression and increased H3K27ac ChIP signal was seen in AML cells treated with a LSD1 inhibitor versus the vehicle. Also, a modest reduction of H3K27ac was seen at genes downregulated after treatment [103].

A last objective of this project was to detect differences in histone epigenetics between LSD1i sensitive and resistant T-ALL cell lines in steady state. To perform mass spectrometry on multiple T-ALL cell lines to obtain an unbiased look on all histone modifications, the histone extraction protocol had to be optimized. Therefore, the direct acid extraction method and the hypotonic lysis buffer extraction method were tested on PEER cells. The yield of histones was larger via the direct acid extraction method, which is shorter and therefore induces less technical variations and epigenetic changes. Histones extracted via the DA method of LSD1i sensitive (HSB-2, LOUCY, PEER, RPMI-8402) and resistant (JURKAT, HPB-ALL, MOLT-16, TALL-1) T-ALL cell lines were prepared for mass spectrometry which will be carried out by the lab of M. Dhaenens. H3K4 is hard to visualize via mass spectrometry, which is a disadvantage of this experiment since H3K4 is a main target of LSD1. However, if H3K4 would not be observed in the T-ALL cell line panel, it can be confirmed via western blot if the results for H3K9 can be extrapolated to H3K4. By comparing LSD1i sensitive and resistant T-ALL cell lines in steady state, a histone modification pattern, which can serve as a biomarker for LSD1 sensitivity, could be discovered. Recently it was shown in AML that LSD1 inhibition influences the enzymatic activity of LSD1 and not its demethylating function [121]. However, in T-ALL it could still be that LSD1 inhibition influences the histone modifications. Silencing of the LSD1 gene was already seen to induce modulating of histone methylation and acetylation leading to apoptosis of MOLT-4 T-ALL cells [87]. Via mass spectrometry the changes in histone modifications after LSD1 treatment could be monitored in time.


39

GENERAL CONCLUSION

LSD1 is under investigation as a novel target for the treatment of T-cell acute lymphoblastic leukemia. However, further research is needed to optimize the use of LSD1 inhibitors in T-ALL. In this master dissertation, the goal of optimizing the LSD1 treatment is approached in three ways: (1) testing combination therapies, (2) acquiring a better understanding of the molecular biology of LSD1 and LSD1 inhibition in T-ALL and (3) obtaining an overview of histone epigenetics in T-ALL.

By testing combination therapies between LSD1 inhibition and targeted therapies, a promising synergism between the LSD1 inhibitor and ABT-263 was observed. Still, multiple biological replicates should be performed on different cell lines and with various targeted therapies so that the most synergistic combinations can be determined and afterwards tested in vivo.

The molecular biology of LSD1 and LSD1 inhibition in T-ALL cell lines was studied in different ways. It was seen that in multiple T-ALL cell lines no interactions are present between LSD1 and IKZF1 or GFI1. It was also found that LSD1 inhibition has no influence on the DNMT1

stability or the expression of PU.1, which is only present in LOUCY cells. C/EBP is absent in all tested T-ALL cell lines. However, a significant part of the results suggests that the LOUCY cell line has a different molecular biology than the other LSD1 sensitive cell lines (HSB-2, PEER, RPMI-8402), and resembles more to AML. For instance, GFI1b and PU.1 are only present in the LOUCY cell line. Therefore, a new hypothesis could contain that LSD1 inhibition disrupts the interaction of LSD1 and GFI1b in LOUCY cells, leading to the reactivation of PU.1-dependent enhancers, just like in AML. For the other cell lines, a different explanation for their LSD1 inhibition sensitivity or resistance must be sought.

Although a histone epigenetic overview of T-ALL cell lines could not yet be obtained, the histone extraction protocol for mass spectrometry was optimized. Mass spectrometry of a T-ALL cell line panel is currently being carried out to detect differences in histone epigenetics between LSD1 inhibition sensitive and resistant cell lines.

In conclusion, LSD1 and the influence of LSD1 inhibition in T-ALL need to be further investigated on different levels so that a better understanding of the use of the LSD1 inhibitor can be acquired. This will hopefully lead to an optimized use of LSD1 inhibition in T-ALL.


40

REFERENCES

1. Hochhaus A, Saussele S, Rosti G, Mahon FX, Janssen JJWM, Hjorth-Hansen H, Richter J,

Buske C (2017) Chronic myeloid leukaemia: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol 28: iv41-iv51.

2. Eichhorst B, Robak T, Montserrat E, Ghia P (2015) Chronic lymphocytic leukaemia: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol 26: v100–v107.

3. Hoelzer D, Bassan R, Dombret H, Fielding A, Ribera JM, Buske C, on behalf of the ESMO Guidelines Committee clinicalguidelines@esmo org (2016) Acute lymphoblastic leukaemia in adult patients: ESMO clinical practice guidelines for diagnosis, treatment and follow-up. Ann Oncol 27: v69–v82.

4. Terwilliger T, Abdul-Hay M (2017) Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer J 7: e577.

5. Leukaemia (all subtypes combined) statistics | Cancer Research UK, accessed at 29/10/2018.

6. Facts and Statistics | Leukemia and Lymphoma Society, accessed at 29/10/2018.

7. Whelan K, Alva E (2017) Epidemiology of Childhood Cancer. In, Pediatric Cancer Genetics.

8. B.C. (2013) Cancer in Children and Adolescents. , Brussels.

9. Goldberg JM, Silverman LB, Levy DE, Dalton VK, Gelber RD, Lehmann L, Cohen HJ, Sallan SE, Asselin BL (2003) Childhood T-cell acute lymphoblastic leukemia: The Dana-Farber Cancer Institute Acute Lymphoblastic Leukemia Consortium experience. J Clin Oncol 19: 3616–3622.

10. Durinck K, Goossens S, Peirs S, Wallaert A, Van Loocke W, Matthijssens F, Pieters T, Milani G, Lammens T, Rondou P, et al. (2015) Novel biological insights in T-cell acute lymphoblastic leukemia. Exp Hematol 43: 625–639.

11. Belver L, Ferrando A (2016) The genetics and mechanisms of T cell acute lymphoblastic leukaemia. Nat Rev Cancer 16: 494–507.

12. Taghon T, Waegemans E, Van De Walle I (2012) Notch signaling during human T cell development. Curr Top Microbiol Immunol 360: 75–97.

13. Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC, Behm FG, Pui CH, Downing JR, Gilliland DG, et al. (2002) Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1: 75–87.

14. Van Vlierberghe P, Ferrando A (2012) The molecular basis of T cell acute lymphoblastic leukemia. J Clin Invest 122: 3398–3406.

15. Meijerink JPP (2010) Genetic rearrangements in relation to immunophenotype and outcome in T-cell acute lymphoblastic leukaemia. Best Pract Res Clin Haematol 23: 307–318.

16. Homminga I, Pieters R, Langerak AW, de Rooi JJ, Stubbs A, Verstegen M, Vuerhard M, Buijs-Gladdines J, Kooi C, Klous P, et al. (2011) Integrated Transcript and Genome Analyses Reveal NKX2-1 and MEF2C as Potential Oncogenes in T Cell Acute Lymphoblastic Leukemia. Cancer Cell 19: 484–497.

17. Hunger SP, Mullighan CG (2015) Acute Lymphoblastic Leukemia in Children. N Engl J Med 373: 1541–1552.

18. Hermine O, Ramos JC, Tobinai K (2018) A Review of New Findings in Adult T-cell Leukemia–Lymphoma: A Focus on Current and Emerging Treatment Strategies. Adv Ther 35: 135–152.

19. Copelan EA (2006) Hematopoietic Stem-Cell Transplantation. N Engl J Med 354: 1813–1826.

20. Gökbuget N (2013) How I treat older patients with ALL. Blood 122: 1366–1375.


41

21. Seng SM, Tsao C-K, Oh WK (2013) Chemotherapy and Associated Symptoms.

22. Chen KH, Wada M, Pinz KG, Liu H, Lin KW, Jares A, Firor AE, Shuai X, Salman H, Golightly M, et al. (2017) Preclinical targeting of aggressive T-cell malignancies using anti-CD5 chimeric antigen receptor. Leukemia 31: 2151–2160.

23. Gomes-Silva D, Srinivasan M, Sharma S, Lee CM, Wagner DL, Davis TH, Rouce RH, Bao G, Brenner MK, Mamonkin M (2017) CD7-edited T cells expressing a CD7-specific CAR for the therapy of T-cell malignancies. Blood 130: 285–296.

24. Pui CH, Pei D, Campana D, Cheng C, Sandlund JT, Bowman WP, Hudson MM, Ribeiro RC, Raimondi SC, Jeha S, et al. (2014) A revised definition for cure of childhood acute lymphoblastic leukemia. Leukemia 28: 2336–2343.

25. Pulte D, Jansen L, Gondos A, Katalinic A, Barnes B, Ressing M, Holleczek B, Eberle A, Brenner H (2014) Survival of adults with acute lymphoblastic leukemia in Germany and the United States. PLoS One 9: e85554.

26. Bhojwani D, Pui C-H, Pui C, Mullighan C, Evans W, Al. E, Hunger S, Lu X, Devidas M, Zhang J, et al. (2013) Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol 14: PE205-E217.

27. Weng AP, Ferrando AA, Lee W, Morris IV JP, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC (2004) Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science (80- ) 306: 269–271.

28. Hebert J, Cayuela JM, Berkeley J, Sigaux F (1994) Candidate tumor-suppressor genes MTS1 (p16INK4A) and MTS2 (p15INK4B) display frequent homozygous deletions in primary cells from T- but not from B-cell lineage acute lymphoblastic leukemias. Blood 84: 4038–4044.

29. Liu Y, Easton J, Shao Y, Maciaszek J, Wang Z, Wilkinson MR, McCastlain K, Edmonson M, Pounds SB, Shi L, et al. (2017) The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic leukemia. Nat Genet 49: 1211–1218.

30. Rothenberg E V., Hosokawa H, Ungerbäck J (2019) Mechanisms of Action of Hematopoietic Transcription Factor PU.1 in Initiation of T-Cell Development. Front Immunol 10: 1–23.

31. Seki M, Kimura S, Isobe T, Yoshida K, Ueno H, Nakajima-Takagi Y, Wang C, Lin L, Kon A, Suzuki H, et al. (2017) Recurrent SPI1 (PU.1) fusions in high-risk pediatric T cell acute lymphoblastic leukemia. Nat Genet 49: 1274–1281.

32. Ran Y, Hossain F, Pannuti A, Lessard CB, Ladd GZ, Jung JI, Minter LM, Osborne BA, Miele L, Golde TE (2017) γ‐Secretase inhibitors in cancer clinical trials are pharmacologically and functionally distinct. EMBO Mol Med 9: 950–966.

33. Maude SL, Tasian SK, Vincent T, Hall JW, Sheen C, Roberts KG, Seif AE, Barrett DM, Chen IM, Collins JR, et al. (2012) Targeting JAK1/2 and mTOR in murine xenograft models of Ph-like acute lymphoblastic leukemia. Blood 120: 3510–3518.

34. Ramakrishnan V, Kumar S (2018) PI3K/AKT/mTOR pathway in multiple myeloma: from basic biology to clinical promise. Leuk Lymphoma 59: 2524–2534.

35. Steelman LS, Franklin RA, Abrams SL, Chappell W, Kempf CR, Bäsecke J, Stivala F, Donia M, Fagone P, Nicoletti F, et al. (2011) Roles of the Ras/Raf/MEK/ERK pathway in leukemia therapy. Leukemia 25: 1080–1094.

36. Rossari F, Minutolo F, Orciuolo E (2018) Past, present, and future of Bcr-Abl inhibitors: From chemical development to clinical efficacy. J Hematol Oncol 11: 84.

37. Hatzimichael E, Crook T (2013) Cancer epigenetics: new therapies and new challenges. J Drug Deliv 2013:.

38. Huether R, Dong L, Chen X, Wu G, Parker M, Wei L, Ma J, Edmonson MN, Hedlund EK, Rusch MC, et al. (2014) The landscape of somatic mutations in epigenetic regulators across 1,000 paediatric cancer genomes. Nat Commun 5: 3630.


42

39. Tajima S, Suetake I, Takeshita K, Nakagawa A, Kimura H (2016) Domain structure of the Dnmt1, Dnmt3a, and Dnmt3b DNA methyltransferases. Adv Exp Med Biol 945: 63–86.

40. Neumann M, Heesch S, Schlee C, Schwartz S, Gökbuget N, Hoelzer D, Konstandin NP, Ksienzyk B, Vosberg S, Graf A, et al. (2013) Whole-exome sequencing in adult ETP-ALL reveals a high rate of DNMT3A mutations. Blood 121: 4749–4752.

41. Ostler KR, Davis EM, Payne SL, Gosalia BB, Expósito-Céspedes J, Beau MML, Godley LA (2007) Cancer cells express aberrant DNMT3B transcripts encoding truncated proteins. Oncogene 26: 5553–5563.

42. Van Vlierberghe P, Ambesi-Impiombato A, De Keersmaecker K, Hadler M, Paietta E, Tallman MS, Rowe JM, Forne C, Rue M, Ferrando AA (2013) Prognostic relevance of integrated genetic profiling in adult T-cell acute lymphoblastic leukemia. Blood 122: 74–82.

43. Kramer AC, Kothari A, Wilson WC, Celik H, Nikitas J, Mallaney C, Ostrander EL, Eultgen E, Martens A, Valentine MC, et al. (2017) Dnmt3a regulates T-cell development and suppresses T-ALL transformation. Leukemia 31: 2479–2490.

44. Kon Kim T, Gore SD, Zeidan AM (2015) Epigenetic Therapy in Acute Myeloid Leukemia: Current and Future Directions. Semin Hematol 52: 172–183.

45. Atak ZK, de Keersmaecker K, Gianfelici V, Geerdens E, Vandepoel R, Pauwels D, Porcu M, Lahortiga I, Brys V, Dirks WG, et al. (2012) High accuracy mutation detection in leukemia on a selected panel of cancer genes. PLoS One 7: e38463.

46. Peirs S, Van der Meulen J, Van de Walle I, Taghon T, Speleman F, Poppe B, Van Vlierberghe P (2015) Epigenetics in T-cell acute lymphoblastic leukemia. Immunol Rev 263: 50–67.

47. Tessarz P, Kouzarides T (2014) Histone core modifications regulating nucleosome structure and dynamics. Nat Rev Mol Cell Biol 15: 703–708.

48. Cosgrove MS, Boeke JD, Wolberger C (2004) Regulated nucleosome mobility and the histone code. Nat Struct Mol Biol 11: 1037–1043.

49. Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, et al. (2006) A Bivalent Chromatin Structure Marks Key Developmental Genes in Embryonic Stem Cells. Cell 125: 315–326.

50. Ntziachristos P, Tsirigos A, Welstead GG, Trimarchi T, Bakogianni S, Xu L, Loizou E, Holmfeldt L, Strikoudis A, King B, et al. (2014) Contrasting roles of histone 3 lysine 27 demethylases in acute lymphoblastic leukaemia. Nature 514: 513–517.

51. Ferrando AA, Armstrong SA, Neuberg DS, Sallan SE, Silverman LB, Korsmeyer SJ, Look AT (2003) Gene expression signatures in MLL-rearranged T-lineage and B-precursor acute leukemias: Dominance of HOX dysregulation. Blood 1: 75–87.

52. Shahbazian MD, Grunstein M (2007) Functions of Site-Specific Histone Acetylation and Deacetylation. Annu Rev Biochem 76: 75–100.

53. Alqinyah M, Hooks SB (2018) Regulating the regulators: Epigenetic, transcriptional, and post-translational regulation of RGS proteins. Cell Signal 42: 77–87.

54. Guillemette B, Drogaris P, Lin HHS, Armstrong H, Hiragami-Hamada K, Imhof A, Bonneil É, Thibault P, Verreault A, Festenstein RJ (2011) H3 lysine 4 is acetylated at active gene promoters and is regulated by H3 lysine 4 methylation. PLoS Genet 7: e1001354.

55. Tie F, Banerjee R, Stratton CA, Prasad-Sinha J, Stepanik V, Zlobin A, Diaz MO, Scacheri PC, Harte PJ (2009) CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development 136: 3131–3141.

56. Karmodiya K, Krebs AR, Oulad-Abdelghani M, Kimura H, Tora L (2012) H3K9 and H3K14 acetylation co-occur at many gene regulatory elements, while H3K14ac marks a subset of inactive inducible promoters in mouse embryonic stem cells. BMC Genomics 13: 424.


43

57. Creyghton MP, Cheng AW, Welstead GG, Kooistra T, Carey BW, Steine EJ, Hanna J, Lodato MA, Frampton GM, Sharp PA, et al. (2010) Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci 107: 21931–21936.

58. Bassett SA, Barnett MPG (2014) The role of dietary histone deacetylases (HDACs) inhibitors in health and disease. Nutrients 6: 4273–4301.

59. Zheng YC, Ma J, Wang Z, Li J, Jiang B, Zhou W, Shi X, Wang X, Zhao W, Liu HM (2015) A Systematic Review of Histone Lysine-Specific Demethylase 1 and Its Inhibitors. Med Res Rev 35:.

60. Chen Y, Yang Y, Wang F, Wan K, Yamane K, Zhang Y, Lei M (2006) Crystal structure of human histone lysine-specific demethylase 1 (LSD1). Proc Natl Acad Sci 103: 13956–13961.

61. Hou H, Yu H (2010) Structural insights into histone lysine demethylation. Curr Opin Struct Biol 20: 739–748.

62. Adamo A, Sesé B, Boue S, Castaño J, Paramonov I, Barrero MJ, Belmonte JCI (2011) LSD1 regulates the balance between self-renewal and differentiation in human embryonic stem cells. Nat Cell Biol 13: 652–659.

63. Wang J, Scully K, Zhu X, Cai L, Zhang J, Prefontaine GG, Krones A, Ohgi KA, Zhu P, Garcia-Bassets I, et al. (2007) Opposing LSD1 complexes function in developmental gene activation and repression programmes. Nature 446: 882–887.

64. Takeuchi M, Fuse Y, Watanabe M, Andrea C-S, Takeuchi M, Nakajima H, Ohashi K, Kaneko H, Kobayashi-Osaki M, Yamamoto M, et al. (2015) LSD1/KDM1A promotes hematopoietic commitment of hemangioblasts through downregulation of Etv2. Proc Natl Acad Sci 112: 13922–13927.

65. Thambyrajah R, Mazan M, Patel R, Moignard V, Stefanska M, Marinopoulou E, Li Y, Lancrin C, Clapes T, Möroÿ T, et al. (2016) GFI1 proteins orchestrate the emergence of haematopoietic stem cells through recruitment of LSD1. Nat Cell Biol 18: 21–32.

66. Sun G, Alzayady K, Stewart R, Ye P, Yang S, Li W, Shi Y (2010) Histone Demethylase LSD1 Regulates Neural Stem Cell Proliferation. Mol Cell Biol 30: 1997–2005.

67. Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G (2005) REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell 121: 645–657.

68. Kim J, Singh AK, Takata Y, Lin K, Shen J, Lu Y, Kerenyi MA, Orkin SH, Chen T (2015) LSD1 is essential for oocyte meiotic progression by regulating CDC25B expression in mice. Nat Commun 6:.

69. Amente S, Lania L, Majello B (2013) The histone LSD1 demethylase in stemness and cancer transcription programs. BBA Gene Regul Mech 1829: 981–986.

70. Greer EL, Shi Y (2012) Histone methylation: A dynamic mark in health, disease and inheritance. Nat Rev Genet 13: 343–357.

71. Wang J, Hevi S, Kurash JK, Lei H, Gay F, Bajko J, Su H, Sun W, Chang H, Xu G, et al. (2009) The lysine demethylase LSD1 (KDM1) is required for maintenance of global DNA methylation. Nat Genet 41: 125–129.

72. Han H, Yang X, Pandiyan K, Liang G (2013) Synergistic Re-Activation of Epigenetically Silenced Genes by Combinatorial Inhibition of DNMTs and LSD1 in Cancer Cells. PLoS One 8: e75136.

73. Jones PA, Baylin SB (2002) The fundamental role of epigenetic events in cancer. Nat Rev Genet 3: 415–428.

74. Saleque S, Cameron S, Orkin SH (2002) The zinc-finger proto-oncogene Gfi-1b is essential for development of the erythroid and megakaryocytic lineages. Genes Dev 16: 301–306.

75. Van Der Meer LT, Jansen JH, Van Der Reijden BA (2010) Gfi1 and Gfi1b: Key regulators of


44

hematopoiesis. Leukemia 24: 1834–1843.

76. Saleque S, Kim J, Rooke HM, Orkin SH (2007) Epigenetic Regulation of Hematopoietic Differentiation by Gfi-1 and Gfi-1b Is Mediated by the Cofactors CoREST and LSD1. Mol Cell 27: 562–572.

77. Velinder M, Singer J, Bareyan D, Meznarich J, Tracy CM, Fulcher JM, McClellan D, Lucente H, Franklin S, Sharma S, et al. (2016) GFI1 functions in transcriptional control and cell fate determination require SNAG domain methylation to recruit LSD1. Biochem J 473: 3355–3369.

78. Barth J, Abou-El-Ardat K, Dalic D, Kurrle N, Maier A-M, Mohr S, Schütte J, Vassen L, Greve G, Schulz-Fincke J, et al. (2019) LSD1 inhibition by tranylcypromine derivatives interferes with GFI1-mediated repression of PU.1 target genes and induces differentiation in AML. Leukemia.

79. Goossens S, Radaelli E, Blanchet O, Durinck K, Van Der Meulen J, Peirs S, Taghon T, Tremblay CS, Costa M, Ghahremani MF, et al. (2015) ZEB2 drives immature T-cell lymphoblastic leukaemia development via enhanced tumour-initiating potential and IL-7 receptor signalling. Nat Commun 6:.

80. Brabletz S, Brabletz T (2010) The ZEB/miR-200 feedback loop-a motor of cellular plasticity in development and cancer? EMBO Rep 11: 670–677.

81. Park SM, Gaur AB, Lengyel E, Peter ME (2008) The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev 22: 894–907.

82. Katoh M, Igarashi M, Fukuda H, Nakagama H, Katoh M (2013) Cancer genetics and genomics of human FOX family genes. Cancer Lett 328: 198–206.

83. Gheldof A, Hulpiau P, Van Roy F, De Craene B, Berx G (2012) Evolutionary functional analysis and molecular regulation of the ZEB transcription factors. Cell Mol Life Sci 69: 2527–2541.

84. Goossens S, Peirs S, Berx G, Van Vlierberghe P (2016) Oncogenic ZEB2 activation drives sensitivity towards lsd1 inhibition in T-cell acute lymphoblastic leukemia. Blood 129: 981–990.

85. Wada T, Koyama D, Kikuchi J, Honda H, Furukawa Y (2015) Overexpression of the shortest isoform of histone demethylase LSD1 primes hematopoietic stem cells for malignant transformation. Blood 125: 3731–3746.

86. Hayami S, Kelly JD, Cho HS, Yoshimatsu M, Unoki M, Tsunoda T, Field HI, Neal DE, Yamaue H, Ponder BAJ, et al. (2011) Overexpression of LSD1 contributes to human carcinogenesis through chromatin regulation in various cancers. Int J Cancer 128: 574–586.

87. Zou ZK, Huang YQ, Zou Y, Zheng XK, Ma XD (2017) Silencing of LSD1 gene modulates histone methylation and acetylation and induces the apoptosis of JeKo-1 and MOLT-4 cells. Int J Mol Med 40: 319–328.

88. Kahl P, Gullotti L, Heukamp LC, Wolf S, Friedrichs N, Vorreuther R, Solleder G, Bastian PJ, Ellinger J, Metzger E, et al. (2006) Androgen receptor coactivators lysine-specific histone demethylase 1 and four and a half LIM domain protein 2 predict risk of prostate cancer recurrence. Cancer Res 66: 11341–11347.

89. Kauffman EC, Robinson BD, Downes MJ, Powell LG, Lee MM, Scherr DS, Gudas LJ, Mongan NP (2011) Role of androgen receptor and associated lysine-demethylase coregulators, LSD1 and JMJD2A, in localized and advanced human bladder cancer. Mol Carcinog 50: 931–944.

90. Schulte JH, Lim S, Schramm A, Friedrichs N, Koster J, Versteeg R, Ora I, Pajtler K, Klein-Hitpass L, Kuhfittig-Kulle S, et al. (2009) Lysine-specific demethylase 1 is strongly expressed in poorly differentiated neuroblastoma: Implications for therapy. Cancer Res 69: 2065–2071.

91. Schenk T, Chen WC, Göllner S, Howell L, Jin L, Hebestreit K, Klein HU, Popescu AC, Burnett A, Mills K, et al. (2012) Inhibition of the LSD1 (KDM1A) demethylase reactivates the all-trans-retinoic acid differentiation pathway in acute myeloid leukemia. Nat Med 18: 605–611.

92. Mohammad H, Smitheman K, Cusan M, Liu Y, Pappalardi M, Federowicz K, Aller G Van,


45

Kasparec J, Tian X, Suarez D, et al. (2013) Inhibition Of LSD1 As a Therapeutic Strategy For The Treatment Of Acute Myeloid Leukemia. Blood 122:.

93. Feng Z, Yao Y, Zhou C, Chen F, Wu F, Wei L, Liu W, Dong S, Redell M, Mo Q, et al. (2016) Pharmacological inhibition of LSD1 for the treatment of MLL-rearranged leukemia. J Hematol Oncol 9: 24.

94. Lee C, Rudneva VA, Erkek S, Zapatka M, Chau LQ, Tacheva-Grigorova SK, Garancher A, Rusert JM, Aksoy O, Lea R, et al. (2019) Lsd1 as a therapeutic target in Gfi1-activated medulloblastoma. Nat Commun 10: 332.

95. Mohammad HP, Smitheman KN, Kamat CD, Soong D, Federowicz KE, VanAller GS, Schneck JL, Carson JD, Liu Y, Butticello M, et al. (2015) A DNA Hypomethylation Signature Predicts Antitumor Activity of LSD1 Inhibitors in SCLC. Cancer Cell 28: 57–69.

96. Sarno F, Papulino C, Franci G, Andersen JH, Cautain B, Melardo C, Altucci L, Nebbioso A (2018) 3-Chloro-N’-(2-hydroxybenzylidene) benzohydrazide: An LSD1-selective inhibitor and iron-chelating agent for anticancer therapy. Front Pharmacol 9:.

97. Magliulo D, Bernardi R, Messina S (2018) Lysine-Specific Demethylase 1A as a Promising Target in Acute Myeloid Leukemia. Front Oncol 8: 255.

98. Mould DP, McGonagle AE, Wiseman DH, Williams EL, Jordan AM (2015) Reversible inhibitors of LSD1 as therapeutic agents in acute myeloid leukemia: Clinical significance and progress to date. Med Res Rev 35: 586–618.

99. Yang M, Culhane JC, Szewczuk LM, Jalili P, Ball HL, Machius M, Cole PA, Yu H (2007) Structural basis for the inhibition of the LSD1 histone demethylase by the antidepressant trans-2-phenylcyclopropylamine. Biochemistry 46: 8058–8065.

100. Binda C, Valente S, Romanenghi M, Pilotto S, Cirilli R, Karytinos A, Ciossani G, Botrugno OA, Forneris F, Tardugno M, et al. (2010) Biochemical, structural, and biological evaluation of tranylcypromine derivatives as inhibitors of histone demethylases LSD1 and LSD2. J Am Chem Soc 132: 6827–6833.

101. Ishikawa Y, Gamo K, Yabuki M, Takagi S, Toyoshima K, Nakayama K, Nakayama A, Morimoto M, Miyashita H, Dairiki R, et al. (2017) A Novel LSD1 Inhibitor T-3775440 Disrupts GFI1B-Containing Complex Leading to Transdifferentiation and Impaired Growth of AML Cells. Mol Cancer Ther 16: 261.

102. Maes T, Mascaró C, Tirapu I, Estiarte A, Ciceri F, Lunardi S, Guibourt N, Perdones A, Lufino MMP, Somervaille TCP, et al. (2018) ORY-1001, a Potent and Selective Covalent KDM1A Inhibitor, for the Treatment of Acute Leukemia. Cancer Cell 33: 495–511.

103. Maiques-Diaz A, Spencer GJ, Lynch JT, Ciceri F, Williams EL, Amaral FMR, Wiseman DH, Harris WJ, Li Y, Sahoo S, et al. (2018) Enhancer Activation by Pharmacologic Displacement of LSD1 from GFI1 Induces Differentiation in Acute Myeloid Leukemia. Cell Rep 13: 3641–3659.

104. Cusan M, Cai SF, Mohammad H, Krivtsov A, Chramiec A, Loizou E, Witkin MD, Smitheman KN, Tenen DG, Ye M, et al. (2018) LSD1 inhibition exerts its antileukemic effect by recommissioning PU.1- and C/EBPa-dependent enhancers in AML. Blood.

105. Fiskus W, Sharma S, Shah B, Portier BP, Devaraj SGT, Liu K, Iyer SP, Bearss D, Bhalla KN (2014) Highly effective combination of LSD1 (KDM1A) antagonist and pan-histone deacetylase inhibitor against human AML cells. Leukemia 28: 2155–2164.

106. Augert A, Eastwood E, Ibrahim AH, Wu N, Grunblatt E, Basom R, Liggitt D, Eaton KD, Martins R, Poirier JT, et al. (2019) Targeting NOTCH activation in small cell lung cancer through LSD1 inhibition. Sci Signal 12: 2922.

107. Yatim A, Benne C, Sobhian B, Laurent-Chabalier S, Deas O, Judde JG, Lelievre JD, Levy Y, Benkirane M (2012) NOTCH1 Nuclear Interactome Reveals Key Regulators of Its Transcriptional Activity and Oncogenic Function. Mol Cell 48: 445–458.


46

108. Jiang X, Wang Z, Ding B, Yin C, Zhong Q, Carter BZ, Yu G, Jiang L, Ye J, Dai M, et al. (2015) The hypomethylating agent decitabine prior to chemotherapy improves the therapy efficacy in refractory/relapsed acute myeloid leukemia patients. Oncotarget.

109. Bertino EM, Otterson GA (2011) Romidepsin: a novel histone deacetylase inhibitor for cancer. Expert Opin Investig Drugs 20: 1151–1158.

110. Vilas-Zornoza A, Agirre X, Abizanda G, Moreno C, Segura V, De Martino Rodriguez A, José-Eneriz ES, Miranda E, Martín-Subero JI, Garate L, et al. (2012) Preclinical activity of LBH589 alone or in combination with chemotherapy in a xenogeneic mouse model of human acute lymphoblastic leukemia. Leukemia 26: 1517–1526.

111. Vogler M, Dinsdale D, Dyer MJS, Cohen GM (2009) Bcl-2 inhibitors: Small molecules with a big impact on cancer therapy. Cell Death Differ 16: 360–367.

112. Zhang M, Mathews Griner LA, Ju W, Duveau DY, Guha R, Petrus MN, Wen B, Maeda M, Shinn P, Ferrer M, et al. (2015) Selective targeting of JAK/STAT signaling is potentiated by Bcl-xL blockade in IL-2-dependent adult T-cell leukemia. Proc Natl Acad Sci U S A 112: 12480–12485.

113. Peirs S, Matthijssens F, Goossens S, Van De Walle I, Ruggero K, De Bock CE, Degryse S, Canté-Barrett K, Briot D, Clappier E, et al. (2014) ABT-199 mediated inhibition of BCL-2 as a novel therapeutic strategy in T-cell acute lymphoblastic leukemia. Blood 124: 3738–3747.

114. Mazzucchelli R, Durum SK (2007) Interleukin-7 receptor expression: Intelligent design. Nat Rev Immunol 7: 144–154.

115. Maude SL, Dolai S, Delgado-Martin C, Vincent T, Robbins A, Selvanathan A, Ryan T, Hall J, Wood AC, Tasian SK, et al. (2015) Efficacy of JAK/STAT pathway inhibition in murine xenograft models of early T-cell precursor (ETP) acute lymphoblastic leukemia. Blood 125: 1759–1767.

116. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J (2008) qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol.

117. Peirs S, Frismantas V, Matthijssens F, Van Loocke W, Pieters T, Vandamme N, Lintermans B, Dobay MP, Berx G, Poppe B, et al. (2017) Targeting BET proteins improves the therapeutic efficacy of BCL-2 inhibition in T-cell acute lymphoblastic leukemia. Leukemia 31: 2037–2047.

118. Ariës IM, Bodaar K, Karim SA, Chonghaile TN, Hinze L, Burns MA, Pfirrmann M, Degar J, Landrigan JT, Balbach S, et al. (2018) PRC2 loss induces chemoresistance by repressing apoptosis in T cell acute lymphoblastic leukemia. J Exp Med 215:.

119. D’Angelo V, Iannotta A, Ramaglia M, Lombardi A, Zarone MR, Desiderio V, Affinita MC, Pecoraro G, Di Martino M, Indolfi P, et al. (2015) EZH2 is increased in paediatric T-cell acute lymphoblastic leukemia and is a suitable molecular target in combination treatment approaches. J Exp Clin Cancer Res 34:.

120. Wen S, Wang J, Liu P, Li Y, Lu W, Hu Y, Liu J, He Z, Huang P (2018) Novel combination of histone methylation modulators with therapeutic synergy against acute myeloid leukemia in vitro and in vivo. Cancer Lett 413: 35–45.

121. Michael E. Vinyard, Cindy Su, Allison P. Siegenfeld, Amanda L. Waterbury, Allyson M. Freedy, Pallavi M. Gosavi, Yongho Park, Eugene E. Kwan, Benjamin D. Senzer, John G. Doench, Daniel E. Bauer LP& BBL (2019) CRISPR-suppressor scanning reveals a nonenzymatic role of LSD1 in AML. Nat Chem Biol 15: 529–539.

122. Maiques-Diaz A, Lynch JT, Spencer GJ, Somervaille TCP (2018) LSD1 inhibitors disrupt the GFI1 transcription repressor complex. Mol Cell Oncol 5:.

123. Marteijn JAF, Van Der Meer LT, Van Emst L, Van Reijmersdal S, Wissink W, De Witte T, Jansen JH, Van Der Reijden BA (2007) Gfi1 ubiquitination and proteasomal degradation is inhibited by the ubiquitin ligase Triad1. Blood 110: 3128–3135.


47

124. Volpe G, Walton DS, Grainger DE, Ward C, Cauchy P, Blakemore D, Coleman DJL, Cockerill PN, Garcia P, Frampton J (2017) Prognostic significance of high GFI1 expression in AML of normal karyotype and its association with a FLT3-ITD signature. Sci Rep 7:.

125. Peirs S (2017) Novel molecular insights and targeted therapies in T-cell acute lymphoblastic leukemia.

126. Chen T (2011) Mechanistic and Functional Links Between Histone Methylation and DNA Methylation. Prog Mol Biol Transl Sci 101: 335–348.

127. Ververis K, Hiong A, Karagiannis TC, Licciardi P V. (2013) Histone deacetylase inhibitors (HDACIS): Multitargeted anticancer agents. Biol Targets Ther 7: 47–60.


ADDENDUM

List of abbreviations Ab Antibody ABL Abelson leukemia oncogene cellular homolog AL Acute leukemia ALL Acute lymphoblastic leukemia AML Acute myeloid leukemia AOL Amine oxidase like AR Androgen receptor ATP Adenosine triphosphate B-ALL B-cell acute lymphoblastic leukemia BM Bone marrow bp Base pairs CAR Chimeric antigen receptor CD Cluster of differentiation CDKN2 Cyclin-dependent kinase inhibitor 2 ChIP Chromatin immunoprecipitation CI Combination index CLL Chronic lymphocytic leukemia CML Chronic myeloid leukemia CNRQ Calibrated normalized relative quantities CoREST Corepressor for RE1‐silencing transcription factor CtBP1 Carboxyl‐terminal binding protein 1 CV Coefficient of variation DA Direct acid DAC Decitabine DMSO Dimethylsulfoxide DN Double negative DNA Deoxyribonucleic acid DNMT DNA methyltransferases DP Double positive ER Estrogen receptor ERK Extracellular signal-regulated kinase EWS Ewing’s sarcoma FAD Flavin adenine dinucleotide FCS Fetal bovine serum FDA Food and drug administration FLI1 Friend leukemia integration 1 GFI1 Growth factor-independent 1 GFP Green fluorescent protein HAT Histone acetyltransferase HDAC Histone deacetylase HLB Hypotonic lysis buffer HSCT Hematopoietic stem cell transplantation HOXA Homeobox A cluster HPC Hematopoietic progenitor cells HSC Hematopoietic stem cells H3K4 Histone 3 lysine 4 H3K9 Histone 3 lysine 9 IC50 Half maximal inhibitory concentration IDH Isocitrate dehydrogenases IL7 Interleukin 7 IP Immunoprecipitation


INK4 Inhibitor of CDK4 JAK Janus kinase JMJD3 Jumonji domain containing 3 LMO TAL/LIM domain only LSD1 (KDM1A) Lysine-specific demethylase 1 (Lysine demethylase 1A) MAO Monoamine oxidase MCL Mantle Cell Lymphoma MDS Myelodysplastic syndrome MEF2C Myocyte enhancer factor 2 MEK MAPK/Erk kinase mgf Mascot Generic Format MLL Mixed lineage leukemia MN1 Meningioma 1 mTOR Mammalian target of rapamycin NK Natural killer NKX2 NK2 homeobox NRQ Normalized relative quantities ns Not significant NSG NOD scid gamma NuRD Nucleosome remodeling and deacetylase NXT Nuclear extracts PAO Polyamine oxidase PBS Phosphate buffered saline PDX Patient-derived xenograft PI3K Phosphoinositide-3-kinase PRC2 Polycomb repressive complex 2 PTM Post-translational modification RFU Relative fluorescent units RNA Ribonucleic acid rpm Rounds per minute RT Room temperature RT-qPCR Real time quantitative polymerase chain reaction SCLC Small cell lung carcinoma SD Standard deviation SE Standard error SP Single positive SWIRM Small alpha-helical domain T-ALL T-cell acute lymphoblastic leukemia TCP Tranylcypromine (Phenylcyclopropylamine) TCR T-cell receptor TET Ten-eleven translocation protein TSG Tumor suppressor gene TLX T-cell leukemia homeobox TSP Thymus seeding progenitors ZEB2 Zinc finger E-box binding homeobox 2


Supplemental figures


Supplemental figure 1. Influence of different targeted therapies on the relative cell viability in different cell lines. The relative viabilities, read out via the Glomax, were plotted in function to the concentration of the compounds. The relative standard deviations are also displayed. Concentration points with a relative viability higher than 100 were not considered. Because the background signal was negligible, it was not brought into account.


Supplemental figure 2. Sorting of living, single, GFP+ LOUCY cells after transduction. Cells were sorted via the FACSAria. Same gating was carried out for shGFI1b 78 but data was not saved.


DNMT1 183 kDa -

Normalized

value DNMT1

0.98 0.90 0.85 0.74

Actin

1.00 0.68 0.94 0.59 0.62 0.44 0.52 0.36

LOUCY PEER RPMI-8402 Replicate 1

42 kDa -

Supplemental figure 3. Relative CNRQ values of DNMT1 expression after LSD1 treatment. The CNRQ values relative to the DMSO control and their SE are plotted for two technical RT-qPCR replicates. CV values were below 0.2 and M values were below 0.5 for all replicates. For replicate 1, the gene expression was standardized against HpRT1 and UBC. For replicate 2, standardization was performed against TBP and UBC or HpRT1, RPL13A and UBC for 72 hours or 144 hours respectively.


42 kDa -

DNMT1 183 kDa -

Normalized

value DNMT1

0.34 0.91 1.19 1.09

Actin

0.81 0.88 0.74 0.51 0.34 0.93 0.59 0.59


0.64 0.69 0.50 0.03

HSB-2

DNMT1 183 kDa -

Normalized

value DNMT1

1.01 0.69 0.98 1.14

Actin

0.60 0.29 0.45 0.37 0.60 0.72 0.93 0.31


42 kDa -

Supplemental figure 4. Western blot and quantification of DNMT1 after LSD1 treatment. Three biological replicates of the LSD1 treatment were performed. Western blot against DNMT1 (largest isoform: 183 kDa) was

performed and intensity was measured via Fiji and normalized to the loading control -actin.


Supplemental figure 5. CNRQ values of CEBP and PU.1 expression. The CNRQ values of the four technical qPCR replicates are plotted. In the first and second replicate no AML cell lines were included. CV values were below 0.2 for all replicates. M values were below 0.6 for replicate 1 and 2 and below 0.5 for replicate 4. For replicate 1, the gene expression was standardized against RPL13A and YWHAZ; for replicate 2 against TBP and YWHAZ; for replicate 3 against RPL13A and YWHAZ; for replicate 4 against HMBS and UBC.


Supplemental figure 6. Relative CNRQ values of PU.1 expression after LSD1 treatment. The CNRQ values and their SE of two technical qPCR replicates are plotted. CV values were below 0.2 and M values were below 0.5 for all replicates. For replicate 1, the gene expression was standardized against HpRT1 and UBC. For replicate 2, standardization was performed against TBP and UBC or HpRT1, RPL13A and UBC for 72 hours or 144 hours respectively.

117 kDa -

42 kDa -

0.99 0.66 0.29 0.34

LOUCY Replicate 1

PU.1

Normalized

value PU.1

Vinculin

1.96

117 kDa -

42 kDa -

1.69 1.90 1.29 0.61

LOUCY Replicate 2

PU.1

Normalized

value PU.1

Vinculin

0.79

117 kDa -

42 kDa -

1.36 1.03 1.58 0.49

LOUCY Replicate 3

PU.1

Normalized

value PU.1

Vinculin

Supplemental figure 7. Western blot and quantification of PU.1 after LSD1 treatment. Three biological replicates of the LSD1 treatment were performed. Western blot against PU.1 was performed and intensity was measured via Fiji and normalized to the loading control vinculin.


0 cycles 5 cycles

10 cycles 15 cycles

Supplemental figure 8. Fragment size of DNA after 0, 5, 10 and 15 sonication cycles. After sonication DNA fragments from LOUCY cells were measured via the Fragment Analyzer. Relative fluorescent units (RFU) are plotted, determining the quantity of samples for each size. The red rectangle indicates the area of fragments with the wanted size of 100 – 500 bp.

10 cycles 11 cycles

12 cycles 13 cycles

14 cycles 15 cycles

Supplemental figure 9. Fragment size of DNA after 10, 11, 12, 13, 14 and 15 sonication cycles. After sonication DNA fragments of LOUCY cells were measured via the Fragment Analyzer. RFU are plotted, determining the quantity of samples for each size. The area under the curve between 100 and 500 bp (red rectangle) is largest after 13 cycles of sonication.


17 kDa - H3K27ac

Supplemental figure 10. H3K27ac present in sonicated DNA. Western blot after sonication for H3K27ac (17 kDa) in LOUCY cells after LSD1 inhibition or DMSO treatment.


DNA input DMSO

repl. 1

ChIP DNA DMSO

repl. 1

DNA input LSD1i

repl. 1

ChIP DNA LSD1i

repl. 1

DNA input DMSO

repl. 2

ChIP DNA DMSO

repl. 2

DNA input LSD1i

repl. 2

ChIP DNA LSD1i

repl. 2

DNA input DMSO

repl. 3

ChIP DNA DMSO

repl. 3

DNA input LSD1i

repl. 3

ChIP DNA LSD1i

repl. 3

Supplemental figure 11. Fragment size of DNA after library prep. Via the Fragment Analyzer fragments were measured after library prep from DNA of H3K27ac IP from LOUCY cells. The red rectangle indicates the fragments between 200 – 600 bp and the blue arrow points out the primer dimers.


Supplemental figure 12. A zoom in of sequencing reads of H3K27ac ChIP and input samples. No difference is seen in peak number and height between ChIP samples and input samples. Even numbers indicate the ChIP samples, odd numbers the input samples.

Supplemental figure 13. Newly diluted LSD1 treatment influences the gene expression. CD11b, GFI1 and MN1 expression was measured with RT-qPCR in LOUCY cells treated with either 100 nM LSD1 inhibitor (red) or DMSO (blue) for 72 or 144 hours. The graph shows the average calibrated normalized relative quantities (CNRQ) values and corresponding standard errors (SE) calculated with qBase+. CV values were below 0.2 for all replicates. M values were below 0.6 for replicate 1 and 2 and below 0.5 for replicate 4. For replicate 1, the gene expression was standardized against RPL13A and YWHAZ; for replicate 2 against TBP and YWHAZ; for replicate 3 against RPL13A and YWHAZ; for replicate 4 against HMBS and UBC. The gene expression of CD11b and GFI1 increased after LSD1 treatment. A decrease in MN1 expression was observed.


Supplemental tables

Supplemental table 1. Primer sequences of genes of interest and reference genes used for qPCR. Primers were synthesized by IDT.

Supplemental table 2. Sequences of MISSION plasmids used to knock down GFI1 and GFI1b. Primers were synthesized by Merckx.

GENE SEQUENCE FORWARD PRIMER SEQUENCE REVERSE PRIMER

CD11b GTGAAGCCAATAACGCAGC TCTCCATCCGTGATGACAAC

C/EBP TGTATACCCCTGGTGGGAGA TCATAACTCCGGTCCCTCTG

DNMT1 CCTTCACCTAGCCCCAGGAT CTGGTCTTTGTCTTCTTCCTTGA

GFI1 CTCGGAGTTTGAGGACTTCTG CCGCTCCATGAGTACGGTTTG

HMBS GGCAATGCGGCTGCAA GGGTACCCACGCGAATCAC

HpRT1 TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCT

MN1 GAAACTTGTCTGCCACAGTA ATGCCAAGATTACCGAAACA

PU.1 GTGCCCTATGACACGGATCTA AGTCCCAGTAATGGTCGCTAT

RPL13A CCTGGAGGAGAAGGAGGGAAAGAGA TTGAGGACCTCTGTGTATTTGTCAA

SDHA TGGGAACAAGAGGGCATCTG CCACCACTGCATCAAATTCATG

TBP CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC

UBC ATTTGGTGCGCGGTTCTTG TGCCTTGACATTCTCGATGGT

YWHAZ TAAATGGTCTGTCACCGTCT GGAAATACTCGGTAGGGTGT

CLONE ID GENE SEQUENCE

TRCN0000020465 GFI1 CCAGACTATTCCCTCCGTTTA

TRCN0000020466 GFI1 TGCCTTTCAAACCGTACTCAT

TRCN0000020467 GFI1 CATCAAGTGCAGCAAGGTGTT

TRCN0000020468 GFI1 CGACCTCTGTGGGAAGGGTTT

TRCN0000013178 GFI1b CCGGCCTCTTTCTGGCTATAA

TRCN0000013179 GFI1b CCCATTCTACAAGCCTAGCTT

TRCN0000013180 GFI1b CCACTGTGTGAAGTGCAACAA

TRCN0000013181 GFI1b CCTTAGCACTCTATTCCCAAA

SHC002 Non-target CCGGCAACAAGATGAAGAGCACCAACTC


Poster Poster submitted for Research Day & Student Research Symposium (04/04/2019)

This document and the information in it are provided in confidence, for the sole purpose of evaluation of the MASTER thesis of Lien Provez, and may not be disclosed to any third party or used for any other purpose without explicit written permission of Pieter Van Vlierberghe (Department of Biomolecular Medicine at Ghent University).

understanding sensitivity and resistance to lsd1 ...€¦ · lien provez understanding sensitivity...

Documents