university of groningen cell wall deformation and ... · table of contents chapter 1.1 chemical...
TRANSCRIPT
University of Groningen
Cell wall deformation and Staphylococcus aureus surface sensingHarapanahalli, Akshay
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.
Document VersionPublisher's PDF, also known as Version of record
Publication date:2015
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):Harapanahalli, A. (2015). Cell wall deformation and Staphylococcus aureus surface sensing. University ofGroningen.
CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.
Download date: 29-11-2020
Cell Wall Deformation and
Staphylococcus aureus Surface
Sensing
Akshay Kumar Harapanahalli
-Cover story-
The story of growth and success...
A respectable distance from a big tree is the small seed’s greatest chance to grow big and
strong someday by getting its own sunlight. Similarly, in the field of science, starting a PhD
was like sowing a seed of knowledge, a beginning. And, the process of finishing it was like
growing stonger in all aspects of scientific research with a hope to deliver greater good to the
society.
Cell Wall Deformation and Staphylococcus aureus Surface Sensing
By Akshay Kumar Harapanahalli
University Medical Center Groningen, University of Groningen
Groningen, The Netherlands
Copyright © 2015 by Akshay Kumar Harapanahalli
Printed by CPI Whormann Print Service B.V., ZUTPHEN
ISBN (printed version): 978-90-367-8422-1
ISBN (electronic version): 978-90-367-8421-4
Financial support for thesis printing was provided by W.J.Kolff Institute and University of
Groningen
Cover design by Rene Dijkstra
Page layout by Akshay kumar Harapanahalli
Cell Wall Deformation and Staphylococcus aureus Surface Sensing
PhD thesis
to obtain the degree of PhD at the University of Groningen on the authority of the
Rector Magnificus Prof. E. Sterken and in accordance with
the decision by the College of Deans.
This thesis will be defended in public on
Wednesday 16 December 2015 at 09.00 hours
by
Akshay Kumar Harapanahalli
born on 7 May 1982 in Adoni, India
Supervisors
Prof. H.C. van der Mei
Prof. H.J. Busscher
Assessment Committee
Prof. J.M. van Dijl
Prof. J. Kok
Prof. Y. Dufrene
Paranymphs:
Dhr. Willem Woudstra
Dr. Deepak.H.Veeregowda
“To my parents, wife and Grandfather to who I shall be indebted for being a great support
in my life and imbibing me with good morals and values”
Table of Contents
Chapter 1.1 Chemical signals and mechanosensing in bacterial responses to their
environment (PLOS Pathogens 11 (2015) e1005057) 09
Chapter 1.2 General aim of this thesis 16
Chapter 2 Nanoscale cell wall deformation impacts long-range bacterial
adhesion forces on surfaces (Applied and Environmental Microbiology
80 (2014) 637-643) 21
Chapter 3 Residence-time dependent cell wall deformation of different
Staphylococcus aureus strains on gold measured using
Surface enhanced fluorescence (Soft Matter 10 (2014) 7638-7646) 51
Chapter 4 Influence of adhesion force on icaA and cidA gene expression
and production of matrix components in Staphylococcus aureus
biofilms (Applied and Environmental Microbiology 81 (2015) 3369-3378) 81
Chapter 5 Expression of NsaRS two-component system in Staphylococcus aureus
under mechanical and chemical stress
(to be submitted to Environmental Microbiology Reports) 109
Chapter 6 General discussion 127
Summary 133
Nederlandse samenvatting 139
Acknowledgements 145
8
9
Chapter 1
General Introduction and Aim
(Reproduced with permission of PLOS from Akshay K. Harapanahalli.; Jessica A.
Younes.; Elaine Allan.; Henny C. van der Mei.; Henk J. Busscher. Chemical Signals and
Mechanosensing in Bacterial Responses to their Environment, PLoS Pathogen, 2015, 11:
e1005057)
Chapter 1.1
10
Bacteria encounter different environmental conditions during the course of their growth and
have developed various mechanisms to sense their environment and facilitate survival.
Bacteria are known to communicate with their environment through sensing of chemical
signals such as pH, ionic strength or sensing of biological molecules, such as utilized in
quorum sensing [1]. However, bacteria do not solely respond to their environment by means
of chemical sensing, but also respond through physical-sensing mechanisms. For instance,
upon adhesion to a surface, bacteria may respond by excretion of extracellular-polymeric-
substances (EPS) through a mechanism called mechanosensing, allowing them to grow in
their preferred, matrix protected biofilm mode of growth [2]. Chemical sensing of
antimicrobials may further enhance EPS excretion [3]. We will now first discuss the
distinction between chemical- and mechanosensing mechanisms and subsequently elaborate
further on mechanosensing.
What Distinguishes Chemical Sensing from Mechanosensing?
Chemical sensing relies on the presence of specific molecules such as H+ ions, antimicrobials
or on the presence of excreted biological signaling molecules that need to diffuse toward
neighbouring organisms to enable communication and response. In general, Gram-negative
bacteria use homoserine lactones as signaling molecules [4], while peptides are
predominantly used by Gram-positive bacteria [5]. When signaling molecules have reached a
threshold concentration, they activate a receptor which induces expression of target genes to
control the response.
In mechanosensing, bacteria are required to come into physical contact with their
environment, for instance by adhering to a substratum surface or the surfaces of
neighbouring bacteria. This can either be through non-specific or highly specific ligand-
receptor interactions (see also below). Some bacterial cells have special surface appendages,
like flagella or pili that can come in direct, physical contact with another surface. In Vibrio
parahaemolyticus for instance, physical contact can act as a signal, to switch the population
from a planktonic to a sessile, surface-adhering phenotype [6]. Vibrio cholerae can use its
flagellum as a mechanosensor and upon contact with a hard surface, the flagellar motor
Chemical and Mechanosensing in Bacteria
11
stops and ion flow through the motor ceases, which increases the membrane potential and
initiates biofilm formation [7].
Not all bacterial strains possess surface appendages to probe a surface, yet upon
adhesion to a surface they respond by producing EPS and adapting a biofilm mode of
growth. Another form of mechanosensing of a surface is based on adhesion force induced
deformation of the bacterial cell wall. In S. aureus, adhesion forces to substratum surfaces
have been found to modulate icaA expression and associated EPS production. [8]. Moreover,
adhesion force modulated icaA expression was disturbed in mutants lacking a rigid, cross-
linked peptidoglycan layer, suggesting that this form of mechanosensing depends on an
intricate balance between rigidity of the bacterial cell wall and prevailing adhesion forces.
The lipid membrane subsequently follows the deformation of the more rigid peptidoglycan
layer in the cell wall.
How does Cell Wall Deformation yield Surface Sensing?
When a bacterial cell wall deforms either under the influence of adhesion forces arising from
a substratum surface or due to other external forces, the intra-bilayer pressure profile across
the lipid membrane changes as a result of bilayer deformation [9]. Pressure profile changes
can be sensed by bacteria in two different ways: one is through a physical approach (gating of
the mechanosensitive channel, see Figure 1A) and the other through responses generated by
stress sensitive proteins on the cell surface (Figure 1B). Cell wall deformation occurs at the
expense of energy, provided by the adhesion forces arising from the substratum surface to
which bacteria adhere. This energy is required to compensate for the energetically
unfavorable contact between hydrophobic membrane lipids and water (“hydrophobic
mismatch”) and the geometric consequences (thinning of the lipid membrane and wider
spacing between lipid molecules) of the lipid bilayer intrinsic curvature (Figure 1A) [9].
Membrane intrinsic curvature changes in Escherichia coli were found to trap membrane
channels in a fully open state, while hydrophobic mismatch alone was unable to open
channels. Accordingly, mechanosensitive channels must be considered as interpreters of
membrane tension [10] through which mechanical stimuli can be translated into a biological
response. Similarly, stress sensitive proteins present on the cell surface can become activated
upon cell wall deformation. In the Cpx two-component system in E. coli for example [11], the
Chapter 1.1
12
stress sensitive protein CpxA protein can autophosphorylate and transfer phosphate groups
to the response regulator protein CpxR in the cytoplasm. Subsequently, the phosphorylated
CpxR binds to multiple regulatory sites of the DNA to increase transcription of target genes.
Figure 1. Bacterial cell wall deformation, mechanosensing and the measurement of cell
wall deformation using surface enhanced fluorescence. A) Left: Intact lipid membrane at
equilibrium of an undeformed bacterium, with a closed mechanosensitive channel (MSC). Right:
Bacterium adhering to a substratum surface, deformed under the influence of adhesion forces arising
from the substratum, yielding hydrophobic mismatch over the thickness of the membrane (water
molecules adjacent to hydrophobic lipid tails) and altered lipid bilayer tension in the lipid membrane.
Hydrophobic mismatch and pressure profile changes lead to the opening of MSCs. B) Left: A non-
Chemical and Mechanosensing in Bacteria
13
activated stress sensitive protein (SS) on the bacterial cell surface of an undeformed bacterium and a
response regulator protein (RR) suspended freely in the cytoplasm. Right: A SS protein senses cell
wall deformation due to adhesion, changes its conformation and phosphorylates a RR protein which
regulates the expression of SS regulated genes. C) Left: Lifshitz-Van der Waals forces operate between
all molecular pairs in a bacterium and a substratum, decreasing with distance between the molecules
(decreasing thickness of the arrows). Right: Adhering bacterium, deformed due to attractive Lifshitz-
Van der Waals forces, with more molecules in the bacterium closer to the substratum, yielding stronger
adhesion and more deformation. Deformation stops once the counter-forces arising from the
deformation of the rigid peptidoglycan layer match those of the adhesion forces. D) Left: Only a small
number of fluorophores inside an undeformed bacterium are sufficiently close to a metal substratum
surface to experience surface-enhanced-fluorsecence (brighter dots). Right: In a deformed, adhering
bacterium, the volume of the bacterium close to the surface increases and the number of fluorophores
subject to surface-enhanced-fluoresecence becomes higher. Thus quantitative analysis of fluorescence
arising from fluorescent bacteria adhering to a metal surface provides a ways to determine cell wall
deformation.
How can we Experimentally Demonstrate and Quantify Bacterial Cell Wall
Deformation upon Adhesion to Surfaces?
Bacterial adhesion to surfaces is mediated by adhesion forces arising from the substratum
surface to which they adhere. From a physico-chemical perspective, there are only a limited
number of different adhesion forces:
Lifshitz-Van der Waals forces, generally attractive and operative over a relatively
long distance range;
electrostatic forces that can either be attractive or repulsive depending on their
magnitude and distance range, as determined by ionic strength and pH;
acid-base interactions between hydrogen-donating and hydrogen-accepting groups
that can also be attractive or repulsive.
When these adhesion forces arise from spatially localized and stereo-chemical groups, they
are sometimes called “specific”, or ligand-receptor interactions [12].
Due to the long-range nature of Lifshitz-Van der Waals forces, contributions to the
total Lifshitz-Van der Waals force arise from all molecular pairs in a bacterium and a
substratum, which of course decrease in magnitude with increasing distance (Figure 1C) [13].
Chapter 1.1
14
It has been argued that, since the overall molecular composition of different bacterial strains
is highly similar, differences in Lifshitz-Van der Waals forces between adhering bacteria on
different substratum surfaces reflect varying degrees of cell wall deformation. The rationale
for this is simple: deformation brings more molecules in the close vicinity of a substratum,
average distance will decrease and adhesion forces increase, yielding more extensive
deformation until impeded by counter-forces arising from the rigidity of the peptidoglycan
layer. It is uncertain whether also ligand-receptor interactions can mediate cell wall
deformation to the extent as non-specific Lifshitz-Van der Waals forces have been
demonstrated to do [14]. Since ligand-receptor interactions only arise from molecules
present at the surface, their number is small relative to compared to the number of
molecules participating in Lifshitz-Van der Waals forces (see Figure 1C). However, their
strength of interaction may be quite strong.
Adhesion induced cell wall deformation has been directly demonstrated through
atomic-force-microscopy measurements of the height and base width of bacteria adhering to
substratum surfaces, but atomic force microscopy data have to be obtained for individual
bacteria, which is a tedious procedure with high variability [14]. As an alternative method to
quantify bacterial cell wall deformation, surface enhanced fluorescence has been proposed.
Surface enhanced fluorescence is based on recent observations that fluorescence is enhanced
on reflecting surfaces once the fluorophores are within the range of 20-30 nm from the
surface [15]. Similarly, upon adhesion of fluorescent bacteria to a reflecting surface, cell wall
deformation will occur that brings a larger volume of the bacterium and therewith more
fluorophores closer to a surface, yielding stronger surface enhanced fluorescence (Figure
1D). Surface enhanced fluorescence of adhering bacteria can be measured using macroscopic
bio-optical imaging that allows observation over substratum areas of several tens of cm2,
therewith encompassing numbers of adhering bacteria that approximate a bacterial
monolayer (around 108 bacteria/cm2). Accordingly, surface enhanced fluorescence has been
proposed as an ideal method to study adhesion induced cell wall deformation in a rapid and
statistically reliable manner under naturally occurring adhesion forces, the only drawback
being the need to use a reflecting surface and fluorescent bacterial strains.
Chemical and Mechanosensing in Bacteria
15
Does Physical Contact between Bacteria Modulate Quorum Sensing?
Physical contact is not only established between bacteria adhering to substratum surfaces
but also between individual bacteria in a biofilm, which raises a number of interesting
questions. First of all, biofilms produce different amounts of EPS depending on the nature of
the substratum [3], but only the initially adhering bacteria have contact with the substratum
surface itself [16]. Clearly, the effective range of all attractive or repulsive forces arising from
a substratum surface is limited to tens of nanometres, making it impossible for bacterial cells
other than the initial colonisers to directly sense a surface. Moreover, they will experience
adhesion forces from neighboring organisms with whom they co-adhere. This implies that
there must be a communication means available within a biofilm through which substratum
information is passed to bacteria that are not in direct contact with the substratum enabling
them to indirectly sense the surface. Quorum sensing likely is the prevailing mechanism for
the indirect passing of this information to later colonizers in a biofilm, although physical
contact between coadhering bacteria may play a role here too. For instance, Myxococcus
xanthus, E. coli, Bacillus subtilis and lactobacilli use contact-dependent signaling for
communication [17] in addition to quorum sensing, suggesting that physical contact not only
provides a direct way of communication between bacteria within their environment,
moreover it may also constitute a mechanism by which bacteria can optimise the use of
quorum sensing molecules. For example, lactobacilli adhere more strongly to staphylococci
than staphylococci to each other, giving lactobacilli the opportunity to penetrate and colonise
regions of vaginal biofilms where staphylococci predominate, resulting in the quorum
sensing mediated quenching of staphylococcal toxic shock syndrome toxin secretion [18, 19].
This form of quorum quenching only occurs however, when there is a sufficiently high
concentration of quorum quenching dipeptides in the close neighborhood of toxic shock
syndrome toxin secreting staphylococci, which occurs more readily when staphylococci and
lactobacilli are in direct contact with each other [18]. Thus physical contact, as established
through adhesion forces between bacteria and biochemical signaling, may be considered as
intrinsically linked mechanisms in a biofilm.
Chapter 1.1
16
Perspective: Cell Wall Deformation and Adhesion Induced Antibiotic
Resistance of Biofilms
Eighty percent of all human infections are caused by biofilms adhering to soft tissue surfaces
in the human body, the surfaces of biomaterial implants or coadhering to other bacteria. The
antibiotic resistance of biofilms exceeds that of planktonic bacteria [20] due to phenotypic
changes induced by adhesion of the bacteria involved and their production of an EPS matrix
which hampers antimicrobial penetration [21]. Cell wall deformation induced by adhesion
forces plays a pivotal role in this transition from antibiotic susceptible planktonic growth to a
more antibiotic resistant biofilm mode of growth and production of a protective EPS matrix
has been found absent for bacteria adhering to surfaces exerting weak adhesion forces [22].
However, this implies only indirect evidence for the involvement of mechanosensitive
channels or stress sensitive proteins in bacterial biofilm formation. Therefore, control of the
forces experienced by bacteria in a biofilm may provide a relatively unexplored pathway to
control resistance associated with implant associated infections and perhaps the
pathogenicity of biofilms.
1.2 AIM OF THIS THESIS
The preceding chapter (1.1) on bacterial interactions with environment suggests a crucial
role for adhesion forces between bacteria and the surface to which they adhere.
In this respect, the aim of this thesis was to evaluate the role of adhesion forces in
the response of bacteria to their adhering state. To this end, we used a model pathogen
Staphylococcus aureus, common in biomaterial associated infections and several of its
isogenic mutants and applied atomic force microscopy and surface enhanced fluorescence to
quantify adhesion forces and cell wall deformation, respectively. Bacterial response was
evaluated in terms of gene expression on different biomaterials commonly used in
orthopedic implants.
Chemical and Mechanosensing in Bacteria
17
References
1. Miller MB, Bassler BL (2001) Quorum sensing in bacteria. Annu Rev Microbiol 55: 165-169.
2. Decho AW (2013) The EPS matrix as an adaptive bastion for biofilms: introduction to special
issue. Int J Mol Sci 14: 23297–23300.
3. Nuryastuti T, Krom BP, Aman AT, Busscher HJ, Van der Mei HC (2011) Ica-expression and
gentamicin susceptibility of Staphylococcus epidermidis biofilm on orthopedic implant
biomaterials. J Biomed Mater Res Part A 96: 365–371.
4. Gambello MJ, Kaye S, Iglewski BH (1993) LasR of Pseudomonas aeruginosa is a
transcriptional activator of the alkaline protease gene (apr) and an enhancer of exotoxin A
expression. Infect Immun 61: 1180–1184.
5. Novick RP, Muir TW (1999) Virulence gene regulation by peptides in staphylococci and other
Gram-positive bacteria. Curr Opin Microbiol 2: 40–45.
6. Gode-Potratz CJ, Kustusch RJ, Breheny PJ, Weiss DS, McCarter LL (2011) Surface sensing in
Vibrio parahaemolyticus triggers a programme of gene expression that promotes colonization
and virulence. Mol Microbiol 79: 240–263.
7. Van Dellen KL, Houot L, Watnick PI (2008) Genetic analysis of Vibrio cholerae monolayer
formation reveals a key role for ΔΨ in the transition to permanent attachment. J Bacteriol
190: 8185–8196.
8. Harapanahalli AK, Chen Y, Jiuyi Li, Busscher HJ, Van der Mei HC (2015) Influence of
adhesion force on icaA and cidA gene expression and production of matrix components in
Staphylococcus aureus biofilms. Appl Environ Microbiol 81: 3369-3378.
9. Perozo E, Kloda A, Cortes DM, Martinac B (2002) Physical principles underlying the
transduction of bilayer deformation forces during mechanosensitive channel gating. Nat
Struct Biol 9: 696–703.
10. Haswell ES, Phillips R, Rees DC (2011) Mechanosensitive channels: what can they do and how
do they do it? Structure 19: 1356–1369.
11. Otto K, Silhavy TJ (2002) Surface sensing and adhesion of Escherichia coli controlled by the
Cpx-signalling pathway. Proc Natl Acad Sci U S A 99: 2287-2292.
12. Van Oss CJ, Good RJ, Chaudhury MK (1986) The role of Van der Waals forces and hydrogen
bonds in “hydrophobic interactions” between biopolymers and low energy surfaces. J Colloid
Interface Sci 111: 378–390.
13. Rijnaarts HHM, Norde W, Lyklema J, Zehnder AJB (1999) DLVO and steric contributions to
bacterial deposition in media of different ionic strengths. Colloids Surf B Biointerf 14: 179–
195.
Chapter 1.1
18
14. Chen Y, Harapanahalli AK, Busscher HJ, Norde W, Van der Mei HC (2014) Nanoscale cell
wall deformation impacts long-range bacterial adhesion forces on surfaces. Appl Environ
Microbiol 80: 637–643.
15. Li J, Busscher HJ, Swartjes J, Chen Y, Harapanahalli AK, Norde W, Van der Mei HC, Sjollema
J. 2014. Residence-time dependent cell wall deformation of different Staphylococcus aureus
strains on gold measured using surface-enhanced-fluorescence. Soft Matter 10:7638–7646.
16. Busscher HJ, Bos R, Van der Mei HC (1995) Initial microbial adhesion is a determinant for
the strength of biofilm adhesion. FEMS Microbiol. Lett 128: 229-234.
17. Blango MG, Mulvey MA (2009) Bacterial landlines: contact-dependent signaling in bacterial
populations. Curr Opin Microbiol 12: 177–181.
18. Younes JA, Van der Mei HC, Van den Heuvel E, Busscher HJ, Reid G (2012) Adhesion forces
and coaggregation between vaginal staphylococci and lactobacilli. PLoS One 7: e36917.
19. Li J, Wang W, Xu SX, Magarvey NA, Mccormick JK (2011) Lactobacillus reuteri -produced
cyclic dipeptides quench agr -mediated expression of toxic shock syndrome toxin-1 in
staphylococci. Proc Natl Acad Sci USA 108: 3360–3365.
20. John AK, Schmaler M, Khanna N, Landmann R (2011) Reversible daptomycin tolerance of
adherent staphylococci in an implant infection model. Antimicrob Agents Chemother 55:
3510–3516.
21. He Y, Peterson BW, Jongsma MA, Ren Y, Sharma PK, et al. (2013) Stress relaxation analysis
facilitates a quantitative approach towards antimicrobial penetration into biofilms. PLoS One
8: e63750.
22. Muszanska AK, Nejadnik MR, Chen Y, Van den Heuvel ER, Busscher HJ, et al. (2012)
Bacterial adhesion forces with substratum surfaces and the susceptibility of biofilms to
antibiotics. Antimicrob Agents Chemother 56: 4961-4964.
19
20
21
Chapter 2
Nano-scale Cell Wall Deformation Impacts Long-range
Bacterial Adhesion Forces to Surfaces
(Reproduced with permission of American Society for Microbiology from Yun Chen, Akshay
K. Harapanahalli, Henk J. Busscher, Willem Norde, and Henny C. van der Mei. Nano-scale
Cell Wall Deformation Impacts Long-range Bacterial Adhesion Forces to Surfaces. Appl.
Environ. Microbiol. 2014, 2, 637-643)
Chapter 2
22
ABSTRACT
Adhesion of bacteria occurs on virtually all natural and synthetic surfaces, and is crucial for
their survival. Once adhering, bacteria start growing and form a biofilm, in which they are
protected against environmental attacks. Bacterial adhesion to surfaces is mediated by a
combination of different short- and long-range forces. Here we present a new, Atomic Force
Microscopy (AFM)-based method to derive long-range bacterial adhesion forces from the
dependence of bacterial adhesion forces on the loading force, as applied during using AFM.
Long-range adhesion forces of wild-type Staphylococcus aureus parent strains (0.5 and 0.8
nN) amounted to only one third of these forces measured for their, more deformable
isogenic Δpbp4 mutants that are deficient in peptidoglycan cross-linking. Measured long-
range Lifshitz-Van der Waals adhesion forces matched those calculated from published
Hamaker constants, provided a 40% ellipsoidal deformation of the bacterial cell wall was
assumed for the Δpbp4 mutants. Direct imaging of adhering staphylococci using the AFM
PeakForce-QNM mode confirmed height reduction due to deformation in the Δpbp4
mutants by 100 – 200 nm. Across naturally occurring bacterial strains, long-range forces do
not vary to the extent as observed here for the Δpbp4 mutants. Importantly however,
extrapolating from the results of this study it can be concluded that long-range bacterial
adhesion forces are not only determined by the composition and structure of the bacterial
cell surface, but also by a hitherto neglected, small deformation of the bacterial cell wall,
facilitating an increase in contact area and therewith in adhesion force.
Cell Wall Deformation and Long-range Adhesion Forces
23
INTRODUCTION
Bacteria adhere to virtually all natural and synthetic surfaces (1, 2), as adhesion is crucial for
their survival. Bacterial adhesion to surfaces is followed by their growth and constitutes the
first step in the formation of a biofilm, in which organisms are protected against
antimicrobial treatment and environmental attacks. Accordingly, the biofilm mode of growth
is highly persistent and biofilms are notoriously hard to remove, causing major problems in
many industrial and bio-medical applications with high associated costs. On the other hand,
biofilms can be beneficial too, as in bio-remediation of soil, for instance. Surface
thermodynamics and (extended) DLVO approaches have been amply applied in current
microbiology to outline that bacterial adhesion to surfaces is mediated by an interplay of
different fundamental physico-chemical interactions, including Lifshitz-Van der Waals,
electric double layer, and acid-base forces (3–5). Assorted according to their different
"effective" ranges, these different fundamental interactions can be alternatively categorized
into two groups: short-range and long-range forces (6) that act over distances of a few nm up
to tens of nm, respectively.
Long-range adhesion forces are generally associated with Lifshitz-Van der Waals
forces and can be theoretically calculated (7) for the configuration of a sphere with radius R0
versus a flat surface (Figure 1) using
02
0 3
0
)(
)2(
6)(
Rz
zdz
zD
zzRA
DDF (1)
in which A is the Hamaker constant (8), z is distance and D indicates the separation distance
between the sphere and the substratum surface. The Hamaker constant in equation 1
accounts for the materials properties of the interacting surfaces and the medium across
which the force is operative. Since long-range adhesion forces result from the summation of
all pair-wise molecular interaction forces in the interacting volumes, any deformation that
brings a bacterial cell surface closer to a substratum surface and extending over a larger
contact area, will increase the long-range adhesion force (see Figure 1).
Chapter 2
24
Figure 1. Pair-wise summation of long-range, Lifshitz-Van der Waals molecular interaction forces in
the bacterial cell and substratum yields the long-range adhesion force between the interacting surfaces.
Deformation of the bacterial cell wall brings more molecules in the bacterium in the close vicinity of the
substratum, which increases the adhesion force. In this schematics, the undeformed bacterial cell is
taken as a sphere with radius R0, deforming under the influence of the adhesion forces into an oblate
spheroid with a polar radius r and an equatorial radius R. D indicates the separation distance.
So far, this aspect of long-range adhesion forces between bacteria and substratum surfaces
has been largely neglected, because deformation due to adhesion forces is small for naturally
occurring bacteria, possessing a rigid, well-structured peptidoglycan layer. Nevertheless, it
has recently been pointed out, that even small deformations can have a considerable impact
on the metabolic activity of adhering bacteria, a phenomenon for which the term “stress de-
activation” has been coined (9). Thus, despite their small numerical values, minor variation
in long-range adhesion forces may still strongly affect the behavior of bacterial cells at
substratum surfaces.
Cell Wall Deformation and Long-range Adhesion Forces
25
In this paper we propose a method to derive long-range adhesion forces between
bacteria and substratum surfaces, based on a previously published elastic deformation model
(10). Through the use of two isogenic Δpbp4 mutants and their wild-type, parent strains
(Staphylococcus aureus NCTC 8325-4 and ATCC 12600), long-range adhesion forces could
be related with the nano-scale deformability of the cell wall. Note that so-called Δpbp4
mutants are deficient in penicillin-binding-proteins that play an important role in cross-
linking peptidoglycan strands and are therefore more susceptible to deformation than their
parent strains (11), for which reason they are ideal to demonstrate the role of deformation in
long-range adhesion forces between bacteria and substratum surfaces.
MATERIALS AND METHODS
Bacterial strains and culture conditions
Two pairs of staphylococcal strains were included in this study. Each pair comprised a wild-
type, parent strain and a so-called Δpbp4 mutant, deficient in penicillin-binding-proteins
that play an important role in cross-linking peptidoglycan strands in the cell wall. The Δpbp4
mutant of S. aureus NCTC 8325-4 was kindly provided by Dr. Mariana G. Pinho
(Universidade Nova de Lisboa), while the Δpbp4 mutant of S. aureus ATCC 12600 was an
own construct, prepared as described by Atilano et al. (12). Briefly, the strain was inoculated
with the pMAD-pbp4 plasmid by electroporation and grown on Tryptone Soya Agar (TSA,
OXOID, Basingstoke, England) plates containing erythromycin (SIGMA-ALDRICH, St.
Louis, Missouri, USA) and X-Gal (SIGMA-ALDRICH) for 48 h at 30°C. To obtain bacteria
with a chromosomally integrated copy of pMAD-pbp4, blue colonies were used to inoculate
overnight cultures in Tryptone Soya Broth (TSB, OXOID) medium. Next, 10 ml TSB was
inoculated with 100 μl of an overnight culture, grown for 1 h at 30°C, and then transferred to
42°C for 6 h. To select bacteria with a chromosomally integrated copy of pMAD-pbp4,
dilutions (1000×) of the culture were plated on TSA plates with erythromycin and X-Gal and
incubated for 48 h at 42°C. To subsequently obtain bacteria that had excised pMAD-pbp4
from the chromosome, blue colonies with integrated pMAD-pbp4 were used to inoculate
overnight cultures in TSB medium at 42°C. Next, 10 ml TSB was inoculated with 10 μl of the
overnight culture and growth was continued for 6 h at 30°C. Dilutions (1000×) of the
Chapter 2
26
cultures were plated on TSA plates with X-Gal and incubated at 42°C for 48 h. White
colonies were tested for erythromycin sensitivity and checked for the presence or absence of
pbp4 by colony PCR.
Staphylococci were pre-cultured from blood agar plates in 10 ml TSB. Pre-cultures
were grown for 24 h at 37°C. After 24 h, 0.5 ml of a pre-culture was transferred into 10 ml
fresh medium and a main culture was grown for 16 h at 37°C. Bacteria were harvested by
centrifugation at 5000 × g for 5 min, washed twice with 10 mM potassium phosphate buffer,
pH 7.0 and finally suspended in the same buffer. When bacterial aggregates were observed
microscopically, 10 s sonication at 30 W (Vibra Cell model 375, Sonics and Materials Inc.,
Danbury, Connecticut, USA) was carried out intermittently for three times, while cooling the
suspension in a water/ice bath. Note that staphylococci are coccal organisms, possessing a
nearly perfect spherical shape (13–15).
Dynamic light scattering (DLS)
In order to account for possible differences in the size of the Δpbp4 mutants with respect to
their wild-type, parent strains, hydrodynamic radii R0 of the staphylococci were determined
using DLS (Zetasizer Nano ZS, Malvern Instruments Ltd., United Kingdom) in 10 mM
potassium phosphate buffer. For each strain, three separate cultures were included, and the
measurements were repeated on three different aliquots from one culture.
AFM force spectroscopy
Glass slides (Gerhard Menzel GmbH, Braunschweig, Germany) were sonicated for 3 min in
2% RBS35 (Omnilabo International BV, The Netherlands), and sequentially rinsed with tap
water, demineralized water, methanol, tap water, and demineralized water.
Bacterial probes were prepared by immobilizing a bacterium to a NP-O10 tipless
cantilever (Bruker, Camarillo, California, USA). Cantilevers were first calibrated by the
thermal tuning method and spring constants were always within the range given by the
manufacturer (0.03 – 0.12 N/m). Next, a cantilever was mounted to the end of a
micromanipulator and under microscopic observation, the tip of the cantilever was dipped
Cell Wall Deformation and Long-range Adhesion Forces
27
into a droplet of 0.01% α-poly-L-lysine with MW 70,000-150,000 (SIGMA-ALDRICH) for 1
min to create a positively charged layer. After 2 min of air-drying, the tip of the cantilever
was carefully dipped into a staphylococcal suspension droplet for 1 min to allow bacterial
attachment through electrostatic attraction and dried in air for 2 min. Successful attachment
of a staphylococcus on the cantilever follows directly from a comparison of the force-distance
curves of a staphylococcal probe versus the one of a poly-L-lysine coated cantilever (see
Figure A1, Supplementary materials). Although this attachment protocol is standard in the
measurement of adhesion forces using AFM (16), it is possible that the attachment
procedure disturbs the structure of the weakened mutant strains and therewith affects the
results. However, bacterial probes produce similar force-distance curves, regardless of the
different drying times for the wild-type, parent strains and the Δpbp4 mutants (see Figure
A2, Supplementary materials). Thus it can be ruled out that the attachment protocol disturbs
the structure of the Δpbp4 mutants, with their weakened cell walls. Bacterial probes were
always used immediately after preparation.
All force measurements were performed in 10 mM potassium phosphate buffer (pH
7.0) at room temperature on a BioScope Catalyst Atomic Force Microscope (AFM) (Bruker).
In order to verify that a bacterial probe had a single contact with the substratum surface, a
scanned image in the AFM contact mode with a loading force of 1 - 2 nN was made at the
onset of each experiment and examined for double contour lines. Double contour lines
indicate that the AFM image is not prepared from the contact of a single bacterium with the
surface, but that multiple bacteria on the probe are in simultaneous contact with the
substratum. Any probe exhibiting double contour lines was discarded. At this point it must
be noted however, that images containing double contour lines seldom or never occurred,
since it represents the unlikely situation that bacteria on the cantilever are equidistant to the
substratum surface within the small range of the interaction forces. This is unlikely because
the cantilever is contacting the substratum under an angle of 15 degrees.
Adhesion forces between the bacterial cell and glass surface were measured at
multiple, randomly chosen spots. Before actual measurements, five force-distance curves of
a bacterial probe toward a clean glass surface were measured at a loading force of 3 nN and
the maximal adhesion force upon retract recorded. Next, the maximal adhesion forces were
measured at loading forces of 1, 3, 5, 7, and 9 nN, separately. For each loading force, at least
20 force-distance curves were recorded (Figure A3, Supplementary materials for replicate
Chapter 2
28
measurements with one probe) and, after this series, the maximal adhesion force under the
loading force of 3 nN was always measured again. Whenever this force differed more than 1
nN from the initially measured value, the bacterial probe was regarded damaged and
replaced by a new one. Measurements for each strain at a single loading force typically
include six bacteria and two probes, with bacteria taken out of three separate cultures.
Derivation of the long-range contribution to the total adhesion force
The long-range force FLR between a bacterium and the substratum arises from pair-wise
attractive Lifshitz-Van der Waals forces between all molecules in the interacting bodies (see
Figure 1), and decays slowly with increasing distance between a bacterium and substratum
surface. Therefore, as long as the bacterial cell surface is in contact with the substratum
surface, FLR can be approximated as a constant, while the short-range force FSR can be
assumed to be proportional to the contact area S. Hence,
SfFFFF SRLRSRLRadh (2)
where fSR is the short-range force per unit contact area. Based on a previously proposed
elastic deformation model (10), Fadh can be expressed as
LR0SRld*
SRadh FSfF
E
fF (3)
Equation 3 indicates a linear relationship between Fadh and the loading force Fld (Figure 2),
while fSR, the reduced Young's modulus E* and the initial contact area S0 are readily
determined from our elastic deformation model (10). By fitting Fadh versus Fld according to
equation 3, the value of FLR can be resolved immediately from the intercept F0 by
0SR0LR SfFF (4)
Cell Wall Deformation and Long-range Adhesion Forces
29
Theoretical evaluation of the cell wall deformation from a comparison of
Lifshitz-Van der Waals forces between a sphere and an ellipsoid
The Lifshitz-Van der Waals force s
LWF between a sphere and a substratum surface can be
expressed as
20s
LW 6D
ARF (5)
Figure 2. The adhesion force Fadh as a function of the loading force Fld applied during AFM
measurements for two wild-type S. aureus strains (NCTC 8325-4 and ATCC 12600) and their isogenic
Chapter 2
30
Δpbp4 mutants. Error bars denote the standard deviations over at least 100 force curves (six bacteria
divided over two different probes and taken from three separate cultures).
where 0R is the radius of the undeformed sphere and D the separation distance between the
sphere and the substratum surface (see also Figure 1) (7, 17). Assuming that adhering coccal
bacteria deform to an ellipsoid, with a shorter polar axis, and a circular equatorial plane, its
Lifshitz-Van der Waals force e
LWF can be calculated from
22
2e
LW )2(3
2
rDD
rARF
(6)
where R and r represent the lengths of the equatorial and polar radii, respectively. When the
bacterial cell volume remains constant during the deformation,
3
0
2 RrR (7)
Insertion of equation 7 into equation 6 leads to
22
3
0e
LW )2(3
2
rDD
ARF
(8)
The Hamaker constant of isogenic mutants can be considered similar to the one of their
parent strains, and, possibly, invariant with bacterial strains involved (18, 19). Hence,
dividing equation 8 as applied to the Δpbp4 mutant by equation 5, as applied to the parent
Cell Wall Deformation and Long-range Adhesion Forces
31
strain, yields the ratio k of the Lifshitz-Van der Waals forces between an ellipsoidally
deformed Δpbp4 bacterium and a undeformed, spherical bacterium of the parent strain:
3
P
0
M
0
2
2P
0
s
LW
e
LW )()2(
)2(
R
R
Dr
DR
F
Fk
(9)
where P
0R and M
0R represent the hydrodynamic radii of the undeformed bacteria for the
parent strain and its isogenic Δpbp4 mutant strain, respectively. Equation 9, at close
approach (20) (D « P
0R , r), simplifies into
2P
0
3M
0 )(
rR
Rk (10)
The ratio k can be readily determined from the Lifshitz-Van der Waals adhesion forces of the
parent strains and their isogenic Δpbp4 mutants, as summarized in Table 1.
Subsequently, r can be calculated by
5.0P
0
M
0M
0 )(kR
RRr (11)
and substitution in equation 7 yields
Chapter 2
32
25.0M
0
P
0M
0 )(R
kRRR (12)
Cell Wall Deformation and Long-range Adhesion Forces
33
Table 1. Pairwise comparison of the hydrodynamic radii R0 of planktonic staphylococci, the long-range
adhesion forces FLR, and the dimensions of the ellipsoidally deformed bacterial cells from matching
experimental and theoretically calculated Lifshitz-Van der Waals forces (rLW and RLW), for the two
wild-type S. aureus strains (NCTC 8325-4 and ATCC 12600) and their isogenic Δpbp4 mutants (for
explanation of the dimensional parameters, see also Figure 1). The deformation of the bacterial cell is
expressed in terms of the difference between the hydrodynamic radius and the polar radius, i.e., (R0 -
rLW) and (R0 - rHeight Image), in which rHeight Image is obtained from AFM imaging. Shaded blocks could not
be calculated due to the assumption of undeformable wild-type strains.
Strain
S. aureus NCTC 8325-4 S. aureus ATCC 12600
Parent
strain Δpbp4
Parent
strain Δpbp4
R0 (nm)a 618 ± 35 570 ± 38 678 ± 38 620 ± 33
FLR (nN)b -0.8 ± 0.2 -2.7 ± 0.3 -0.5 ± 0.1 -1.6 ± 0.4
kb 3 ± 1 3 ± 1
rLW (nm)b 304 ± 97 327 ± 99
RLW (nm)b 780 ± 202 854 ± 197
R0 - rLW (nm)b 266 ± 135 293 ± 132
rHeight Image
nm)c
638 ± 44 508 ± 40† 690 ± 31 583 ± 27†
R0 – rHeight
Image (nm)b 82 ± 78 49 ± 60
a ± signs indicate standard deviations in hydrodynamic radii over nine aliquots taken from three
separate bacterial cultures of each strain.
b ± signs indicate standard deviations calculated by error propagation.
Chapter 2
34
c ± signs indicate standard deviations in the height of bacterial cells over at least 60 staphylococci taken
from three different cultures of each strain.
† The polar radius rHeight Image determined in AFM PeakForce-QNM mode is significantly smaller than
the hydrodynamic radius R0 measured by DLS, according to a one-sided Student's t-test (p < 0.05).
Imaging of bacterial cell deformation using AFM in the PeakForce-QNM mode
In order to directly image possible deformation of staphylococci adhering to a surface, AFM
was applied in the so-called PeakForce-QNM mode, providing the possibility to obtain
images while applying a minimal imaging force through the precise control of the force
response. SCNASYST-FLUID tips (Bruker) for use in the PeakForce-QNM mode were
calibrated as described above for NP-O10 tipless cantilevers. The tip radius was estimated by
scanning the calibration surface provided by the manufacturer and image-analysis with the
NanoScope Analysis software (Bruker). First a droplet of 0.01% α-poly-L-lysine was spread
on a clean glass slide and air-dried to create a positively charged surface (21). Next, a 200 µl
droplet of a staphylococcal suspension was put on the slide. After 30 min, the suspension
was washed off and immobilized bacteria within an area of 25 μm2 were scanned in 10 mM
potassium phosphate buffer (pH 7.0) using a previously calibrated tip in the PeakForce-
QNM mode on the BioScope Catalyst AFM, at a scan rate of 0.5 Hz and PeakForce set-point
of 1 nN. The images were analyzed using Gwyddion v2.30 (22). The height of each individual
bacterial cell was determined from the extracted height profile (see Figure 3). For each
strain, images were taken of at least 60 different staphylococci, representing three separate
cultures.
Cell Wall Deformation and Long-range Adhesion Forces
35
RESULTS
Hydrodynamic radii of planktonic staphylococci
Hydrodynamic radii R0 of planktonic staphylococci are presented in Table 1. According to a
one-sided Student’s t-test performed at a significance level of p < 0.05, Δpbp4 mutants are
slightly, but significantly smaller than their wild-type parent strains. Importantly,
hydrodynamic radii of the strains were not affected by harvesting procedures, as
demonstrated in Figure S5a (Supplemental Material).
Long-range contributions to bacterial adhesion forces and bacterial cell
deformation
In Figure 2, the adhesion force Fadh is plotted versus the loading force Fld applied during
AFM measurements, as derived from force-distance curves under different applied loading
forces (see Figure S4, Supplemental Material). Three out of four strains show good linear
relationships (R2 > 0.9) despite variations in slope and intercept. However, for S. aureus
NCTC 8325-4Δpbp4, the adhesion force appears to be independent of the loading force.
Table 1 also summarizes the long-range contribution FLR to the adhesion force for the two
parent strains and their isogenic Δpbp4 mutants. All strains show attractive long-range
forces. Interestingly, the ratios k of these two forces for the parent strains and their
respective isogenic mutant are very similar around 3 for both S. aureus NCTC 8325-4 and
ATCC 12600. Since the space separating the bacterial cell from the glass substratum is filled
with potassium phosphate buffer of relatively high ionic strength (10 mM), electric double
layer interactions may be considered negligible,23,24 and the ratio k between the long-range
forces for parent and mutant strain can be considered as the ratio between their Lifshitz-Van
der Waals forces. This consideration allows for calculating the change in the dimensions of
the Δpbp4 staphylococcal mutants under the influence of attractive Lifshitz-Van der Waals
forces. Measured long-range Lifshitz-Van der Waals adhesion forces matched those
calculated from published Hamaker constants,18,19 provided an ellipsoidal deformation of the
bacterial wall was assumed for the Δpbp4 mutants from its original undeformed, spherical
shape with a radius R0 (for details see equations 11 and 12). Accordingly, it can be calculated
that the deformation of the Δpbp4 mutants R0 – rLW amounts to 266 nm and 293 nm for S.
Chapter 2
36
aureus NCTC 8325-4 and ATCC 12600, respectively (see also Table 1) due to the built-in
deficiency in their cell wall rigidity.
Direct measurement of staphylococcal cell deformation
Comparative, quantitative data do not exist for the deformation of Δpbp4 mutants as
compared to their parent strains. Although the above results from our elastic deformation
model are intuitively reasonable, we also measured the deformation directly using the AFM
in the PeakForce-QNM mode (Figure 3). Importantly, the polar radii of the strains were not
affected by harvesting procedures, as demonstrated in Figure S5b (Supplemental Material).
The height images and profiles of the respective wild-type, parent and mutant strains were
expressed in terms of the polar radii rHeight Image and are also presented in Table 1. According
to a two-sided Student's t-test performed at a significance level of p < 0.05, the rHeight Image
values of the wild-type, parent strains are not significantly different from their
hydrodynamic radii R0 values.
Cell Wall Deformation and Long-range Adhesion Forces
37
Figure 3. Height images and profiles of individual staphylococci immobilized on a glass surface in the
AFM PeakForce-QNM mode for two wild-type S. aureus strains (NCTC 8325-4 and ATCC 12600) and
their isogenic Δpbp4 mutants. Five examples of height profiles are presented for each strain. The
profiles plotted as solid lines are derived along the directions indicated by the dashed lines in the
height images presented.
Chapter 2
38
However, according to a one-sided Student's t-test performed at a significant level of p <
0.05, the rHeight Image values of both Δpbp4 mutants are significantly smaller than their
hydrodynamic radii R0 values determined using DLS. These direct measurements confirm
strong deformation of Δpbp4 mutants during adhesion to glass, although not to the extent as
derived from our elastic deformation model.
DISCUSSION
Long-range, Lifshitz-Van der Waals adhesion forces between bacteria and substratum
surfaces are of ubiquitous importance in facilitating adhesion of bacteria, since they cause
attraction of bacteria from a large distance to a substratum surface while, they operate
regardless of the details of the bacterial cell surface structure and composition. Moreover, in
a long-range approach, surface appendages may be less important, as the concept of distance
between bacteria and substratum surfaces is lost upon close approach. Long-range, Lifshitz-
Van der Waals adhesion forces can be derived from contact angles with liquids on the
interacting surfaces and surface thermodynamic modeling25,26 or decoupling of AFM
adhesion force measurements using Poisson analysis.27–30 However, long-range adhesion
forces vary considerably less among different strains than short-range forces.27–30 Similarity
in long-range adhesion forces is to be expected, because these forces arise from the entire
bacterial cell, i.e. its DNA content, cytoplasm, cell membrane, peptidoglycan layer and
outermost cell wall structures (see Figure 1). Whereas the outermost cell wall structures may
vary most across different strains, yet the overall composition of different bacterial strains is
rather similar, which suggests that the variations observed hitherto in long-range adhesion
forces may have other sources than differences in chemical composition. This is the first
study to derive quantitative data on the nano-scale deformation of deformable Δpbp4
mutants and its relation with long-range adhesion forces between these staphylococci and
substratum surfaces. Long-range adhesion forces of the deformable mutants are three-fold
stronger than of their rigid parent strains, which suggests that long-range, Lifshitz-Van der
Waals forces between bacteria and substratum surfaces are strongly affected by the
deformability of the bacterial cell wall. In this study, Staphylococcus aureus was used, since
the undeformed bacterium is spherical and can be attached to the AFM cantilever without
orientational preference. Evaluation of cell wall deformation based on the comparison of the
Cell Wall Deformation and Long-range Adhesion Forces
39
Lifshitz-Van der Waals forces for other cell types, like rod-shaped organisms is possible, but
this requires different equations to derive the theoretical values of the Lifshitz-Van der
Waals force and moreover, precise control of the orientation of the organisms on the AFM
cantilever.
An impact of bacterial cell wall deformation on long-range adhesion forces is new, as
it is extremely difficult to reveal by other methods. Contact angle measurements with liquids
on bacterial lawns for instance, most likely yield information on undeformed cell wall of the
bacteria with the outer surface structures collapsed in a partly dehydrated state. Force values
derived from combining contact angles on solid substrata and bacterial lawns using
thermodynamic modeling therefore do not include an influence of deformation as a result of
adhesion to a substratum surface. This implies that studies aimed to reveal an impact of
deformation on long-range adhesion forces should one way or another include cell wall
deformation combined with an appropriate method. At this point it should be admitted, that
even in the current study using our previously published elastic deformation model,10 we
conclude that bacteria slightly deform under the influence of adhesion forces from an
extrapolation of results obtained for highly deformable Δpbp4 staphylococcal mutants to the
situation as valid for rigid organisms.
Deformation of Δpbp4 staphylococcal mutants has never been quantified before, and
hence we have no independent comparative data. Based on the ellipsoidal deformation (see
Figure 1), over forty percent deformation along the polar axis occurred for the Δpbp4
mutants under a loading as high as 9 nN, using the assumption that the wild-type parent
strains remained spherical under the same load. When directly imaging bacteria
immobilized at the poly-L-lysine-coated glass slide, as mediated by attractive electrostatic
interactions,16 the polar radii rHeight Image of the Δpbp4 mutants are smaller than their
hydrodynamic radii R0, but the differences appeared much smaller compared to the
deformation obtained from our elastic deformation model (compare R0 – rHeight Image with R0
– rLW in Table 1). However, in AFM force spectroscopy the loading force also contributes to
the deformation of the bacterial cell wall. In the AFM PeakForce-QNM mode, the loading
force hardly deforms immobilized bacteria and the cell wall deforms only under the
influence of the adhesion force between the bacterium and the substratum surface. This
difference in origin of external loads likely explains why the deformation calculated from
matching measured and theoretically calculated Lifshitz-Van der Waals forces is larger than
Chapter 2
40
directly measured using the AFM in the PeakForce-QNM mode. Although quantitatively
deviating, results from our elastic deformation model and AFM, support that Δpbp4 mutants
are mechanically "softer" than their parent strains and deform significantly under loading,
which is consistent with the lack of cross-linked peptidoglycan strands in their cell wall.11,12
At a first glance, from the independence of the adhesion force Fadh on the applied loading Fld,
this may not seem true for S. aureus NCTC 8325-4Δpbp4 (Figure 2). However, this
particular mutant readily reaches a strong adhesion force at low loading forces, which may
be indicative of deformation over the entire range of loading forces applied, i.e. it may
possess an extremely soft peptidoglycan layer.
Due to the lack of sufficiently sensitive techniques, like the AFM PeakForce-QNM, it
has hitherto been assumed that naturally occurring bacterial strains, including the parent
strains of our isogenic mutants, do not deform during adhesion. Recent observations
emphasize that de-activation of bacterial metabolism differs when bacteria adhere to
different substrata.9,31 Assuming stress-deactivation is related to cell deformation, it is
inferred that naturally occurring bacteria suffer small, nano-scale deformation upon
adhesion, causing stress-deactivation9,32 and cell death as a fatal result when adhesion forces
and accompanying deformation become too large.33–35 Yet, these studies do not provide
direct evidence of bacterial cell wall deformation upon adhesion. Based on the results of this
study, it can be concluded that minor differences in long-range Lifshitz-Van der Waals forces
may be considered indicative of potential bacterial cell wall deformation.
Summarizing, differences in long-range Lifshitz-Van der Waals forces between
adhering bacteria and substratum surfaces need not only be due to variation in composition
and structure of the bacterial cell surface, but can also be caused by nano-scale deformation
of the bacterial cell wall, facilitating an increase in contact area and therewith in adhesion
force. Bacterial cell wall deformation has never been accounted for in bacterial adhesion
studies and therewith the current paper paves the way for a better understanding of poorly
understood phenomena like bacterial “stress-deactivation” upon strong adhesion of micron-
sized bacteria to a substratum surface.
Cell Wall Deformation and Long-range Adhesion Forces
41
ACKNOWLEDGMENTS
The authors are grateful to Dr. Mariana G. Pinho, Laboratory of Bacterial Cell Biology, and
Dr. Sergio R. Filipe, Laboratory of Bacterial Cell Surfaces and Pathogenesis, Instituto de
Tecnologia Quimica e Biológica, Universidade Nova de Lisboa, for providing S. aureus NCTC
8325-4 Δpbp4 and the pMAD-pbp4 plasmid.
REFERENCES
1. Fletcher M. 1994. Bacterial biofilms and biofouling. Curr. Opin. Biotechnol. 5:302–306.
2. Hall-Stoodley L, Costerton JW, Stoodley P. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat. Rev. Microbiol. 2:95–108.
3. Bos R, Van der Mei HC, Busscher HJ. 1999. Physico-chemistry of initial microbial adhesive interactions – its mechanisms and methods for study. FEMS Microbiol. Rev. 23:179–230.
4. Hermansson M. 1999. The DLVO theory in microbial adhesion. Colloids Surf. B Biointerfaces 14:105–119.
5. Van Oss CJ. 1994. Interfacial forces in aqueous media. Marcel Dekker.
6. Van Oss CJ. 2003. Long-range and short-range mechanisms of hydrophobic attraction and hydrophilic repulsion in specific and aspecific interactions. J. Mol. Recognit. 16:177–190.
7. Israelachvili JN. 1992. Intermolecular and surface forces, 2nd ed. Academic Press.
8. Hamaker HC. 1937. The London—van der Waals attraction between spherical particles. Physica 4:1058–1072.
9. Liu Y, Strauss J, Camesano TA. 2008. Adhesion forces between Staphylococcus epidermidis and surfaces bearing self-assembled monolayers in the presence of model proteins. Biomaterials 29:4374–4382.
10. Chen Y, Norde W, Van der Mei HC, Busscher HJ. 2013. Bacterial cell surface deformation under external loading. mBio 3:e00378–12.
11. Wyke AW, Ward JB, Hayes MV, Curtis NA. 1981. A role in vivo for penicillin-binding protein-4 of Staphylococcus aureus. Eur. J. Biochem. FEBS 119:389–393.
Chapter 2
42
12. Atilano ML, Pereira PM, Yates J, Reed P, Veiga H, Pinho MG, Filipe SR. 2010. Teichoic acids are temporal and spatial regulators of peptidoglycan cross-linking in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 107:18991–18996.
13. Lee JC, Betley MJ, Hopkins CA, Perez NE, Pier GB. 1987. Virulence studies, in mice, of transposon-induced mutants of Staphylococcus aureus differing in capsule size. J. Infect. Dis. 156:741–750.
14. Touhami A, Jericho MH, Beveridge TJ. 2004. Atomic force microscopy of cell growth and division in Staphylococcus aureus. J. Bacteriol. 186:3286–3295.
15. Madigan MT, Martinko JM, Stahl DA, Clark DP. 2011. Brock biology of microorganisms. Pearson Education, Limited.
16. Vadillo-Rodríguez V, Busscher HJ, Norde W, De Vries J, Dijkstra RJB, Stokroos I, Van der Mei HC. 2004. Comparison of atomic force microscopy interaction forces between bacteria and silicon nitride substrata for three commonly used immobilization methods. Appl. Environ. Microbiol. 70:5441–5446.
17. Parsegian VA. 2006. Van der Waals forces. Cambridge University Press.
18. Rijnaarts HHM, Norde W, Bouwer EJ, Lyklema J, Zehnder AJB. 1993. Bacterial adhesion under static and dynamic conditions. Appl. Environ. Microbiol. 59:3255–3265.
19. Rijnaarts HHM, Norde W, Lyklema J, Zehnder AJB. 1999. DLVO and steric contributions to bacterial deposition in media of different ionic strengths. Colloids Surf. B Biointerfaces 14:179–195.
20. Van Kampen NG, Nijboer BRA, Schram K. 1968. On the macroscopic theory of Van der Waals forces. Phys. Lett. 26:307–308.
21. Camesano TA, Natan MJ, Logan BE. 2000. Observation of changes in bacterial cell morphology using tapping mode atomic force microscopy. Langmuir 16:4563–4572.
22. Nečas D, Klapetek P. 2012. Gwyddion: an open-source software for SPM data analysis. Cent. Eur. J. Phys. 10:181–188.
23. Verwey EJW. 1947. Theory of the stability of lyophobic colloids. J. Phys. Colloid Chem. 51:631–636.
24. Butt H-J, Graf K, Kappl M. 2006. Physics and chemistry of interfaces. John Wiley & Sons.
25. Absolom DR, Lamberti FV, Policova Z, Zingg W, Van Oss CJ, Neumann AW. 1983. Surface thermodynamics of bacterial adhesion. Appl. Environ. Microbiol. 46:90–97.
26. Van Oss CJ. 1989. Energetics of cell-cell and cell-biopolymer interactions. Cell Biophys. 14:1–16.
Cell Wall Deformation and Long-range Adhesion Forces
43
27. Han T, Williams J, Beebe T. 1995. Chemical-bonds studied with functionalized atomic-force microscopy tips. Anal. Chim. Acta 307:365–376.
28. Williams J, Han T, Beebe T. 1996. Determination of single-bond forces from contact force variances in atomic force microscopy. Langmuir 12:1291–1295.
29. Stevens F, Lo Y, Harris JM, Beebe TP. 1999. Computer modeling of atomic force microscopy force measurements: comparisons of Poisson, histogram, and continuum methods. Langmuir 15:207–213.
30. Chen Y, Busscher HJ, Van der Mei HC, Norde W. 2011. Statistical analysis of long- and short-range forces involved in bacterial adhesion to substratum surfaces as measured using atomic force microscopy. Appl. Environ. Microbiol. 77:5065–5070.
31. Busscher HJ, Van der Mei HC. 2012. How do bacteria know they are on a surface and regulate their response to an adhering state? PLoS Pathog. 8:e1002440.
32. Rizzello L, Galeone A, Vecchio G, Brunetti V, Sabella S, Pompa PP. 2012. Molecular response of Escherichia coli adhering onto nanoscale topography. Nanoscale Res. Lett. 7:575.
33. Lewis K, Klibanov AM. 2005. Surpassing nature: rational design of sterile-surface materials. Trends Biotechnol. 23:343–348.
34. Tiller JC. 2011. Antimicrobial Surfaces. Bioact. Surfaces 240:193–217.
35. Schaer TP, Stewart S, Hsu BB, Klibanov AM. 2012. Hydrophobic polycationic coatings that inhibit biofilms and support bone healing during infection. Biomaterials 33:1245–1254.
Chapter 2
44
SUPPLEMENTAL MATERIAL
Control experiments to demonstrate effective bacterial probe preparation
Effective attachment of a staphylococcus on a poly-L-lysine coated cantilever was
demonstrated by comparing force-distance curves between a staphylococcal probe and a
poly-L-lysine coated cantilever versus a glass surface (see Figure S1).
Figure S1. Examples of force-distance curves recorded for a poly-L-lysine coated cantilever (a) and a
staphylococcal probe (S. aureus NCTC 8325-4) (b) on a glass surface taken in 10 mM potassium
phosphate buffer (pH 7.0) under a maximal loading force of 3 nN. Note that the X-axes have different
scales.
The poly-L-lysine coated cantilever adheres weakly to the glass surface with a single, narrow,
adhesion force in the retract curve, while the staphylococcal probe shows a stronger
adhesion force with multiple peaks upon retract.
A second control involves the possible disturbance of the bacterial cell wall upon air-
drying the staphylococci to the cantilever, which might be especially important for the Δpbp4
mutants with their weakened cell wall. In Figure S2, it can be seen that drying times up to 3
min do not systematically affect the force-distance curves, neither of the wild-type, parent
strains nor of the Δpbp4 mutants within the reproducibility of the experiments. In neither
case do the force-distance curves resemble those of a cantilever without bacteria.
Cell Wall Deformation and Long-range Adhesion Forces
45
Figure S2. Retract force-distance curves for staphylococcal probes prepared of S. aureus NCTC 8325-
4 (a), S. aureus NCTC 8325-4 Δpbp4 (b), S. aureus ATCC 12600 (c) and S. aureus ATCC 12600Δpbp4
(d) after different drying times. Note that panel b has a different X-axis scale than the other three
panels.
Chapter 2
46
Replicate force-distance curves for a staphylococcal probe and influence of the
loading force
Force-distance curves between staphylococci and glass surfaces were generally reproducible
(see Figure S3), showing clear effects of the loading force (see Figure S4).
Figure S3. Five replicates of retract force-distance curves recorded for a bacterial probe of S. aureus
NCTC 8325-4 under a loading force of 3 nN at a same spot on a glass surface in 10 mM potassium
phosphate buffer (pH 7.0). Different symbols represent five different replicates.
Cell Wall Deformation and Long-range Adhesion Forces
47
Figure S4. Retract force-distance curves for a bacterial probe of S. aureus NCTC 8325-4 on a glass
surface under loading forces Fld of 1, 3, 5, 7 and 9 nN in 10 mM potassium phosphate buffer (pH 7.0).
Chapter 2
48
Influence of centrifugation and sonication on the hydrodynamic radii of
planktonic staphylococci
In order to verify whether centrifugation and sonication affected the hydrodynamic radii of
the staphylococci in their planktonic state, three additional harvesting protocols were
applied other than the standard protocol described in the Materials and Methods section.
Their hydrodynamic radii R0 and polar radii rHeight Image were determined using DLS and AFM
PeakForce-QNM mode, respectively:
PROTOCOL 1: staphylococci were harvested by a single centrifugation at 5000 × g for 5
min and directly suspended in 10 mM potassium phosphate buffer.
PROTOCOL 2: 10 s sonication at 30 W was carried out intermittently for three times for
bacteria harvested using Protocol 1, while cooling the suspension in a water/ice bath.
PROTOCOL 3: the bacteria were harvested and suspended as described in the standard
protocol, but no sonication was conducted afterwards.
Figure S5 summarizes the hydrodynamic radii R0 (Figure S5a) the polar radii rHeight Image
(Figure S5b) of bacterial cells prepared by different protocols. Two-sided, one-way ANOVA
indicated no significant differences in polar radii of staphylococci harvested according to
different protocols (p > 0.05).
Cell Wall Deformation and Long-range Adhesion Forces
49
Figure S5. Hydrodynamic radii R0 measured by DLS (a) and polar radii rHeight Image determined using
AFM imaging (b) for staphylococci harvested according to different protocols. Error bars in panel a
denote the standard deviations over nine aliquots taken from three separate bacterial cultures of each
strain, and error bars in panel b denote the standard deviations over at least 60 staphylococci taken
from three separate bacterial cultures of each strain.
Chapter 2
50
51
Chapter 3
Residence-time Dependent Cell Wall Deformation of
Different Staphylococcus aureus Strains on Gold
measured using Surface-Enhanced-Fluorescence
(Reproduced with permission of Royal Society of Chemistry from Jiuyi Li, Henk J. Busscher,
Jan J. T. M. Swartjes, Yun Chen, Akshay K. Harapanahalli, Willem Norde, Henny C. van der
Mei, Jelmer Sjollema. Residence-time Dependent Cell Wall Deformation of Different
Staphylococcus aureus Strains on Gold measured using Surface-Enhanced-Fluorescence.
Soft Matter 2014, 38, 7638-7646)
Chapter 3
52
ABSTRACT
Bacterial adhesion to surfaces is accompanied by cell wall deformation that may extend to
the lipid membrane with an impact on the antimicrobial susceptibility of the organisms.
Nanoscale cell wall deformation upon adhesion is difficult to measure, except for Δpbp4
mutants, deficient in peptidoglycan cross-linking. This work explores surface enhanced
fluorescence to measure cell wall deformation of staphylococci adhering on gold surfaces.
Adhesion-related fluorescence enhancement depends on the distance of the bacteria to the
surface and the residence-time of the adhering bacteria. A model is forwarded based on the
adhesion-related fluorescence enhancement of green-fluorescent microspheres, through
which the distance to the surface and cell wall deformation of adhering bacteria can be
calculated from their residence-time dependent adhesion-related fluorescence enhancement.
The distances between adhering bacteria and a surface, including compression of their
extracellular polymeric substance (EPS)-layer, decrease up to 60 min after adhesion,
followed by cell wall deformation. Cell wall deformation is independent on the integrity of
the EPS-layer and proceeds fastest for a Δpbp4 strain.
Cell Wall Deformation on Gold Surfaces using SEF
53
INTRODUCTION
Bacterial adhesion to substratum surfaces constitutes the first step in the formation of a
biofilm. Biofilms can pose considerable problems in many industrial and environmental
applications and over 60% of all human bacterial infections are due to biofilms (1, 2). On the
other hand, there are applications where the development of biofilms is beneficiary to
processes like bioremediation of soil, or to support host-protection against invading
pathogens (3, 4). The bacterial cell wall consists of a relatively soft outermost layer, crucial
for adhesion and biofilm formation, and a more rigid, hard core enveloped by a cross-linked
peptidoglycan layer. The peptidoglycan layer is relatively thick in Gram-positive bacteria as
compared to Gram-negative ones. The outermost bacterial cell layer can be composed of a
variety of different surface appendages and a matrix of “extracellular polymeric substances”
(EPS) containing amongst others, polysaccharides, lipids, proteins and eDNA (2, 5, 6). eDNA
is pivotal for the integrity of the EPS-layer around a bacterium and serves as a glue holding
its various components together (7-9).
The outermost surface of bacteria behaves differently upon adhesion to a substratum
surface than the one of inert, non-biological particles, although similarities exist too. Both
adhering bacteria as well as inert particles show initial maturation of the adhesive bond by
progressive removal of interfacial water, re-arrangement of surface structures to increase the
number of contact points and structural adaptation of surface-associated macromolecules.
Residence-time dependent desorption phenomena in a parallel plate flow chamber, time
dependent adhesion force measurements using atomic force microscopy (AFM) and
experiments with a quartz-crystal microbalance with dissipation (QCM-D) have all indicated
that this type of physico-chemical bond-maturation proceeds on a time-scale of up to several
minutes (10). The forces involved in bacterial adhesion to a substratum surface not only
affect this initial bond-maturation, but moreover dictate the amount of EPS produced (11)
and, when exceeding a threshold force, lead to so-called “stress de-activation” of an adhering
bacterium (12). Stress de-activation can become so severe as to cause cell death. Nanoscale
cell wall deformation upon bacterial adhesion to a substratum surface has been suggested to
trigger the bacterial response to an adhering state (13, 14). Nanoscale bacterial cell wall
deformation is extremely difficult to measure due to the rigidity of the peptidoglycan layer.
The little evidence available for bacterial cell wall deformation as a result of adhesion to a
surface, stems from work with so-called Δpbp4 isogenic mutants. Staphylococcus aureus
Δpbp4 mutants lack chemical cross-linking in their peptidoglycan layers (3), and accordingly
Chapter 3
54
relatively large deformations of up to 100-300 nm have been reported, depending upon the
method applied (15). Thus by extrapolation, it can be expected that wild-type strains with
cross-linked peptidoglycan also deform as a result of their adhesion to a surface, but less
than their Δpbp4 isogenic mutants.
Surface enhanced fluorescence (SEF) is a relatively newly discovered phenomenon
that was first described for fluorescent proteins and later also for fluorescently-engineered
bacteria. It involves enhanced emission of fluorescent light when fluorophores come close to
a reflecting metal surface, a mechanism which has been widely investigated during the last
10 years (16-19). SEF on average extends over a distance of around 30 nm and decreases
exponentially with separation distance between the fluorophore and the reflecting surface, as
demonstrated by measuring SEF of proteins adsorbed to reflecting surfaces with polymeric
spacers of different lengths in between (20, 21). In principle, bacterial cell wall deformation
brings the intracellular content closer to a substratum surface, and hence it can be expected
that SEF will enable quantitative evaluation of cell wall deformation of fluorescent bacteria
upon their adhesion to a reflecting substratum.
The aim of this study is to measure SEF of three green-fluorescent S. aureus strains
upon adhesion to gold surfaces as a function of their residence-time. Secondly, a model is
proposed to describe the decrease of SEF with distance between green-fluorescent
microspheres and a reflecting gold surface, based on the measurement of SEF of green-
fluorescent microspheres adhering to gold-coated quartz surfaces with adsorbed
poly(ethylene glycol) methyl ether thiol (PEG-thiols) layers of different thickness. Further
elaboration of the model enables to quantitatively evaluate bacterial cell wall deformation
from SEF. Two S. aureus strains with different expression of EPS were employed, as well as
a Δpbp4 mutant, expected to yield more extensive cell wall deformation than its parent
strain. All strains were evaluated prior to and after treatment with DNase I to disrupt the
integrity of their EPS (22), therewith enabling to distinguish between effects of initial
deposition, compression of EPS, and cell wall deformation. S. aureus was chosen as it
represents a major pathogen in human health and disease, with especially pathogenic traits
when involved in biomaterial-associated infections.
Cell Wall Deformation on Gold Surfaces using SEF
55
MATERIALS AND METHODS
Bacterial strains and cultures
Three different S. aureus strains were involved in this study, i.e. S. aureus RN4220, S.
aureus ATCC 12600 and its isogenic pbp4 mutant differing in the degree of cross-linking of
their peptidoglycan layer (3). To generate GFP expressing bacteria, the plasmid pMV158 GFP
containing optimized GFP under control of the constitutively expressed MalP promoter (23),
was introduced into these S. aureus strains by electroporation (24). Bacteria were routinely
cultured aerobically at 37°C on a Tryptone Soya Broth (TSB; OXOID, Basingstoke, England)
agar plate supplemented with 10 g mL-1 tetracycline. One colony was used to inoculate 10
ml TSB also supplemented with 10 g ml-1 tetracycline and this pre-culture was grown for 24
h at 37°C. The pre-culture was diluted 1:20 in 200 ml TSB and grown for 16 h at 37°C.
Cultures were harvested by centrifugation (Beckman J2-MC centrifuge, Beckman Coulter,
Inc., CA, USA) for 5 min at 4000 g, and washed twice with 10 ml phosphate buffered saline
(PBS: 5 mM K2HPO4, 5 mM KH2PO4, 0.15 M NaCl, pH 7.0). To break staphylococcal
aggregates, sonication at 30 W (Vibra Cell Model 375, Sonics and Materials Inc., Danbury,
CT, USA) was applied (3 times 10 s), while cooling in an ice/water bath. Finally, bacteria
were resuspended in PBS to a concentration of 3 108 ml-1 as determined in a Bürker-Türk
counting chamber. The hydrodynamic diameter of these staphylococci amounted 1.2 µm on
average, as determined using dynamic light scattering.
DNase I treatment
All three S. aureus strains produced EPS, as they grew black colonies on Congo Red agar
plates (data not shown). To address the contribution of the EPS-matrix on cell wall
deformation, bacterial pellets harvested from 200 ml TSB culture were suspended in 10 ml
PBS solution with 100 g ml-1 DNase I (Fermentas Life Sciences, Roosendaal, The
Netherlands) for 1 h at 37C, after which sonication at 30 W was applied (3 times 10 s) to
remove naturally present endogenous eDNA and therewith disrupting the EPS-matrix on the
bacterial cell surfaces and slightly reducing the staphylococcal diameter to 1.1 µm.
Subsequently, bacteria were harvested, washed and sonicated to break staphylococcal
aggregates, as described above. Finally, bacteria were resuspended in PBS to a concentration
of 3 108 ml-1, also as described above.
Chapter 3
56
Fluorescent microspheres
Green-fluorescent polystyrene microspheres with a size similar to the one of staphylococci,
i.e. with a similar diameter as the staphylococci of 1.1 m (Molecular Probes,
Invitrogen Life Technology, Grand Island, NY, USA), were used to represent
undeformable fluorescent particles. Although polystyrene particles deposited from
suspension can deform and coalesce upon drying to form latex films due to forces associated
with the evaporation of the suspension liquid (25), polystyrene particles kept in a liquid
phase will not experience such forces and can be considered undeformable. As received
microsphere suspensions were diluted in PBS to a concentration of 1 107 ml-1 as determined
in a Bürker-Türk counting chamber.
Gold-coated surfaces, coupling of PEG-thiols and their layer thickness using
QCM-D
Gold-coated quartz-crystal sensors (Jiaxing JingKong Electonic Co. Ltd., Jiaxing, China)
were used as a reflecting substratum for staphylococcal adhesion and adhesion of green-
fluorescent microspheres. Before each experiment, gold-coatings were cleaned by immersion
in a 3:1:1 mixture of water, 25% NH3H2O and 20% H2O2 (Merck, Darmstadt, Germany) at
70C for 10 min. After cleaning, gold-coated crystals were mounted in the chamber of a
QCM-D (Q-Sense AB, Gothenburg, Sweden) to allow deposition of staphylococci and
microspheres. The QCM-D chamber is disc-shaped with a diameter of 14 mm, and a height
of 0.66 mm.
In order to establish a relation between SEF and the separation distance of
fluorescent microspheres and the gold surface, gold surfaces were coated with a self-
assembled monolayer of variable thickness. To this end, the gold-coated crystals were placed
in the QCM-D chamber and the system was perfused with water at a flow rate of 0.144 ml
min-1 until stable baseline values were obtained. Subsequently, the chamber was filled with a
0.2 mM PEG-thiol (molecular weight of 2000, 5000, and 10000; Sigma-Aldrich, St. Louis,
MO, USA) solution in water for 30 min at room temperature after which the chamber was
perfused again with water and the resulting changes in frequency and dissipation were used
Cell Wall Deformation on Gold Surfaces using SEF
57
to calculate the adsorbed layer thickness of the PEG-thiols with the QCM-D accompanying
software package (Q-Sense, Sweden) (26).
Deposition of staphylococci and microspheres and fluorescence imaging
Next, a suspension of fluorescent staphylococci or microspheres was flown into the QCM-D
chamber and flow was arrested to allow measurement of deposition using a metallurgical
microscope. Since staphylococci and microspheres were suspended in relatively high ionic
strength PBS, there will be no electrostatic energy barrier for deposition and deposition
occurs solely under the influence of diffusion and sedimentation (27). For deposition
measurements, the microscope was equipped with a 40 objective (ULWD, CDPlan, 40PL,
Olympus Co, Tokyo, Japan), connected to a CCD camera (Basler A101F, Basler AG,
Germany). Staphylococci or microspheres were allowed to sediment under the influence of
gravity and the number of bacteria or particles adhering per unit area was expressed as a
fraction of the number of bacteria or particles adhering to the coatings in a stationary phase,
i.e. when all staphylococci present in the chamber had deposited.
For fluorescence imaging, the entire QCM-D chamber was placed on a sample stage
inside a bio-optical imaging system (IVIS Lumina II, PerkinElmer, Inc., Hopkinton, MA,
USA), and the above described deposition experiments repeated. The IVIS was kept at 20C
and provided a field of view of 7.5 x 7.5 cm, to encompass the diameter of the crystal
surfaces. Excitation and emission wavelengths for detection of both GFP staphylococci and
microspheres were 465 nm and 515-575 nm, respectively. An exposure time of 5 s was
employed and images were taken every 10 min over the entire period of 3 h. Average
fluorescence radiances, R (photons s-1 cm-2 sr-1) over a 1 cm2 user-defined region of interest
were determined for each image with the Living Image software package 3.1 (PerkinElmer
Inc., USA) which transforms electron counts on the CCD camera to an average fluorescence
radiance, taking into account the current optical parameters (area of the region of interest,
magnification, binning, diaphragm, exposure time and light collecting ability of the camera
as calibrated with standard light sources). The total number of staphylococci or
microspheres, ntot, contributing to the fluorescent radiance captured within the region of
interest was around 2.0 107 and 6.6 105, respectively. Fluorescence radiance R(t) was
monitored as a function of time during deposition.
Chapter 3
58
Calculation of residence-time dependent, adhesion-related fluorescence
enhancement
The increase of the fluorescence radiance due to adhesion of fluorescent staphylococci or
microspheres was measured relative to the fluorescence of suspended ones and expressed as
a total fluorescence enhancement, TFE(t), according to
(1)
in which R(t) denotes the fluorescence radiance at time t, while R0 and R(0) indicate the
fluorescence radiance before and after the introduction of staphylococci or microsphere
suspension into the flow chamber, respectively. TFE(t) comprises the fluorescence
contribution from adhering bacteria or microspheres and those still in the suspension.
Fluorescence enhancement was not corrected for photobleaching, because photobleaching
was found to be negligible over the time scale of the experiments (see Supporting
Information, Figure S1). Note that for staphylococci, demonstrating a residence-time
dependent fluorescent enhancement, TFE(t) comprises the fluorescence contribution from
adhering bacteria with various residence-times and the ones still in the suspension.
Accordingly,
(2)
in which 0 is the fluorescence from staphylococci in suspension, () is the adhesion-related
residence-time dependent fluorescence enhancement, τ is the residence-time of adhering
staphylococci, j(t) is the deposition rate at time t and ntot is the total number of bacteria or
microspheres, both in suspension and attached, contributing to the fluorescent radiance
captured within the region of interest.
In order to assess (), eqn (2) has been transformed to a finite summation according to
0
0
(0)
)()(
RR
RtRtTFE
tot0
t
0
tot
t
0
0
n
j(t)dtnτ)dτα(τ)j(t
TFE(t)
Cell Wall Deformation on Gold Surfaces using SEF
59
(3)
in which is the deposition rate at time i x Δt divided by ntot. Subsequently 1, the
adhesion-related fluorescence enhancement for the shortest residence-time Δt, is obtained
from the first measurement after the start of an experiment at t = Δt
(4)
In line, m, the adhesion-related fluorescence enhancement for residence-time m x Δt, can
be calculated after m consecutive steps according to
(for m>=2) (5)
STATISTICS
Data were statistically analysed using paired, two tailed Student t-tests. Significance was
established at p< 0.05.
11)(αjΔtTFEm
1i
i1mim
ij
1jΔt
1TFEα
1
11
1
m
1i
1m
1i
1iimim
mjΔt
1jαjΔtTFE
α
Chapter 3
60
RESULTS
Fluorescence enhancement during deposition of staphylococci and
microspheres
Figure 1. Total fluorescence enhancement, TFE(t), and percentage staphylococci and
microspheres deposited to a gold-coated surface as a function of deposition time for three,
green-fluorescent S .aureus strains. (a) S. aureus ATCC 12600GFP, (b) S. aureus RN4220GFP, (c)
S. aureus ATCC 12600 pbp4GFP and (d) green-fluorescent microspheres (note the different
time axis). TFE is due to planktonic and adhering bacteria and microspheres, while deposition
is expressed as a percentage of the number of adhering bacteria or microspheres, na with
respect to their total numbers in the system, ntot. Error bars represent standard errors over four
separate experiments with different bacterial cultures and microsphere suspensions. Open
symbols represent data for staphylococci treated with DNase I.
Cell Wall Deformation on Gold Surfaces using SEF
61
Adhesion-related fluorescence enhancement as a function of residence-time
Fluorescent enhancement will increase over time due to increasing numbers of adhering
staphylococci or microspheres on the gold surface and time dependent deformation of the
bacterial cell wall. Using a finite summation procedure, we were able to calculate the
adhesion-related fluorescence enhancement, (), as a function of residence-times, , of
adhering fluorescent bacteria and microspheres. Both bacteria as well as inert particles
showed an initially high adhesion-related fluorescence enhancement (Figure 2), followed by
a continuous increase for adhering staphylococci over a time period of at least 3 h (Figure
2a-2c) that levelled off after 1 h for S. aureus RN4220GFP and S. aureus ATCC 12600GFP but
not for its isogenic mutant S. aureus ATCC 12600 Δpbp4GFP, suggesting ongoing
deformation. For adhering fluorescent microspheres, however, a stationary level was
obtained within 10 min (Figure 2d), confirming their undeformable nature under the current
experimental conditions. These observations suggest that the rapid, initial increase bacterial
fluorescence enhancement is due to adhesion of the staphylococci at the surface and EPS-
compression, while the slower, continued increase results from cell wall deformation.
Importantly, the rate of continued increase is slightly higher for the Δpbp4GFP mutant (0.11 h-
1) than for its parent strain (0.08 h-1). Treatment of the EPS-matrix of the staphylococcal
strains with DNase I consistently resulted in an increased adhesion-related fluorescence
enhancement (Figure 2a-2c).
Chapter 3
62
Figure 2. Adhesion-related fluorescence enhancement, (), as a function of residence-time, ,
for three, green-fluorescent S. aureus strains and microspheres adhering to a gold-coated
surface. (a) S. aureus ATCC 12600GFP, (b) S. aureus RN4220GFP, (c) S. aureus ATCC 12600
pbp4GFP and (d) green-fluorescent microspheres. Error bars represent standard errors over
four separate experiments with different bacterial cultures and microsphere suspensions. Open
symbols represent staphylococci treated with DNase I.
Modelling the distance-dependence of adhesion-related fluorescence
enhancement of fluorescent microspheres on PEG-thiol layers
SEF of fluorescent proteins as a function of distance has been determined on reflecting
surfaces with polymeric spacers of different lengths in between.20,21 The task at hand in this
manuscript however, is more difficult and challenging, as we want to determine not only the
effects of bringing an undeformed, fluorescent bacterium closer to a reflecting substratum
surface as a result of deposition and EPS-compression under the influence of the adhesion
forces, but we also want to quantify further deformation of the bacterial cell wall. Therefore,
we first studied the time-dependence of the total fluorescence enhancement of
undeformable, fluorescent microspheres adhering on gold surfaces with polymeric spacers of
different molecular weights, yielding different separation distances between the
microspheres and the reflecting gold surface (Figure 3a). The thickness of the polymer layer
was determined using QCM-D.
Cell Wall Deformation on Gold Surfaces using SEF
63
Figure 3. Analysis of the fluorescence enhancement of green-fluorescent microspheres
adhering to a gold-coated surface. (a) Total fluorescence enhancement, TFE(t) as a function of
time to gold-coated surfaces with adsorbed PEG-thiol layers of different molecular weight, (b)
Adhesion-related fluorescence enhancement, (δ), for green-fluorescent microspheres
adhering to a gold-coated surface as a function of the adsorbed layer thickness of PEG-thiols.
Fluorescent enhancement values are taken in the stationary phase of the deposition process
(see Figure 3a) and are independent of residence-time (see also Figure 2d). Bars represent
standard errors over four separate experiments with different suspensions of microspheres.
The solid line represents calculated adhesion-related fluorescence enhancement as a function
of distance according to the model presented for undeformed green-fluorescent microspheres
on a reflecting metal surface, using literature values for the decay rates in the absence of a
metal, the enhancement factors N0nr and N0
r and the characteristic distances dn and dr (20).
Chapter 3
64
The enhancement factor N0ex and characteristic distance de were used as parameters in a least-
square fitting procedure yielding values of 68 and 387 Å, respectively.
Figure 3b presents the adhesion-related fluorescence enhancement of green-fluorescent
microspheres (similarly sized as our staphylococci) on gold surfaces, coated with PEG-thiol
layers as a function of the coating thickness. Adhesion-related fluorescence enhancement for
microspheres decreased with increasing thickness, i.e., the separation distance between the
microspheres and the reflecting gold surface. Since adhesion-related fluorescence
enhancement of microspheres was immediate and not increasing over time (see Figure 2d),
it can be assumed that the surfaces of the microspheres were in direct contact with the PEG-
thiol coating within the 10 min time-resolution of our measurements. SEF of single
fluorophores can be described (20, 28, 29) as the combined result of metal-induced
increases in the rate of (1) fluorescence quenching or non-radiative decay (knr) by a factor
Nnr, (2) fluorescence emission or radiative decay (Γ) by a factor Nr and (3) excitation of
fluorophores by a factor Nex. The distance-dependent adhesion-related fluorescence
enhancement of a single fluorophore, α(d), on a reflecting metal surface can be described by
the relative increase of the quantum yield Q(d) as related to the quantum yield far away from
the substratum, Q , multiplied by the increase in the excitation rate
(6)
The quantum yield, Q(d), can be expressed as the ratio of radiative decay relative to the total
decay,20 i.e., the sum of the radiative and non-radiative decays
(7)
The rates of non-radiative and radiative decay and the excitation rates occurring in eqn (6)
and (7) decrease exponentially as a function of the distance to the reflecting metal surface
according to
)()(
)( dNQ
dQd ex
nrnrr
r
kdNdN
dNdQ
)()(
)()(
Cell Wall Deformation on Gold Surfaces using SEF
65
(8)
where dn, dr, and de are the characteristic distances over which these effects decrease and
N0nr, N0
r and N0ex are the non-radiative, radiative and excitation rates of single fluorophores
at the surface. The distance-dependent adhesion-related fluorescence enhancement, α(d), of
Cy3-labeled oligonucleotides on silver particles rapidly increases with their distance from the
reflecting surface and amounts to around 80 at a distance of 10 nm, after which an
exponential decrease sets in ranging over approximately 30 nm (20).
In order to calculate the distance-dependent adhesion-related fluorescence
enhancement, α(δ) of green-fluorescent microspheres as a function of the distance, δ,
between the surface of a microsphere and a reflecting gold surface, it is assumed that
fluorophores distribute homogeneously within the microspheres, while we describe their
volume as a stack of 100 cylindrical disks. Eqn (6) to (8) subsequently allow calculation of
the fluorescent enhancement by each disk at various distances and summation values can be
compared with experimental data (Figure 3b) using a least-square fitting procedure. Note
that the adhesion-related fluorescence enhancement of microspheres is maximally 1.65 at
contact, which is about 50 times smaller than of fluorescent molecules. This is because for
fluorescent microspheres, there is only a fraction of all fluorophores present in the region
close to the reflecting surface where fluorescence enhancement is largest. In Figure 3b it can
be seen that unlike for single fluorophores, the near-linear data variation does not allow
derivation of all eight model parameters occurring in eqn (6) to (8). Therefore values for the
decay rates in the absence of a metal Γ (109 s-1) and knr (4 x 108 s-1), the enhancement factors
N0nr (38000) and N0
r (186) and characteristic distances dn (8.5 Å) and dr (119 Å) were
taken from surface enhanced fluorescence of Cy3-labeled oligonucleotides on silver particles
(20), and only values of N0ex and de were obtained from least-square fitting, which are the
main model parameters accounting for the distance dependence of SEF. Accordingly, a high
quality of the fit (R2 = 0.99; see Figure 3b) could be obtained, yielding a relation between
1)/exp()(
1)/exp()(
1)/exp()(
0
0
0
dedNdN
drdNdN
dndNdN
exex
rr
nrnr
Chapter 3
66
adhesion-related fluorescence enhancement of fluorescent microspheres and their distance
from a reflecting surface.
Residence-time dependent adhesion-related fluorescence enhancement and
staphylococcal cell wall deformation
Adhesion-related fluorescence enhancement of undeformable fluorescent microspheres on a
bare gold surface immediately reached a stationary value of around 1.6, within the time-
resolution of our fluorescence measurements. Adhering staphylococci however, did not reach
that level of fluorescence enhancement, which indicates that they kept a larger separation
distance between the cell wall and the gold surface through the presence of the EPS-layer
around them. Assuming that the GFP molecules are homogeneously distributed throughout
the entire volume of the bacterial cytoplasm as enclosed by the bacterial cell wall, the
separation distance can be calculated using the model for the distance-dependence of
adhesion-related fluorescence enhancement forwarded above. If we assume that cell wall
deformation only occurs when a bacterium has approached the gold surface to the closest
possible distance, we can first derive the residence-time dependent distance between the
staphylococci and the surface. The initial distance varied between 25 and 45 nm, depending
on the strain considered and the distance decreased within an hour (Figure 4). Interestingly,
DNase I treated staphylococci with a disrupted EPS-layer approached the surface faster than
strains with an intact EPS-layer to a distance of around 18 nm, which we consider as the
limiting distance for EPS compression. Adapting 18 nm as the closest possible distance to
which bacteria can approach the substratum surface, further interpretation of adhesion-
related fluorescence enhancement was done in analogy to the model outlined above for
fluorescent microspheres, but now allowing cell wall deformation. Cell wall deformation
brings a larger fluorescent volume of an adhering staphylococcus closer to the surface and
accordingly adhering staphylococci were assumed to deform from an initial sphere with
radius R0 to an oblate ellipsoid, with a short, polar radius, b and a circular equatorial plane
with radius, a. Assuming constant volume
V= (9) 3
0
2
3
4
3
4Rba
Cell Wall Deformation on Gold Surfaces using SEF
67
The ellipsoids could also be divided in stacks of discs and using the model proposed
above and the parameters presented in Figure 3, cell wall deformation could be evaluated
and expressed as the difference between the radius of the undeformed staphylococcus, R0
and the short, polar radius of the ellipsoidally deformed bacterium. All three staphylococcal
strains deformed between 1 and 3 h after deposition on the gold surface. It should be noted
that deformation was calculated up to 3 h for demonstration of the principle, while under
more physiologically relevant conditions adhering bacteria may well have divided by then. S.
aureus ATCC 12600 deformed more extensively than S. aureus RN4220, but both strains
with cross-linked peptidoglycan layers demonstrated similar cell wall deformations
irrespective of DNase I treatment. S. aureus ATCC 12600 Δpbp4GFP, deficient in
peptidoglycan cross-linking showed the most extensive deformation of its cell wall (Figure
4), that initially seemed dampened by the presence of an intact EPS-layer compared to the
deformation observed for the DNase I treated Δpbp4GFP mutant.
DISCUSSION
The biofilm-mode of growth is a ubiquitously occurring form of bacterial growth during
which the organisms experience adhesion forces from the surfaces to which they adhere, i.e.
either substratum surfaces or surfaces of neighbouring bacteria. This is unlike the situation
during planktonic growth, where they are freely suspended in an aqueous phase. The forces
experienced by bacteria in a biofilm-mode of growth have been demonstrated to have severe
impact on their susceptibility to antimicrobials and general viability (11, 12). The response of
bacteria to these adhesion forces has been suggested to be due to cell wall deformation,
causing altered membrane stresses (12), and re-arrangement of membrane lipids (30). AFM
has demonstrated that the bacterial cell wall can indeed be deformed up to the level of its
rigid peptidoglycan layer, but these experiments have all been carried out by wrenching
bacteria between a substratum surface and an AFM-cantilever15 or tip (31, 32) under the
influence of an externally applied loading force, rather than under the influence of the
naturally-occurring adhesion force arising from a substratum surface. Besides AFM-imaging
of bacteria artificially immobilized on positively charged surfaces, bacterial cell wall
deformation under the influence of naturally-occurring adhesion forces has never been
demonstrated nor reliably quantified. In this study, we used recently described surface
enhanced fluorescence of adhering bacteria (17, 24) to assess bond-maturation processes
and cell wall deformation of staphylococci adhering to gold surfaces.
Chapter 3
68
To this end, we have developed a new model to describe the distance dependence of
SEF for undeformable fluorescent microspheres and bacteria, from which we extrapolate to
deformation of the rigid core of adhering bacteria containing the fluorophores. As a first step
in bacterial interaction with a substratum surface (see Figure 5 for a schematic summary),
bacteria approach the surface and jump into contact. Jump into contact is facilitated by a low
energy barrier as a result of the absence of strong electrostatic repulsion in PBS (27), similar
to the coalescence of two liquid layers after approach.33 Next bond-maturation processes
occur, including removal of interfacial water that has been described to occur within several
minutes (10). These initial bond-maturation processes cannot be separated from effects of
EPS-compression, by consequence of the 10 min time-resolution of our experiments. In
initial bond-maturation, significant effects of DNase I treatment of staphylococci are seen for
S. aureus ATCC 12600GFP and S. aureus RN4220GFP. Although initial bond-maturation is
more extensive for S. aureus ATCC 12600GFP than for its isogenic mutant S. aureus ATCC
12600 Δpbp4GFP (Figure 4), this difference disappears after DNase I treatment. S. aureus
RN4220GFP differs from S. aureus ATCC 12600GFP in the sense that DNase I treatment of S.
aureus ATCC 12600GFP removes virtually all stainable EPS, while stainable EPS clearly
remains behind after DNase I treatment in case of S. aureus RN4220GFP (Supplementary
Figure S2). Thus, whereas DNase I treated S. aureus ATCC 12600GFP immediately reaches
the distance of closest possible approach to the gold surface, this requires more time for S.
aureus RN4220GFP (see Figure 4). This distance of closest approach between the
staphylococci adhering on a gold surface may be compared with the height of an assumed,
cylindrical contact volume that can be obtained using a newly proposed elastic deformation
model,15 based on the relation between adhesion forces and externally applied, loading forces
in AFM. Importantly, the elastic deformation model self-defines the height of the contact
volume between adhering bacteria and substratum surfaces. In order to find confirmation
for the separation of adhesion-related fluorescence enhancement into a component due to
the distance between adhering bacteria and a reflecting surface and cell wall deformation, we
performed AFM adhesion force measurements as a function of the external loading force and
applied the above mentioned elastic deformation model (see Supplementary Figure S3).
Interestingly, regardless of the strain involved, the height of the contact cylinder was found
to be around 20 nm, confirming the validity of our analysis of adhesion-related fluorescence
enhancement for our strains, yielding a distance of closest approach of 18 nm.
Cell Wall Deformation on Gold Surfaces using SEF
69
The bacterial core of adhering staphylococci enveloped by peptidoglycan, deforms
more readily in case of S. aureus ATCC 12600 Δpbp4GFP, deficient in peptidoglycan cross-
linking than observed for both wild-type strains, which supports the validity of our model.
Nevertheless, also the staphylococcal cores enveloped by cross-linked peptidoglycan deform.
DNase I treatment to disrupt the integrity of the EPS-layer, destabilizes the cell wall of the
Δpbp4GFP mutant, resulting in an almost instantaneous cell wall deformation right after
adhesion. This confirms a recently proposed new role for EPS as a stress-absorber (34),
hampering cell wall deformation and the associated development of membrane stresses that
may increase bacterial susceptibility to antimicrobials (30). Cell wall deformation for S.
aureus ATCC 12600 Δpbp4 immobilized on a positively charged, α-poly-L-lysine coated
surface, obtained using AFM-imaging and measured within approximately 1 h of contact,
amounts to 49 ± 60 nm (15), which is comparable to the deformation observed here for
staphylococci after 1 h of adhesion on a negatively charged gold surface (see Figure 4). Note
that deformation observed from AFM-imaging possesses a much larger standard deviation
than obtained using SEF, as SEF in essence is a macroscopic technique encompassing
numbers of bacteria that exceed the numbers of bacteria involved in microscopic AFM-
imaging by orders of magnitude.
The adhesion forces between the staphylococci involved in this study and the gold surfaces
and responsible for the deformations as presented in Figure 4, have been measured using
AFM force measurements between staphylococci attached to a tipless cantilever and the gold
coatings (see Supplementary Figure S4). These forces initially amount around 1 nN and
increase to between 2 and 3 nN after 30 s of bond-maturation under an externally applied
loading force of 1 nN, regardless of the strain considered. An estimate of the deformations
that might arise from these forces can be calculated using a Hertz model (15) that considers a
bacterium as a homogeneous elastic mass. Taking a Young’s modulus of whole bacteria in
the order of 1000 kPa (15), it can be calculated that an adhesion force of 3 nN yields a cell
wall deformation in the order of 20 - 25 nm, which is in the same range as reported here for
a residence-time of adhering staphylococci of 1 h.
Chapter 3
70
Figure. 4 Bacterium-substratum distance, δ, and bacterial cell wall deformation, (R0-b), as a
function of the residence-time of staphylococci adhering to gold surfaces. Error bars represent
standard errors calculated from adhesion-related fluorescence enhancement data from four
different bacterial cultures.
Wrenched between V-shaped and colloidal-probe AFM tips, deformations of Gram-
negative Pseudomonas aeruginosa PAO1 under an externally applied force of 10 nN, exerted
during a time-period of 10 s, amounted to 200 nm, while similar conditions for Gram-
positive Bacillus subtilis 168 strain yielded 80 nm deformation (32-35). Considering the
generally short time-periods involved in these studies while yielding cell deformations in the
same range as obtained here after 1 – 3 h (compare Figure 4), it can be concluded that
experiments in which bacteria are wrenched between a substratum and an AFM cantilever
overestimate initial bacterial cell wall deformation. This can either be due to the fact that the
externally applied forces by the AFM probe always yield a high local stress or due to the fact
that it is difficult to match the externally applied force to the naturally occurring forces
involved in bacterial adhesion to surfaces. Both these aspects are avoided through the use of
SEF.
Cell Wall Deformation on Gold Surfaces using SEF
71
Figure. 5 Schematic presentation of the different steps in bacterial interaction with a surface and SEF
events.(a) Approach of a bacterium towards the substratum surface. (b) Bacteria jump into
contact and SEF occurs from the fluorophores within the cytoplasm of the bacterium,
sufficiently close to the reflecting metal surface. (c) EPS is compressed under the influence of
the adhesion forces between the bacterium and the substratum surfaces, bringing more
fluorophores sufficiently close to the surface for SEF, up to a minimum separation distance of
around 18 nm. (d) When EPS is compressed to its limiting thickness, the cell wall deforms,
further increasing the number of fluorophores within the reach of SEF
CONCLUSION
Summarizing, we have forwarded a new method to determine residence-time dependent
adhesion-related fluorescence enhancement, and developed a model through which bond-
maturation of bacteria adhering on reflective metal surfaces can be analyzed in terms of the
distance between an adhering bacterium and the substratum, including EPS compression
and cell wall deformation. Cell wall deformations arising from the measurement of adhesion-
related fluorescence enhancement could be validated with AFM measurements of cell wall
deformation, provided care was taken to carefully match the conditions under which the
AFM experiments are carried out with the naturally occurring adhesion forces. As an
important advantage of using SEF, the number of bacteria involved in a single analysis is
much larger than can be obtained using more microscopic methods, like AFM.
Cell wall deformation plays an important role in understanding bacterial
susceptibility to antimicrobials as it extends to the lipid membrane and affects the lipid
density in the membrane. Deformations of the bacterial cell wall as demonstrated here, are
accompanied by an increase in the surface area of the lipid membrane from around 3 μm2 to
4.5 μm2. Therewith the distance between lipid molecules in the membrane increases, making
Chapter 3
72
it more susceptible for antimicrobials to penetrate. With the era of current antimicrobials
approaching its end (36), accurate measurement of cell wall deformation as a result of
bacterial adhesion to surfaces, irrespective of whether of synthetic or biological origin, is
thus highly important to develop alternatives for current antimicrobials.
Cell Wall Deformation on Gold Surfaces using SEF
73
REFERENCES
1. Busscher HJ, Van der Mei HC, Subbiahdoss G, Jutte PC, Van den Dungen JJAM, Zaat SAJ, Schultz MJ, Grainger DW. 2012. Biomaterial-Associated Infection: Locating the Finish Line in the Race for the Surface. Sci. Transl. Med. 4:153rv10–153rv10.
2. Flemming H-C, Wingender J. 2010. The biofilm matrix. Nat. Rev. Microbiol. 8:623–633.
3. Atilano ML, Pereira PM, Yates J, Reed P, Veiga H, Pinho MG, Filipe SR. 2010. Teichoic acids are temporal and spatial regulators of peptidoglycan cross-linking in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 107:18991–6.
4. Reid G, Younes JA, Van der Mei HC, Gloor GB, Knight R, Busscher HJ. 2011. Microbiota restoration: natural and supplemented recovery of human microbial communities. Nat. Rev. Microbiol. 9:27–38.
5. Sheng G-P, Yu H-Q, Li X-Y. 2010. Extracellular polymeric substances (EPS) of microbial aggregates in biological wastewater treatment systems: A review. Biotechnol. Adv. 28:882–894.
6. Koo H, Xiao J, Klein MI, Jeon JG. 2010. Exopolysaccharides produced by Streptococcus mutans glucosyltransferases modulate the establishment of microcolonies within multispecies biofilms. J. Bacteriol. 192:3024–3032.
7. Whitchurch CB, Tolker-Nielsen T, Ragas PC, Mattick JS. 2002. Extracellular DNA required for bacterial biofilm formation. Science 295:1487.
8. Huseby MJ, Kruse AC, Digre J, Kohler PL, Vocke JA, Mann EE, Bayles KW, Bohach GA, Schlievert PM, Ohlendorf DH, Earhart CA. 2010. Beta toxin catalyzes formation of nucleoprotein matrix in staphylococcal biofilms. Proc. Natl. Acad. Sci. U. S. A. 107:14407–14412.
9. Das T, Sehar S, Manefield M. 2013. The roles of extracellular DNA in the structural integrity of extracellular polymeric substance and bacterial biofilm development. Environ. Microbiol. Rep. 5:778–786.
10. Busscher HJ, Norde W, Sharma PK, Van der Mei HC. 2010. Interfacial re-arrangement in initial microbial adhesion to surfaces. Curr. Opin. Colloid Interface Sci.
11. Busscher HJ, Van der Mei HC. 2012. How do bacteria know they are on a surface and regulate their response to an adhering state?. PLoS Pathog. 8:e1002440.
12. Liu Y, Strauss J, Camesano T a. 2008. Adhesion forces between Staphylococcus epidermidis and surfaces bearing self-assembled monolayers in the presence of model proteins. Biomaterials 29:4374–4382.
13. Ruiz N, Silhavy TJ. 2005. Sensing external stress: Watchdogs of the Escherichia coli cell envelope. Curr. Opin. Microbiol. 8:122–126.
Chapter 3
74
14. Otto K, Silhavy TJ. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 99:2287–2292.
15. Chen Y, Norde W, Mei HC Van Der, Busscher HJ. 2012. Bacterial Cell Surface Deformation under External Loading. MBio 3:e00378–12.
16. Lakowicz JR. 2001. Radiative decay engineering: biophysical and biomedical applications. Anal. Biochem. 298:1–24.
17. Lee K, Hahn LD, Yuen WW, Vlamakis H, Kolter R, Mooney DJ. 2011. Metal-Enhanced Fluorescence to Quantify Bacterial Adhesion. Adv. Mater. 23:H101–H104.
18. Moal E Le, Fort E, Lévêque-Fort S, Cordelières FP, Fontaine-Aupart M-P, Ricolleau C. 2007. Enhanced fluorescence cell imaging with metal-coated slides. Biophys. J. 92:2150–2161.
19. Dragan AI, Bishop ES, Casas-Finet JR, Strouse RJ, McGivney J, Schenerman M a., Geddes CD. 2012. Distance Dependence of Metal-Enhanced Fluorescence. Plasmonics 7:739–744.
20. Malicka J, Gryczynski I, Gryczynski Z, Lakowicz JR. 2003. Effects of fluorophore-to-silver distance on the emission of cyanine-dye-labeled oligonucleotides. Anal. Biochem. 315:57–66.
21. Fu Y, Lakowicz JR. 2006. Enhanced fluorescence of Cy5-labeled oligonucleotides near silver island films: A distance effect study using single molecule spectroscopy. J. Phys. Chem. B 110:22557–22562.
22. Harmsen M, Lappann M, Knøchel S, Molin S. 2010. Role of extracellular DNA during biofilm formation by listeria monocytogenes. Appl. Environ. Microbiol. 76:2271–2279.
23. Nieto C, Espinosa M. 2003. Construction of the mobilizable plasmid pMV158GFP, a derivative of pMV158 that carries the gene encoding the green fluorescent protein. Plasmid 49:281–285.
24. Li J, Busscher HJ, Van der Mei HC, Sjollema J. 2012. Surface enhanced bacterial fluorescence and enumeration of bacterial adhesion. Biofouling. 29:11–19.
25. Sperry PR, Snyder BS, O’Dowd ML, Lesko PM. 1994. Role of Water in Particle Deformation and Compaction in Latex Film Formation. Langmuir 10:2619–2628.
26. Voinova M V., Jonson M, Kasemo B. 2002. “Missing mass” effect in biosensor’s QCM applications. Biosens. Bioelectron. 17:835–841.
27. Wilson WW, Wade MM, Holman SC, Champlin FR. 2001. Status of methods for assessing bacterial cell surface charge properties based on zeta potential measurements. J. Microbiol. Methods 43:153–164.
28. Anger P, Bharadwaj P, Novotny L. 2006. Enhancement and quenching of single-molecule fluorescence. Phys. Rev. Lett. 96:3–6.
Cell Wall Deformation on Gold Surfaces using SEF
75
29. Chris D. Geddes, Joseph R. Lakowicz. 2002. Metal-Enhanced Fluorescence. J. Fluoresc. 12:121–129.
30. Isabel Perez M, Rodriguez N, Ocampo J, Chavez J, Fernanda Contreras M, Arevalo C, Feussner I, Trier S, Leidy C. 2013. Bacterial Biofilm Formation Induces Strong Shifts in Lipid Composition Resulting in Increased Resistance Towards Antimicrobial Peptide Activity. Biophys. J. 104:20A.
31. Vadillo-Rodriguez V, Schooling SR, Dutcher JR. 2009. In situ characterization of differences in the viscoelastic response of individual gram-negative and gram-positive bacterial cells. J. Bacteriol. 191:5518–5525.
32. Bolshakova A V, Kiselyova OI, Yaminsky I V. 2004. Microbial surfaces investigated using atomic force microscopy. Biotechnol. Prog. 20:1615–1622.
33. Chen N, Kuhl T, Tadmor R, Lin Q, Israelachvili J. 2004. Large deformations during the coalescence of fluid interfaces. Phys. Rev. Lett. 92:024501.
34. Crismaru M, Asri L a TW, Loontjens TJ a, Krom BP, De Vries J, Van der Mei HC, Busscher HJ. 2011. Survival of adhering staphylococci during exposure to a quaternary ammonium compound evaluated by using atomic force microscopy imaging. Antimicrob. Agents Chemother. 55:5010–5017.
35. Vadillo-Rodriguez V, Beveridge TJ, Dutcher JR. 2008. Surface viscoelasticity of individual gram-negative bacterial cells measured using atomic force microscopy. J. Bacteriol. 190:4225–4232.
36. Woodford N, Livermore DM. 2009. Infections caused by Gram-positive bacteria: a review of the global challenge. J. Infect. 59 Suppl 1:S4–16.
Chapter 3
76
SUPPLEMENTAL MATERIAL
Figure S1 Fluorescence radiance, R(t), normalized against the radiance at t=0, R(0), arising
from green-fluorescence staphylococci adhering to a glass surface as a function of time for three
different strains involved in this study. Fluorescence is constant over a time period of at least 5
h, demonstrating the absence of significant photo-bleaching upon repetitive excitation.
Cell Wall Deformation on Gold Surfaces using SEF
77
Figure S2 Stainable EPS expression in planktonic cultures of S. aureus ATCC12600 and S.
aureus RN4220. Staphylococci, grown and harvested as described in the main text, were
suspended in 10 ml PBS to an optical density at 578 nm of 1. Subsequently, 1.5 ml suspension
was pelleted at 5000 g for 5 min at 10°C, after which EPS was extracted by re-suspending the
pellet in 50 μL of 0.5 M EDTA (pH 8.0) for 5 min at 100°C. Concentrated EPS was incubated at
37°C with 10 μl of 20 μg/ml proteinase K for 30 min and diluted 1:100 in water and 40 µL was
blotted on a nitrocellulose membrane. The membrane was then blocked using 1% bovine serum
albumin-Tris buffered saline (20 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.05% Tween20) for 1 h
under mild shaking at room temperature. The membrane was subsequently incubated with a 1:
10,000 dilution of Wheat Germ Agglutinin (Sigma-Aldrich, St. Louis, USA) for 1.5 h under mild
shaking at room temperature. Wheat Germ Agglutinin is a biotin labelled antibody specific for
poly-n-acetylglucosamine, a major constituent of staphylococcal EPS. Finally, Streptavidin
IRDye (LI-COR Biosciences, Lincoln, USA) was added in 1: 10,000 dilution for 30 min under
similar conditions and the membrane was washed 3 times, for 10 min each, with Tween20-Tris
buffered saline. The membrane was imaged using an Odyssey Infrared Imaging System (LI-
COR Biosciences, Lincoln, USA), yielding dark spots on the blot indicative of the amount of
PNAG.
Chapter 3
78
Figure S3 Height of the contact cilinder of untreated and DNase I treated S. aureus adhering
on gold-coated quartz surfaces, as derived from AFM adhesion force measurements under
different loading forces. Staphylococci were grown, harvested and DNase I treated as described
in the main text. Bacterial probes were prepared by immobilizing a bacterium to an α-poly-L-
lysine coated tipless cantilever (Bruker, Camarillo, CA). Deformation was measured at different
loading forces as exerted by the AFM cantilever up to 1 nN and applied in a recently published 15
elastic deformation model, that self-defines the dimensions of an assumed cylindrical, contact
volume between adhering bacteria and substratum surfaces based on the relation between
deformation and the loading force applied. Error bars represent standard deviations of 90
force-distance measurements on 30 randomly chosen spots, equally divided over the surfaces
of three different bacteria.
Cell Wall Deformation on Gold Surfaces using SEF
79
Figure S4 Residence-time dependent adhesion forces for untreated and DNase I-treated S.
aureus adhering on gold-coated quartz surfaces from AFM force measurements. Staphylococci
were grown, harvested and DNase I treated as described in the main text and immobilized to an
α-poly-L-lysine coated tipless cantilever (Bruker, Camarillo, CA) for residence-time dependent
AFM adhesion force measurements in 10 mM potassium phosphate buffer (pH 7.0) at room
temperature using a BioScope Catalyst AFM (Bruker) under a loading force of 1 nN. For each
bacterial probe, force-distance curves were measured upon initial contact (0 s) and after 30 s
bond-maturation. Error bars represent standard deviations of 90 force-distance measurements
on 30 randomly chosen spots, equally divided over the surfaces of three different bacteria.
80
81
Chapter 4
Influence of Adhesion Force on icaA and cidA Gene
Expression and Production of Matrix Components in
Staphylococcus aureus Biofilms
(Reproduced with permission of American Society for Microbiology from Akshay K.
Harapanahalli, Yun Chen, Jiuyi Li, Henk J. Busscher and Henny C. van der Mei. Influence of
Adhesion Force on icaA and cidA Gene Expression and Production of Matrix Components in
Staphylococcus aureus Biofilms. Appl. Environ. Microbiol. 2015, 12, 3369-3378)
Chapter 4
82
ABSTRACT
The majority of human infections are caused by biofilms. The biofilm mode of growth
enhances the pathogenicity of Staphylococcus spp. considerably, because once adhering
staphylococci embed themselves in a protective, self-produced matrix of extracellular-
polymeric-substances (EPS). The aim of this study is to investigate the influence of
staphylococcal adhesion forces to different biomaterials on icaA (regulating production of
EPS matrix components) and cidA (associated with cell lysis and eDNA release) gene
expression in Staphylococcus aureus biofilms. Experiments were performed with S. aureus
ATCC12600 and its isogenic mutant S. aureus ATCC12600Δpbp4, deficient in peptidoglycan
cross-linking. Deletion of pbp4 was associated with greater cell-wall deformability, while not
affecting planktonic growth rate, biofilm formation or cell-surface-hydrophobicity or zeta-
potential of the strains. Adhesion forces of S. aureus ATCC12600 were strongest on
polyethylene (4.9 ± 0.5 nN), intermediate on polymethylmethacrylate (3.1 ± 0.7 nN) and
weakest on stainless steel (1.3 ± 0.2 nN). Production of poly-N-acetylglucosamine, eDNA
presence and expression of icaA genes decreased with increasing adhesion forces. However,
no relation between adhesion forces and cidA expression was observed. Adhesion forces of
the isogenic mutant S. aureus ATCC12600Δpbp4 (deficient in peptidoglycan cross-linking)
were much weaker than of the parent strain and did not show any correlation with the
production of poly-N-acetylglucosamine, eDNA nor the expression of icaA and cidA genes.
This suggests that adhesion forces modulate the production of matrix molecules poly-N-
acetylglucosamine, eDNA and icaA gene expression by inducing nanoscale cell-wall
deformation with a pivotal role of cross-linked peptidoglycan layers in this adhesion force
sensing.
Influence of Adhesion Force on Gene Expression
83
INTRODUCTION
Staphylococcus spp. present an important group of potentially pathogenic strains and
species. According to estimates by The National Institutes of Health, about 80% of all human
infections are caused by biofilms (1). The biofilm mode of growth enhances the pathogenicity
of Staphylococcus spp. considerably when formed on the surfaces of biomaterial implants
and devices, such as total knee or hip arthroplasties or pacemakers (2). Biofilm formation
starts with the adhesion of individual organisms to a substratum surface. Initially, adhesion
is reversible but the bond between an adhering organism and a substratum surface rapidly
matures over time to become stronger and eventually adhesion is irreversible (3). Adhesion
is further enforced through the production of a matrix consisting of Extracellular Polymeric
Substances (EPS) by the adhering organisms in which they grow and find shelter against the
host immune system and antibiotic treatment. EPS composition largely depends on bacterial
strains and environmental conditions, but major components of EPS across different species
are polysaccharides, proteins and extracellular DNA (4).
It is difficult to envision how adhering bacteria regulate EPS production in response
to their adhesion to different surfaces. Recently, we have proposed that the bacterial
response to adhesion is dictated by the magnitude of the force by which a bacterium adheres
to a surface (5) and distinguished three regimes of adhesion forces (Figure 1). In the
planktonic regime, bacteria adhere weakly and accordingly cannot realize that they are on a
surface and retain their planktonic phenotype. The opposite regime is called the lethal
regime, where strong adhesion forces lead to high cell-wall stresses, retarded growth and
finally cell death. Both the planktonic regime as well as the lethal regime occur mostly after
application of coatings, like highly hydrated and hydrophilic polymer brush coatings or
positively charged quaternary ammonium coatings exerting strong, attractive electrostatic
forces on adhering bacteria, which are usually negatively charged under physiological
conditions (6). Most biomaterials used for implants and devices however, exert intermediate
adhesion forces on adhering bacteria and this regime is called the interaction regime. In the
interaction regime, bacteria were hypothesized to respond to the adhesion forces exerted by
a surface through production of various matrix components. Clinically indeed, biofilms of
the same strain can have different pathogenicity when formed on different biomaterials (7).
For example in abdominal wall surgery, hydrophobic surgical meshes made of
polytetrafluoroethylene are more susceptible to infection than meshes of less hydrophobic
polypropylene (8). On orthopedic biomaterials, icaA expression by Staphylococcus
Chapter 4
84
epidermidis and EPS production were higher on polyethylene than on
polymethylmethacrylate. Moreover, biofilms on polyethylene showed lower susceptibility to
gentamicin relative to biofilms on polymethylmethacrylate (9).
Figure 1 Regimented scheme for the interaction of bacteria with substratum surfaces. Weakly
adhering bacteria remain to have a planktonic phenotype, while strongly adhering ones die upon
contact. In the interaction regime bacteria are hypothesized to respond to their adhering state with
differential gene expression according to the adhesion force value they experience (5).
Little is known however, on the exact role of adhesion forces on the complex
response of adhering bacteria in the interaction regime. A likely hypothesis is that the
adhesion forces cause nanoscale cell-wall deformations and membrane stresses that act as a
signaling mechanism for an organism to its adhering state. Therefore, the response of
bacteria to their adhering state will not only differ on different biomaterials but will also
depend on the rigidity of the cell-wall itself as maintained in Gram-positive strains by a
relatively thick layer of cross-linked peptidoglycan. Measuring nanoscale cell wall
deformation upon bacterial adhesion to a surface is extremely difficult. Recently a new,
highly sensitive method has been proposed based on surface enhanced fluorescence that
measures cell-wall deformation over a large number of adhering bacteria under the influence
of the naturally occurring adhesion forces arising from a substratum surface (10). Surface
enhanced fluorescence is the phenomenon of increased fluorescence when fluorophores
come closer to a reflecting metal surface. It was first described for fluorescent proteins (11)
and ranges over a distance of 30 nm beyond which it decreases exponentially with separation
distance between the fluorophore and the reflecting surface. This relationship between
Influence of Adhesion Force on Gene Expression
85
surface enhanced fluorescence and separation distance was validated using fluorescent
proteins attached to polymeric spacers of varying lengths (12) and forms the basis for the
interpretation of surface enhanced fluorescence of adhering fluorescent bacteria in terms of
deformation of their cell wall. This method has a drawback that it can only be applied on
reflecting metal surfaces, but bears as advantages with respect to atomic force microscopy
e.g., that there are no external forces applied on an adhering bacterium, while it also
measures a large number of adhering bacteria simultaneously.
The aim of this study is to investigate the influence of adhesion to different common
biomaterials on icaA and cidA gene expression in Staphylococcus aureus biofilms. To this
end, we first measure staphylococcal adhesion forces to different biomaterials and relate
these adhesion forces with the expression of icaA and cidA genes. The ica operon is present
in S. aureus and is mainly involved in production of capsular polysaccharides upon
activation (13). Recently, it has also been reported that the ica locus is also required for
colonization and immunoprotection during colonizing the host (13, 14). IcaA and icaD
synthesize poly-N-acetylglucosamine (PNAG) which supports cell-cell and cell-surface
interactions (15). cidA expression is associated with cell lysis and the release of eDNA during
planktonic growth to facilitate adhesion and biofilm formation (16). Therefore, eDNA is
known to act as an essential glue to maintain the integrity of both the EPS matrix and
biofilms as a whole (16, 17). All experiments were performed with S. aureus ATCC12600 and
its isogenic mutant S. aureus ATCC12600Δpbp4, deficient in peptidoglycan cross-linking.
Higher deformability of the S. aureus ATCC12600Δpbp4 cell-wall with respect to the wild-
type strain was demonstrated using surface enhanced fluorescence.
Chapter 4
86
MATERIALS AND METHODS
Bacterial strains and culture conditions
Bacterial strains S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 were used
throughout this study. All the strains were stored at -80°C in Tryptone Soya Broth (TSB,
OXOID, Basingstoke, UK) containing 15% glycerol. Bacteria were cultured aerobically at
37°C on blood agar or TSB-agar plates with 10 μg ml-1 tetracycline. One colony was
inoculated in 10 ml TSB and grown for 24 h at 37°C. The pre-culture was then inoculated in
10 ml fresh TSB (1:100) and cultured for 16 h. The main culture (1:100) was used for 24 h
biofilm growth, while for other experiments staphylococci were suspended in TSB or
phosphate-buffered saline (PBS; 10 mM potassium phosphate, 0.15 M NaCl, pH 7.0) to the
desired density, as determined either by OD578 nm (Genesys™ 20 visible spectrophotometer,
Beun de Ronde, Abcoude, The Netherlands) or enumeration of the number of bacteria per
ml using a Bürker-Türk counting chamber. A stable chromosomal mutation in S. aureus
ATCC12600Δpbp4 was obtained by transfecting the temperature sensitive pMAD-pbp4
plasmid, as previously described (18). pMAD-pbp4 plasmid was obtained from Dr. M. G.
Pinho, Laboratory of Bacterial Cell Biology, and Dr. S. R. Filipe, Laboratory of Bacterial Cell
Surfaces and Pathogenesis, Instituto de Tecnologia Quimica e Biológica, Universidade Nova
de Lisboa.
To confirm that pbp4 deletion had an influence on cell-wall deformation using
surface enhanced fluorescence, GFP expressing variants (S. aureus ATCC12600-GFP and S.
aureus ATCC12600Δpbp4-GFP) were made by introducing the plasmid PMV158 into the
staphylococci, as controlled by the MalP promoter using electroporation and selected on 10
μg ml-1 tetracycline TSB-agar plates.
Cell-wall deformation
pbp4 deletion was confirmed by PCR and its expression was quantified in both the
staphylococcal strains using primer sets listed in Table 1. Main cultures were diluted 1:100 in
10 ml TSB and grown for 24 h under static conditions. Next, 1 ml of the resulting suspension
was subjected to RNA isolation and cDNA synthesis procedures, as described below for icaA
and cidA gene expression. To confirm that pbp4 deletion had an influence on cell-wall
deformation of the staphylococci, we applied a novel, highly sensitive method to
demonstrate cell-wall deformation of bacteria adhering on reflecting metal surfaces based on
Influence of Adhesion Force on Gene Expression
87
surface enhanced fluorescence (19). Briefly, staphylococci suspended in PBS (3 x 108 cells ml-
1) were allowed to sediment from a 0.075 cm high suspension volume above a stainless steel
316L (SS) substratum surface (7.6 x 1.6 cm) and the fluorescence radiance was measured as a
function of time using a bio-optical imaging system (IVIS Lumina II, PerkinElmer, Inc.,
Hopkinton, MA, USA) at an excitation wavelength of 465 nm and emission wavelength
between 515-575 nm. The IVIS was kept at 20°C with an exposure time of 5 s and images
were taken from the entire SS substratum surface every 5 min over a period of 3 h. From
three user defined regions of interest (1 cm2) the average fluorescent radiance was
determined with Living Image software package 3.1 (PerkinElmer Inc., USA). It was not
necessary to correct the fluorescence enhancement for photobleaching because previously
reported control experiments on glass showed negligible bleaching up to 5 h (19).
Staphylococcal sedimentation was monitored by direct observation and images of adhering
bacteria were taken using a metallurgical microscope equipped with 40x objective (ULWD,
CDPlan, 40PL, Olympus Co, Tokyo, Japan) connected to a CCD camera (Basler A101F,
Basler AG, Germany). The images were analysed using an in-house developed software
based on MATLAB to count the number of adhering bacteria in each image. Numbers of
adhering bacteria over the entire substratum surface were subsequently expressed as a
percentage with respect to the total number of bacteria present in the suspension volume
(0.912 ml) above the substratum.
The increase of the fluorescence radiance due to sedimentation and adhesion of
fluorescent staphylococci was measured relative to the fluorescence of suspended ones and
expressed as a total fluorescence enhancement, TFE(t), according to
(1)
in which R(t) denotes the fluorescence radiance at time t, while R0 and R(0) indicate the
fluorescence radiance of a suspension in the absence of staphylococci and immediately prior
to their sedimentation from suspension, respectively. Whereas total fluorescence
enhancement is due to a combination of increasing numbers of sedimented staphylococci
and their cell-wall deformation, increases in total fluorescence enhancement extending
0
0
(0)
)()(
RR
RtRtTFE
Chapter 4
88
beyond the time at which sedimentation is complete, are due to cell-wall deformation (19).
Cell-wall deformation brings a larger volume of the bacterial cytoplasm closer to the surface
and therewith more fluorophores inside the bacterium become subject to fluorescence
enhancement, yielding a higher fluorescence signal. Fluorescence enhancement only occurs
on reflecting substrata and accordingly effects of pbp4 deletion on cell-wall deformation
were only examined on SS.
Staphylococcal characteristics not-related to cell-wall deformation
In order to verify that other characteristics relevant for the current study were not affected
by pbp4 deletion, planktonic growth curves, biofilm formation, cell surface hydrophobicity
and zeta potential of the bacterial cell surfaces were determined.
Planktonic growth curves
Planktonic growth curves of S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 were
compared. Staphylococci were suspended in 10 ml TSB to an optical density OD578 nm of 0.05
and grown at 37°C under static conditions. Optical densities were subsequently measured as
a function of time.
Biofilm formation and quantitation
Biofilms on SS, polymethylmethacrylate (PMMA) and polyethylene (PE) coupons were
grown in triplicate in a 12-wells plate. After incubation for 6, 12 and 24 h at 37°C, the
coupons with biofilms were carefully removed and placed into a new 12-wells plate and
gently washed. The biofilms from three coupons of the same material were then suspended
by repeated pipetting and pooled in 1 ml PBS. To measure the biofilm biomass, 1:10 dilutions
of the pooled bacterial suspensions were prepared and optical densities OD578nm were
measured.
Microbial Adhesion To Hydrocarbons (MATH)
MATH was carried out in its kinetic mode (20) to reveal possible differences in adhesive cell
surface properties between S. aureus ATCC12600 and its isogenic Δpbp4 mutant. To this
end, staphylococci were suspended in phosphate buffer (10 mM potassium phosphate buffer,
pH 7.0) to an optical density OD578nm of 0.45-0.50 (Ao) and 150 μl hexadecane was added to
Influence of Adhesion Force on Gene Expression
89
3 ml bacterial suspension, and the two phase system was vortexed for 10 s (0.17 min) and
allowed to settle for 10 min. The optical density (At) was measured and this procedure was
repeated 5 more times (increasing vortexing times) and results were plotted as log (At / Ao ×
100) against the vortexing time (t) to determine the rate of initial bacterial removal R0 (min-
1) from the aqueous phase, i.e. their hydrophobicity as by the kinetic MATH assay, according
to
Zeta potential Bacterial suspensions of the wild-type and mutant strain were prepared as
mentioned above. Main cultures were centrifuged at 4000 g for 10 min and washed 2 times
in 10 ml PBS, pH 7.0. The washed pellets were resuspended in 10 ml PBS, pH 7.0 and zeta
potentials were determined by particulate microelectrophoresis (Zetasizer nano-ZS; Malvern
Instruments, Worcestershire, UK) at 25°C. The experiments were repeated three times and
the data are presented as averages ± standard error of the mean.
Preparation of bacterial AFM probes and adhesion force measurements In order
to measure adhesion forces between the S. aureus strains and different biomaterials,
staphylococci were immobilized on a cantilever for atomic force microscopy (AFM), as
described before (21). Bacteria were cultured as described above, with the difference that
they were washed and suspended in demineralized water. Adhesion force measurements
were performed at room temperature in PBS using a Dimension 3100 system (Nanoscope V,
Digital Instruments, Woodbury, NY, USA). For each bacterial probe, force-distance curves
were measured with no surface delay at a 2 nN trigger threshold. Using the same bacterial
probe, fifteen force measurements were recorded and three different probes were used on
three random locations on each material surface. Adhesion forces were determined from the
cantilever deflection data which were converted to force values (nN) by multiplication with
the cantilevers spring constant according to Hooke’s law
F= Ksp × D ` (3)
where Ksp is the spring constant of the cantilever and D is the deflection of the cantilever.
The spring constant of each cantilever was determined using the thermal method (22). The
integrity of a bacterial probe was monitored before and after the onset of each adhesion cycle
Chapter 4
90
by comparing adhesion forces measured on a clean glass surface. Whenever this adhesion
force differed more than 0.5 nN, data obtained last with that probe were discarded and a new
bacterial probe was made.
icaA and cidA gene expression
Gene expression analysis was performed on 1 h, 3 h and 24 h old biofilms. Biofilms were
grown by adding 2 ml of 1:100 diluted main culture with growth medium to each sample.
Total RNA from the biofilms was isolated using RiboPureTM-Bacteria Kit (Ambion,
Invitrogen) according to the manufacturer’s instructions. Traces of genomic DNA was
removed using DNAfreeTM kit (Ambion, Applied biosystems, Foster City, CA) and absence of
genomic DNA contamination was verified by real-time PCR prior to cDNA synthesis. cDNA
synthesis was carried out using 200 ng of RNA, 4 μl 5x iScript Reaction Mix, 1 μl iScript
Reverse Transcriptase, in a total volume of 20 μl (Iscript, Biorad, Hercules, CA) according to
manufacturer’s instructions. Real time RT-qPCR was performed in triplicates in a 96-well
plate AB0900 (Thermo Scientific, UK) with the primer sets for gyrB, icaA and cidA (Table
1). The following thermal conditions were used for all qPCR reactions: 95°C for 15 min and
40 cycles of 95°C for 15 s and 60°C for 20 s. The mRNA levels were quantified in relation to
endogenous control gene gyrB. Expression levels of icaA and cidA in all biofilms were
expressed relative to biofilms grown on PE.
Influence of Adhesion Force on Gene Expression
91
TABLE 1 Primer sequences for qRT-PCR used in this study.
Primer Sequence (5’- 3’) icaA-forward GGAAGTTCTGATAATACTGCTG icaA-reverse GATGCTTGTTTGATTCCCTC cidA-forward AGCGTAATTTCGGAAGCAACATCCA cidA-reverse CCCTTAGCCGGCAGTATTGTTGGTC pbp4 -forward GTTTGCCGGGTACAGATGGT pbp4-reverse CTCTTGGATAGTCCGCGTGT gyrB-forward GGAGGTAAATTCGGAGGT gyrB-reverse CTTGATGATAAATCGTGCCA
Production of matrix components in staphylococcal biofilms.
PNAG extraction and quantitation
Extraction of PNAG from S. aureus was performed as previously described (13). Briefly, 24 h
staphylococcal biofilms grown on SS, PMMA and PE coupons as described above were
suspended in 1 ml PBS for normalization, and diluted to an OD578nm of 0.75 for slime
extraction. The bacterial suspension was pelleted at 4000 g for 15 min, the supernatant was
aspirated and the pellet was re-suspended in 50 μl 0.5 M EDTA (pH 8) and incubated 5 min
at 100°C on a hot plate. Cell debris was pelleted at 8500 g for 5 min and 30 μl of the EPS
containing supernatant was pipetted into fresh tubes. The samples were treated with 10 μl
proteinase K (20 μg ml-1) for 30 min at 37°C before quantitation. The concentrated EPS was
diluted 1:100 with ultrapure water and 20 μl was blotted on nitrocellulose membrane using
Bio-Dot® apparatus (Biorad, Hercules, CA). The nitrocellulose membrane was then blocked
using 1% bovine serum albumin-Tris buffered saline (20 mM Tris-HCl pH 7.5, 500 mM
NaCl, 0.05% Tween20) for 1 h under mild shaking at room temperature. The membrane was
subsequently incubated with the lectin (wheat germ agglutinin, Sigma-Aldrich, Saint Louis,
USA) isolated from Triticum vulgaris that detects 1,4 β-N-acetyl-D-glucosamine, labeled
with biotin as a primary antibody in a 1:1000 dilution for 1.5 h under mild shaking at room
temperature. Finally, Streptavidin-Infra Red Dye® (LI-COR Biosciences, Leusden, The
Netherlands) was added as a secondary antibody in 1:10,000 dilution for 30 min under mild
shaking at room temperature. The membrane was washed 3 times, for 10 min each, with
Tween20-Tris buffered saline and the amount of PNAG measured using an Odyssey Infrared
Imaging System (LI-COR Biosciences).
eDNA extraction and quantitation. Extraction of eDNA was performed, as previously
described (14), but with some minor modifications. Briefly, biofilms grown for 24 h on SS,
Chapter 4
92
PMMA and PE coupons as described above were suspended in 1 ml 500 mM NaCl containing
10 mM EDTA and 50 mM Tris.HCl, pH 7.5 and transferred into chilled tubes. OD578nm of the
suspensions were measured for normalization and staphylococci were centrifuged at 4000 g
for 15 min to separate bacteria and eDNA. The supernatant was collected and subjected to
DNA extraction twice with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1)
and precipitated using 1/10 (v/v) of 3 M sodium acetate and 2/3 (v/v) of ice cold
isopropanol. After centrifugation (15 min, 4°C, 8500 g), the pellet was washed with 100%
ethanol and air dried. The dried DNA pellet was dissolved in 50 μl TE buffer (10 mM Tris-
HCl, 1 mM EDTA, pH 7.5). The amount of eDNA was quantified using CyQuant cell
proliferation assay kit (Invitrogen, molecular probes, Eugene, Oregon, USA) based on a
calibration curve of λDNA from 0 to 1000 ng ml-1. The eDNA samples were processed
according to the manufacturer’s instructions and measured by a fluorescence plate reader at
an excitation wavelength of 485 nm and emission wavelength of 520 nm.
Substratum surfaces, contact angle and surface roughness measurements
Substratum surfaces used in this study were SS, PMMA and PE. All substratum surfaces
were prepared to possess a comparable surface roughness in the micron-range, 1-2 μm in
order to rule out possible effects of surface roughness. SS was polished using 1200 grid SiC
paper followed by MetaDi 3 μm diamond suspension (Buehler, Lake bluff, IL, USA) on a
polishing mat for 20 min, while PMMA and PE surfaces were used as received. Circular
coupons of 0.5 mm thickness with a surface area of 3.1 cm2 were made to fit into a 12-wells
plate, sterilized with methanol, washed with sterile PBS and stored in sterile demineralized
water until use. Water contact angles were measured on all materials at 25°C using the
sessile drop technique in combination with a home-made contour monitor. Surface
roughness of the biomaterials was determined by AFM (Nanoscope IV DimensionTM 3100)
using a silicon nitride tip (Mountain View, CA, USA; probe curvature radius of 18 nm).
Influence of Adhesion Force on Gene Expression
93
RESULTS
Physico-chemical surface properties of biomaterials
Hydrophobicities of the biomaterials were evaluated using water contact angles. Water
contact angles varied considerably over the three materials included in this study. SS was the
least hydrophobic material with an average water contact angle of 33 ± 9 degrees, followed
by PMMA 69 ± 6 degrees and PE 84 ± 1. Surface roughnesses measured with AFM of the
materials were all in the micron-range and amounted 1.8 ± 0.2 µm, 2.0 ± 0.4 µm and 1.0 ±
0.2 µm for SS, PMMA and PE, respectively.
Effects of pbp4 deletion on S. aureus
Peptidoglycan cross-links provide cell-wall rigidity, therefore effects on cell-wall deformation
were determined from total fluorescence enhancement of S. aureus sedimenting and
adhering to SS. The initial linear increase (1–2 h) in total fluorescence enhancement for S.
aureus ATCC12600-GFP and S. aureus ATCC12600Δpbp4-GFP is due in part to an increase
in the number of sedimented bacteria (compare Figure 2a and Fig 2b), but the slow increase
in total fluorescence enhancement after 3 h once all staphylococci from the suspension have
sedimented on the surface, is fully due to cell-wall deformation. Accordingly, it can be seen
that S. aureus ATCC12600Δpbp4-GFP deforms to a greater extent than does S. aureus
ATCC12600-GFP due to the absence of pbp4 crosslinking.
Chapter 4
94
Figure 2 Effects of pbp4 deletion on cell-wall deformation.(a) Cell-wall deformation of S. aureus
ATCC12600-GFP and S. aureus ATCC12600∆pbp4-GFP upon adhesion to SS, as measured using
surface enhanced fluorescence. As an adhering bacterium deforms, its fluorescent intracellular content
gets closer to the reflecting metal surface yielding a surface enhanced fluorescence that increases with
increasing deformation. Each point represents an average ± standard error of the mean over three
individual experiments. All differences between S. aureus ATCC12600 and S. aureus
ATCC12600Δpbp4 are statistically significant (p < 0.05).(b) The number of adhering S. aureus
ATCC12600-GFP and S. aureus ATCC12600∆pbp4-GFP on SS surfaces as a function of sedimentation
time, expressed as a percentage of bacteria adhering (na) with respect to the total number of bacteria
(ntot) in the suspension volume above the substratum surface. Each point represents an average ±
standard error of the mean over three individual experiments. All differences between S. aureus
ATCC12600 and S. aureus ATCC12600Δpbp4 are statistically significant (p < 0.05).
In order to establish that pbp4 deletion solely affected the cell-wall deformability of S.
aureus ATCC12600 and no other properties, planktonic growth (Figure 3a), biofilm
formation (Figure 3d and 3e), cell surface hydrophobicities (Figure 3B) using the MATH-test
in its kinetic mode (20) and zeta potentials (Figure 3c) were compared with the ones of S.
aureus ATCC12600Δpbp4. Growth curves, zeta potentials and cell surface hydrophobicities
(initial removal coefficients R0 of 0.0002 min-1) of both strains were identical. Generally, S.
aureus ATCC12600Δpbp4 formed less biofilm than S. aureus ATCC12600. For both strains
on SS, more biofilm is formed than on PMMA and PE for all time points measured (Figure
3d, 3e), although no statistically significant differences could be established in amount of
biofilm on the three substratum surfaces after 24 h of growth.
Influence of Adhesion Force on Gene Expression
95
S. aureus adhesion forces to different biomaterials
The adhesion forces of S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 were
measured using AFM, equipped with a bacterial probe as recently advocated by Alsteens et
al. (23). For S. aureus ATCC12600 (Figure 4a), strongest adhesion forces were observed on
the PE surface (4.9 ± 0.5 nN) that decreased in a statistically significant manner (p < 0.05)
toward more hydrophilic PMMA (3.1 ± 0.7 nN) and SS (1.3 ± 0.2 nN) surfaces. Adhesion
forces of the Δpbp4 mutant were significantly smaller (p < 0.05) than of S. aureus
ATCC12600 (Figure 4b).
Figure 3 Effects of expression of pbp4 in S. aureus ATCC12600 on strain characteristics not-related to
cell-wall deformation. (a) Planktonic growth curves of S. aureus ATCC12600 and S. aureus
ATCC12600Δpbp4 at 37°C (fully overlapping). (b) The optical density log (At/A0 × 100) as a function of
the vortexing time for the removal of S. aureus ATCC12600 and its isogenic mutant S. aureus
Chapter 4
96
ATCC12600Δpbp4 from an aqueous phase (10 mM potassium phosphate buffer, pH 7.0) by
hexadecane. Absence of removal indicates a hydrophilic cell surface.Each point represents an average ±
standard error of the mean over three individual experiments with separately grown staphylococcal
cultures. None of the differences between S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 are
statistically significant. (c) Zeta potentials of S. aureus ATCC12600 and S. aureus ATCC12600∆pbp4 in
PBS, pH 7.0. Each point represents an average ± standard error of the mean over three individual
experiments with separately grown staphylococcal cultures. None of the differences between S. aureus
ATCC12600 and S. aureus ATCC12600Δpbp4 are statistically significant. (d) and (e) Biofilm formation
of S. aureus ATCC12600 and S. aureus ATCC12600Δpbp4 expressed as OD578 nm after 6, 12 and 24 h of
growth on SS, PMMA and PE.
Figure 4 S. aureus adhesion forces to different biomaterials. (a) Adhesion forces of S. aureus
ATCC12600 to SS, PMMA and PE. (b) Similar as in (a), for S. aureus ATCC12600Δpbp4. Each bar
represents an average of 135 adhesion force curves measured with 9 different bacterial probes taken
from three separately grown staphylococcal cultures. Error bars represent the standard errors of the
mean. * indicates significant differences (p < 0.05) in staphylococcal adhesion forces to different
biomaterials (two tailed, two-sample equal variance Student’s t-test).
Influence of Adhesion Force on Gene Expression
97
Production of matrix components and gene expression in relation with
staphylococcal adhesion forces in 24 h old biofilms.
PNAG production normalized with respect to the amount of biofilm formed decreased with
increasing adhesion force towards the more hydrophobic PE surface in a significant manner
(p < 0.05) (Figure 5a). Normalized amounts of eDNA in 24 h S. aureus ATCC12600 biofilms
decreased as well with increasing adhesion force (p < 0.05) (Figure 5b). However for 24 h S.
aureus ATCC12600Δpbp4 biofilms, neither PNAG production nor eDNA presence relates in
a significant way with its adhesion forces to different biomaterials (Figure 5c and 5d).
Figure 5 S. aureus PNAG production and eDNA presence versus adhesion forces. (a)
Normalized PNAG production in 24 h S. aureus ATCC12600 biofilms as a function of the
adhesion force. (b) Normalized eDNA presence in 24 h S. aureus ATCC12600 biofilms as a
function of the adhesion force.(c) Similar as in (a) for S. aureus ATCC12600Δpbp4. (d)
Chapter 4
98
Similar as in (b) for S. aureus ATCC12600Δpbp4. Linear regression analysis was performed
in all graphs to analyse the correlation between PNAG production, eDNA presence and
adhesion force. The drawn line represents the best fit to a linear function, while r2 values
represent the correlation coefficients. The dotted lines enclose the 95% confidence intervals.
PNAG and eDNA were normalized to the amount of biofilm formed on each substratum and
each point represents an average ± standard error of the mean over three individual
experiments with separately grown staphylococcal cultures.
In Figure 6 we have plotted the staphylococcal adhesion forces on the different biomaterials
versus their icaA and cidA gene expression in 24 h old biofilms, as responsible for the
production of PNAG and eDNA respectively. In S. aureus ATCC12600, icaA gene expression
decreased as adhesion forces increased (Figure 6a) in line with PNAG production. cidA gene
expression did not follow a similar trend as that of icaA expression in 24 h old biofilms, but
was equally expressed on all the biomaterials irrespective of the adhesion forces experienced
over different biomaterials (Figure 6b). In S. aureus ATCC12600Δpbp4, lacking
peptidoglycan cross-linking, neither expression of icaA nor of cidA relates with its adhesion
force to the different biomaterials (Figs. 6c and 6d).
Influence of Adhesion Force on Gene Expression
99
Figure 6 S. aureus icaA and cidA gene expressions versus adhesion forces in 24 h old biofilms. (a)
Normalized icaA expression in 24 h S. aureus ATCC12600 biofilms as a function of the adhesion force.
(b) Normalized cidA expressions in 24 h S. aureus ATCC12600 biofilms as a function of the adhesion
force.(c) Similar as in (a) for S. aureus ATCC12600Δpbp4. (d) Similar as in (b) for S. aureus
ATCC12600Δpbp4. Linear regression analysis was performed in all graphs to analyse the correlation
between gene expression and adhesion force. The drawn line represents the best fit to a linear function,
while r2 values represent the correlation coefficients. The dotted lines enclose the 95% confidence
intervals. IcaA and cidA expression were normalized to gyrB and presented as normalized fold
expression with respect to PE. Each point represents an average ± standard error of the mean over
three individual experiments with separately grown staphylococcal cultures.
Chapter 4
100
icaA gene expression in relation with staphylococcal adhesion forces in 1 and 3
h old biofilms of S. aureus ATCC12600
In order to assess the speed at which gene expression is regulated by the adhesion forces an
adhering bacterium experiences, icaA gene expression was also assessed in 1 h and 3 h old
biofilms of S. aureus ATCC12600 and plotted against adhesion forces (Figure 7). In 1 h old
biofilms, icaA gene expression did not show any relation with adhesion force (Figure 7a), but
in 3 h old biofilms (Figure 7b) a similar relation with adhesion force was observed as in 24 h
old biofilms (compare Figure 7b and Figure 6a).
Figure 7 icaA gene expression versus adhesion forces in 1 h and 3 h old biofilms of S. aureus
ATCC12600.(a) Normalized icaA expression in 1 h old S. aureus biofilms as a function of the adhesion
force. (b) Similar as in (a) in 3 h old S. aureus biofilms. Linear regression analysis was performed to
analyse the correlation between icaA gene expression and adhesion force. The drawn line represents
the best fit to a linear function, while r2 values represent the correlation coefficients. The dotted lines
enclose the 95% confidence intervals. IcaA expression was normalized to gyrB and presented as
normalized fold expression with respect to PE. Each point represents an average ± standard error of
the mean over three individual experiments with separately grown staphylococcal cultures.
Influence of Adhesion Force on Gene Expression
101
DISCUSSION
In this study, we hypothesized that adhesion forces sensed by S. aureus upon adhesion to
different biomaterials regulate the expression of two important genes icaA and cidA, known
to contribute in the formation of their self-produced EPS matrix. Over the range of adhesion
forces between 1 and 5 nN, icaA gene expression decreased with increasing adhesion forces
in 3 h and 24 h old biofilms but not in 1 h old ones, while for cidA gene expression no
influence of adhesion forces was found. Moreover, production of the EPS matrix components
PNAG and eDNA decreased with increasing adhesion forces experienced by S. aureus
ATCC12600 on different biomaterials, making it unlikely that cidA expression solely
regulates eDNA release. The differences in eDNA presence in biofilms grown on SS, PMMA
and PE can be caused by autolysin atl gene. This gene produces two functional proteins
responsible for regulating growth, cell lysis and biofilm formation (24). The expression of the
alt gene occurs under several external stress conditions (25) including adhesion as a
potential trigger for DNA release. Since matrix components (PNAG and eDNA) provide an
important means through which bacteria can evade the host immune response and antibiotic
attack, we can speculate from the results in this study that pathogenicity of S. aureus
biofilms is regulated in part by the adhesion forces arising from the substratum to which
they adhere.
Bacterial behavior has been found to be extremely sensitive to minor differences in
adhesion forces. In S. aureus, invasive isolates exhibited higher mean adhesion forces to a
fibronectin-coated substratum by 0.28 nN than non-invasive control isolates (26). Moreover,
strains of Listeria monocytogenes with adhesion forces to the silicon nitride tip of an AFM
cantilever stronger than 0.38 nN were found more pathogenic than strains with smaller
adhesion forces (27), coinciding with our conclusion on the impact of adhesion forces on S.
aureus gene expression and associated pathogenicity. In the current study, we measured
adhesion forces between S. aureus and different biomaterial surfaces with bacterial probe
AFM. This method has been applied more often, but raises concerns as to whether contact is
established by a single organism or multiple ones. In the past (28), we have noticed that
multiple contacts seldom or never happen because bacteria attached to the cantilever are
unlikely to be equidistant to the substratum surface within the small distance range of
interaction forces. In addition, the bacterial probe is contacting the surface at an angle of 15
degrees which makes it less probable for multiple contacts. Multiple contact points however,
would become evident from double contour lines when a bacterial probe is used for imaging.
Chapter 4
102
Routine checks on probes have never yielded double contour lines and hence it is safe to
assume that our bacterial probes do not yield multiple contact points.
Biofilm formation starts with adhesion of so-called “linking film” bacteria, which
provide the groundwork for further biofilm growth. In essence, only these linking film
bacteria are capable of sensing a substratum surface, since all organisms later appearing in a
biofilm adhere to neighboring organisms. Yet we found that a similar relation between icaA
gene expression in 3 h old biofilms of S. aureus ATCC12600 (see Figure 7b) as in 24 h old
ones (compare Figure 7b and 6a), while in 1 h old biofilm this relation was still lacking (see
Figure 7a) as bacteria may not have adapted within 1 h to the substratum to which they
adhere. This shows that gene expression is a time-dependent process and stable expression
only occurs after 3 h and lasts minimally during 24 h of biofilm growth. This raises the
important question how organisms appearing later in a biofilm, either due to growth or
progressive co-adhesion, sense the adhesion forces arising from a substratum. Clearly, the
range of all attractive or repulsive forces arising from a substratum surface is limited to few
tens of nm, making it impossible for later organisms to directly sense a surface. Much more,
they will experience adhesion forces from neighboring organisms with which they co-adhere
(29). This implies that there must be a communication means available within a biofilm
through which substratum information is passed to bacteria in a biofilm that are not in
direct contact with the substratum.
Expression of icaA, but not of cidA genes decreased with increasing adhesion forces
experienced by adhering staphylococci. Adhesion forces arising from substratum surfaces
have recently been demonstrated to induce nanoscopic cell-wall deformation, yielding
membrane stresses (21). Deformation of lipid bilayers has been shown to result in opening of
mechanosensitive channels involved in adhesion force sensing, as they transduce a
mechanical force into chemical signals (30). Note that also for Pseudomonas aeruginosa,
surface-associated organisms have been found to produce more pili than their planktonic
counterparts, suggesting that a localized mechanical signal, i.e. cell-wall stress arising from
surface-association, plays a pivotal role in regulating genes associated with surface adhesion
(31). Cell-wall stress and resulting deformation are extremely difficult to measure due to the
rigidity of the peptidoglycan layer and therefore we employed an isogenic mutant S. aureus
ATCC12600Δpbp4-GFP lacking peptidoglycan cross-linking and confirmed the greater
deformability of the isogenic mutant (Figure 2) using surface enhanced fluorescence (32).
Surface enhanced fluorescence can only be measured on reflecting surfaces and was thus
Influence of Adhesion Force on Gene Expression
103
only performed on SS. Importantly, due to the extreme sensitivity of surface enhanced
fluorescence measurements, also other wild-type strains have been shown to deform upon
adhesion to a surface (19). As important aspects of surface enhanced fluorescence, the
number of bacteria involved in a single analysis is much larger than can be obtained using
more microscopic methods, like AFM, while secondly it measures deformation under the
naturally occurring adhesion forces that is, not under an applied force as in AFM (21).
Therefore, it can be anticipated that differences in adhesion forces between S. aureus and
various substratum surfaces may actually induce different degrees of cell-wall deformation
which supports our hypothesis that adhesion forces cause nanoscale cell-wall deformations
and membrane stresses that act as a signaling mechanism for an organism to its adhering
state.
cidA expression did not relate with adhesion forces, possibly because cidA
membrane proteins program cell death based on the oxidation and reduction state of the cell
membrane (33) rather than its deformation suggesting that other environmental conditions
like pH, nutrient availability, biofilm age or antimicrobial stress influencing DNA release
(34). The peptidoglycan layer, ensuring rigidity to the bacterial cell-wall, appears of pivotal
importance in adhesion force sensing, as its deformation is directly transmitted to the
membrane. In the isogenic mutant S. aureus ATCC12600Δpbp4, lacking cross-linked
peptidoglycan and therewith possessing a softer cell-wall, adhesion force sensing appears to
be ineffective as no relation was found between adhesion forces and gene expression.
Deletion of pbp4 from S. aureus ATCC12600 neither had an effect on planktonic
growth, cell surface hydrophobicity or zeta potential, and had only a small effect on biofilm
formation (see Figure 3). However, it may be considered strange, that the amount of biofilm
of both strains formed on different materials bears no significant relation with the forces
experienced by these linking film organisms. This can be explained by the fact that that
bacteria will only adhere once they experience attractive forces that exceed the prevailing
detachment forces in a given environment. The current experiments were carried out under
static conditions rather than under flow, which implies a virtually zero detachment force
operating during adhesion and making any adhesion force large enough for a bacterium to
remain adhering. In this respect, it is not surprising that S. aureus ATCC12600Δpbp4 had a
similar ability to form biofilm than its parent strains as both its cell surface hydrophobicity
as well as its zeta potential are similar to the ones of the parent strain (see Figure 3).
Importantly for the development of biofilms in the presence of weak adhesion forces,
biofilms even form on highly hydrated, polymer-brush coatings, exerting very small
Chapter 4
104
adhesion forces in the sub-nN range that were found insufficient for adhering bacteria to
even realize they were in an adhering state (35).
Concluding, S. aureus reacts to its adhering state based on the magnitude of the
adhesion forces it experiences as arising from the substratum surface to which it adheres.
This response predominantly involves icaA gene expression and the production of EPS
matrix components (PNAG and eDNA) that both decrease with increasing adhesion forces.
Increasing adhesion forces bring an adhering organism closer to the “lethal” regime which
might be a reason as to why less EPS is produced by organisms experiencing stronger
adhesion forces. In addition, our data also suggest that mechanical properties of the cell-wall
as provided by the peptidoglycan layer surrounding the cell membrane, serve as an
important tool for the adhesion force sensing capacity in S. aureus.
ACKNOWLEDGEMENTS
The authors are grateful to Dr. Mariana G. Pinho, Laboratory of Bacterial Cell Biology, and
Dr. Sergio R. Filipe, Laboratory of Bacterial Cell Surfaces and Pathogenesis, Instituto de
Tecnologia Quimica e Biológica, Universidade Nova de Lisboa, for providing pMADΔpbp4
plasmid.
Influence of Adhesion Force on Gene Expression
105
REFERENCES
1. The national institutes of health. 1999. The national institutes of health. SBIR/STTR Study Control Microb. biofilms.
2. Darouiche RO. 2004. Treatment of infections associated with surgical implants. N. Engl. J. Med. 350:1422–1429.
3. Monroe D. 2007. Looking for chinks in the armor of bacterial biofilms. PLoS Biol. 5:e307.
4. Flemming H-C, Wingender J. 2010. The biofilm matrix. Nat. Rev. Microbiol. 8:623–633.
5. Busscher HJ, Van der Mei HC. 2012. How do bacteria know they are on a surface and regulate their response to an adhering state? PLoS Pathog. 8:e1002440.
6. Kügler R, Bouloussa O, Rondelez F. 2005. Evidence of a charge-density threshold for optimum efficiency of biocidal cationic surfaces. Microbiology. 151:1341–1348.
7. Tiller JC, Liao CJ, Lewis K, Klibanov AM. 2001. Designing surfaces that kill bacteria on contact. Proc. Natl. Acad. Sci. U. S. A. 98:5981–5985.
8. Engelsman AF, Van Dam GM, Van der Mei HC, Busscher HJ, Ploeg RJ. 2010. In vivo evaluation of bacterial infection involving morphologically different surgical meshes. Ann. Surg. 251:133–137.
9. Nuryastuti T, Krom BP, Aman AT, Busscher HJ, Van der Mei HC. 2011. Ica-expression and gentamicin susceptibility of Staphylococcus epidermidis biofilm on orthopedic implant biomaterials. J. Biomed. Mater. Res. Part A. 96:365–371.
10. Li J, Busscher HJ, Swartjes J, Chen Y, Harapanahalli AK, Norde W, Van der Mei HC, Sjollema J. 2014. Residence-time dependent cell wall deformation of different Staphylococcus aureus strains on gold measured using surface-enhanced-fluorescence. Soft Matter 10:7638–7646.
11. Lakowicz JR, Geddes CD, Gryczynski I, Malicka J, Gryczynski Z, Aslan K, Lukomska J, Matveeva E, Zhang J, Badugu R, Huang J. 2004. Advances in surface-enhanced fluorescence. J. Fluoresc. 14:425–441.
12. Fu Y, Lakowicz JR. 2006. Enhanced fluorescence of Cy5-labeled oligonucleotides near silver island films: A distance effect study using single molecule spectroscopy. J. Phys. Chem. B 110:22557–22562.
13. Cramton SE, Gerke C, Schnell NF, Nichols WW, Götz F. 1999. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect. Immun. 67:5427–5433.
14. Begun J, Gaiani JM, Rohde H, Mack D, Calderwood SB, Ausubel FM, Sifri CD. 2007. Staphylococcal biofilm exopolysaccharide protects against Caenorhabditis elegans immune defenses. PLoS Pathog. 3:e57.
Chapter 4
106
15. Arciola CR, Baldassarri L, Montanaro L. 2001. Presence of icaA and icaD genes and slime production in a collection of Staphylococcal strains from catheter-associated infections. J. Clin. Microbiol. 39:2151–2156.
16. Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, Smeltzer MS, Bayles KW. 2007. The cidA murein hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus. Proc. Natl. Acad. Sci. U. S. A. 104:8113–8118.
17. Dominiak DM, Nielsen JL, Nielsen PH. 2011. Extracellular DNA is abundant and important for microcolony strength in mixed microbial biofilms. Environ. Microbiol. 13:710–721.
18. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl. Environ. Microbiol. 70:6887–6891.
19. Li J, Busscher HJ, Van der Mei HC, Sjollema J. 2012. Surface enhanced bacterial fluorescence and enumeration of bacterial adhesion. Biofouling. 29:11–19.
20. Lichtenberg D, Rosenberg M, Sharfman N, Ofek I. 1985. A kinetic approach to bacterial adherence to hydrocarbon. J. Microbiol. Methods. 4:141–146.
21. Chen Y, Harapanahalli AK, Busscher HJ, Norde W, Van der Mei HC. 2014. Nanoscale cell wall deformation impacts long-range bacterial adhesion forces on surfaces. Appl. Environ. Microbiol. 80:637–643.
22. Burnham NA, Chen X, Hodges CS, Matei GA, Thoreson EJ, Roberts CJ, Davies MC, Tendler SJB. 2002. Comparison of calibration methods for atomic-force microscopy cantilevers. Nanotechnology. 14:1–6.
23. Alsteens D, Beaussart A, El-Kirat-Chatel S, Sullan RMA, Dufrêne YF. 2013. Atomic force microscopy: a new look at pathogens. PLoS Pathog. 9:e1003516.
24. Singh VK. 2014. High level expression and purification of Atl, the major autolytic protein of Staphylococcus aureus. Int. J. Microbiol. 2014:615965.
25. Vollmer W, Joris B, Charlier P, Foster S. 2008. Bacterial peptidoglycan (murein) hydrolases. FEMS Microbiol. Rev. 32:259–86.
26. Yongsunthon R, Fowler jr VG, Lower BH, Vellano III FP, Alexander E, Reller LB, Corey GR, Lower SK. 2007. Correlation between fundamental binding forces and clinical prognosis of Staphylococcus aureus infections of medical implants. Langmuir. 23:2289–2292.
27. Park B-J, Haines T, Abu-Lail NI. 2009. A correlation between the virulence and the adhesion of Listeria monocytogenes to silicon nitride: An atomic force microscopy study. Colloids Surf B Biointerf. 73:237–243.
28. Younes JA, Van der Mei HC, Van den Heuvel E, Busscher HJ, Reid G. 2012. Adhesion forces and coaggregation between vaginal staphylococci and lactobacilli. PLoS One 7:e36917.
Influence of Adhesion Force on Gene Expression
107
29. Mayer C, Moritz R, Kirschner C, Borchard W, Maibaum R, Wingender J, Flemming H-C. 1999. The role of intermolecular interactions: studies on model systems for bacterial biofilms. Int. J. Biol. Macromol. 26:3–16.
30. Kumamoto CA. 2008. Molecular mechanisms of mechanosensing and their roles in fungal contact sensing. Nat. Rev. Microbiol. 6:667–673.
31. Cowles KN, Gitai Z. 2010. Surface association and the MreB cytoskeleton regulate pilus production, localization and function in Pseudomonas aeruginosa. Mol. Microbiol. 76:1411–1426.
32. Hao Q, Qiu T, Chu PK. 2012. Surfaced-enhanced cellular fluorescence imaging. Prog. Surf. Sci. 87:23–45.
33. Ranjit DK, Endres JL, Bayles KW. 2011. Staphylococcus aureus CidA and LrgA proteins exhibit holin-like properties. J. Bacteriol. 193:2468–2476.
34. Kaplan JB, Izano EA, Gopal P, Karwacki MT, Kim S, Bose JL, Bayles KW, Horswill AR. 2012. Low levels of β-lactam antibiotics induce extracellular DNA release and biofilm formation in Staphylococcus aureus. mBio. 3:e00198–12.
35. Dong B, Jiang H, Manolache S, Wong ACL, Denes FS. 2007. Plasma-mediated grafting of poly(ethylene glycol) on polyamide and polyester surfaces and evaluation of antifouling ability of modified substrates. Langmuir. 23:7306–7313.
108
109
Chapter 5
Expression of the NsaRS Two-Component System in
Staphylococcus aureus under Mechanical and Chemical
Stresses
(Submitted to Environmental Microbiology Reports. Akshay K. Harapanahalli, Henk J.
Busscher and Henny C. van der Mei. Expression of the NsaRS Two-Component-System in
Staphylococcus aureus under Mechanical and Chemical Stresses)
Chapter 5
110
ABSTRACT
Nisin-associated-sensitivity-response-regulator (NsaRS) is important for surface adhesion,
biofilm formation and bacterial resistance against chemical stresses in S. aureus. It consists
of an intra-membrane located sensor NasS and a cytoplasmatically located response
regulator NsaR, which becomes activated upon receiving phosphate groups from the NsaS
sensor. The intra-membrane location of the NsaS sensor leads us to hypothesize that the
NsaRS system can sense not only chemical but also mechanical stresses to modulate
antibiotic resistance via the NsaAB efflux pump. To verify this hypothesis, we compared
expressions of the NsaS sensor and NsaA efflux pump in S. aureus SH1000 in their adhering
(“mechanical stress”) and planktonic state, while the presence of nisin constitutes a chemical
stress. NsaS and NsaA gene expressions by S. aureus SH1000 were higher in a mechanically
stressed, adhering state than in a planktonic one. Chemical stress enhanced NsaS and NsaR
gene expressions. Gene expression became largest, when the organisms experienced a
chemical stress in combination with a strong mechanical stress, in the current study
quantitated as the adhesion force arising from a substratum surface measured using
bacterial probe atomic force microscopy. This confirms our hypothesis that the NsaRS
system can sense both chemical and mechanical stresses.
Expression of NsaRS under Mechanical and Chemical Stress
111
INTRODUCTION
Staphylococcus aureus possesses an extensive infection capacity in a plethora of ecological
niches within the host, including the surfaces of biomaterial implants and devices. An
infection related to the presence of a biomaterial implant surface starts with the reversible
adhesion of bacteria to the implant surface, after which adhering bacteria embed themselves
in a matrix of extracellular polymeric substances (EPS) to yield a transition to irreversible
adhesion and biofilm growth commences. The EPS matrix protects biofilm inhabitants
against biological, mechanical and chemical stresses, such as the host immune response,
fluid shear and antibiotic treatment (1). Different biomaterials used in the clinical practice
have different tendencies to become colonized and cause infection (2). Moreover, antibiotic
resistance of biofilms seems to be related to the biomaterial used (3). This indicates that
adhering bacteria can sense the type of biomaterial they adhere to and regulate gene
expression for optimal adaptation and survival.
S. aureus interacts with its surroundings through a wide range of sensing systems to
regulate gene expression in response to environmental stresses. Bacteria, including
Staphylococcus aureus, can either use one- (4) or two-component systems (5,6) to process
environmental stimuli. Nisin associated sensitivity response regulator (NsaRS) is a recently
discovered two-component system in S. aureus, consisting of an intra-membrane bound
histidine kinase and a cytoplasmatically located response regulator NsaR, that becomes
activated upon receiving phosphate groups from the NsaS sensor. Intra-membrane bound
histidine kinase senses environmental changes and reprograms bacterial gene expression to
reduce stress (see Figure 1). Depending on the type of external stress, the response regulator
activates or represses the target gene expression (7). The NsaRS two-component system has
been shown to be important for surface adhesion, biofilm formation (8) and bacterial
resistance against chemical stresses, exerted by antimicrobial peptides including nisin (9),
bacitracin and cell wall perturbing antibiotics such as phosphomycin and ampicillin (8).
NsaRS mediates resistance by upregulating the NsaAB efflux pump (Figure1) which
detoxifies the cell to promote survival (8).
Chapter 5
112
Figure 1. Schematic presentation of the NsaRS two-component system and upregulation of
downstream transporter NsaAB. The NsaS intra-membrane histidine kinase (IM-HK) rearranges upon
sensing an external chemical stress and autophosphorylates to transfer phosphate to the NsaR
response regulator. The NsaR activates or represses target gene expression. Upon activation of the
target genes, NsaAB is activated to pump chemicals out of the cell.
Mechanical stresses exerted by adhesion forces between a substratum surface and
adhering staphylococci have been shown to impact ica expression and associated production
of the extracellular matrix component poly-N-acetylglycosamine (10), resulting in
differential sensitivities of adhering staphylococci against chemical stresses (3). Although
NsaRS activation is clearly associated with chemical stress (8, 9) the intra-membrane
location of the NsaS sensor suggests its possible activation by membrane deformation as a
result of mechanical stress (11), as seen in ica expression by adhering staphylococci (10). Few
Expression of NsaRS under Mechanical and Chemical Stress
113
other examples are known where mechanical stress, such as fluid shear forces (12, 13) or
adhesion to a surface lead to surface sensing and cause gene activation. In Escherichia coli
initial surface adhesion causes physical stress to the cell envelop and activates the Cpx
pathway for biofilm formation (6). Similarly, Vibrio parahaemoliticus uses the ScrABC
pathway (14) for surface sensing and biofilm formation. Considering the intra-membrane
location of the NsaS sensor and the involvement of the NsaRS two-component system in
both biofilm formation and antibiotic resistance, we here hypothesize that the NsaRS system
can sense both chemical and mechanical stresses and therewith plays an important role in
biomaterial induced modulation of antiobiotic resistance via the NsaAB efflux pump.
The aim of this study was to verify the above hypothesis by investigating differences
in expression of the NsaS sensor and NsaA efflux pump during early S. aureus biofilm
formation in presence and absence of nisin on two common biomaterials (stainless steel (SS)
and polyethylene (PE)) exerting different adhesion forces on S. aureus. Bacterial adhesion
forces on the two biomaterials will be measured using bacterial probe atomic force
microscopy as an indicator of mechanical stress, while the presence of nisin constitutes a
chemical stress. Experiments will be conducted with S. aureus SH1000 and S. aureus
SH1000∆NsaS, a mutant lacking the intra-membrane kinase sensor, NsaS.
MATERIALS AND METHODS
Bacterial strains and culture conditions
The bacterial strains S. aureus SH1000 and S. aureus SH1000ΔNsaS, a mutant lacking the
kinase sensor, were used in this study and kindly provided by Dr. Lindey N. Shaw,
Department of Cell Biology, Microbiology and Molecular Biology, University of South
Florida, Tamps, FL. USA. The strains were cultured aerobically at 37°C on blood agar. One
colony was inoculated in 10 ml Tryptone Soya Broth (TSB, OXOID, Basingstoke, UK) and
grown for 24 h at 37°C. The pre-culture was used to inoculate the main culture, 10 ml TSB
(1:100) and cultured for 16 h. The main culture was diluted (1:5) and 3 ml was used to grow 3
and 6 h biofilms on coupons made of SS and PE at 37°C in presence and absence of 2 µg ml-1
nisin, a sub-minimal inhibitory concentration (MIC for S. aureus SH1000 is 4 µg ml-1; (9) in
a 6 wells plate. Biofilms were harvested by transferring the coupons with biofilms to a new 6
wells plate, washing the coupons twice with phosphate-buffered saline (PBS; 10 mM
potassium phosphate, 0.15 M NaCl, pH 7.0) and resuspended in 1 ml PBS by repeated
Chapter 5
114
pipetting. The suspended biofilm was centrifuged at 4000 x g for 10 min, the supernatant
was removed and the pellets were stored at -20 ºC until RNA isolation.
Materials and preparation
SS and PE were prepared to possess a comparable surface roughness in the micron-range. SS
was polished using 1200 grid SiC paper followed by MetaDi 3 μm diamond suspension
(Buehler, Lake bluff, IL, USA) on a polishing mat for 15 min, using a mechanical polisher
Phoenix Beta, fitted with VectorTM power head (Buehler, Dusseldorf, Germany). PE was used
as received from the manufacturer (Goodfellow Cambridge Ltd, Huntingdon, England).
Coupons were made to fit into a 6-wells plate with a total surface area of 7.5 cm2, sterilized
with ethanol (96%), washed with sterile PBS and stored in sterile demineralized water until
use.
Water contact angles measurements
Water contact angles were measured on SS and PE surfaces at 25°C using the sessile drop
technique with a home-made contour monitor.
Adhesion force measurements
In order to measure adhesion forces between the S. aureus strains and SS and PE surfaces,
staphylococci were immobilized on a tipless cantilever for the atomic force microscope
(AFM), as described before (15) Adhesion force measurements were performed at room
temperature in PBS using a Dimension 3100 system (Nanoscope V, Digital Instruments,
Woodbury, NY, USA). For each bacterial probe, force-distance curves were measured
without surface delay at a 2 nN trigger threshold. Bacterial probes were prepared out of three
different cultures. For each bacterial probe, ten force measurements were recorded and three
different probes were used on three random locations on each material surface. The spring
constant of each cantilever was determined using the thermal method (16). The integrity of a
bacterial probe was monitored before and after the onset of each ten adhesion force
measurements by comparing adhesion forces measured on a clean glass surface. Whenever
this adhesion force had a difference > 0.5 nN, data obtained last with that probe were
discarded and a new bacterial probe was made.
Expression of NsaRS under Mechanical and Chemical Stress
115
NsaS and NsaA gene expression
Total RNA from 3 and 6 h biofilms grown on SS and PE surfaces, was isolated using
RiboPureTM-Bacteria Kit (Ambion, Invitrogen) according to the manufacturer’s instructions.
Traces of genomic DNA were removed using DNAfreeTM kit (Ambion, Applied biosystems,
Foster City, CA) and absence of genomic DNA contamination was verified by real-time PCR
prior to cDNA synthesis. 200 ng of RNA was used for cDNA synthesis, 4 μl 5x iScript
Reaction Mix, 1 μl iScript Reverse Transcriptase, in a total volume of 20 μl (Iscript, Biorad,
Hercules, CA) according to manufacturer’s instructions. Real time RT-qPCR was performed
in triplicates in a 384-well plate HSP-3905 (Bio-RAD, Laboratories, Foster city, CA, USA)
with the primer sets for 16s, NsaS and NsaA (Table 1). The following thermal conditions
were used for all qPCR reactions: 95°C for 15 min and 40 cycles of 95°C for 15 s and 59°C for
20 s. The mRNA levels were quantified in relation to endogenous control gene 16s. NsaS and
NsaA expression levels in the biofilms were normalized to S. aureus SH1000 planktonic
culture.
TABLE 1 Primer sequences for qRT-PCR used in this study
Primer Sequence (5’- 3’) NsaS-forward GCAACATGGCATGCACCTC NsaS-reverse AGGTTATAATGGCCAGCGCC NsaA-forward TGCATGCCATGTTGCT NsaA-reverse TTCACCAGCTTCAACT 16s -forward TACGGGAGGCAGCAG 16s-reverse ATTACCGCGGCTGCTGG
Chapter 5
116
RESULTS AND DISCUSSION
Staphylococcal adhesion forces to SS and PE biomaterial surfaces
Figure 2. Adhesion forces of S. aureus strains on SS and PE measured by bacterial probe AFM. Each
bar represents an average of 90 adhesion force curves measured with 9 different bacterial probes taken
from three separately grown staphylococcal cultures. Error bars represent the standard errors of the
mean. *indicates significant differences (p < 0.05) in staphylococcal adhesion forces (two tailed, two-
sample equal variance Student’s t-test).
Adhesion forces were measured using bacterial probe atomic force microscopy (17) for the
wild-type S. aureus SH1000 and the ΔNsaS mutant strain. The wild-type strain SH1000 and
the ΔNsaS mutant showed similar adhesion forces on SS surfaces, but on PE surfaces
adhesion forces for the wild-type strain were significantly stronger than for the mutant strain
(Figure 2). Whereas the wild-type strain adhered more strongly to PE than to SS surfaces,
the mutant strain adhered strongest to SS surfaces. Such differences in adhesion forces can
arise from several environmental factors, including the physico-chemical properties of the SS
Expression of NsaRS under Mechanical and Chemical Stress
117
and PE surfaces or the bacterial surface properties. Bacteria experience in general stronger
adhesion forces on hydrophobic surfaces than on hydrophilic surfaces. (18) Thewes et al.
(2014) have shown that Staphylococcus carnosus adheres two times more strongly to
hydrophobic silicon wafers than to hydrophilic ones, suggesting that short-range, non-
specific hydrophobic interactions present between bacterial cell wall proteins and
substratum surfaces enhance the adhesion forces. Our results show a similar trend with
stronger adhesion forces of staphylococci to hydrophobic PE (water contact angle 85 ± 2
degrees) compared to hydrophilic SS (water contact angle 35 ± 3 degrees) for the wild-type
staphylococcal strain, but not for the mutant strain. This suggests a potential change in cell
surface hydrophobicity or charge upon deletion of the NsaS sensor from its membrane
position in the ΔNsaS mutant strain.
NsaS and NsaA gene expression under mechanical stress
NsaS and NsaA gene expressions of wild-type S. aureus SH1000 and the ΔNsaS mutant
strain upon mechanical stress, i.e. adhesion to SS and PE surfaces, were measured by
isolating total RNA from 3 h and 6 h biofilms grown on SS and PE surfaces, using
RiboPureTM-Bacteria Kit. In the wild-type strain, NsaS and NsaA expressions were always
trended higher for staphylococci in their adhering state than in their planktonic state
(compare Figs. 3a and 3b and Figs. 3c and 3d). However, no such consistent pattern in NsaS
and NsaA expressions were observed in the ΔNsaS mutant strain, probably due to the loss of
the intra-membrane NsaS sensor, implying the inability of the strain to perceive its adhering
state. Previously, it has been suggested that loss of intra-membrane NsaS impedes surface
sensing capacity of S. aureus, but not necessarily affects the expression of the downstream
drug transporter NsaA (8).
Surface sensing under mechanical stress occurs through deformation of the bacterial
cell wall and adhesion forces in the order of magnitude of 0.5 - 1 nN have been shown, using
surface fluorescence enhancement, to yield substantial cell wall deformation in staphylococci
(10). Whereas in S. aureus ATCC12600, expression of icaA and poly-N-acetylglucosamine
upon adhesion to different biomaterial surfaces decreased with increasing adhesion forces
(10), expressions of NsaS and NsaA genes do not necessarily increase with increasing
adhesion forces over the range of force values observed here, but mainly seem to respond to
the absence (planktonic state) or presence of adhesion forces (biofilm mode of growth).
Chapter 5
118
Figure 3. NsaS and NsaA expression in S. aureus in a planktonic state and under mechanical stress in
an early biofilm mode of growth. (a) Normalized NsaS gene expression in a planktonic state and after 3
h biofilm formation to SS and PE of the wild-type S. aureus SH1000 and the mutant SH1000ΔNsaS.(b)
Normalized NsaA gene expression in a planktonic state and after 3 h biofilm formation to SS and PE of
the wild-type S. aureus SH1000 and the mutant SH1000ΔNsaS (c) Normalized NsaS gene expression
in a planktonic state and after 6 h biofilm formation to SS and PE of the wild-type S. aureus SH1000
and the mutant SH1000ΔNsaS (d) Normalized NsaA gene expression in a planktonic state and after 6
h biofilm formation to SS and PE of the wild-type S. aureus SH1000 and the mutant SH1000ΔNsaS
The mRNA levels were quantified in relation to the endogenous control gene 16s with respect to wild-
type SH1000 cells in planktonic cultures. Each point represents an average ± standard error of the
mean over three individual experiments with separately grown staphylococcal cultures.
Expression of NsaRS under Mechanical and Chemical Stress
119
NsaS and NsaA gene expression under chemical and mechanical Stresses
Figure 4. NsaS and NsaA expression in S. aureus SH1000 in a planktonic state and under mechanical
and chemical stresses in an early biofilm mode of growth. (a) Normalized NsaS gene expression in a
planktonic state and in early, 3 h biofilms on SS and PE in the presence of nisin (2 µg/ml). (b)
Normalized NsaA gene expression in a planktonic state and in early, 3 h biofilms in the presence of
Chapter 5
120
nisin (2 µg/ml).The mRNA levels were quantified in relation to endogenous control gene 16s with
respect to wild-type SH1000 in planktonic cultures. Each point represents an average ± standard error
of the mean over three individual experiments with separately grown staphylococcal cultures.
In order to study the combination of a chemical and mechanical stress, NsaS and NsaA gene
expression in the presence of nisin was measured for planktonic S. aureus SH1000 and
staphylococci in a biofilm mode of growth. No experiments were done with the ΔNsaS
mutant strain because the mutant strain was killed upon exposure to nisin at the
concentration of 2 µg/ml applied, likely because 2 µg/ml is above the minimal inhibitory
concentration of S. aureus ΔNsaS (8). In planktonic S. aureus SH1000, expressions of both
NsaS (Figure 4a) and NsaA (Figure 4b) were significantly higher in presence of nisin than in
its absence. NsaS and NsaA gene expressions in presence of nisin were highest on PE, likely
due to the fact that PE exerted the strongest adhesion forces (6.2 ± 0.2 nN) on adhering S.
aureus SH1000. Gene expression in presence of nisin for staphylococci adhering to SS was
similar as in a planktonic state, but significantly different from that of SS because adhesion
forces on SS (3.5 ± 0.2 nN) are significantly weaker than on more hydrophobic PE.
In general, it can be concluded that NsaS and NsaA gene expressions by S. aureus
SH1000 are higher when the organism is mechanically stressed in an adhering state than
when in a planktonic one (see Figure 5), which we attribute to cell wall deformation under
the influence of the adhesion forces arising from a substratum surface. Furthermore,
chemical stress enhances NsaS and NsaA gene expression (see also Figure 5), and gene
expression clearly becomes largest, when the organisms experiences a strong mechanical
stress in combination with a chemical one. This confirms our hypothesis that the NsaRS
system can sense both chemical and mechanical stresses and therewith plays an important
role in biomaterial induced modulation of antiobiotic resistance via the NsaAB efflux pump.
Expression of NsaRS under Mechanical and Chemical Stress
121
Figure 5. Expression of NsaA versus NsaS in wild-type S. aureus SH1000 in a planktonic state and
after 3 h biofilm formation in the presence and absence of nisin. The solid lines represent the best fit to
a linear function (correlation coefficient r2 equals 0.683), while the dotted lines enclose the 95%
confidence interval.
Chapter 5
122
ACKNOWLEDGEMENTS
The authors are grateful to Dr. Lindsey N. Shaw, Department of Cell Biology, Microbiology
and Molecular Biology, University of South Florida, Tampa, FL, USA, for providing S. aureus
SH1000 and S. aureus SH1000ΔNsaS strains.
Expression of NsaRS under Mechanical and Chemical Stress
123
REFERENCES
1. Flemming H-C, Wingender J. 2010. The biofilm matrix. Nat. Rev. Microbiol. 8:623–633.
2. An YH, Friedman RJ. 1998. Concise review of mechanisms of bacterial adhesion to biomaterial surfaces. J. Biomed. Mater. Res. 43:338–348.
3. Nuryastuti T, Krom BP, Aman AT, Busscher HJ, Van der Mei HC. 2011. Ica-expression and gentamicin susceptibility of Staphylococcus epidermidis biofilm on orthopedic implant biomaterials. J. Biomed. Mater. Res. Part A. 96:365–371.
4. Ulrich LE, Koonin E V., Zhulin IB. 2005. One-component systems dominate signal transduction in prokaryotes. Trends Microbiol. 13:52–56.
5. Kawada-Matsuo M, Yoshida Y, Nakamura N, Komatsuzawa H. 2011. Role of two-component systems in the resistance of Staphylococcus aureus to antibacterial agents. Virulence 2:427–430.
6. Otto K, Silhavy TJ. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 99:2287–92.
7. Lejeune P. 2003. Contamination of abiotic surfaces: what a colonizing bacterium sees and how to blur it. Trends Microbiol. 11:179–184.
8. Kolar SL, Nagarajan V, Oszmiana A, Rivera FE, Miller HK, Davenport JE, Riordan JT, Potempa J, Barber DS, Koziel J, Elasri MO, Shaw LN. 2011. NsaRS is a cell-envelope-stress-sensing two-component system of Staphylococcus aureus. Microbiology 157:2206–2219.
9. Blake KL, Randall CP, O’Neill AJ. 2011. In vitro studies indicate a high resistance potential for the lantibiotic nisin in Staphylococcus aureus and define a genetic basis for nisin resistance. Antimicrob. Agents Chemother. 55:2362–2368.
10. Harapanahalli AK, Chen Y, Li J, Busscher HJ, Van der Mei HC. 2015. Influence of Adhesion Force on icaA and cidA Gene Expression and Production of Matrix Components in Staphylococcus aureus Biofilms. Appl. Environ. Microbiol. 81:3369–3378.
11. Harapanahalli AK, Younes JA, Allan E, Van der Mei HC, Busscher HJ. 2015. Chemical Signals and Mechanosensing in Bacterial Responses to Their Environment. PLoS Pathog. 11:e1005057.
12. Stoodley P, Jacobsen A, Dunsmore BC, Purevdorj B, Wilson S, Lappin-Scott HM, Costerton JW. 2001. The influence of fluid shear and AICI3 on the material properties of Pseudomonas aeruginosa PAO1 and Desulfovibrio sp. EX265 biofilms. Water Sci. Technol. 43:113–120.
13. Stoodley P, Cargo R, Rupp CJ, Wilson S, Klapper I. 2002. Biofilm material properties as related to shear-induced deformation and detachment phenomena. J. Ind. Microbiol. Biotechnol. 29:361–367.
Chapter 5
124
14. Ferreira RBR, Antunes LCM, Greenberg EP, McCarter LL. 2008. Vibrio parahaemolyticus ScrC modulates cyclic dimeric GMP regulation of gene expression relevant to growth on surfaces. J. Bacteriol. 190:851–860.
15. Beaussart A, El-Kirat-Chatel S. 2014. Quantifying the forces guiding microbial cell adhesion using single-cell force spectroscopy. Nat. Protoc. 9:1049–55.
16. Burnham NA, Chen X, Hodges CS, Matei GA, Thoreson EJ, Roberts CJ, Davies MC, Tendler SJB. 2002. Comparison of calibration methods for atomic-force microscopy cantilevers. Nanotechnology. 14:1–6.
17. Liu Y, Strauss J, Camesano T a. 2008. Adhesion forces between Staphylococcus epidermidis and surfaces bearing self-assembled monolayers in the presence of model proteins. Biomaterials 29:4374–4382.
18. Thewes N, Loskill P, Jung P, Peisker H, Bischoff M, Herrmann M, Jacobs K. 2014. Hydrophobic interaction governs unspecific adhesion of staphylococci: a single cell force spectroscopy study. Beilstein J. Nanotechnol. 5:1501–1512.
125
126
127
Chapter 6
General Discussion
General discussion
128
Bacterial communication with their environment takes place in two different systems: 1)
Quorum Sensing (QS) and 2) mechanosensing (1, 2). The mechanism of QS is described in
literature (1) for many bacteria, including Staphylococcus aureus. However, very little is
known about the mechanism of mechanosensing which contributes to sensing of the
environment when it is in contact with surfaces. Therefore, in this thesis we have studied the
adhesion of S. aureus to biomaterials in terms of 1) Physical characteristics to the bacterial
cell wall that contribute to surface sensing and 2) Gene specific responses of bacteria
adhering to different biomaterials. To study physical characteristics (adhesion forces and cell
wall deformation), we have used advanced state of the art techniques, like Atomic Force
Microscopy (AFM) and Surface Enhanced Fluorescence (SEF). Molecular changes at the
gene level due to external stress were studied using quantitative real time polymerase chain
reactions.
Cell wall deformation determined by atomic force microscopy and surface
enhanced fluorescence
In the field of microbiology, AFM is widely used to measure nanomechanical properties of
the living cell. Properties such as visco-elasticity, single protein functionality, cell wall
deformation and adhesion forces can be measured to understand nano-scale organization,
dynamics of cell membranes and cell walls (1-3). Adhesion forces and cell wall deformations
between the cell and the substratum can be quantified in the range of piconewtons (~ 10-12
N) and nanometers, respectively (3). In chapter 2 we have directly determined the cell wall
deformation by measuring the polar radii (height images) of two S. aureus strains and their
isogenic Δpbp4 mutants (strains with a softer cell wall) to demonstrate that, Δpbp4 mutants
are 40% more deformable than their parent strains. In chapter 4 we have measured adhesion
forces of the same wild-type and mutant strains on three different biomaterials (stainless
steel, poly-methyl methacrylate and polyethylene) and have shown that, adhesion forces are
substratum specific and stronger for the wild-type S. aureus than the Δpbp mutant strains.
Although, the wild-type S. aureus strains have more rigid and less deformable cell walls, we
can anticipate that differences in adhesion forces between the wild-type cells and the
biomaterials can induce, adhesion force dependent substratum specific deformation.
Adhesion forces and cell-wall deformations measured using AFM give considerable
understanding about cell–substratum interactions, but there are a few critical drawbacks
General Discussion
129
using AFM. Firstly, AFM requires an external load, which is required to image the cell
surface, which is used to calculate the cell wall deformation and its rigidity. Secondly,
bacteria are immobilized (using α-poly-L-lysine or dopamine) to the AFM cantilever or the
surface through chemical treatment (4). Application of an external load and chemical
treatment can potentially introduce artifacts during studying bacterial adhesion forces when
compared to the bacterial adhesion force to surfaces under natural conditions as in a flow
chamber. For instance, cell wall deformations obtained using AFM imaging for S. aureus
Δpbp4 mutants attached to α-poly-L-lysine coated surface, showed deformations between 49
– 82 nm (chapter 2) that were more or less similar than deformations measured by SEF (20
– 25 nm) (chapter 3). With SEF deformation of bacterial cell walls can be determined under
natural conditions and at a macroscopic level (3 x 108 cells cm-3), while the AFM can only be
applied to a single bacterial cell and requires many experiments in order to get similar
statistics as SEF. Therefore, application of new methods like SEF are a more appropriate and
accurate method to evaluate cell–substratum interactions than AFM.
SEF as applied in this thesis is a very reliable and powerful method to measure the
cell wall deformation. However, SEF also has a few drawbacks. Firstly, SEF (also known as
metal enhanced fluorescence) can only be applied on metal surfaces due to the nature of the
method. Secondly, we assumed that distribution of the fluorophores in the bacterial cell is
homogeneous. To validate this assumption, other microscopical methods, like the super-
resolution microscopy can be applied (5). With this method single molecule localization
within a spatial resolution of 1 nm can be determined. Therefore, in order to determine cell-
wall deformation SEF is the preferred technique but has the limitation that it can only be
used on metal surfaces, therefore the AFM method is a good alternative. Moreover, the best
way to overcome these limitations would be to apply both methods wherever possible to
compliment the findings of one another.
General discussion
130
Gene specific responses to biomaterials and mechanosensing in bacteria
Sensing environmental stresses is an important part of bacterial survival. For
mechanosensing, some bacteria have developed extracellular appendages like flagella, pili or
curli to respond to adhesion or physical stress (6). Interestingly, S. aureus does not possess
any extracellular appendages, yet it can respond to physical contact, suggesting that a
generalized surface sensing approach must exist for all microorganisms and cells to respond
to localized surface stresses upon adhesion. Eukaryotic cells have several points of contact
between the cell and the surface, these points of contact are called focal adhesion points,
which connect the extracellular membrane to the transmembrane linkers through an actin-
myosin networks (7). In Pseudomonas aeruginosa, transmembrane links are established
through MreB cytoskeleton, which has a similar function as the actin-myosin network and
also regulate the type IV pili of P. aeruginosa to sense adhesion forces to surfaces and
transmit regulatory signals for biofilm formation (8). The surface sensing of S. aureus
possibly takes places through adhesion force induced cell wall deformation. In chapter 4, we
show that cell wall deformation of S. aureus strains is due to adhesion forces caused by
different biomaterials. Although, this is not a direct quantification of the cell wall
deformation, we determined molecular changes that took place upon adhesion to three
different biomaterials, stainless steel, poly-methyl-methacrylate and polyethylene. Matrix
associated poly-N-acetylglucosamine and its corresponding icaA gene expression showed a
remarkable correlation with adhesion forces measured on the three surfaces, confirming the
effects of adhesion force induced cell wall deformation. Studies also show that icaA
expression in Staphylococcus epidermidis is substratum specific in presence of gentamicin
(9).
Bacterial cell wall deformation in its natural surface adhesive state can be quantified
using SEF. The molecular effects of nanoscale cell wall deformations can be linked to
adhesion forces arising from the substratum surfaces. Furthermore, investigating molecular
links between mechanosensitive channels and cell surface proteins can reveal more insights
into mechano-transduction, bacterial sensing of substratum surfaces and adaptability.
General Discussion
131
Future perspectives
Bacteria can sense and interact with the substratum and gain resistance. In this thesis, we
have shown that membrane proteins can detect and respond to adhesion forces experienced
by the cell wall to up-regulate antibacterial resistance. Mechanisms such as two-component
systems serve as key models in understanding surface sensing and regulation of antibacterial
resistance. However bacteria regulate antibacterial resistance through more than one
mechanism, and at an alarming rate. Infection causing strains detected in 2013 were
resistant to four classes of antibiotics, which were still effective treatments in 2009 (10).
Therefore, identifying alternative targets and mechanisms are very important in order to
keep pace with growing antibacterial resistance. Mechanosensitive channels are ideal
candidates for surface sensing and perhaps in regulating antibacterial resistance upon
surface adhesion via opening and closing of the channels. Therefore, it would be worthwhile
to investigate the impact of adhesion forces on channel opening and regulation of
antibacterial susceptibility in the wild-type strains and compare it with mutants lacking
mechanosensitive channels in biomaterial associated infections.
General discussion
132
REFERENCES
1. Miller MB, Bassler BL. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165–169.
2. Dorel C. 2010. Manipulating bacterial cell fate: key role of surface-sensing and signal transduction. Appl. Microbiol. Microb. Biotechnol. 791–800.
3. Heinisch JJ, Lipke PN, Beaussart A, Chatel SEK, Dupres V, Alsteens D, Dufrene YF. 2012. Atomic force microscopy - looking at mechanosensors on the cell surface. J. Cell Sci. 125:4189–4195.
4. Li J, Busscher HJ, Swartjes JJTM, Chen Y, Harapanahalli AK, Norde W, Van der Mei HC, Sjollema J. 2014. Residence-time dependent cell wall deformation of different Staphylococcus aureus strains on gold measured using surface-enhanced-fluorescence. Soft Matter 10:7638–7646.
5. Betzig E, Patterson GH, Sougrat R, Lindwasser OW, Olenych S, Bonifacino JS, Davidson MW, Lippincott-Schwartz J, Hess HF. 2006. Imaging intracellular fluorescent proteins at nanometer resolution. Science 313:1642–1645.
6. Jarrell KF, McBride MJ. 2008. The surprisingly diverse ways that prokaryotes move. Nat. Rev. Microbiol. 6:466–476.
7. Kumamoto CA. 2008. Molecular mechanisms of mechanosensing and their roles in fungal contact sensing. Nat. Rev. Microbiol. 6:667–673.
8. Cowles KN, Gitai Z. 2010. Surface association and the MreB cytoskeleton regulate pilus production, localization and function in Pseudomonas aeruginosa. Mol. Microbiol. 76:1411–1426.
9. Nuryastuti T, Krom BP, Aman AT, Busscher HJ, Van der Mei HC. 2011. Ica-expression and gentamicin susceptibility of Staphylococcus epidermidis biofilm on orthopedic implant biomaterials. J. Biomed. Mater. Res. Part A. 96:365–371.
10. Centers for disease control and prevention. (2013) http://www.cdc.gov/narms/pdf/2013-annual-report-narms-508c.pdf
Summary
133
Summary
Summary
134
Staphylococcus aureus is one of the major causative bacteria of implant associated
infections. Biomaterial associated infections start with the reversible adhesion of bacteria to
the implant surface, after which adhering bacteria embed themselves in a matrix of
extracellular polymeric substances (EPS) to yield a transition to irreversible adhesion and
biofilm growth commences. The EPS matrix protects biofilm inhabitants against biological,
mechanical and chemical stresses, such as the host immune response, fluid shear and
antibiotic treatment. All these phenomenal changes in S. aureus physiology occurs due to
adhesion and biofilm formation, therefore a sense of touch or mechanical sensitivity towards
surface adhesion is an important characteristic for adaptation and survival. However, very
less is understood about mechanical sensitivity of S. aureus during adhesion to a surface.
Chapter 1. gives an overview of the differences between two major sensory
strategies used by bacteria to sense the external environment, the chemical and
mechanosensing. Bacteria encounter different environmental conditions during the course
of their growth and have developed various mechanisms to sense their environment and
facilitate survival. Bacteria communicate with their environment through sensing of
chemical signals such as pH, ionic strength or sensing of biological molecules, such as
utilized in quorum sensing. However, bacteria do not solely respond to their environment by
means of chemical sensing, but also respond through physical-sensing mechanisms. For
instance, upon adhesion to a surface, bacteria may respond by excretion of EPS through a
mechanism called mechanosensing, allowing them to grow in their preferred, matrix
protected biofilm mode of growth. Therefore, the aim of this thesis was to evaluate the role of
adhesion forces in the response of bacteria to their adhering state. We have used a model
pathogen S. aureus, common in biomaterial associated infections and several of its isogenic
mutants and applied atomic force microscopy (AFM) and surface enhanced fluorescence
(SEF) to quantify adhesion forces and cell wall deformation, respectively. Bacterial response
was evaluated in terms of gene expression on different biomaterials commonly used in
orthopedic implants.
Bacterial adhesion to surfaces is mediated by a combination of different short- and
long-range forces. In Chapter 2, we present a new AFM based method to derive long-range
bacterial adhesion forces from the dependence of bacterial adhesion forces on the loading
force, as applied during the use of AFM. We have used two S. aureus strains, (S. aureus
ATCC12600 and S. aureus NCTC 8325-4) and their isogenic Δpbp4 mutants. The long-range
Summary
135
adhesion forces of wild-type S. aureus parent strains (0.5 and 0.8 nN) amounted to only one
third of these forces measured for their more deformable isogenic Δpbp4 mutants (2.7 and
1.6 nN) that were deficient in peptidoglycan cross-linking. The measured long-range
Lifshitz-Van der Waals adhesion forces matched those calculated from published Hamaker
constants, provided that a 40% ellipsoidal deformation of the bacterial cell wall was assumed
for the Δpbp4 mutants. Direct imaging of adhering staphylococci using the AFM peak force-
quantitative nanomechanical property mapping imaging mode confirmed a height reduction
due to deformation in the Δpbp4 mutants of 100 – 200 nm. Across naturally occurring
bacterial strains, long-range forces do not vary to the extent as observed here for the Δpbp4
mutants. Importantly however, extrapolating from the results of this study it can be
concluded that long-range bacterial adhesion forces are not only determined by the
composition and structure of the bacterial cell surface, but also by a hitherto neglected, small
deformation of the bacterial cell wall, facilitating an increase in contact area and therewith in
adhesion force.
Nanoscale cell wall deformation upon adhesion is difficult to measure, except
for Δpbp4 mutants, deficient in peptidoglycan cross-linking. Chapter 3 discusses a
more advanced technique to quantify cell wall deformation based on surface
enhanced fluorescence in staphylococci adhering on gold surfaces. Adhesion related
fluorescence enhancement depends on the distance of the bacteria from the surface
and the residence-time of the adhering bacteria. In this chapter, a model was
forwarded based on the adhesion related fluorescence enhancement of green-
fluorescent microspheres, through which the distance to the surface and cell wall
deformation of adhering bacteria can be calculated from their residence-time
dependent adhesion related fluorescence enhancement. The distances between
adhering bacteria and a surface, including compression of their EPS-layer, decreased
up to 60 min after adhesion, followed by cell wall deformation. Cell wall deformation
is independent on the integrity of the EPS-layer and proceeds fastest for a Δpbp4
strain.
Based on the results from chapter 2 and 3, it can be concluded that cell wall
deformation of both the parent and the Δpbp4 mutant strains occurred upon surface
adhesion. However, what these deformations mean to bacteria in terms of molecular
response in modulating their phenotypes from free floating to surface growing biofilms is
Summary
136
unknown. In Chapter 4, we have investigated the influence of staphylococcal adhesion
forces to different biomaterials on icaA (regulating production of EPS matrix components)
and cidA (associated with cell lysis and extracellular DNA release) gene expression in S.
aureus biofilms. Experiments were performed with S. aureus ATCC12600 and its isogenic
mutant S. aureus ATCC12600Δpbp4, deficient in peptidoglycan cross-linking. Deletion of
pbp4 was associated with greater cell-wall deformability, while it did not affect the
planktonic growth rate, biofilm formation, cell surface hydrophobicity or zeta potential of the
strains. The adhesion forces of S. aureus ATCC12600 were strongest on polyethylene (4.9 ±
0.5 nN), intermediate on polymethylmethacrylate (3.1 ± 0.7 nN) and the weakest on
stainless steel (1.3 ± 0.2 nN). The production of poly-N-acetylglucosamine, eDNA presence
and expression of icaA genes decreased with increasing adhesion forces. However, no
relation between adhesion forces and cidA expression was observed. The adhesion forces of
the isogenic mutant S. aureus ATCC12600Δpbp4 were much weaker than those of the parent
strain and did not show any correlation with the production of poly-N-acetylglucosamine,
eDNA presence, or expression of the icaA and cidA genes. This suggests that adhesion forces
modulate the production of matrix molecules poly-N-acetylglucosamine, eDNA presence and
icaA gene expression by inducing nanoscale cell wall deformation, with cross-linked
peptidoglycan layers playing a pivotal role in this adhesion force sensing.
Bacterial adhesion to biomaterial surfaces and associated susceptibility to
antimicrobials is an important threat faced by the medical community. Bacteria not only
form biofilms, but may also gain up to 1000 times more resistance to antibiotics when in a
biofilm than in a planktonic mode of growth. To reveal mechanisms that induce such strong
resistance, in Chapter 5, we investigated the regulation of one of the newly discovered two-
component system nisin-associated-sensitivity-response-regulator (NsaRS) and its
downstream drug transporter NsaAB in S. aureus cells, in presence of chemical stress and
mechanical stress. NsaRS is important for surface adhesion, biofilm formation and bacterial
resistance against chemical stresses in S. aureus. It consists of an intra-membrane located
sensor NasS and a cytoplasmatically located response regulator NsaR, which becomes
activated upon receiving phosphate groups from the NsaS sensor. The intra-membrane
location of the NsaS sensor leads us to hypothesize that the NsaRS system can sense not only
chemical but also mechanical stresses to modulate antibiotic resistance via the NsaAB efflux
pump. To verify this hypothesis, we compared expressions of the NsaS sensor and NsaA
efflux pump in S. aureus SH1000 in their adhering (“mechanical stress”) and planktonic
Summary
137
state, while the presence of nisin constitutes a chemical stress. NsaS and NsaA gene
expressions by S. aureus SH1000 were higher in a mechanically stressed, adhering state
than in a planktonic one. Chemical stress enhanced NsaS and NsaR gene expressions. Gene
expression became largest, when the organisms experienced a chemical stress in
combination with a strong mechanical stress, in the current study quantitated as the
adhesion force arising from a substratum surface measured using bacterial probe AFM. This
confirms our hypothesis that the NsaRS system can sense both chemical and mechanical
stresses.
In Chapter 6 we have discussed the differences in using AFM and SEM in
quantifying cell wall deformation. Furthermore, we discuss the molecular basis for surface
sensing in S. aureus in comparison with other bacteria and eukaryotic cells. Finally, from the
results obtained in this thesis, we suggested future studies on the role of mechanosensitive
channels in antimicrobial susceptibility.
138
139
Nederlandse Samenvatting
Nederlandse Samenvatting
140
Staphylococcus aureus is één van de belangrijkste bacteriën verantwoordelijk voor
implantaat gerelateerde infecties. Biomateriaal gerelateerde infecties beginnen met
reversibele hechting van bacteriën aan een implantaat, waarna de gehechte bacteriën
beginnen met de productie van een matrix van extracellulaire polymere substanties (EPS)
om over te gaan tot irreversibele hechting, gevolgd door biofilm groei. De EPS matrix
beschermd de bacteriën in een biofilm tegen biologische, mechanische en chemische stress,
zoals de immuun respons, vloeistof gerelateerde schuifkrachten en behandeling met
antibiotica. Al deze grootse veranderingen in S. aureus fysiologie vinden plaats vanwege
hechting en biofilm formatie, vandaar dat mechanische waarneming van oppervlakte
hechting een belangrijke eigenschap is voor aanpassing en overleving. Echter, er is slechts
weinig bekend over de mechanische sensitiviteit van S. aureus gedurende hechting aan
oppervlakken.
Hoofdstuk 1 geeft een overzicht van de verschillen tussen twee belangrijke
sensorische strategieën die bacteriën gebruiken om de omgeving waar te nemen, chemische
en mechanisch sensorische perceptie. Bacteriën worden aan verschillende
omgevingscondities blootgesteld tijdens hun groei en hebben verschillende mechanismes
ontwikkeld om hun omgeving waar te nemen en overleving te vergemakkelijken. Bacteriën
communiceren met hun omgeving door het waarnemen van chemische signalen zoals pH,
ionische sterkte of het waarnemen van biologische moleculen, zoals door quorum sensing.
Bacteriën reageren echter niet alleen op hun omgeving door chemische waarnemingen, maar
ook door fysieke waarnemingsmechanismen. Bij hechting aan een oppervlak bijvoorbeeld,
kunnen bacteriën reageren door de excretie van EPS door een mechanisme dat
mechanosensing wordt genoemd. Dit stelt ze in staat om te groeien in de door hun
geprefereerde matrix beschermde biofilm.
Vandaar dat het doel van dit proefschrift was om de rol van hechtingskrachten in de
respons van bacteriën op hechting te onderzoeken. We hebben S. aureus gebruikt als model
pathogeen dat veelvuldig voorkomt bij biomateriaal gerelateerde infecties en vervolgens deze
stam en een aantal isogene mutanten onderzocht met behulp van atomische kracht
microscopie (AFM) en oppervlakte versterkte fluorescentie (SEF), om de hechtingskrachten
en celwand vervorming te bepalen. De bacteriële respons werd geëvalueerd in termen van
gen expressie en getest op verschillende biomaterialen die veelvuldig gebruikt worden in
orthopedische implantaten.
Nederlandse Samenvatting
141
Bacteriële hechting op oppervlakken wordt beheerst door een combinatie van
verschillende korte- en langeafstandskrachten. In Hoofdstuk 2 presenteren we een nieuwe
methode gebaseerd op AFM om de bacteriële hechtingskrachten die over lange afstand
werken te bepalen, aan de hand van de toegepaste kracht tijden het gebruik van AFM. We
hebben twee S. aureus stammen (S. aureus ATCC12600 en S. aureus NCTC 8325-4) en hun
isogene Δpbp4 mutanten gebruikt. De lange afstand hechtingskrachten van de S. aureus
stammen (0.5 en 0.8 nN) waren slechts een derde van de krachten die gemeten werden voor
de meer vervormbare Δpbp4 mutanten (2.7 en 1.6 nN), die niet in staat zijn om
peptidoglycan te crosslinken. De gemeten Lifshitz-Van der Waals hechtingskrachten die over
lange afstand domineren, gaven de aanleiding om een 40% elliptische vervorming van de
bacteriële celwand aan te nemen voor de Δpbp4 mutanten. Directe metingen van hechtende
stafylokokken gemaakt met behulp van AFM in de PeakForce-QNM mode bevestigden een
hoogte reductie door vervorming in de Δpbp4 mutanten van 100 – 200 nm. Onder natuurlijk
voorkomende bacteriële stammen variëren de langeafstandskrachten niet in dezelfde mate
als hier is waargenomen voor de Δpbp4 mutanten. Door deze resultaten te extrapoleren
kunnen we echter concluderen dat de langeafstandskrachten in bacteriële hechting niet
alleen bepaald worden door de samenstelling en de structuur van het bacteriële cel
oppervlak, maar ook door tot nu toe genegeerde kleine vervormingen van de bacteriële
celwand, die het contactoppervlak vergroten en daarmee ook de hechtingskrachten.
Celwand vervorming op de nanoschaal die plaats vindt tijdens de hechting van
bacteriën is moeilijk te meten, behalve bij Δpbp4 mutanten die niet in staat zijn om
peptidoglycan te cross linken. Hoofdstuk 3 behandelt een meer geavanceerde techniek om
celwand vervorming te kwantificeren gebaseerd op oppervlakte versterkte fluorescentie in
stafylokokken hechtend op goud oppervlakken. Hechting gerelateerde versterking van
fluorescentie hangt af van de afstand van de bacteriën tot het oppervlak en de hechtingstijd.
In dit hoofdstuk wordt een model aangedragen gebaseerd op de hechting gerelateerde
versterking van fluorescentie van groen-fluorescente microspheres, waarmee de afstand tot
het oppervlak en de celwand vervorming van gehechte bacteriën berekend kan worden,
gebaseerd op hun hechtingstijd afhankelijke versterking van fluorescentie. De afstanden
tussen hechtende bacteriën en een oppervlak, inclusief compressie van de EPS-laag, daalde
tot 60 min na hechting, gevolgd door vervorming van de celwand. Vervorming van de
celwand is onafhankelijk van de integriteit van de EPS-laag en verloopt het snelst voor een
Δpbp4 stam.
Nederlandse Samenvatting
142
Gebaseerd op de resultaten van hoofdstuk 2 en 3 kan er geconcludeerd worden dat
de celwand vervorming van zowel de moeder stam als de Δpbp4 mutanten optreedt na
hechting aan een oppervlak. Echter, wat de vervorming betekent voor de bacteriën in termen
van moleculaire respons in het moduleren van het fenotype van vrij bewegend naar het
groeien in een biofilm is niet bekend. In Hoofdstuk 4 hebben we onderzocht wat de invloed
is van hechtingskrachten met verschillende biomaterialen op icaA (reguleert productie van
EPS matrix componenten) en cidA (geassocieerd met cel lyse en extracellulair DNA
productie) gen expressie in S. aureus biofilms. Experimenten werden uitgevoerd met S.
aureus ATCC12600 en zijn isogene mutant S. aureus ATCC12600Δpbp4, die niet in staat is
om peptidoglycan te crosslinken. Het verwijderen van pbp4 leidde tot meer vervorming van
de celwand, terwijl groei, biofilm formatie, hydrofobiciteit van het cel oppervlak en zeta
potentialen van de stammen onveranderd bleven. De hechtingskrachten van S. aureus
ATCC12600 waren het sterkst op polyethyleen (4.9 ± 0.5 nN), het zwakst op roestvrij staal
(1.3 ± 0.2 nN) en hechtingskrachten op polymethylmethacrylaat (3.1 ± 0.7 nN) lagen tussen
die waarden in. De productie van poly-N-acetylglucosamine, aanwezigheid van eDNA en
expressie van icaA genen daalde met toenemende hechtingskrachten. Er werd echter geen
relatie gevonden tussen hechtingskrachten en cidA expressie. De hechtingskrachten van de
isogene mutant S. aureus ATCC12600Δpbp4 waren veel zwakker dan die van de
moederstam en toonden geen correlatie met de productie van poly-N-acetylglucosamine,
aanwezigheid van eDNA of expressie van de icaA en cidA genen. Dit suggereert dat
hechtingskrachten de productie van matrix moleculen, poly-N-acetylglucosamine,
aanwezigheid van eDNA en icaA gen expressie moduleren door het induceren van
vervorming van de celwand, waarbij waarneming van de hechtingskrachten door
gecrosslinkte peptidoglycan lagen een grote rol speelt.
Hechting van bacteriën aan biomaterialen en de daarmee geassocieerde gevoeligheid
voor antibiotica is een belangrijke bedreiging voor de medische gemeenschap. Bacteriën
vormen niet alleen biofilms, maar ze worden ook tot 1000 keer meer resistent voor
antibiotica wanneer ze als biofilm groeien. Om het mechanisme dat deze sterke resistentie
veroorzaakt te onthullen, hebben we in Hoofdstuk 5 de regulatie van een recent ontdekt 2-
componenten systeem bestaande uit een met nisine geassocieerde gevoeligheidsrespons
regulator (NsaRS) en de bijbehorende transporter NsaAB in S. aureus onderzocht in de
aanwezigheid van chemische en mechanische stress. NsaRS is belangrijk voor hechting,
biofilm formatie en resistentie tegen chemische factoren in S. aureus. Het bestaat uit een in
Nederlandse Samenvatting
143
het membraam gelegen sensor NasS en een in het cytoplasma voorkomende respons
regulator NsaR, welke geactiveerd wordt wanneer het een fosfaat groep ontvangt van de
NsaS sensor. De aanwezigheid van de NsaS sensor in het membraam leidt tot onze
hypothese die stelt dat het NsaRS systeem niet alleen chemische, maar ook mechanische
stress kan waarnemen om zo de antibiotica resistentie via de NsaAB efflux pomp te
moduleren. Om deze hypothese te verifiëren vergeleken we de expressie van de NsaS sensor
en de NsaA efflux pomp in S. aureus SH1000 in de hechtende (“mechanische stress”) en de
planktonische toestand, terwijl de aanwezigheid van nisine werd gebruikt als chemische
stress. NsaS en NsaA expressie door S. aureus SH1000 was verhoogd onder mechanische
stress, in de gehechte toestand. Chemische stress verhoogde de gen expressie van NsaS en
NsaR ook. Gen expressie was het hoogst wanneer de bacteriën een combinatie van
chemische stress en een sterke mechanische stress ondergingen, in de huidige studie
gekwantificeerd als de hechtingskrachten die ontstaan door een substraat oppervlak en
gemeten met behulp van AFM. Dit bevestigd onze hypothese dat het NsaRS systeem zowel
chemische als mechanische stress kan waarnemen.
In Hoofdstuk 6 hebben we de verschillen besproken tussen het gebruik van AFM
en SEF in het kwantificeren van celwand vervorming. Daarnaast bespreken we ook de
moleculaire basis voor het waarnemen van oppervlakken in S. aureus in vergelijking met
andere bacteriën en eukaryote cellen. Tenslotte, met de resultaten van dit proefschrift,
bevelen we toekomstige studies aan om de rol van mechanische sensoren bij antibiotica
gevoeligheid te onderzoeken.
144
145
Acknowledgements
Acknowledgements
146
I feel really lucky and happy to have done my PhD in a diversified group like Biomedical
Engineering. In the last 4-5 years of my stay at BME, I also had the opportunity to meet
people from different countries, cultures and backgrounds which have broadened my
thinking and understanding of the world. Not only did I get to know you all, it was also very
interesting to discussed science. Some of them are engineers, chemists and life-science
scientists, there was always something interesting to learn from each other and do better as a
scientist. Now the time has come for me to say good bye to all of you. Although we will not
see eachother on a day-to-day basis, I believe we may cross into eachother someday. During
this fascinating journey, I have had help from many people in doing science and arranging
administrative things, without which completing my thesis was not possible. Therefore I
would like to convay my sincere thanks to you all and share my experiences with each of you.
Dear Henk and Henny, You both are like two strong and great pillers of the department
overseeing all the PhDs. I have always wondered, how you managed so many projects, wrote
grants, assisted PhDs and make successful collaborations across the world. I admire you for
this and have learned a lot. Also, I enjoyed the scientific independence to design and execute
projects duing my PhD and I appreciate your support in every aspect to bring these projects
to a conclusion. Thank you for sharing your expertise and enthusiasm for science and
constructive discussions in guiding me in the right direction.
Prof. Jan Maarten van Dijl, Prof. Jan Kok and Prof. Yves Durene, thank you for
agreeing to be the reading committee for my thesis and suggesting valuable inputs.
Bastiaan, thank you for recognizing my research skills and hiring me for the PhD position.
Although you moved to Amsterdam after few months I joined, you had already laid the
foundation required for my project, and your feedfack during the initial days was very
helpful and allowed me to settle down quickly and do the right things required for the
project.
Prashant, thank you for informing me about the vacancy at BME and forwarding my CV, I
will always remember your help which has given me the opportunity to achieve my goal.
Also, thank you for interesting discussions during the coffee breaks and for hosting all the
BBQ parties during summer. Also, Spoorthi and I really enjoyed the Biryani party during the
last New Year’s Eve. Thanks you for inviting.
Acknowledgements
147
Jelmer, our discussions regarding two different projects were very interesting. I am also
happy that, of those two projects one is accepted and published, in which I am a co-author.
Thank you for giving me the opportunity to collaborate.
Wya, Ina and Willy, Thank you all for all the help with respect to paper work, financial
matters and arranging important things when I joined the department
Ed the IT guru of BME, thank you for all the technical support and for arranging a wonderful
PC which never gave any problems in the last 5 years.
Yun, Juiyi, Deepak and Jessica, thank you all for you collaboration in my PhD.
Importantly, I believe each of us have unique expertise which has helped to solve bio-
physical aspects of Implant-infection relationships in this thesis. Katya and Moijtaba,
thank you for giving me the opportunity to contribute to your work and at the same time
broaden the understanding of bacterial interactions with its environment. It was great
knowing you all and working with.
Joop, Willy and Rene, It goes without saying that all you three were very helpful in
introducing me to AFM/ DNA lab/ IVIS. Thank you for always being there to help whenever
I ran into trouble during the experiments. Joop, thanks for organizing the virtual Word CUP
football competition, it was really fun and of course I was more happy when I won. Rene,
I appreciate your simplicity and willingness to help all PhD students, thank you for
desigining a wonderful cover page for my thesis. Also, discussions during the coffee breaks,
lunch breaks or in the corridor were always great. It was good to know you.
Present fellows of room number 1265 and former occupants of brain center Deepak,
Agnieszka, Otto, Gene, Meyul and Willem, it was great sharing office space with you all,
lot of fun and memories. Deepak and Agnieszka, thank you for being such a nice host, we
have had many parties and “n” number of dinners (never had Polish dinner though) at your
place. Otto, Gene and Willem, thank you for being a good company at office. Willem and
Deepak, special thanks to you both for being my support as paranimphs and for taking
responsibility of arranging important things on my defense.
Jan, Barbra, Phillip and Jessica, It was fun knowing you guys and thank you for inviting
me and Spoorthi to all the birthday parties and house warming parties, it was a nice way to
Acknowledgements
148
catch up outside work. Most of you are not at BME anymore or will finish very soon; I wish
you all the success in your careers and life.
I also would like to acknowledge all other colleagues Theo, Roel, Danialle, Arina, Stefan,
Steven, Vera, Helen, Anna, Song, Joana, Sara, Rebecca, Hilde, Edward, Brian,
Brandon, Katya, Rene, Adhi, Das, Marja, Mini, Marianne, Betsy, Chris, Niar,
Jelly, Gesinda and Victor, thank you for a pleasant and memorable time at BME.
Fortunately, I also have a lot of friends outside BME to balance my work and personal life.
My neighbours Rajender and Shilpa, you are almost like a family to us, never needed an
appointment to meet up and in numerable dinners, parties and vacations together. We truly
enjoyed your company and thank you for being there for us all the time. Shilpa, good luck
for your new job and I hope you both will find a balance between work and personal life.
Raja babu and Saisri, although you live far away from Groningen (in your village
Hoornsemeer) you made it to a point to visit us often for most of the get togethers. Thanks
for being there for us and for your kind help to drop us home after late night parties. Apart
from general stuff, I found that our discussions were intense and most of the time head on to
prove eachother wrong, but I think that’s a best way to debate facts. Saisri, when I met you
for the first time you were very shy and reserved, but after seeing you at Saritha’s party I
know you can burn the dance floor, very significant improvement after coming to Europe.
Good luck for your new job and I hope you both will find a balance between work and
personal life, because travelling is always tyring and time consuming.
Shiva and Ananya, Shiva you are the most funny and witty person I have ever met, your
presence itself makes me laugh. Thanks for all the fun during our parties and get togethers.
Good luck with your PostDoc in Norway. Hope to see you in Netherlands soon.
Gopi and Saritha, you both are good friends since long, but I never had a clue that you both
were together. I am happy for you both; your couple is unique in our friends circle because
you’re the first, and may the only doctor couple. My best wishes for your wedding and all the
best in life.
Kabir Hussain and Julian, we have known each other for not so long but you are very
friendly and helping, it was good to know you. Thank you for inviting us to visit your place at
Acknowledgements
149
Stadskanaal, we enjoyed the stay and the tasty food that Julian made. I wish you both and to
be born baby all the success and happiness in life.
Kiran and Shruthi, Ganesh and Subha, Vikram and Oksana, Eshwar and Mounika
Sridhar and Richa, It was very good to meet you all at some point of time in Groningen,
thank you all for making my stay in Groningen a memorable one. I am sure we will keep in
contact where ever we are and share our experiences in life.
Goutam, Pranav, Praneeth, Suresh Vijay, Khayum, Sai Krishna, Arun, Sodhan,
Chaitnaya, Shanti, Sunil and Smitha, Tushar, Jasmin, Neha, Pallavi, Amol,
Sneha, Abhishek, Veena, Arun Patil and Suchita, It was fun to enjoy Diwali, holi,
Bolluwood nights and GISA events with you all. I will always cherish those Groningen
moments. All the best in your future endeavors.
Meena aunty and Vinod uncle, you both are like guardian angels, always ready to help
and take care like a family, very kind and down to earth. I admire you both for your qualities
and values. Thank you for all the help Uncle and Aunty. Vinesh, Vinay and Nawina, it was
good to know you guys, enjoyed the movie nights and dinners we had to gether, success to
you all in your endeavors.
Bhaskar Reddy uncle, thank you for helping me during difficult times, it is because of you
I was able to pursue my Masters in The Netherlands. I wish you and you family all the
success and happiness.
Niveditha (Sister) and Kalyan bava (Brother-in-law), thank you so much for your
immense support and advice at the end of my PhD days. It is always fun to catch up with you
guys, we should meet more frequently. I will miss you both on my defense and party. Love
you both.
Sahitya / Sali, you’r my darling, fun loving and a lovely girl. Very happy to have you as my
Sali, but you should keep our secrets a secret and not tell them to your sister. Good luck
with your Masters in Belgium.
Janardhan Mamayya (Father-in-law) and Bramara attamma (Mother-in-law), your
support and encouragement has always helped me during my PhD. Thank you for your love
and care.
Acknowledgements
150
Amma (Mother) and Nana (Father), I do not know how to say thank you for all the things
you have done for me. It is because of your teachings and values imbibed in me; I have
reached this happy day in my life. Nana, thank you for all your efforts and hardships to
provide me with good education. This is the biggest asset that you can ever give me. I will
miss you on my defense. I wish you all the happiness in life.
Last but not the least; Dear wife Spoorthi, thank you for being my greatest support during
good and bad times; your words always filled confidence in me. I am very happy to have you
in my life.