updated: new high throughput sequencing technologies at the norwegian sequencing centre - and beyond
DESCRIPTION
Un update of the previous talk with the same title. A talk I gave at the Computational Life Science initiative (University of Oslo) about new High Throughput Sequencing instruments at the Norwegian Sequencing Centre. I also mentioned future upgrades, and the upcoming nanopore sequencing platform of Oxford nanopore.TRANSCRIPT
New High Throughput Sequencing technologies at the Norwegian Sequencing Centre
- and beyond
Lex Nederbragt, NSC and [email protected]
Norwegian Sequencing Centre
National technology core facility
Norwegian Sequencing Centre
Offering sequencing services
GS FLX from Roche/454 HiSeq 2000 from Illumina
1) New instruments:
Benchtop sequencers
High-throughput sequencing
Phase 1: more is better
2005 GS20 200 000 reads 100 bp0.02 Gb/run
2011 GS FLX+ 1.2 million reads 750 bp0.7 Gb/run
2006 GA 28 million reads 25 bp0.7 Gb/run
2011 HiSeq 2000 3 billion reads 2x100 bp600 Gb/run
High-throughput sequencing
Phase 2: smaller is better
GS Junior from Roche/454
MiSeq from Illumina
PGM from Ion Torrent/Life Technologies
0.04 GB/run400 bp reads
0.7 GB/run700 bp reads
2 GB/run2x150 bp reads
600 GB/run2x100 bp reads
0.01, 0.1 or 1 GB/run100 or 200 bp reads
High-throughput sequencing
Why benchtop sequencing instruments?
10 hours
27 hours
23 hours
10 days
3 hours
GS Junior from Roche/454
MiSeq from Illumina
PGM from Ion Torrent/Life Technologies
High-throughput sequencing
Why benchtop sequencing instruments?
Affordable price per instrument Small projects
Diagnostics
Fast turn around time
http://pennystockalerts.com/ http://www.highqualitylinkbuildingservice.com/http://www.vetlearn.com/ http://vanillajava.blogspot.com
High-throughput sequencing
Benchtop sequencing instruments at the NSC
✔
✔
✖✔
✔
Sequencing technology
Sequencing technology
Reversible dye terminator sequencing-by-synthesis
Reversible terminators
Metzker 2010 Nat Rev Genet.11(1):31-46
Sequencing technology
Pyrosequencing
PPi: pyrophosphate
Sequencing technology
Free proton current shift sequencing-by-synthesis
Error profiles
Substitution errors
ACGTAGCTGATTTTAGGCTTAGCTACGTAGCTGCTTTTAGGCTTAGCT
Homopolymer errors
ACGTAGCTGATTTTAGGCTTAGCTACGTAGCTGATTT-AGGCTTAGCT
Applications
Platform 454 Illumina HiSeq
Illumina MiSeq Ion Torrent
resequencing - +++ ++ +++de novo +++ + + ++
metagenomics +++ ++ + ++
mRNA ++ +++ ++ +
miRNA - +++ +++ -
ChIP - +++ ++ -
DNA meth - +++ + -
Announced upgrades
750 bp reads?
2x 250 bp reads8.5 Gbp
Proton from Ion Torrent
Fall 2012: 10 Gb on Proton I chip, 400 bp2013: 4 x more wells on Proton II chip
HiSeq 20002x150 bp?
HiSeq 2500Rapid run mode 27 hrs
2x150 bp, 90 Gbp
400 bp reads
Which instrument to choose?
Shameless self-promotion (1)
flxlexblog.wordpress.com
Shameless self-promotion (1)
@lexnederbragt
2) New instruments:
Pacific Biosciences RS
High-throughput sequencing
Phase 3: single-molecule
C2 (current) chemistry:Average read length 2500 bp36 000 reads90 MB per ‘run’
High-throughput sequencing
Technology
Zero-mode waveguide
High-throughput sequencing
Technology
High-throughput sequencing
Library preparation
High-throughput sequencing
Read length
High-throughput sequencing
Raw reads and subreads
‘Subreads’
High-throughput sequencing
Raw read quality
85-87% accuracyRandom errors (!)
4 to 5 passes: accuracies in the high 90's %5 passes yields average Q30 (1:1000 chance of error)
Applications
Platform 454 Illumina HiSeq
Illumina MiSeq* Ion Torrent PacBio
resequencing - +++ ++ - +de novo +++ + + +++ +++
metagenomics +++ ++ + +++ +/-
mRNA ++ +++ ++ ++ ++
miRNA - +++ +++ - -
ChIP - +++ ++ - -
DNA meth - +++ + - !!!
SNP validation + - - - ++
PacBio and base modifications
What use for PacBio?
http://www.walker.co.uk/What-Use-Is-a-Moose-9780744578393.aspx
PacBio: uses
Short reads high quality
SNP validationShort tandem repeats!
PacBio: uses
Long reads low quality
Uses?
85-87% accuracy
PacBio: uses
Can long PacBio reads overcome repeats
during de novo assembly?
http://nopsa.hiit.fi/pmg/viewer/photo.php?id=14134
PacBio: long read uses
For de novo
http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
For scaffolding
PacBio: long read uses
For de novo Error correct with short reads
http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
PacBio: long read uses
For de novo
http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
PacBio: long read uses
For de novo
Koren et al, 2012
PacBio: long read uses
For de novo
PacBio: long read uses
For de novo - alternatives
ALLPATHS_LG
Shameless self-promotion (2)
flxlexblog.wordpress.com
3) Preliminary results:
Pacific Biosciences RS
PacBio: first results
Samples
Atlantic cod Fish X
http://www.drawinghowtodraw.com/http://en.wikipedia.org
PacBio: first results
Libraries
4kb and 17b insert sizes
PacBio: first results
Raw reads
cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb
Fish X 17kb
0
5,000
10,000
15,000
20,000
25,000
30,000
ZMWs
cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb
Fish X 17kb
0500
1,0001,5002,0002,5003,0003,5004,000
Mean readlength
cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb Fish X 17kb0
5,000
10,000
15,000
20,000
25,000
Longest read
PacBio: first results
Length of longest subread for all raw reads
PacBio: first results
Length of longest subread for all raw reads
Fish XCod
PacBio: first results
Mapping to the cod genome
Long insert – single pass
Short insert – many passes
PacBio: first results
Mapping to the cod genome
Long insert – single pass
11.4 kbp subread
PacBio: first results
Mapping to the cod genome
Long insert – single pass
10.6 kbp subread
PacBio: first results
Mapping to the cod genome
Long insert – single pass
10.9 kbp subread
4) Beyond ‘second generation’ sequencing
High-throughput sequencing
Phase 1: more is better
Phase 2: smaller is better
Phase 3: single-molecule
Phase 4: the sky is the limit?
Nanopore sequencing
Oxford Nanopore
AGBT conference, February 2012
Oxford Nanopore
AGBT conference, February 2012
100 kbp readsCurrently at 4% error1% error at release
GridION2000 nanopores/nodetens of Gb data per 24 hourRun until…20 nodes 1 human genome in 15 minutes
Oxford Nanopore
AGBT conference, February 2012
MinION
512 nanopores 150mb/hour
Up to 6 hours$900
Nanopore sequencing
Seeing is believing
http://uwgcm.org
Nanopore sequencing
Democratization of sequencing