S

U

KB

a

ARRAA

KCFGAP

1

hpfoiWsvsa

(pIaPkodrm

i(

0d

Journal of Biotechnology 155 (2011) 173– 177

Contents lists available at ScienceDirect

Journal of Biotechnology

jou rn al hom epage: www.elsev ier .com/ locate / jb io tec

hort communication

tility of Aspergillus niger citrate synthase promoter for heterologous expression

ashyap Dave, Narayan S. Punekar ∗

iotechnology Group, Department of Bioscience and Bioengineering, Indian Institute of Technology Bombay, Mumbai 400076, India

r t i c l e i n f o

rticle history:eceived 21 December 2010eceived in revised form 2 June 2011ccepted 17 June 2011vailable online 23 June 2011

a b s t r a c t

Citrate synthase is a central player in the acidogenic metabolism of Aspergillus niger. The 5′ upstreamsequence (0.9 kb DNA) of citrate synthase gene (citA) from A. niger NCIM 565 was analyzed and its pro-moter function demonstrated through the heterologous expression of two proteins. The cloned citratesynthase promoter (PcitA) sequence was able to express bar coding sequence thereby conferring phos-phinothricin resistance. This sequence was further analyzed by systematic deletions to define an effective

eywords:itrate synthaseungal promoterene constructs

but compact functional promoter. The PcitA driven egfp expression showed that PcitA was active in alldifferentiation cell-stages of A. niger. EGFP expression was highest on non-repressible carbon sources likeacetate and glycerol. Mycelial EGFP levels increased during acidogenic growth suggesting that PcitA isfunctional throughout this cultivation. A. niger PcitA is the first Krebs cycle gene promoter used to expressheterologous proteins in filamentous fungi.

spergillus niger

rotein expression

. Introduction

Recent advances in genetic engineering tools (Meyer, 2008)ave brought filamentous fungi in spotlight as protein productionlatforms. Endowed with high secretion capacity, good yields andavorable media requirements, Aspergilli are much sought afterrganisms for use (Lubertozzi and Keasling, 2009). Aspergillus nigers an industrially important citric acid producer (Papagianni, 2007).

ell-tested fermentation processes and ‘generally regarded as safe’tatus make it an attractive protein production host. Developingarious components namely promoters, markers, reporters and auitable host background (Fleissner and Dersch, 2010) thereforessume importance.

Few strong filamentous fungal promoters like PglaA are availableNagaraj et al., 2009; Fleissner and Dersch, 2010). Krebs cycle generomoters are noticeable by their absence in expression strategies.

n this context, we chose A. niger citrate synthase promoter (PcitA)nd evaluated its potential for heterologous expression. A. nigercitA was selected based on the following: (a) citrate synthase is aey enzyme for citrate formation, (b) its activity is found through-ut the acidogenic growth of A. niger and hence PcitA is expected toisplay strong and constitutive expression, and (c) analysis of PcitAegulation is of broader interest in understanding fungal carbonetabolism.The promoter region of A. niger citA was cloned and character-

zed. Its function was evaluated by expressing a selection markerbar) and a reporter (egfp).

∗ Corresponding author. Tel.: +91 022 2576 7775; fax: +91 022 2572 3480.E-mail address: nsp@iitb.ac.in (N.S. Punekar).

168-1656/$ – see front matter © 2011 Elsevier B.V. All rights reserved.oi:10.1016/j.jbiotec.2011.06.012

© 2011 Elsevier B.V. All rights reserved.

2. Methods

2.1. Strains, media and culture conditions

A. niger strain NCIM 565 (National Collection of IndustrialMicroorganisms, NCL-Pune, India) was used in this study. Thebar maker from plasmid pCB1265 (Ahuja and Punekar, 2008) wasemployed to select A. niger transformants. The A. niger NCIM 565strain was grown either on potato dextrose agar or on minimalmedium (NM) agar (Ahuja and Punekar, 2008). Shake flask cul-tivation was carried out in citric acid producing medium (CPM)(Punekar et al., 1984). For selection of bar transformants, sterileyeast dextrose agar (YDA) medium was supplemented with 5 mMdl-phosphinothricin (PPT).

2.2. Construction of PcitA expression vectors

The citA promoter region (867 bp sequence upstream to ATG)was PCR amplified using primers CitHF2 and CitPR1 (Table 1). Thisfragment was used to construct expression vectors pCBPFln (Fig. 1a)and pCB�XCE (Fig. 1b). pCB�XCE was designed for bar selectionwhile P�XcitA activity monitored through egfp expression.

2.3. Aspergillus niger transformation

A. niger NCIM 565 mycelia grown in liquid NM (shake flasks for16 h) were harvested on cheese cloth. Lysing enzyme (Sigma, L-

1412; at 10 mg ml−1) was used (at 37 ◦C and up to 4 h) to releaseprotoplasts from the mycelia. Transformation, selection of trans-formants and Southern analysis were performed as before (Ahujaand Punekar, 2008). Representative transformants were selected

174 K. Dave, N.S. Punekar / Journal of Biot

Table 1List of primers used.

Primers Sequence

CitHF2 gggaagcttgtgaccatgcaaatcagcCitPR1 ggtctgcagtctcaaggtggaagcDHCitF1 cacaagctttacggatgagacggcDHCitF2 ggcaagcttgagactagtgtgaccDHCitF3 cataagcttggaacaccgtgcggc

fd

3

ttRpst

3

5cAe–1pNwsim

w5gpm

Fa

BarXbR1 gctctagaaatctaaatctcggtgacggnspt3 aattaaccctcactaaaggg

or further analysis, based on their healthy growth and good coni-iation.

. Results and discussion

Citrate synthase sequences from several fungi are known. Prioro the publication of its genome (Pel et al., 2007), citA gene fromwo different A. niger strains was studied (Kirimura et al., 1999;uijter et al., 2000). However their focus was on increasing citrateroduction and not the citA promoter. This is the first report demon-trating the promoter function of PcitA through the expression ofwo proteins namely, PPT-acetyltransferase and EGFP in A. niger.

.1. PcitA is able to drive bar expression in A. niger

The putative promoter region of citA gene from A. niger NCIM65 (PcitA; 0.9 kb sequence upstream to ATG) was PCR amplified,loned and sequenced on both strands. This sequence (GenBankcc. No. HQ418220) was compared (ClustalW analysis) with rel-vant sequences available from four different A. niger strains

ATCC 9029 (Ruijter et al., 2000), WU-2223L (Kirimura et al.,999), ATCC 1015 (chr 1 1:1569453-1571577, http://genome.jgi-sf.org/Aspni5/Aspni5.home.html) and CBS 513.88 (GenBank Acc.o AM270988.1). While the sequence showed excellent identityith the three reported sequences, it differed maximally from the

equence of WU-2223L strain. Other putative citA-like sequencesn the A. niger genome (Pel et al., 2007) with much lower identities

ay correspond to genes like methylcitrate synthase.The ability of 0.9 kb PcitA sequence to function as a promoter

as evaluated through expression of bar CDS in A. niger NCIM

65. The PcitA-bar gene construct (linearized pCBFln) upon inte-ration gave rise to PPT-resistant transformants (Fig. 2c). Resistanthenotype is indicative that PcitA sequence functions as a pro-oter. Also, the promoter activity of PcitA was directional with the

ig. 1. PcitA plasmid constructs to drive the expression of bar and egfp CDS. (a) The bar Clong with Tgla (A. awamori glucoamylase terminator) (Vanden Wymelenberg et al., 1997

echnology 155 (2011) 173– 177

construct−−−→PcitA-bar (forward orientation of PcitA sequence, pFCBP)

alone being effective (Table S1).Efficient but compact promoters are desirable in the con-

struction of expression cassettes. Four deletion constructs weredesigned (Fig. 2a) to further delimit the optimal promoter lengthof the PcitA sequence. All four bar expression cassettes were ableto impart PPT-resistance to their respective transformants. Theywere characterized for corresponding PcitA-bar DNA integrationsthrough diagnostic genomic PCR’s (Fig. 2b) and Southern analysis(not shown). Reporters like �-glucuronidase (Hisada et al., 2006)and �-galactosidase (Punt et al., 1990) are normally employed inpromoter deletion analysis. The present work however made useof bar selection marker for this purpose. Although single copy inte-grants were available for all five PcitA cassettes, they are expectedto be random integrations. Further promoter strength comparisonis feasible only with single copy integrations at a predefined locus(Nayak et al., 2006).

Ability of the short 121 bp A. niger PcitA fragment (PcitAF3) toexpress bar CDS was interesting (Fig. 2). The 5′ upstream sequencesof enoA (224 bp) (Toda et al., 2001), sodM (200 bp) (Hisada et al.,2006) and crp (188 bp) (Kwon et al., 2009) are some of the short-est DNA fragments with demonstrated promoter activity. PcitAF3is thus the shortest DNA sequence with demonstrated fungalpromoter activity to date; only two CT-rich nucleotide stretches(beginning at −84 and −37 positions) occur in this fragment. CT-rich nucleotide stretches are an important feature of constitutivefungal promoters (Hamer and Timberlake, 1987; Punt et al., 1990;Chen and Roxby, 1997). A long CT box also occurs (at −105 to −43)in citA of Aspergillus nidulans (Min et al., 2010).

Three short conserved stretches (ClustalW analysis; Fig. 3) werefound by comparing PcitA sequences (1.0 kb upstream to ATG)from different Aspergilli (Jones, 2007). These conserved elements,located between −187 and −136 from ATG (A as +1) of A. niger citAgene, suggest a possible common cis regulatory feature of PcitA.

3.2. Evaluation of P�XcitA function through EGFP expression

P�XcitA was chosen to express EGFP in A. niger since it wascompact (with 0.5 kb of PcitA sequence) and provided best trans-formation efficiency (2.5 per �g DNA; Table S1). The P�XcitA-egfpexpression cassette was used to transform A. niger and PPT resis-tant transformants were selected as before. Colony fluorescence

(long UV, 365 nm) due to expressed EGFP served as a secondaryscreen. Out of 33 bar transformants 24 were fluorescent; both sin-gle and multi copy integrants were detected. A single copy integrant(C6JT2, confirmed by genomic PCR and Southern analysis) showed

DS was cloned in frame with PcitA in pBS KS (pCBPFln). (b) P�XcitA and egfp cDNA), were cloned in frame in pCB1265 to obtain pCB�XCE.

K. Dave, N.S. Punekar / Journal of Biotechnology 155 (2011) 173– 177 175

Fig. 2. Characterization of various PcitA deletion transformants. (a) Schematic of PcitA-bar constructs showing various PcitA deletions. To constructs pDHCBPF1, pDHCBPF2and pDHCBPF3 through PCR, the primer CitPR1 was paired respectively with DHCitF1, DHCitF2 and DHCitF3 (Table 1). In the fourth construct (p�XCBP) XhoI fragmentwas deleted from pCBPFln. (b) Genomic PCR of different PcitA-bar transformants. Five forward primers (CitHF2, DHCitF1, nspt3, DHCitF2, DHCitF3) were used individuallywith BarXbR1 (reverse primer). PCR with pCBPFln DNA served as control (Lane 1). PCR products from genomic DNAs of A. niger NCIM 565 (Lane 2) and of transformantscorresponding to gene constructs PcitAFln-bar (Lane 3), PcitAF1-bar (Lane 4), P�XcitA-bar (Lane 5), PcitAF2-bar (Lane 6), PcitAF3-bar (Lane 7) are shown. Lane 8 contains1 kb DNA ladder. (c) Transformants (after four passages on bar selection plates) resulting from gene constructs namely – PcitAFln-bar, PcitAF1-bar, P�XcitA-bar, PcitAF2-bar,PcitAF3-bar – are shown. A. niger NCIM 565 (B) and a single copy bar transformant (A) characterized earlier were controls.

tive p

bpadg

Fa

Fig. 3. Three conserved stretches found in the puta

right EGFP fluorescence throughout its mycelia, conidiophores,

rimary and secondary sterigmata and conidia (Fig. 4). This gener-lized EGFP expression suggests that citA promoter is active in allifferentiated cells and stages of A. niger life cycle. However, whenfp CDS was fused in-frame with citA mitochondrial targeting sig-

ig. 4. Fluorescence and bright field images of A. niger (C6JT2 strain) mycelia. Mycelial EG fluorescence microscope (Nikon ECLIPSE TE2000-U) with 40× objective. Images (scale b

romoter regions of citA gene from seven Aspergilli.

nal, the expressed protein was preferentially localized to A. nidulans

mitochondria (Murray and Hynes, 2010; Min et al., 2010).

The transformant C6JT2 was used to evaluate P�XcitA functionthrough EGFP expression. Growth of strain C6JT2 and the parentA. niger NCIM 565 was comparable on different carbon and nitro-

FP fluorescence was captured with FITC filter (a) and the bright field image (b) onar, 10 �m) were captured using CoolSNAP-Pro camera (and ImageJ software).

176 K. Dave, N.S. Punekar / Journal of Biot

Table 2EGFP expression in A. niger (C6JT2 strain) grown on various carbon sources.

Carbon sourcea RFU mg−1 of proteinb pH at the time of harvest

Glucose 5000 3.1Starch + glucose 3500 2.3Sucrose 7000 3.3Molasses (cane) 1750 4.3Acetate 68,800 6.3Glycerol 15,700 5.5

a All carbon sources in NM were used at 1% (w/v) except with starch + glucose(both at 1% each). The initial pH of the medium was adjusted to 5.5. Cells wereharvested after 24 h of growth; but for acetate and glycerol this was after 48 h.

b A. niger mycelia were extracted (Noor and Punekar, 2005) with EGFPextraction buffer (100 mM Tris–Cl pH 8.0, 50 mM MgCl2, 25% glycerol, 1.0 mM 2-mercaptoethanol). The buffer also included 1.0 mM PMSF (phenylmethylsulfonylfluoride), TLCK (N�-Tosyl-l-lysine choloromethyl ketone; 1.0 �g ml−1) and TPCK(N-p-Tosyl-l-phenylalanine chloromethyl ketone; 0.5 �g ml−1). EGFP fluorescencemeasurements (excitation at 488 nm and emission at 510 nm; Shimadzu, RF-530PC series, with version 2.04 of fluorescence spectroscopy software) were made in20 mM HEPES buffer at pH 8.0. EGFP concentrations were calculated in relativeflsw

gooEgelgAeecleofpor

aA

Foerc(

uorescence intensity unit (RFU) per mg of total protein. Fluorescence data repre-entative of three independent experiments and the variation between duplicatesas less than 10%. No EGFP fluorescence was detected in parent, A. niger NCIM 565.

en sources. Both grew very poorly on starch and grew slowlyn glycerol and acetate. No growth was observed when ethanolr glutamate was the sole carbon source. In terms of mycelialGFP levels, P�XcitA was functional on all the carbon and nitro-en sources that supported growth of strain C6JT2. Specific EGFPxpression was generally higher on non-repressing carbon sourcesike acetate or glycerol (Table 2). High EGFP levels on acetate (versuslucose) suggest that PcitA may be subject to glucose repression in. niger. Starvation/stress induction of P�XcitA could also possiblyxplain this effect with medium pH being another relevant param-ter. These however need further study. Two very recent reports onitA transcription implicate a role for glucose repression in A. nidu-ans (Murray and Hynes, 2010; Min et al., 2010). Comparable EGFPxpression (in the range of 4500–11,000 RFU mg−1 of protein) wasbserved when C6JT2 strain was grown on NM but containing dif-erent nitrogen sources (NH4NO3, arginine, glutamine, ornithine,roline and glutamate; all at equimolar N corresponding to 28 mMf NH4NO3). The final pH of the medium with different N-sources

anged between 3.1 and 5.5.

EGFP expression in C6JT2 strain provided a convenient handle toddress PcitA function and regulation during acidogenic growth of. niger. Growth of strain C6JT2 and A. niger NCIM 565 was com-

ig. 5. EGFP expression and citrate formation in the A. niger strain C6JT2 grownn normal and citric acid production media. Fluorescence was measured in crudextracts of mycelia grown on NM (�) and CPM (©). Specific RFUs shown are rep-esentative of three independent experiments. Citrate lyase was used to measureitrate (Petrarulo et al., 1995) in the spent medium after growth on NM (�) and CPM�); data is representative of triplicates from two independent experiments.

echnology 155 (2011) 173– 177

parable both on NM and on CPM. EGFP levels (in RFU mg−1 ofprotein) declined with time and this correlated well with the initi-ation of conidiation on NM. EGFP was found in C6JT2 mycelia whencultivated on CPM and its levels increased with time (Fig. 5). Contin-ued presence of citrate synthase enzyme activity during acidogenicgrowth is already described (Kubicek and Rohr, 1980). Functioningof P�XcitA throughout acidogenic growth is suggested by the levelsof EGFP found in C6JT2 strain. Performance of PcitA during growthon CPM forms an additional yet valuable indicator.

In summary, we have cloned and functionally characterized thepromoter region of citrate synthase gene from A. niger NCIM 565.PcitA is thereby added to the repertoire of fungal promoters. This isthe first report of a Krebs cycle gene promoter expressing heterolo-gous proteins in filamentous fungi. In principle, it may be exploitedboth in normal and in acidogenic growth conditions.

Acknowledgements

Bayer Crop-Science is gratefully acknowledged for providingglufosinate ammonium (PPT). This research was funded by theNew Millennium Indian Technology Leadership Initiative of Coun-cil of Scientific and Industrial Research (NMITLI-CSIR), India andforms a part of Indian Patent application (No. 2542/MUM/2009).Kashyap Dave was supported by a University Grants Commission(UGC) research fellowship.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.jbiotec.2011.06.012.

References

Ahuja, M., Punekar, N.S., 2008. Phosphinothricin resistance in Aspergillus niger and itsutility as a selectable transformation marker. Fungal Genet. Biol. 45, 1103–1110.

Chen, Y., Roxby, R., 1997. Identification of a functional CT-element in the Phytoph-thora infestans piypt1 gene promoter. Gene 198, 159–164.

Fleissner, A., Dersch, P., 2010. Expression and export: recombinant protein produc-tion systems for Aspergillus. Appl. Microbiol. Biotechnol. 87, 1255–1270.

Hamer, J.E., Timberlake, W.E., 1987. Functional organization of the Aspergillus nidu-lans trpC promoter. Mol. Cell. Biol. 7, 2352–2359.

Hisada, H., Sano, M., Ishida, H., Hata, Y., Abe, Y., Machida, M., 2006. Deletion analy-sis of the superoxide dismutase (sodM) promoter from Aspergillus oryzae. Appl.Microbiol. Biotechnol. 72, 1048–1053.

Jones, M.G., 2007. The first filamentous fungal genome sequences: Aspergillus leadsthe way for essential everyday resources or dusty museum specimens? Micro-biology 153, 1–6.

Kirimura, K., Yoda, M., Ko, I., Oshida, Y., Miyake, K., Usami, S., 1999. Cloning andsequencing of the chromosomal DNA and cDNA encoding the mitochondrialcitrate synthase of Aspergillus niger WU-2223L. J. Biosci. Bioeng. 88, 237–243.

Kubicek, C.P., Rohr, M., 1980. Regulation of citrate synthase from the citric acid-accumulating fungus, Aspergillus niger. Biochim. Biophys. Acta 615, 449–457.

Kwon, B.R., Kim, M.J., Park, J.A., Chung, H.J., Kim, J.M., Park, S.M., Yun, S.H., Yang,M.S., Kim, D.H., 2009. Assessment of the core cryparin promoter from Cryphonec-tria parasitica for heterologous expression in filamentous fungi. Appl. Microbiol.Biotechnol. 83, 339–348.

Lubertozzi, D., Keasling, J.D., 2009. Developing Aspergillus as a host for heterologousexpression. Biotechnol. Adv. 27, 53–75.

Meyer, V., 2008. Genetic engineering of filamentous fungi-progress, obstacles andfuture trends. Biotechnol. Adv. 26, 177–185.

Min, I.S., Bang, J.Y., Seo, S.W., Lee, C.H., Maeng, P.J., 2010. Differential expression ofcitA gene encoding the mitochondrial citrate synthase of Aspergillus nidulans inresponse to developmental status and carbon sources. J. Microbiol. 48, 188–198.

Murray, S.L., Hynes, M.J., 2010. Metabolic and developmental effects resulting fromdeletion of the citA gene encoding citrate synthase in Aspergillus nidulans.Eukaryot. Cell 9, 656–666.

Nagaraj, G., Dave, K., Sastry, K.N., Punekar, N.S., 2009. Yeasts and filamentous fungi ashosts for recombinant protein production. In: Ravishankar, R.V., Bhat, R. (Eds.),Biotechnology: Concepts and Applications. Narosa Publishing House, New Delhi,pp. 183–221.

Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J.,

Osmani, S.A., Oakley, B.R., 2006. A versatile and efficient gene-targeting systemfor Aspergillus nidulans. Genetics 172, 1557–1566.

Noor, S., Punekar, N.S., 2005. Allosteric NADP-glutamate dehydrogenase fromaspergilli: purification, characterization and implications for metabolic regu-lation at the carbon–nitrogen interface. Microbiology 151, 1409–1419.

f Biot

P

P

P

P

P

K. Dave, N.S. Punekar / Journal o

apagianni, M., 2007. Advances in citric acid fermentation by Aspergillus niger:biochemical aspects, membrane transport and modeling. Biotechnol. Adv. 25,244–263.

el, H.J., et al., 2007. Genome sequencing and analysis of the versatile cell factoryAspergillus niger CBS 513.88. Nat. Biotechnol. 25, 221–231.

etrarulo, M., Facchini, P., Cerelli, E., Marangella, M., Linari, F., 1995. Citratein urine determined with a new citrate lyase method. Clin. Chem. 41,

1518–1521.

unekar, N.S., Vaidyanathan, C.S., Appaji Rao, N., 1984. Mechanisms of citric acidfermentation by Aspergillus niger. J. Sci. Ind. Res. 43, 398–404.

unt, P.J., Dingemanse, M.A., Kuyvenhoven, A., Soede, R.D., Pouwels, P.H., vanden Hondel, C.A., 1990. Functional elements in the promoter region of the

echnology 155 (2011) 173– 177 177

Aspergillus nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydro-genase. Gene 93, 101–109.

Ruijter, G.J., Panneman, H., Xu, D., Visser, J., 2000. Properties of Aspergillus nigercitrate synthase and effects of citA overexpression on citric acid production.FEMS Microbiol. Lett. 184, 35–40.

Toda, T., Sano, M., Honda, M., Rimoldi, O.J., Yang, Y., Yamamoto, M., Takase, K.,Hirozumi, K., Kitamoto, K., Minetoki, T., Gomi, K., Machida, M., 2001. Dele-

tion analysis of the enolase gene (enoA) promoter from the filamentous fungusAspegillus oryzae. Curr. Genet. 40, 260–267.

Vanden Wymelenberg, A.J., Cullen, D., Spear, R.N., Schoenike, B., Andrews, J.H., 1997.Expression of green fluorescent protein in Aureobasidium pullulans and quantifi-cation of the fungus on leaf surfaces. Biotechniques 23, 686–690.