UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

UvA-DARE (Digital Academic Repository)

Genetic engineering of flavonoid biosynthesis in tomato

Schijlen, E.G.W.M.

Publication date2007Document VersionFinal published version

Link to publication

Citation for published version (APA):Schijlen, E. G. W. M. (2007). Genetic engineering of flavonoid biosynthesis in tomato.

General rightsIt is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s)and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an opencontent license (like Creative Commons).

Disclaimer/Complaints regulationsIf you believe that digital publication of certain material infringes any of your rights or (privacy) interests, pleaselet the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the materialinaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letterto: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. Youwill be contacted as soon as possible.

Download date:21 Aug 2021

Genetic engineering of flavonoid biosynthesis in tomato

Elio Schijlen

Genetic engineering offlavonoid biosynthesis in tomato

ACADEMISCH PROEFSCHRIFT

Ter verkrijging van de graad van doctoraan de Universiteit van Amsterdamop gezag van de Rector Magnificus

prof. mr. P.F. van der Heijdenten overstaan van een door het college voor promoties ingestelde

commissie, in het openbaar te verdedigen in de Aula der Universiteit op donderdag 8 februari 2007 te 10.00 uur

door

Elias Gerardus Wilhelmus Maria Schijlen

Geboren te Maastricht

Promotiecommissie

Promotor prof. dr.A.J. van Tunen

Co-promotor dr.A.G. Bovy

Overige leden prof. dr. M.A. Haring

prof. dr. B.J.C. Cornelissen

dr. M.Verhoeyen

dr. F. Quattrocchio

prof. dr. R.J. Bino

prof. dr.A. Schram

Faculteit der Natuurwetenschappen,Wiskunde en Informatica

The research described in this thesis was carried out in the business unit

Bioscience of Plant Research International,Wageningen UR,The Netherlands.

Printing of this thesis was financially supported by

- J.E. Jurriaanse Stichting

- ENZA zaden B.V.

- Plant Research International

Contents

Chapter 1 General Introduction 7

Modification of flavonoid biosynthesis in crop plants

Chapter 2 Inhibition of tomato flavonoid biosynthesis results in 33

parthenocarpic fruits

Chapter 3 Transcriptional regulation of flavonoid biosynthetic genes 53

by Rosea and Delila in anthocyanin producing tomato fruits

Chapter 4 Pathway engineering for healthy phytochemicals leading to 75

the production of novel flavonoids in tomato fruit

Chapter 5 Consumption of genetically modified flavonoid-rich tomato 95

reduces human CRP and other markers of cardiovascular

risk in human CRP transgenic mice

Chapter 6 Summarizing discussion 111

References 121

Appendices 141

Samenvatting

Dankwoord

Curriculum Vitae

List of publications

Colour figures

7

8

Chapter 1

Modification of flavonoid biosynthesis

in crop plants

Elio G W M Schijlen, C H Ric de Vos,Arjen J van Tunen, and Arnaud G Bovy.

Phytochemistry 65, 2631-2648 (2004)

9

Cha

pter

1

Abstract

Flavonoids comprise the most common group of polyphenolic plant secondary metabolites.

In plants, flavonoids play an important role in biological processes. Beside their function as

pigments in flowers and fruits, to attract pollinators and seed dispersers, flavonoids are involved

in UV-scavenging, fertility and disease resistance.

Since they are present in a wide range of fruits and vegetables, flavonoids form an integral part

of the human diet. Currently there is broad interest in the effects of dietary polyphenols on

human health. In addition to the potent antioxidant activity of many of these compounds in vitro,

an inverse correlation between the intake of certain polyphenols and the risk of cardiovascular

disease, cancer and other age related diseases has been observed in epidemiological studies.The

potential nutritional effects of these molecules make them an attractive target for genetic

engineering strategies aimed at producing plants with increased nutritional value.

This review describes the current knowledge of the molecular regulation of the flavonoid

pathway and the state of the art with respect to metabolic engineering of this pathway in crop

plants.

10

Introduction

In order to be able to respond to an ever-changing environment, plants use their enormous

metabolic capacity to produce a large variety of secondary metabolites.The basic biosynthetic

pathways are conserved over a wide range of plants, resulting in the occurrence of a limited

number of basic skeletons.These can then be modified by an array of specific reactions resulting

in the generation of the enormous number of different secondary compounds. Flavonoids

represent a large family of low molecular weight polyphenolic secondary metabolites that are

widespread throughout the plant kingdom, ranging from mosses to angiosperms (Koes et al.,

1994). In nature they are involved in a wide range of functions, for example I) in providing

pigmentation for flowers, fruits and seeds to attract pollinators and seed dispersers, II) in

protection against ultraviolet light, III) in plant defence against pathogenic micro organisms, IV)

in plant fertility and germination of pollen, and V) in acting as signal molecules in plant-microbe

interactions (Koes et al.,1994; Dixon and Paiva, 1995; Dooner and Robbins, 1991).

To date, more than 6000 different flavonoids have been described and the number is still

increasing (Harborne & Williams, 2000). By definition, they all share the same basic skeleton, the

flavan-nucleus, consisting of two aromatic rings with six carbon atoms (ring A and B)

interconnected by a hetero cycle including three carbon atoms (ring C). According to the

modifications of the central C-ring they can be divided in different structural classes like

flavanones, isoflavones, flavones, flavonols, flavanols and anthocyanins (figure 1). In this review

also the closely related chalcones and stilbenes are included. The huge diversity in flavonoid

structures is due to modifications of the basic skeleton by enzymes such as glycosyl

transferases, methyl transferases and acyl transferases. In a single plant species dozens of

different flavonoids may be present and most of these are conjugated to various sugar moieties

(Forkmann and Heller, 1999).

Since flavonoids impart much of the colour and flavour of fruits, vegetables, nuts and seeds, they

form an integral part of the human diet (Parr and Bowell, 2000). Rich dietary sources of

flavonoids are for example soybean (isoflavones), citrus (flavanones), tea, apple and cocoa

(flavanols), celery (flavones), onions (flavonols) and berries (anthocyanins) (Rice-Evans, 1995;

Ross and Kasum, 2002; Le Gall et al., 2003).

Historically, flavonoids have been an attractive research subject mainly because of the coloured

anthocyanins. In particular the eye-catching anthocyanin pigments have been very useful to

perform genetic experiments, including Gregor Mendel’s study of the inheritance of genes

responsible for pea seed coat colour, and the discovery of transposable elements interrupting

maize pigment biosynthetic genes by McClintock (McClintock 1967; Lloyd et al., 1992; Koes et

al., 1994).

11

Cha

pter

1

12

Figure 1. Schematic overview of the major flavonoid pathway in plants.

Enzymes abbreviated in blue as follows: CHS, chalcone synthase; CHR, chalcone reductase; STS, stilbene synthase; AS,

aureusidin synthase;CHI, chalcone isomerase; F3H, flavanone hydroxylase; FNS, flavone synthase; IFS, isoflavone synthase;

FLS, flavonol synthase, F3’H, flavonoid-3’-hydroxylase; F3’5’H, flavonoid-3’,5’-hydroxylase; DFR, dihydroflavonol-4-

reductase; ANS, anthocyanidin synthase; LAR, leucoanthocyanidin reductase; ANR, anthocyanidin reductase; 3GT,

flavonoid-3-glycosyltransferase. Colour figure on p.153

Nowadays, the flavonoid biosynthetic pathway has been almost completely elucidated. Many of

the structural and some of the regulatory genes have been cloned from several model plants,

including maize, Antirrhinum, tobacco, Petunia and Arabidopsis (Holton and Cornisch, 1995) and

have been expressed in genetically modified model plants and micro-organisms (Dixon and

Steele, 1999; Forkmann and Martens, 2001; Winkel-Shirley, 2001; Hwang et al., 2003). Today,

standard molecular tools are available to genetically modify plants including several world-wide

important crops such as maize, potato, tomato, sugar beet and wheat (Sévenier et al., 2002).

Although some plants contain high levels of certain flavonoids, in other species the composition

of these secondary metabolites is ‘sub-optimal’.Attempts to modify flavonoid biosynthesis have

been made for different reasons. During the last decade, in several ornamental plant species

newly pigmented flowers have been developed by genetic modification of the flavonoid pathway

(Van der Krol et al., 1988; Courtney-Gutterson et al., 1994; Deroles et al., 1998;Tanaka et al.,

1998; Davies et al., 1998; Mol et al., 1999;Aida et al., 2000; Suzuki et al., 2002; Zuker et al.,2002;

Fukui et al., 2003).

Since defence against pathogens is one of the functions of flavonoids in planta, also for this

reason plants with improved flavonoid production have been made (Yu et al., 2003; Fisher et al.,

1997; Jeandet et al.,2002). In the past decade it has become more and more clear that the

composition of secondary metabolites greatly influences the quality and health potential of food

and food products (Stobiecki et al., 2002). In this respect flavonoids are important since they

have been suggested to protect against oxidative stress, coronary heart disease, certain cancers,

and other age related diseases (Kuo, 1997;Yang et al., 2001; Ross & Kasum, 2002).At least part

of these presumed health promoting properties of flavonoids can be attributed to the well-

documented antioxidant properties of these compounds. The chemical structure of most

polyphenols appears to be ideal for free radical scavenging and in vitro studies have shown that

the majority of flavonoids are more effective antioxidants on a mole to mole basis than the

antioxidant nutrients vitamins E and C. For example, the flavonol quercetin and the flavan-3-ol

epicatechin gallate have a five fold higher total antioxidant activity than the vitamins E and C,

when measured as trolox equivalent antioxidant activity (Rice-Evans et al., 1995; 1997). Beside

antioxidant activity, the inhibitory effect of flavonoids on enzymatic activities (Castelluccio et al.,

1995; Rice-Evans et al., 1997; Pietta, 2000) and their interaction with signal transduction

pathways, leading to changes in the expression of genes involved in cell survival, cell proliferation

and apoptosis (Yang et al., 2001; Sarkar and Li, 2003; O’prey et al., 2003;Van Dross et al., 2003)

may contribute to their health-promoting properties. For this reason, there is currently a

growing interest in the development of agronomically important food crops with optimized

levels and composition of flavonoids.

The aim of this review is to present the state of the art of flavonoid pathway engineering in crop

plants.

13

Cha

pter

1

The flavonoid biosynthetic pathway

Two classes of genes can be distinguished within the flavonoid pathway: (I) the structural genes

encoding enzymes that directly participate in the formation of flavonoids, and (II) regulatory

genes that control the expression of the structural genes.The precursors of the synthesis of

most flavonoids are malonyl-CoA and p-coumaroyl-CoA, which are derived from carbohydrate

metabolism and phenylpropanoid pathway, respectively (Forkmann and Heller, 1999).

The biosynthesis of flavonoids is initiated by the enzymatic step catalysed by chalcone synthase

(CHS), resulting in the yellow coloured chalcone. In the majority of plants chalcones are not the

end-products, but the pathway proceeds with several enzymatic steps to other classes of

flavonoids, such as flavanones, dihydroflavonols and finally to the anthocyanins, the major water-

soluble pigments in flowers and fruits. Other flavonoid classes (i.e. isoflavones, aurones, flavones,

proanthocyanidins and flavonols) represent side branches of the flavonoid pathway and are

derived from intermediates in anthocyanin formation.

From the beginning of the pathway towards anthocyanins

Chalcone synthase (CHS)

The enzyme chalcone synthase catalyzes the stepwise condensation of three acetate units

starting from malonyl-CoA with p-coumaroyl-CoA to yield 4,2’,4’,6’-tetrahydroxychalcone

(Tanaka, 1998: Holton & Cornish., 1995). Genomic and cDNA sequences encoding CHS have

been isolated and characterised from many plant species and the expression of endogenous

CHS genes has been studied in detail. CHS has been an attractive target for genetic engineering

and there are numerous examples of co-suppression or down regulation of this gene in order

to modify flower colour towards pure white as a result of a complete absence of flavonoids.

However, blocking the flavonoid pathway may also lead to pleiotropic effects such as male

sterility (Napoli et al., 1999;Van der Meer et al., 1992;Ylstra et al., 1994; Jorgensen et al., 1996;

Deroles et al., 1998).

Chalcone isomerase (CHI)

Most plants do not accumulate chalcones. After its formation, naringenin chalcone is rapidly

isomerized by the enzyme chalcone isomerase (CHI) to form the flavanone naringenin. Even in

the absence of CHI, naringenin chalcone may spontaneously isomerise to form naringenin

(Holton & Cornish, 1995). However, in some plants chalcone accumulation does occur. CHI

mutants of aster (Callistephus chinensis) and carnation (Dianthus cayophyllus) appeared to have

yellowish flower petals; a CHI mutant of Arabidopsis contains a changed seed coat colour

(Forkmann and Heller, 1999), and also the fruit peel of tomato accumulates the yellow coloured

14

naringenin-chalcone (Muir et al.,2001). Two types of CHI are known: one type that can

isomerise 6’-hydroxyl- as well as 6’-deoxy chalcones, and another that only converts 6’-

hydroxychalcones to flavanones.Although it was thought that the former type of CHI enzyme

was restricted to the legumes, it has recently been reported that the tobacco CHI is able to

isomerize the 6’-deoxychalcone isoliquiritigenin to the 5’-deoxyflavanone liquiritigenin as well

(Joung et al., 2003).

Flavonoid hydroxylation (F3H / F3’H / F3’5’H)

The subsequent hydroxylation in position C-3 of flavanones to dihydroflavonols has been

demonstrated for a wide variety of plant species including Petunia, snapdragon, tomato and

maize. The reaction is carried out by flavanone-3-hydroxylase (F3H), a member of the 2-

oxoglutarate-dependent dioxygenase family which is highly conserved among widely divergent

plant species as shown by sequence comparison (Britsch et al., 1993).A mutation resulting in a

loss of F3H activity, both in Petunia and Antirrhinum, prevents the progression along the

anthocyanin pathway and white flowers are the consequence (Britsch et al., 1992; Martin et al.,

1991). Dihydrokaempferol (DHK), the product of F3H catalyzed hydroxylation of naringenin,

can be further hydroxylated, either at the 3’ position or at both the 3’ and 5’ positions of the

B-ring.The former reaction leads to the formation of dihydroquercetin (DHQ) and ultimately

to the production of cyanidin based pigments. This is carried out by the P450 hydroxylase

flavonoid 3’-hydroxylase (F3’H). The latter hydroxylation steps are catalysed by the P450

enzyme flavonoid 3’,5’-hydroxylase (F3’5’H), responsible for the conversion of DHK into

dihydromyricetin (DHM), which is required for the production of delphinidin-based

anthocyanins (Forkmann 1991;Winkel-Shirley, 2001;Toda et al., 2002).

Dihydroflavonol 4-reductase (DFR)

The enzyme dihydroflavonol 4-reductase (DFR) catalyzes the stereo specific reduction of

dihydroflavonols to leucoanthocyanidins (flavan-3,4-diol) using NADPH as a cofactor

(Kristiansen and Rohde, 1991). These leuco-anthocyanidins are the immediate precursors for

the synthesis of anthocyanins. In addition, they are also precursors for the production of

catechins and proanthocyanidins, which are involved in plant resistance and are considered as

potential health-protecting compounds in food and feed. Clear evidence for the role of DFR in

anthocyanin synthesis came from biochemical supplementation with flavan-3,4-diol as well as

from complementation experiments with DFR clones in DFR mutants (Goldsbrough et al.,

1994;Yoder et al., 1994; Forkmann and Heller, 1999; Martens et al., 2002).

Anthocyanidin synthase (ANS)

The leucoanthocyanidins are converted into anthocyanidins by the anthocyanidin synthase

15

Cha

pter

1

(ANS), another member of the 2-oxoglutarate-dependent dioxygenase family.ANS shows large

homology to F3H and FLS (Martin et al., 1991; Tanaka et al., 1998). Genomic or cDNA

sequences encoding ANS have been obtained from several plant species including Arabidopsis,

Antirrhinum, Petunia,Vitis vinifera and maize. ANS mutants, as well as mutations in regulatory genes

affecting ANS gene expression have been studied in these plants (Martin et al., 1991; Jackson et

al., 1992; Pelletier et al., 1999; Bradley et al., 1998).

Flavonoid 3-O-Glucosyltransferase (3GT)

In general, flavonoids and anthocyanidins with a free hydroxyl group at the 3 position of the

heterocyclic ring are unstable under physiological conditions and are therefore not found in

nature (Forkmann & Heller, 1999).The enzyme UDP-glucose:flavonoid 3-O-glucosyltransferase

(3GT) is responsible for the transfer of the glucose moiety from UDP-glucose to the hydroxyl

group in position 3 of the C ring. Since this is an essential final step required to stabilise

anthocyanidins so that they can accumulate as water soluble pigments in the vacuoles, 3GT is

regarded as an indispensable enzyme of the main biosynthetic pathway to anthocyanins, rather

than simply a modifying enzyme. In this regard it is interesting to note that mutants with

decreased DFR and ANS activity also show decreased 3GT activity, suggesting that the late

genes of the anthocyanin pathway are co-regulated or may exist as a functional complex

(Hrazdina and Wagner, 1995; Hrazdina and Jensen, 1992). Depending on the B-ring hydroxylation

pattern, three major types of anthocyanins can finally be distinguished. Each has a characteristic

colour since the visible absorption maximum becomes longer as the number of hydroxyl groups

in the B-ring increases: pelargonidin-derived pigments are responsible for orange, pink or red

colours, cyanidin-derived pigments for red or magenta, and delphinidin-derived pigments for

purple or blue (Zuker et al., 2002). Beside the structures of the anthocyanins, differences in

vacuolar pH, intermolecular stacking (self-association of anthocyanins and co-pigmentation of

anthocyanins with other polyphenols), intramolecular stacking of aromatically modified

anthocyanins, glycosylation, metal complexation and cell shape give an almost infinite range of

flower colours (Tanaka et al., 1998). Further flavonoid modification by acylation, additional

glycosylation to flavonoid disaccharides or trisaccharides, methylation or hydroxylation may

occur within each flavonoid class, whereas modifications like prenylation, sulfation and C-

glycosylation are restricted to particular flavonoid groups.

Most modifications are performed on the endproducts such as anthocyanin-3-glucosides,

flavonols, flavones and (iso) flavones, but also intermediates of the pathway can be used as

substrate (Heller and Forkmann, 1993).

Formation of other flavonoid classesBeside going to anthocyanins, the pathway can also branch to other classes of flavonoids, such

16

as stilbenes, aurones, deoxy-(iso)-flavonoids, flavones, flavonols, catechins and proanthocyanidins.

The next section gives an overview of how these flavonoids are synthesised.

Stilbenes

Chalcone synthase, the enzyme responsible for the first step in the flavonoid pathway, is a

member of the plant polyketide synthase super family, which catalyses the production of a wide

variety of secondary metabolites from a limited set of substrates (malonyl CoA and 4-

coumaroyl CoA, in exceptional cases cinnamoyl-CoA), using subtly different reaction

mechanisms. For instance, stilbene synthase (STS), the enzyme which catalyses the production

of stilbenes, is also a member of this family. Based on the results of mutational and structural

analysis and the fact that STS is found in a limited number of unrelated plant species, it has been

suggested that STS has evolved from CHS (Tropf et al., 1994; Schröder, 1997). Indeed, CHS and

STS share a deduced amino acid sequence similarity of up to 70 percent (Schröder and

Schröder, 1990; Eckermann et al., 2003).

Genes encoding STS have been isolated from grape (vitis vinifera sp.) but are also found in peanut

and pine. Originally, the stilbene type phyto-alexins such as resveratrol have gained a lot of

interest due to their fungicidal properties. In addition, resveratrol and its glycoside piceid are of

great interest due to their presumed health effects (Jang et al., 1997; Hall, 2003; Finkel, 2003).

Aurones

In some popular ornamental plants, such as Antirrhinum, the yellow flower colour is mainly

provided by glycosides of flavonoids belonging to the class of aurones (aureusidin and

bracteatin).The formation of aureusidin and bacteatin, derived from tetra-hydroxychalcone and

penta-hydroxychalcone, respectively, have been demonstrated to be a single enzymatic process

catalyzed by the same enzyme, aureusidin synthase (Nakayama et al., 2000).This enzyme and the

encoding cDNA sequence (AmAS1) have been purified and isolated from Antirrhinum flower

petals. Based on its high deduced amino acid similarity to plant polyphenol oxidases (PPO),

aureusidin synthase was classified as a PPO homologue, an enzyme family which occurs

ubiquitously in higher plants.

5’ deoxy-(iso)flavonoids

A branch in the first step of the flavonoid pathway, resulting in deoxyflavonoids, has a very

limited distribution to just leguminous plants. When CHS alone is present in a plant, 6’-

hydroxychalcones are produced. The first deoxy-flavonoid, isoliquiritigenin (2',4',4-

trihydroxychalcone or 6'-deoxychalcone), is synthesized by the co-action of chalcone synthase

and polyketide reductase (PKR), also referred to as chalcone reductase (CHR) (Welle and

Grisebach, 1988; Davies et al., 1998; Forkmann and Martens, 2001).

17

Cha

pter

1

Isoliquiritigenin is the precursor of 5-deoxy-(iso)flavonoids and can, in two subsequent steps, be

converted to the 5-deoxy-isoflavonoid daidzein, through the combined action of CHI, leading to

the production of the deoxyflavanone liquiritigenin, and the cytochrome P450 enzyme

CYP93C1 (2-hydroxy-isoflavanone synthase, commonly termed isoflavone synthase (IFS)).This

is the key enzyme for the production of isoflavonoids and carries out the 2,3 migration of the

B-ring of liquiritigenin or naringenin, resulting in the production of the isoflavones daidzein and

genistein, respectively (Yu et al., 2000).

Flavones

In several plants (e.g. Petroselinum, Chrysanthenum, Dahlia, Gerbera) naringenin can be used as a

precursor for the production of flavones.Two enzymes capable of converting naringenin into the

flavone apigenin have been identified from different plant species. In some plant species this

conversion is catalysed by a cytochrome P450, whereas in other plants a dioxygenase is

responsible for this reaction (Heller & Forkmann,1994; Forkmann and Martens, 2001). This

demonstrates an example of parallel evolution of these flavonoid pathway branches. Flavones

play an important role in determining flower colour since they can function as co-pigments by

forming complexes with anthocyanins (Aida et al., 2000; Ueyama et al., 2002; Nielsen et al., 2002).

In addition, they are proposed to have health beneficial properties (Van Dross et al., 2003).

3-Deoxy-anthocyanins and phlobaphenes

In maize and other cereals, two major branches within the flavonoid pathway exist. Beside the

common pathway leading to 3-hydroxy-flavonoids such as anthocyanins, a second branch

specifically leads to the production of three types of 3-deoxy-flavonoids: C-glycosyl flavones, 3

deoxy-anthocyanins and the pigment phlobaphene.This branch of the pathway is active in maize

floral organs and is controlled by the MYB-type transcription factor P (Styles and Cheska, 1975;

Grotewold, 1998). Flavanones are the common precursors for the production of these 3-

deoxyflavonoids. C-glycosyl flavones, a special type of flavones with a C-glycoside attached to

the A-ring, are produced from flavanones by an as yet unclear reaction mechanism (Heller and

Forkmann, 1988; Grotewold, 1998).The 3-deoxy-anthocyanins and the phlobaphene pigments

are derived from flavan-4-ols, which are produced from flavanones through the action of DFR

(Styles and Cheska, 1975; Grotewold, 1998). So, depending on substrate availability, the maize

DFR enzyme can either convert flavanones into flavan-4-ols, which are precursors for the

formation of 3-deoxy-anthocyanins and phlobaphenes, or convert dihydroflavonols to

leucoanthocyanidins, which lead to the production of anthocyanins. This suggests that the

branching of the pathway towards either anthocyanins or 3-deoxy anthocyanins and

phlobaphenes is, at least in part, determined by the activity of the F3H enzyme, which catalyses

the conversion of flavanones into dihydroflavonols.

18

Flavonols

One step further downstream in the main pathway towards anthocyanins, the dihydroflavonols

(DHK, DHQ, DHM) can be converted into flavonols by the enzyme flavonol synthase (FLS).This

enzyme catalyzes the introduction of a double bond between carbon 2 and 3 of the C-ring,

producing the flavonols kaempferol, quercetin and myricetin respectively. With regard to the

over-all flavonoid biosynthesis leading to anthocyanin formation, there is clearly competition

between the enzymes FLS and DFR for the common substrate dihydroflavonols. For instance,

transgenic anti-sense FLS flowers of Petunia and tobacco accumulate increased levels of

anthocyanins (Holton et al., 1993; Nielsen et al., 2002). It has been reported that FLS activity

was high in still uncoloured flowers of Petunia,Dianthus and Matthiola, but that the activity rapidly

declined when anthocyanin formation starts (Forkmann and Heller, 1999). This temporal

regulation of the activity of enzymes using the same substrate is an attractive way to

prevent competition for the dihydroflavonols to be used for either anthocyanin or flavonol

biosynthesis.

Catechins and proanthocyanidins

There are two branching points in the anthocyanin pathway which lead to the production of

(epi) catechins and proanthocyanidins: one at the level of leucoanthocyanidins and one at the

level of anthocyanidin aglycons (Figure 1). Leucoanthocyanidins can be converted either to

anthocyanidins and subsequently anthocyanins through the subsequent action of ANS and 3GT

(i.e. the ‘normal pathway’), or reduced to catechins through the action of the enzyme

leucoanthocyanidin reductase (LAR).The LAR gene has recently been isolated from the legume

Desmodium. Expression of this recombinant LAR cDNA in E.coli, transgenic tobacco and white

clover resulted in detectable LAR activity and the synthesis of catechin (Tanner et al., 2003;

Marles et al., 2003).

Evidence for a second branch point towards catechins at the level of anthocyanidins came from

the analysis of a loss-of-function Arabidopsis mutant, called BANYULS, which accumulated high

levels of anthocyanins. In first instance it was thought that the BANYULS gene (BAN) encoded a

negative regulator of pigmentation. However, ectopic expression of the Arabidopsis as well as the

Medicago BAN genes in tobacco showed that both genes encode an anthocyanidin reductase,

which converts anthocyanidins to the epicatechin 2,3-cis-flavan-3-ol (Bartel and Matsuda, 2003).

Since BANYULS and 3GT compete for the common precursor anthocyanidin, expression of

BAN resulted in a loss of anthocyanins, as well as an accumulation of condensed tannins (Xie

et al., 2003).

Proanthocyanidins (PA), also known as condensed tannins, are polymeric flavonoids that are

thought to be synthesised by sequential addition of intermediates derived from flavan-3,4-diol

(e.g. leucocyanidin) to a flavan-3-ol initiating unit (e.g. catechin) or a pre-existing chain. In planta,

19

Cha

pter

1

complex PA polymers can be found as the result of a combinatorial incorporation of several

isomers, and the degree of polymerization as well as the composition may change during plant

development.A condensation reaction resulting in a PA polymer has been demonstrated in vitro

(Delcour, 1983), but until now little is known about the genes and enzymes responsible for the

polymerisation reactions leading to proanthocyanidins.

Much of our knowledge on PA’s to date has been derived from extensive analysis of Arabidopsis

seed coat mutants.A number of tannin deficient seed (tds) and transparent testa (tt) genes have

been identified in Arabidopsis which, when mutated, cause a disruption in proanthocyanin

biosynthesis (Abraham et al., 2002).

Regulators controlling the flavonoid pathway

Coordinate transcriptional control of biosynthetic genes has emerged as a major mechanism

dictating the final levels of secondary metabolites in plant cells. This regulation is achieved by

specific transcription factors. These DNA binding proteins interact with promoter regions of

target genes and modulate the rate of initiation of mRNA synthesis by RNA polymerase II

(Ranish and Hahn, 1996). Regulatory genes, in particular those controlling pigmentation intensity

and pigmentation pattern through influencing the expression of many different structural genes,

have been identified in many plants (Holton et al., 1995). The regulation of these regulatory

genes appeared to be highly dependent on tissue type and/or response to internal signals, such

as hormones, and to external signals such as microbial elicitors or UV radiation (Memelink et

al., 2000; Martin et al., 2001;Vom Endt et al., 2002).

Transposon tagging has proven to be a very useful tool for isolating flavonoid regulatory genes

for which no prior information existed concerning their gene sequence, function or final

products (Holton et al., 1995). In particular three species have been important for elucidating

the anthocyanin biosynthetic pathway and its control by regulatory genes: maize, Antirrhinum

and Petunia. More recently, regulatory genes have been found in Arabidopsis and tomato. In

general the isolated regulatory genes can be divided into two transcription factor families: one

with sequence homology to a protein encoded by the vertebrate proto-oncogene c-MYB, and

the other with similarity to the vertebrate basic-Helix-Loop-Helix (bHLH) protein encoded by

the proto-oncogene c-MYC (Mol et al., 1998). In various plant species the tissue-specific

regulation of the structural genes involved in the flavonoid biosynthesis is controlled by the

combination of regulators from these two transcription factor families. In different plant species,

homologous sets of transcription factors activate different sets of structural genes, thus

allowing regulatory diversity in the pathway. Ectopic expression of transcription factor genes in

various plant species has confirmed that these regulatory genes are functionally conserved

among different plant species. However, the final quantity and class of flavonoids that is

20

produced is determined by a number of parameters: the binding affinity of the transcription

factor to the promoter sites of their target structural genes; the ability to cooperate with

endogenous transcription factors; the functionality of these endogenous transcription factors

(Quattrocchio et al., 1993). There is however a remarkable sequence homology between the

flavonoid transcription factors from different plant species, indicating that they are derived from

a common ancestor. Some of them have already been successfully expressed ectopically in

various transgenic plant species such as tobacco, tomato and Petunia. It appeared therefore that

they have been functionally conserved among plant species during evolution (Koes et al., 1994;

Quattrochio et al., 1993).

Pathway engineering using the maize R and C1 transcription factors

Several of the anthocyanin myc and myb regulatory genes have been tested for their ability to

improve anthocyanin accumulation when expressed in heterologous plants. However, up to now

the success of this strategy has been highly variable. Amongst the most well characterized

regulatory plant genes are the maize leaf colour (LC) gene belonging to the MYC type R gene

family and the MYB type C1 (colourless) gene.

Already more than a decade ago, activation of anthocyanin production was achieved in

Arabidopsis and tobacco plants by the introduction of the maize regulators R and C1. In both

plant species, expression of the R regulatory gene alone resulted in enhanced anthocyanin

pigmentation of tissues that normally produce anthocyanins, whereas in Arabidopsis also an

increased trichome production was observed. The C1 gene alone had no visible effect.

Accumulation of anthocyanins in tissues that normally do not contain any anthocyanins was

observed in hybrid transgenic Arabidopsis plants expressing both C1 and R (Lloyd et al., 1992).

Also in other dicot species, expression of LC resulted in enhanced anthocyanin pigmentation.

For example, in LC over-expressing cherry tomato plants, anthocyanins accumulated in leaves,

stems, sepals, petal, main vein and, to a lesser extent, in developing green fruits (Goldsbrough et

al., 1996). Not only anthocyanins, but also other classes of flavonoids have been reported to

accumulate when LC and C1 are ectopically expressed. For example in red ripe tomato fruits,

which normally produce only small amounts of the flavonols kaempferol and quercetin in the

fruit peel tissue, the introduction and co-ordinate expression of the maize regulatory genes LC

and C1 under the control of a combination of general and fruit specific promoters, was sufficient

to up-regulate the flavonoid pathway in the fruit flesh, a tissue that normally does not produce

flavonoids (Bovy et al., 2002).The main compounds accumulating in the fruits were glycosides

of the flavonol kaempferol. A more modest increase in glycosides of the flavanone naringenin

was also observed. Total flavonol content of ripe transgenic tomatoes over-expressing LC/C1

21

Cha

pter

1

was about 20-fold higher than that of the controls (Bovy et al., 2002; Le Gall et al., 2003).

Remarkably, no increase of anthocyanins was detected in these fruits.However,RNA expression

analysis revealed that all of the structural genes leading to kaempferol-type flavonols and

pelargonidin-type anthocyanins were strongly induced by the introduced LC/C1 transcription

factors. Biochemical and transcriptional analysis of the transgenic lines indicated that the

absence of anthocyanins was primarily due to a low, LC/C1 independent expression of the gene

encoding flavanone-3’,5’-hydroxylase, together with a strong preference of the tomato

dihydroflavonol reductase (DFR) enzyme for dihydromyricetin (Forkmann and Heller, the

precursor for delphinidin-type anthocyanins. In contrast to fruits, old leaves and nodes of some

LC/C1 tomato plants, as well as light-stressed LC/C1 seedlings, revealed a clearly visible

accumulation of delphinidin-type anthocyanins. In purple-coloured LC/C1 leaves, F3'5'H gene

expression was at least 10-fold higher than in fruits (Bovy et al., 2002).

In potato, another globally important crop belonging to the same Solanaceae family, expression

of LC and C1 resulted in a marked accumulation of kaempferol in the whole tuber and an

increased anthocyanin pigmentation of the peel (Figure 2, de Vos et al., 2000).

22

Figure 2.

Increased flavonoid biosynthesis in transgenic potato tubers. In addition to kaempferol accumu-lation in the whole tuber

(De Vos et al., 2000), the LC/C1 over-expressing tubers (left) clearly show an increased  accumulation of  anthocyanins in

the peel compared to the control tuber (right). Colour figure on p.154

In alfalfa, no induction of anthocyanin formation was found in transgenic plants expressing the

maize regulatory genes LC, B-Peru, or C1 when grown under normal conditions.The LC gene,

but not B-Peru or C1, was found to stimulate anthocyanin and pro-anthocyanin biosynthesis in

alfalfa, but only in combination with the presence of one or more unknown environmental

stress-responsive factors. After cold or light stress the red to deep purple colouration of the

leaves and stems of LC transgenic alfalfa plants was accompanied by a rapid accumulation of CHS

and F3H transcript levels. Weak expression levels of these two structural genes in non-

transgenic plants suggests that the expression of both genes must bypass a certain threshold

level before the anthocyanin pathway is induced (Ray et al., 2003).

Although ectopic expression of LC alone was sufficient to enhance pigmentation in tobacco,

Arabidopsis, Petunia and to a lesser extent in alfalfa and tomato, it has not been demonstrated to

do so in some other plant species, such as Lisianthus and Pelargonium.This apparent

inconsistency in response to ectopic LC expression is reflected in the remarkable variation

between plant species in their transcriptional response to the introduced LC genes. For example

in Petunia, the introduced LC gene slightly induced the steady state mRNA levels of CHS, CHI,

and F3H and resulted in a stronger activation of DFR, F3’H, F3’5’H, ANS, UFGT, and 3RT. In

tobacco plants, only the expression levels of CHS and DFR were enhanced by LC (Bradley et al.,

1998), and in Lisianthus and Pelargonium, LC over-expression was not sufficient to up-regulate

expression levels of flavonoid biosynthesis genes (Bradley et al., 1999).

A deficient transcriptional activation may be due to a lack of appropriate transcription factor

binding sites on the promoter sequence of one or more structural genes. Alternatively, it is

possible that the introduced LC gene product is not able to interact with the endogenous MYB

like proteins that may be required to up-regulate flavonoid gene expression or that these MYB

like proteins are rate-limiting. Since, in many cases, the induction of flavonoid biosynthesis is

enhanced by environmental stress, other endogenous regulators such as stress-induced

transcription activators or repressors may also play a role in the final activation of the flavonoid

pathway. In this respect, a transgene-dosage effect could be of importance.This dependence on

additional transcription factors could, at least in part, be overcome by the coordinate

expression of both LC and C1: whereas LC/C1 together were sufficient to upregulate the

flavonoid biosyntesis pathway in tomato fruit, neither LC, nor C1 alone were sufficient to induce

the pathway in tomato fruit.

All the above-mentioned examples of introducing the LC and/or C1 transcription factors in

heterologous plants clearly show that these genes can be functionally expressed in many, though

not all, plant species. Whereas the introduction of LC alone may be sufficient to enhance

anthocyanins in those tissues normally accumulating flavonoids, in most cases both LC and C1

seem to be necessary to produce significant amounts of anthocyanin pigments or flavonols in

plant tissues that normally do not accumulate these compounds.

23

Cha

pter

1

Dicot representatives of Myc/Myb type transcription factors

Homologs of the maize flavonoid transcription factor genes LC and C1 have also been isolated

from dicot species. Petunia, Arabidopsis, tomato and Antirrhinum contain genes with sequence

homology to transcription factors that regulate the structural genes of the anthocyanin

biosynthetic pathway (Cone,1986; Goodrich et al.,1992; Grotewold, 1994; Quattrocchio et

al.,1998; Ramsay et al., 2003).

In contrast to maize, where LC and C1 regulate all genes of the pathway from CHS until 3GT,

it has been shown that in dicots such as Petunia and Antirrhinum distinct sets of MYB/MYC

transcription factors are responsible for regulating the early part (CHS up to F3H) or the late

part (DFR to 3GT) of the pathway. For example, in Antirrhinum, three anthocyanin regulatory

genes – Delila, Eluta and Rosea- have been identified.The Antirrhinum Delila gene (DEL), a MYC

(bHLH) homologue, is required for pigmentation of the flower tube.The first two steps in the

flavonoid pathway, CHS and CHI, show minimal regulation by Delila but subsequent steps (F3H,

DFR, 3GT) have an absolute requirement for the Delila gene product and show quantitative

regulation by Eluta and Rosea (Martin et al., 1991;).

Over-expression of Delila in tobacco and tomato resulted in enhanced pigmentation of

vegetative tissues in tomato whereas only the flowers were affected in tobacco. In both plants

this was at least due to increased expression of the DFR gene.A 10-fold increase of DFR mRNA

levels was observed in tomato and a 4-fold increase in tobacco when DEL was over-expressed.

Transcript levels of CHS were only slightly increased, 2 and 3-fold, for tobacco and tomato,

respectively (Mooney et al., 1995).

Recently, a Myb transcription factor gene was identified by activation tagging in a tomato line

accumulating anthocyanins (Mathews et al., 2003).This gene encoded the ANT1 protein, which

shows strongest similarity with the Petunia AN2 (MYB) protein.This gene is responsible for the

intense purple colour of vegetative tissue and purple spots in the fruit epidermis of the

transposon mutant. Strong constitutive over-expression of a single genomic ANT1 gene in the

tomato cultivar Micro-Tom demonstrated phenotypes ranging from weak to strong anthocyanin

accumulation. The same result was obtained with ANT1 transformed tobacco plants. The

anthocyanin levels in 3-week-old in vitro-grown seedlings of transgenic ANT1 tomato plants

were increased up to 3574 µg/g fresh weight, an almost 500-fold increase compared to

untransformed seedlings. Beside the 3-rutinoside-5-glucosides of delphinidin-type anthocyanins

(delphinidin, petunidin and malvidin), six additional acylated pigments were found. These

appeared to be the same three delphinidin-type anthocyanins acylated with either p-coumaric

acid or caffeic acid. Over-expression of ANT1 resulted in the up-regulation of early (CHS) as well

as late (DFR) genes of the anthocyanin biosynthesis. Furthermore, genes encoding flavonoid

modifying enzymes such as 3-O-glucosyltransferase and 5-O-glucosyltransferase, as well as the

24

flavonoid binding protein GST-I, required for transport, were increased. In addition, three new

genes involved in tomato anthocyanin biosynthesis were found in the ANT1 over-expressing

line: a Chalcone isomerase-like gene, a gene similar to Arabidopsis transcription factor HD-GL2,

and a gene with strong homology to an Arabidopsis permease required for vacuolar transport

of pro-anthocyanidins (Mathews et al., 2003).

Beside transcription factors which increase activity in the flavonoid pathway, also negative

regulators have been found. Over-expression of the FaMYB1 transcription factor isolated from

red strawberry fruits resulted in suppression of anthocyanin as well as flavonol accumulation in

tobacco (Aharoni et al., 2001). Also two MYB transcription factors from Antirrhinum,

AmMYB308 and AmMYB330 were shown to have repressing effects on genes involved in

phenylpropanoid biosynthesis when expressed in tobacco (Tamagnone et al., 1998).

Interestingly, all these suppressing MYB factors share a conserved motif in their C-terminal end

(Vom Endt et al., 2002), suggesting that additional suppressing transcription factors may more

easily be identified in the future.Vom Endt et al. (2002) speculated that these MYB suppressor

genes encode weak activators/repressors which compete with endogenous MYB-related

activators.

Recently, fruit specific RNAi-mediated suppression of the tomato regulatory gene DET1, which

normally represses light controlled signalling pathways, resulted in a "high pigment" fruit

phenotype. In addition to enhanced carotenoid levels, these DET1-RNAi fruits contained an up

to 3.5 fold increase in flavonoid content (Davuluri et al., 2005).

Modifying the structural genes

Down-regulation or over-expression of structural flavonoid genes in transgenic plants have

shown to be useful tools to elucidate the function of flavonoid pathway genes. Furthermore,

over-expression of structural genes can be used in metabolic engineering strategies to

overcome rate-limiting enzymatic steps in the pathway. In this way, the flux through an already

existing pathway of the hostplant can be increased, which may lead to enhanced levels of specific

flavonoids or even new flavonoids. As outlined below, this approach has been used extensively

to increase the flavonoid content of tomato fruit, in order to improve the food quality of this

important crop.

In tomato, naringenin chalcone accumulates almost exclusively in peel tissue and is

simultaneously formed with colouring of the fruit, peaking at the turning peel stage. In addition,

the flavonols quercetin-rutinoside (rutin) and, to a lesser extent, kaempferol-rutinoside, also

accumulate almost exclusively in the peel of ripening tomato fruits. Expression analysis of the

endogenous tomato flavonoid genes CHS, CHI, F3H and FLS revealed that CHS, F3H and FLS were

expressed in peel tissue during all stages of fruit development, peaking in the turning stage. In

25

Cha

pter

1

contrast, the CHI transcript levels remained below detection levels (Muir et al., 2001). Based on

these biochemical and gene-expression data it was suggested that a block exists at the level of

CHI. Indeed, ectopic expression of a single CHI gene from Petunia resulted in a tissue specific

increase of total flavonols in the fruit peel. This was mainly due to the accumulation of the

flavonol rutin (quercetin 3-rutinoside) and quercitrin (quercetin-3-glucoside), and to smaller but

still substantial increases in kaempferol glycosides (Figure 3).

In these high-flavonol transformants, naringenin chalcone levels were strongly reduced,

suggesting that the Petunia CHI enzyme utilizes the natural naringenin chalcone pool as

substrate (Muir et al., 2001;Verhoeyen et al., 2002).

26

Figure 3.

HPLC chromatogram recorded at 360 nm of non hydrolysed peel of control and CHI over-expressing tomato fruit. In the

control tomato the major peaks correspond to naringenin chalcone and quercetin rutinoside. In CHI over-expressing

tomato naringenin chalcone is decreased and flavonol (quercetin and kaempferol) derivatives are the major flavonoids in

the fruit peel.

Although it was not possible to distinguish CHI transformants from the parental variety based

on their vegetative phenotype, transgenic lines showed dullness in the tone of their red ripe

fruits. The correlation of dullness with the CHI over-expressing phenotype suggests that

naringenin-chalcone in some way may be involved in determining the shininess of fruits. In fruit

flesh and leaves of CHI-overexpressing plants, the total amount of flavonoids remained

unchanged (Muir et al., 2001).

In flesh tissue of tomato fruits, the transcript levels of CHS, CHI, F3H and FLS were below

detection levels.To enhance the levels of flavonols in the fruit flesh, a four-gene construct has

been used and concomitant ectopic expression of Petunia CHS, CHI, F3H and FLS in tomato fruit

resulted in increased levels of flavonols in both peel (primarily quercetin glycosides) and flesh

(primarily kaempferol glycosides) (Colliver et al., 2002). When expressed separately, none of

these four genes was sufficient to produce flavonols in the fruit flesh: CHS over-expression

resulted in accumulation of naringenin in the flesh, CHI only affected flavonol levels in the peel,

and F3H and FLS showed no effects on flavonoid levels, neither in peel, nor in flesh. Crossing

experiments with parental single gene transformants revealed that concomitant expression of

both CHS and FLS had a synergistic effect, resulting in accumulation of naringenin- as well as

kaempferol-glucosides in tomato flesh. So, the transgenes that appear to be critical to achieving

flavonol biosynthesis in tomato flesh (pericarp and columella) tissue are CHS and FLS, while CHI

gene activity appears to be the key to flavonol accumulation in the peel tissue (Colliver, 2002;

Verhoeyen, 2002). Furthermore, it can be concluded that, in tomato flesh, ectopic expression of

CHI and F3H are not required for flavonol production. Possibly, this could be due to the

presence of sufficient endogenous CHI enzyme or spontaneous conversion of naringenin

chalcone to naringenin. In addition, preliminary results from in vitro experiments show that FLS

can use naringenin to form kaempferol, suggesting that the FLS enzyme harbours an intrinsic

F3H-like activity as well (Martens et al., 2003; Luka_in et al., 2003).

Also in potato, another Solanaceous crop, several attempts have been made to increase the

flavonoid production in the tubers by introducing structural genes. Over-expression of a

chalcone synthase cDNA from Petunia resulted in an increase in petunidin and pelargonidin-type

anthocyanins in potato tubers.This result could not be obtained, however, with all CHS genes.

For example the cDNA encoding CHS J from barley was not functional in transgenic potato

(Stobiecki et al., 2002; Lukaszewicz et al., 2004). Transgenic potato plants over-expressing a

Petunia cDNA encoding dihydroflavonol 4-reductase (DFR) resulted in an increase of tuber

anthocyanins, namely a 3-fold increase in petunidin and a 4-fold increase in pelargonidin

derivatives. A significant decrease in anthocyanin levels was observed when the plants were

transformed with a corresponding anti-sense construct (Lukaszewicz et al., 2004). In addition, a

lower but still significant increase of anthocyanins was observed after over expressing CHI.

Antisense suppression of the genes encoding CHS and DFR, but not CHI resulted in a significant

27

Cha

pter

1

decrease in anthocyanin content. A likely explanation for the lack of co-suppression with the

Petunia CHI cDNA may be that this cDNA was not homologous enough to repress the

endogenous potato CHI gene (Stobiecki et al., 2002). Alternatively, it is possible that the lack of

reported CHI (co-)suppression could rely on the spontaneous conversion of chalcones to

naringenin even in the absence of CHI enzyme activity (Heller and Forkmann, 1993).

Introducing new pathway branches to crop plants

The previous section gave several examples of how genetic engineering can be used to enhance

or reduce the flux through the endogenous flavonoid pathway in a plant, tissue or organ or even

to activate the whole pathway. In addition, one can target flavonoid synthesis towards branches

that are normally not present in the host plant by introducing foreign genes that branch off from

the existing pathway towards new compounds.

From flavonoid precursors to stilbenes

The flavonoid-related stilbenes are well known for their anti-microbial properties and several

research groups have expressed STS in their favourite host plants to increase disease resistance.

To date, STS genes have been ectopically expressed in rice, tomato, alfalfa, kiwifruit, barley, wheat

and very recently apple (Stark-Lorenzen, 1997; Hain, 1993; Leckband and Lörz, 1998; Kobayashi et

al., 2000; Szanskowski et al., 2003; Giovinazzo et al., 2005). In all cases, expression of STS genes led

to a significant increase in STS enzyme activity, with resveratrol accumulating in transformed

plants. Independent expression of STS genes from three different Vitis ssp. in transgenic kiwifruit

resulted in the production of piceid, the 3-O-glucoside of resveratrol, rather than resveratrol

aglycon. Also in wheat and apple, resveratrol could be detected only after acid hydrolysis,

suggesting that the stilbene produced was accumulated in a glycosidic form. Consequently, the

resveratrol produced by the action of the introduced STS genes seems to be metabolized into

piceid by an endogenous glycosyltransferase (Kobayashi et al., 2000).A clear relationship between

resveratrol and disease resistance could be demonstrated in all transgenic plants except kiwifruit.

In past years, stilbenes have received increasing interest due to their presumed health promoting

properties (Jang et al., 1997; Hall, 2003; Finkel, 2003). Over-expression of STS in crop plants could

therefore be an attractive way to enhance nutritional value. Moreover, recently STS overexpression

in genetically modified tomato was reported to increase the antioxidant activity of red ripe fruits

(Giovinazzo et al., 2005; Morelli et al., 2006).

However, very high constitutive STS expression also has a dramatic influence on flower colour and

pollen development.These undesirable side effects may be due to a competition between CHS and

STS for their common substrates, leading to reduced levels of flavonoids, which may give rise to

male sterility in some species (Ylstra et al.,1992;Van der Meer et al., 1992). Male sterile phenotypes

28

have been reported for STS over-expressing tobacco (Fischer et al., 1997).These plants accumulate

relatively high amounts of resveratrol (up to 400 µg/g fresh weight). In contrast, transgenic wheat

lines with relatively small amounts of resveratrol (2 µg/g fresh weight) were found to be

completely fertile.Therefore it has been proposed that the STS activity in this case may be to weak

to give rise to sterility.The reports mentioned here suggest that the reason for diminished flower

pigmentation and male sterility is competition for the substrates 4-coumaroyl CoA and malonyl

CoA rather than suppression of endogenous CHS expression by STS sequences (Fischer et al,

1997; Fettig & Hess, 1999; Jeandet et al., 2002). More evidence for the hypothesis that the observed

pleiotropic effects in STS over-expressing plants are due to reduced flavonoid levels comes from

partial chemical complementation of the male sterility phenotype by exogenous addition of

flavonols as well as flavonoid precursors from the phenylpropanoid pathway (Fischer et al., 1997).

Increasing the production of isoflavonoids

In plants the occurrence of isoflavonoids is limited to the Leguminoceae. In members of this family

isoflavones have very important functions as inducers of Rhizobium nodulation genes and anti-

microbial phytoalexins. In addition, isoflavonoids are common constituents of the human diet and

are regarded as potentially health-protecting compounds. Some isoflavonoids even exhibit

medicinal properties and there is increasing evidence that these compounds may be protective

against certain forms of cancer (Joung et al., 2003; Sarkar and Li, 2003). These properties

demonstrate that there is a great potential for isoflavonoid engineering, to enhance the nutritional

value of crop plants that normally do not synthesize these compounds (Winkel-Shirley, 2001).

To date, all attempts to produce isoflavonoids in non legumes (Arabidopsis, tobacco and maize), by

over-expression of the soybean IFS gene, have merely resulted in the production of only small

amounts of isoflavones (Liu et al., 2002).These studies have shown that the limited production of

isoflavonoids in non-leguminous plants was mainly due to competition for naringenin between F3H

and IFS rather than a limiting IFS activity (Yu et al., 2000; Liu et al., 2002). This hypothesis is

supported by the recent finding that genistein levels could be increased remarkably by ectopic

expression of IFS in an Arabidopsis F3H mutant line with a reduced flavonol biosynthesis (Liu et al.,

2002). In IFS over-expressing maize cells, detectable levels of genistein could only be observed

when the flux through the pathway, and thereby the availability of substrate, was increased by

additional expression of the chimeric transcription factor CRC (a fusion in which the R protein is

inserted between the DNA binding and activation domains of C1).

The maize CRC transcription factor has also been used to increase isoflavonoid production in

soybean: ectopic CRC expression caused a two-fold increase in isoflavonoid levels of soybean

seeds. A substantial increase of daidzein was observed while genistein levels were decreased,

resulting in only a slight increase in the total isoflavone levels.The observed decrease of genistein

compared to daidzein could be a result of increased transcription levels in the CRC transgenic

29

Cha

pter

1

soybean seeds of (i) CHR, thereby channeling the pathway towards liquiritigenin, the precursor

of daidzein, and (ii) F3H, DFR and FLS which leads to decreased levels of naringenin, the

precursor of genistein, due to competition for the same substrate between F3H and IFS. Co-

suppression of F3H, to block the anthocyanin and flavonol pathway, together with CRC

expression, enhanced the isoflavone accumulation in soybean up to 4 times as compared to wild

type. Only in the presence of CRC, when the flavonoid pathway is up-regulated, F3H co-

suppression led to increased accumulation of isoflavonoids in soybean seeds (Yu et al., 2003).

Similar results have been described earlier for Arabidopsis (Liu et al., 2002).

Chalcone reductase; decision point for deoxy- or hydroxy-flavonoids

In maize cells, expression of the soybean CHR cDNA together with the transcription factor

CRC and IFS led to the synthesis of the deoxy isoflavonoid daidzein in addition to genistein.

Although in vitro studies showed that the IFS enzyme was able to convert liquiritigenin to

daidzein more efficiently than naringenin to genistein, daidzein was present in these cells at

about a 10-fold lower level than genistein.This implies that in the maize cell system the synthesis

of the liquiritigenin substrate, rather than substrate specificity, may be limiting. As a possible

reason for this substrate limitation in the CHR expressing plants it was suggested that the soy

CHR was unable to interact properly with the endogenous maize CHS, resulting in a limited

liquiritigenin production (Yu et al.,2000).

Beside the enhanced nutritional value obtained by increasing isoflavone levels through CHR and

IFS expression, CHR over-expression has also been performed for ornamental purposes. Since

in non-legume plants, the isomerization rate of 6’-deoxychalcones by CHI is much lower than

that of the comparable 6’-hydroxychalcones, modification of plants to produce 6’-

deoxychalcones could be one way to produce stable chalcones, giving more intense yellow

flower colours. Expression of CHR not only leads to the production of of yellow-coloured

6’deoxychalcones, but also prevents the formation of 6’-hydroxychalcones, the preferred

substrate of endogenous CHI (Welle and Grisebach, 1988). In this way, a phenotype with a

‘block’ at the CHI step within the hydroxy flavonoid pathway could be obtained. For example

the pink flowering Xanthi line of tobacco became white to pink by the introduction and

constitutive expression of a CHR gene from Pueraria montana. This was due to a strongly

reduced anthocyanin content in the floral tissues and the production of 5’-deoxyflavonoids

(Joung et al., 2003).Also in Petunia, the flower colour was changed from white to pale yellow or

from deep purple to pale purple by the introduction of CHR. As in Pueraria, the decreased

anthocyanin production and concommittant fading of purple colouration of Petunia flowers

reflects the competition between the endogenous 5’ hydroxy pathway leading to anthocyanins

and the CHR-dependent 5’deoxy pathway leading to deoxyflavonoids (Davies et al., 1998).

30

Pro-anthocyanins

The presence of pro-anthocyanins (PA) or condensed tannins in edible plant tissues has gained

increasing interest, due to the presumed beneficial health effects of these compounds on

animals and human (Dixon et al., 1996; Aerts et al., 1999). The presence of these flavonoid

polymers in forage can contribute to: I) improved efficiency of protein conversion from plant

proteins into animal protein, II) the reduction of greenhouse gasses and III) increased disease

resistance. Furthermore, PA’s and their precursors, the catechins, strongly contribute to the

flavour and astringency of two important beverages: wine and tea. The recent cloning of the

genes required for the biosynthesis of catechins, BAN and LAR, will certainly lead to applications

in crop plants, aimed at enhancing the levels of catechins and the PA's derived thereof. The

isolation of genes encoding the condensing enzymes involved in the synthesis of PA polymers,

if any, is one of the major challenges in the years to come.

Remarks for genetic engineering

The research described above has led to a huge leap forward in our understanding of the

flavonoid biosynthesis. However, despite all the extensive work, there are still challenging tasks

ahead.

The isolation and cloning of most of the structural flavonoid genes opens up possibilities to

develop plants with tailor-made optimised flavonoid levels and composition. However, it will also

be clear that the variation between plant species may lead to complications or unexpected

results in pathway engineering. In addition, there are several pathway branches that are still a

mystery which remain to be unravelled.The pro-anthocyanidin branch is as yet largely unknown,

and the branches leading to the production of flavones or the relatively unknown aurones have

not yet been introduced in transgenic crop plants. Beside this, not much is known about

modifying enzymes and the corresponding genes that are responsible for glycosylation,

methylation and prenylation reactions that are important for flavonoid stability, cellular

distribution, bioactivity and bioavailability.The above mentioned examples are challenging topics

to investigate further in the future.

Nevertheless, several considerations have to be kept in mind with regard to genetic engineering.

First of all, the final result of the engineering is dependent on the approach used (over-

expression or down-regulation). Secondly, it is dependent on the encoded function of the

introduced transgene (a transcription factor or an enzyme).Also the activity of the endogenous

pathway, as well as its regulation, is of great importance.As illustrated earlier, the stimulation of

the flavonoid biosynthesis by the transcription factors LC and C1 in tomato led to the induction

of several flavonoid genes, but was not sufficient to induce F3’5’H activity, which appeared to be

essential for the production of anthocyanins in tomato fruit.The introduction of a new branch

31

Cha

pter

1

point within the existing pathway could interfere with endogenous flavonoid biosynthesis

and/or fail to compete with the endogenous pathway for common substrates. This has been

described in detail for the introduction of IFS into non-leguminous plant species, where

especially F3H appears to prevent the formation of high levels of isoflavonoids (Yu et al., 2000).

Also, the host plant or tissue may be "incapable" of producing certain compounds due to

substrate specificity of endogenous enzymes, as was reported for the tomato DFR that was

restricted in its substrate specificity to dihydromyricetin and thus can only give rise to the

production of delphinidin-type anthocyanins (Bovy et al., 2002).

Finally, it has to be taken into account that flavonoids play an essential role in many

developmental and physiological processes.Although modification of flavonoid biosynthesis may

lead to increased or decreased levels of a desired compound, disruption of the existing pathway

can result in pleiotropic effects.Altered growth patterns, enhanced susceptibility to stress and

a decreased fertility have been described several times (Van der Meer, 1992; Fischer, 1997; et al.,

1992, 1994; Mo et al., 1992; Deboo et al., 1995; Eldik et al., 1997).The use of specific promoters

could be a way to circumvent at least part of these pleiotropic effects.

On top of this, controlling the overall metabolic flux within the targeted pathway and

endogenous competing pathways is a very important aspect to consider when designing

strategies for metabolic engineering.

The concept that the flavonoid pathway may be organized as a multi-enzyme complex was first

proposed by Stafford in 1974 (Winkel-Shirley, 2001). These multi-enzyme complexes, or

metabolons, are organized assemblies that catalyze sequential reactions in a metabolic pathway.

They afford important advantages to the cell in terms of metabolic efficiency, providing the

means to attain high local substrate concentrations, partition of common metabolites between

branch pathways, co-ordinate the activities of pathways with shared enzymes or intermediates

and sequester toxic intermediates (Winkel-Shirley, 1999). Nowadays, a model has been

proposed, in which the phenylpropanoid and flavonoid pathways are organized as a linear array

of enzymes loosely associated at the cytosolic face of the endoplasmic reticulum and anchored

via the cytochrome P450-dependent mono-oxygenases, cinnamate-4-hydroxylase and F3’H

(Hrazdina and Wagner, 1985).Co-immuno-precipitation, affinity chromatography and two-hybrid

experiments indicate that there are direct associations between CHS, CHI, F3H and DFR in

Arabidopsis (Burbulis and Winkel-Shirley, 1999:Winkel-Shirley, 2001; Burbulis et al., 1999). It has

also been suggested that CHS and FLS play a key role in stabilizing a metabolic complex

comprising CHS, CHI, F3H and FLS in tomato flesh tissue (Verhoeyen et al., 2002). Moreover, a

mutation in the Arabidopsis F3’H gene resulted in an altered subcellular localization of CHS and

CHI, again indicating that F3’H may function as part of a membrane anchor for other enzymes

of the flavonoid pathway. Also findings from the early isoflavonoid pathway, in which a direct

interaction between CHS and CHR is involved in pushing the metabolite flow into the iso-

32

flavonoid branch, support the idea of metabolic channelling (Winkel-Shirley, 1999; Dixon &

Steele, 1999). So, in conclusion, it is possible that these metabolic systems, in which catalytic

efficiency and control of end-product specificity can be enhanced by macromolecular

complexes, could complicate metabolic engineering strategies by limiting the access of

substrates to introduced enzymes.

In this paper we have described how different approaches have proven to be more or less

powerful in directing the flavonoid biosynthesis in crop plants by genetic engineering. Results

have illustrated how modern biotechnology can be used as an invaluable tool to gain insight into

the regulation of the flavonoid pathway. In addition to traditional plant breeding, genetic

engineering provides great opportunities to develop plants with the desired levels and/or

composition of flavonoids.

Scope and outline of this thesis

During the last decades the increasing knowledge of the flavonoid biosynthesis in diverse plant

species has led to several approaches to modify the flavonoid pathway in crop plants. These

include overexpression of transcriptional regulators resulting in increased expression of

structural target genes of the flavonoid biosynthesis, introduction of a (partial) block within the

endogenous pathway to prevent production of particular flavonoids or increase intermediate

compounds, as well as the introduction of new pathway branches by the overexpression of

heterologous genes (reviewed in chapter 1).

In this thesis, we aimed to genetically modify the flavonoid pathway in tomato fruit.This research

has been done for two main reasons: First, as a proof of principle to gain more insight into the

flavonoid pathway regulation in tomato and, second, to explore the possibilities to obtain

tomato fruits with improved health related flavonoids.

We have used tomato (Solanum lycopersicum) as model plant for several reasons; I) The flavonoid

pathway is already (partially) active in tomato, resulting in an accumulation of flavonoids in the

fruit peel, II) During the past few years, tomato has been successfully subjected to genetic

modification by several research groups, III) Tomato is a world wide crop, among vegetables

second only after potato, with high commercial importance on the fresh market and processing

industry.

In this thesis we utilized several approaches for metabolic engineering of flavonoid biosynthesis

in tomato. By use of RNAi expression of the endogenous gene encoding chalcone synthase, the

first step specific for the flavonoid pathway, we were able to block the flavonoid biosynthesis in

tomato fruit.

In chapter 3 we describe the use of several molecular tools to identify putative structural target

33

Cha

pter

1

genes of the dicot transcription factors Rosea and Delila and the monocot transcription factors

LC and C1 that were used to increase flavonoid biosynthesis in tomato fruit.

New health related flavonoid classes, that are normally not present in tomato fruit, were

obtained by the overexpression of structural genes derived from other plants species as

described in chapter 4.

In chapter 5, tomato fruits with high levels of flavones and flavonols (described in the previous

chapter) were used in mouse feeding experiments to get more insight in the health beneficial

effects of dietary flavonoids with respect to prevention of cardiovascular disease.

In the summarizing discussion, different aspects of flavonoid pathway engineering in tomato are

discussed and the potential means of manipulating flavonoid biosynthesis and its social relevance

are discussed (chapter 6).

34

Chapter 2

Inhibition of tomato flavonoid biosynthesis

results in parthenocarpic fruits

Elio G W M Schijlen, C H Ric de Vos, Stefan Martens, Harry H Jonker, Faye M Rosin, Jos W

Molthoff,Yury M Tikunov, Gerco C Angenent,Arjen J van Tunen,Arnaud G Bovy.

Submitted

35

Cha

pter

2

Abstract

Parthenocarpy, the formation of seedless fruits in the absence of functional fertilisation, is a

desirable trait for several important crop plants including tomato. Seedless fruits can be of great

value for consumers, processing industry and breeding companies. In this paper we present a

novel strategy to obtain parthenocarpic tomatoes, by down-regulation of the flavonoid

biosynthesis pathway using RNAi mediated suppression of chalcone synthase, the first gene in

the flavonoid pathway.

Although a relation between flavonoids and parthenocarpic fruit development has never been

described, it is well-known that flavonoids are essential for pollen development and pollen tube

growth, and hence play an essential role in plant reproduction. The observed parthenocarpic

fruit development appeared to be pollination-dependent and Chs RNAi fruits displayed impaired

pollen tube growth. Our results lead to novel insight in the mechanisms underlying

parthenocarpic fruit development. The potential of this technology for applications in plant

breeding will be discussed.

36

Introduction

Flavonoids are plant secondary metabolites that are widespread throughout the plant kingdom.

To date, more than 6000 flavonoids have been identified. Based on the structure of their basic

skeleton, flavonoids can be divided into different classes, such as chalcones, flavonols and

anthocyanins (Figure 1). In nature, flavonoids are involved in many biological processes. For

example they act as UV-light scavengers to protect against oxidative damage, as antimicrobial

compounds to defend against pathogens and as pigments in fruits, flowers and seeds where they

have a function in attracting pollinators and seed dispersers to facilitate reproduction (Koes et

al., 1994). Flavonoids are also present in pollen and pistils of many plant species (Wiermann,

1979) and there is increasing evidence showing that flavonoids, at least in some plants, play a

crucial role in fertility and sexual reproduction. For example, inhibition of flavonoid production

in Petunia plants, through antisense suppression of the gene encoding chalcone synthase (CHS),

the first enzyme in the flavonoid pathway (Figure 1), resulted not only in the inhibition of flower

pigmentation, but also in male sterility (Van der Meer et al., 1992). Pollination experiments

revealed that flavonoids in either the anther or pistil are essential for pollen tube growth,

fertilization and subsequent seed set (Ylstra et al., 1992). After cross pollination, the sterile

phenotype could be partly rescued by flavonoids present in the wild type plant. In addition, in

vitro experiments showed that flavonols, in particular kaempferol and quercetin are essential for

pollen tube germination and growth in Petunia and maize (Ylstra et al., 1992, 1996; Mo et al.,

1992). Further evidence for a role of flavonoids in sexual reproduction is provided by the male

sterile Petunia white anther (wha) mutant, which could be complemented by the introduction of

a functional CHS cDNA (Napoli et al., 1999).

In addition to (male) sterility, parthenocarpy, which is defined as the formation of seedless fruits

in the absence of functional fertilisation (Gustafson 1942) is a desirable trait for several

important crop plants.The production of seedless fruits can be of great value for consumers

when directly eaten, but also for the processing industry. Besides this, parthenocarpy is

advantageous when pollination or fertilisation is affected due to extreme temperatures.

Unfortunately, mutations causing parthenocarpic fruits often have pleiotropic effects and can

result in undesirable characteristics such as misshapen fruits (Varoquaux et al., 2000).

In order to obtain more insight in the role of flavonoids in reproduction and fruit development,

we have blocked flavonoid biosynthesis in tomato by RNAi suppression of the gene encoding

chalcone synthase.The resulting transgenic fruits showed a strong decrease of total flavonoid

levels and displayed an altered colour. Surprisingly, these fruits were devoid of seeds.

In this paper we show that engineering of the flavonoid pathway is a novel approach to obtain

parthenocarpic tomato fruits. In addition, we present evidence for a possible mechanism and

discuss potential applications of this technology.

37

Cha

pter

2

38

Figure 1. Schematic overview of the flavonoid biosynthesis pathway in plants.

The pathway normally active in tomato fruit peel, leading to flavonol production, is indicated by solid arrows.

Abbreviations: CHS, chalcone synthase; STS, stilbene synthase; CHI, chalcone isomerase; F3H, flavanone hydroxylase;

FNS, flavone synthase; IFS, isoflavone synthase; FLS, flavonol synthase, F3’H, flavonoid-3’-hydroxylase; F3’5’H, flavonoid-

3’,5’-hydroxylase; DFR, dihydroflavonol-4-reductase; ANS, anthocyanidinsynthase.

Results

RNAi strategy down-regulates Chs gene expression in tomato

In order to down-regulate the flavonoid biosynthesis in tomato, we introduced a Chs-1 RNAi

gene construct (Figure 2) using Agrobacterium-mediated plant transformation. This Chs RNAi

construct was expressed under control of the constitutive enhanced cauliflower mosaic virus

(CaMV) 35S promoter, and therefore it was expected that the transgene effect would not be

restricted to the tomato fruit only, but would also influence the flavonoid pathway in other parts

of the tomato plant.

Biochemical analysis of flavonoid levels

In total 15 PCR-positive transgenic Chs RNAi T0 plants were used for a first biochemical

analysis. Based on HPLC analyses of leaf as well as fruit peel extracts, transgenic plants showing

various degrees of reduced total flavonoid levels could be identified (Figure 3A).

From these primary transformants, four single-copy transgenic lines with strongly decreased

flavonoid levels were selected for further analysis. Of each plant, three cuttings were propagated

and from each individual cutting a sample was collected encompassing at least three ripe fruits.

These samples from transgenic and wild type tomato plants were analyzed for flavonoid content

using HPLC.

The main flavonoids accumulating in WT tomato fruits are naringenin-chalcone and the flavonol

rutin (quercetin-3-rutinoside). In fruits, these flavonoids are predominantly produced in the

peel, since the flavonoid pathway is inactive in flesh tissue (Muir et al., 2001; Bovy et al., 2002).

In peel extracts of Chs RNAi fruits, a large decrease was observed in the levels of both rutin

and naringenin-chalcone when compared with extracts from control plants (Figure 3B+C).

According to the percentage of naringenin chalcone and quercetin derivatives relative to

control plants, lines 24, 39 and 44 were regarded as lines with a "strong" phenotype (< 5% of

total flavonoids left), and line 34 as a "weak" phenotype (approximately 30 % left).

39

Cha

pter

2

Figure 2. Schematic of the tomato Chs RNAi construct.

Transgene expression was under control of the CaMV double 35S promoter (Pd35S) and terminated by the

Agrobacterium tumefaciens nos terminator (Tnos).An inverted repeat was generated by cloning a sense Chs-1 cDNA

fragment (801 bp) followed by the full length cDNA sequence encoding tomato Chs-1 in anti-sense orientation.

40

Figure 3. Comparison of flavonoid levels between Wt and Chs RNAi tomato.

a.Total flavonoid levels in leaf extracts of different Chs RNAi transgenic lines.

b. HPLC chromatograms obtained from non hydrolyzed fruit peel extracts of wild type (upper panel) and Chs RNAi

plants (lower panel). In the control plant the major compounds found are naringenin-chalcone (NC) and the favonol

rutin (R).

c. Percentage of flavonoids in the fruit peel of Chs RNAi plants (lines 34, 39, 44 and 24) relative to the fruit peel of

control tomatoes. Mean control values (mg/kg FW): naringenin chalcone = 212.5, sd 66.5; quercetin derivatives (rutin

+ rutin apioside) = 80.7, sd 11.0.

Chs gene expression analysis

In tomato, Chs is a member of a small multi-gene family comprising at least two genes with high

sequence similarity (Yoder et al., 1994). Gene-specific oligonucleotides were designed to

discriminate between both Chs1 and Chs2 mRNA. The samples used for biochemical analysis

were also used to measure the expression of the endogenous Chs1 and Chs2 genes by real time

quantitative RT PCR.The constitutively expressed tomato gene encoding ribosomal protein L33

was used as internal standard. Expression of this gene was found to be constitutive in DNA

micro-array experiments with Chs RNAi and wild type fruit peel, as well as during different

stages of fruit ripening (data not shown). Compared to wild type, the "strong" Chs RNAi lines

showed a large decrease in expression levels of both Chs1 and Chs 2 (Figure 4). In contrast, a

relatively small decrease in Chs expression was found in fruits of line 34, the "weak" phenotype.

For all lines, the observed decreases in gene expression levels correlated well with the

biochemical data.

41

Cha

pter

2

Figure 4. Quantitative Real Time PCR analysis.

Steady state mRNA levels of tomato Chs1 and Chs2 relative to the housekeeping gene L33 (encoding tomato ribosomal

protein L33) were measured in fruit peel extracts of RNAi (34, 39, 44 and 24) and control lines. Expression levels in

control were set to 100%.

A similar decrease was found in CHS enzyme activity (Figure 5). The strong Chs RNAi lines

appeared to have the lowest CHS activity and product levels (reduced to 2 % of wild type

values) whereas most remaining activity was found in line 34. In fruits derived from reciprocal

crossing the presence of CHS activity was related to the (WT) maternal genotype, giving rise

to fruit peel tissue.

42

Figure 5. CHS enzyme activity.

a).Autoradiography scan of extraction of CHS assays developed on cellulose plates in CAW. Left panel showing CHS

activity of tomato fruit peel in different Chs RNAi and control lines. Right panel showing CHS activity in fruits obtained

after (reciprocal) crossings between WT and Chs RNAi.

b). Densitometric scans of profiles of selected assays. The peak representing the CHS reaction product Naringenin

(NAR) peak is indicated.

Phenotypic characterization of Chs RNAi tomatoes

The Chs RNAi tomato plants were phenotypically similar to wild-type with respect to the

vegetative tissues. However, all the "strong" Chs RNAi plants showed a delayed fruit

development and yielded smaller fruits (Figure 6). In addition, ripe fruits derived from Chs RNAi

plants were reddish and the colour of their peel was dull (Figure 7b and c), in contrast to wild

ripe fruits that are more orange-red and shiny (Figure 7a).The more intense red colour of Chs

RNAi fruits was most probably due to the reduction in the levels of the yellow-pigmented

naringenin-chalcone, normally present at high levels in epidermal cells of the ripening fruit (Hunt

and baker, 1980). Interestingly, chalcone isomerase (Chi) overexpressing fruits display reduced

naringenin chalcone levels, amore intense red colour and a dull appearance as well (Muir et al.,

2001).This suggests a relationship between flavonoids and fruit dullness.To investigate the dull

appearance of the fruit peel in more detail, red wild type and Chs RNAi fruits were subjected

to electron microscopy analysis. The epidermal cell layer of the wild type fruits consisted of

intact cells with a typical conical shape (Figure 8a and b) which normally confers the properties

of higher light absorption and velvet sheen.The absence of this conical cell surface in Chs RNAi

fruits could be an explanation for the dullness, as was described for the Antirrhinum majus (mixta)

and the Petunia (mybPh1) mutants (Noda et al., 1994; van Houwelingen et al., 1998; Mol et al.,

1998) in which the fainter petal colours also resulted from flattening of the epidermal cells.

Furthermore, the fruit surface of the Chs RNAi plants consisted of dead epidermal cells that

were empty, as shown by the scanning EM freeze-fraction cross view (Figure 8c and d).A similar

collapsed ‘flat tyre’ appearance of epidermal cells was observed in petals of the Petunia shrivelled

up (shp) mutants and led to a drastic change of flower color (Mol et al., 1998).

43

Cha

pter

2

Figure 6.Tomato fruit weight in grams (black bars) and fruit size at equatorial cross section in mm (grey bars).Values

represent are mean values ± sem.

Control (WT), n=10; Chs RNAi line 34, n=4; line 44, n=15; line 24 and 39, each n=14.

Parthenocarpic fruit development

A more detailed investigation of the fruits revealed that the majority of the transgenic lines

tested produced parthenocarpic fruits, containing no seed at all ("strong" phenotypes) or

arrested seed set at early stages of development ("weak" phenotypes).Within each line, the fruit

phenotype was quite constant, but between different transgenic lines the phenotype varied

considerably. Like in many parthenocarpic plants (Falavigna et al., 1978; Abad et al., 1989)

undersized, misshapen or hollow fruits were also found in Chs RNAi tomato.At the end of the

growing season the Chs RNAi phenotype appeared to be more extreme in terms of very small

fruit size for some lines when compared to wild type fruits (Figure 7d).

Fruits of some Chs RNAi plants contained no jelly and were completely filled with "flesh". An

overview of all the phenotypes found is shown in Figure 7.

44

Figure 7. Overview of different phenotypes found in Chs RNAi tomatoes compared with wild type.

a) Typical ripe wild type tomato fruits are shiny and orange red, in contrast to dull, smaller and more reddish Chs RNAi

fruits (b, c and d; line 24, 34 and 39 respectively). Fruits derived from flowers that were pollinated with wild type pollen

(arrow) grew to normal size and obtained their shininess (d).Transgenic lines 44 and 34 yielded extreme small fruits

and ‘fruit caves’ when compared to wild type (e). In parthenocarpic Chs RNAi fruits seed development was disturbed

(g) or totally absent (h and i), whereas wild type fruits had a normal seed set (f). Colour figure on p.155

Plant pollen tube growth and fertility

Since flavonoids were shown to play an essential role in pollen germination and pollentube

growth in Petunia and maize (Ylstra et al., 1992, 1996; Mo et al., 1992) we investigated whether

these processes were affected in Chs RNAi plants as well. Fertilized carpels of wild type, Chs

RNAi (line 24), and reciprocal crossed plants were histochemically stained specific for callose

present in growing pollen tubes 2 days after pollination. In wild type self pollinated plants pollen

tubes reached the ovules 2 days after pollination (Figure 9b, f and j). Within the same time

period, pollen tubes of Chs RNAi self pollinated plants germinated, but did not grow well. In

these plants, callose staining was clearly visible in the stigma and absent further down the style,

indicating an inhibited pollen tube growth (Figure 9 d, h and l). Pollen tube growth could be

(partially) rescued by crossing wild type and Chs RNAi plants in both directions. Pollen tube

growth in wild type female plants pollinated with Chs RNAi pollen reached the base of the style

2 days after pollination (Figure 9b, f and j).The reciprocal crossing, i.e. Chs RNAi pistils pollinated

with wild type pollen, was less efficient (Figure 9c, g and k). Here, the pollen tubes grew only to

about 9/10 of the way down the style and some of the tube tips were swollen.

45

Cha

pter

2

Figure 8. Electron microscopy photograph of epidermal cells of red ripe tomato fruits.A and C: surface view; B and D:

cross section.Wild type (A and B) fruits contain conical shaped cells on the epidermal surface, whereas in Chs RNAi

(C and D) fruits the epidermal cell layer is disturbed (absence of conical shapes and ‘empty cells’).

46

Figure 9: Histochemical staining of WT and Chs RNAi (line 24) pollen tube growth in carpels 2 days after pollination.

Fertilized carpels were stained with aniline blue to specifically stain callose present in growing pollen tubes.A, E, and I

are WT carpels crossed with WT pollen; B, F, and J are WT carpels x Chs RNAi pollen; C,G, and K represent Chs RNAi

x WT; finally D, H, and L are Chs RNAi self crossings.A-D show pollen at the stigma. Note in D, callose in the pollen

tubes is still visible at the stigma (arrow), indicating inhibited growth. E-H, proliferation of pollen tube growth in the

middle of the style, except for H which is only 1/4 of the way down the style from the stigma. No pollen tubes were

visible in the middle of the styles from Chs RNAi selfed plants. I-L, pollen tube growth at the base of the style, except

K which grew only 9/10 of the way down the style. In K, the tips of the pollen tubes are swollen (arrow). Pollen tubes

are not visible at the base of the style in K (not shown) or L.All micrographs are the same magnification.

Several cross-fertilised flowers were allowed to give fruits to see if the rescued pollen tube

growth was able to yield fruits with normal seed production (Table I). Seed production was fully

rescued when wild type female plants were pollinated with Chs RNAi pollen.Wild type pollen

was also able to give rise to seed production in Chs RNAi female plants, however this was less

efficient. Interestingly, the size of fruit obtained after Chs RNAi flowers were pollinated with wild

type pollen increased to normal and the fruits gained their velvet sheen, although they were still

more reddish, due to the absence of naringenin chalcone (figure 7d). It is likely that seed set and

fruit shininess result from complex interactions between more development factors.Apparently

flavonoids present in wild type pollen are sufficient to give rise to seed set, and possibly they

also trigger directly or indirectly signals involved in fruit peel formation.The wild type flowers

that were pollinated with Chs RNAi pollen gave rise to fruits that were indistinguishable from

normal wild type fruits.

Table I.

Fruit seed set (mean ± s.d.) subsequent to crossings between WT and Chs RNAi tomato line 39 and 44.

( x ) WT x WT 39 x WT 44 x WT WT x 39 WT x 44

Seeds per fruit 121 ± 47 35 ± 8 57 ± 22 121 ± 41 129 ± 22

Fruits (n) 4 6 7 8 5

Transgene stability and offspring

A few offspring plants (F1) obtained from transgenic line 34 and several obtained from crossings

of Chs RNAi with wild type plants were selected for further evaluation of inheritance stability

of the transgene. The low flavonoid phenotype was shown to segregate with the Chs RNAi

transgene in all plants tested (n=8).The segregation of the transgene could already be seen in

light stressed seedlings. Non transgenic seedlings accumulated anthocyanins in stems and leaf

axis when grown under high light conditions and became purple. In contrast, in Chs RNAi

transgenic seedlings the inhibition of flavonoid biosynthesis resulted in the absence of

anthocyanins.Also in fruits of the transgenic offspring the total flavonoid levels remained very

low (less than 1% of non transgenic fruits, data not shown).

Discussion

In this study we have shown that the flavonoid pathway in tomato can be efficiently down-

regulated by RNAi-mediated suppression of chalcone synthase gene expression. In fruits, this

led to a strong decrease in expression of both Chs1 and Chs2 genes and CHS activity. As a

47

Cha

pter

2

consequence, an up to 99% reduction in total flavonoids was measured.This was mainly due to

reduced levels of naringenin chalcone and rutin, the predominant flavonoids in tomato peel. Chs

RNAi fruits showed a dull appearance and altered fruit colour, due to aberrations in the

epidermal cell layers. Also pollen development was hampered, resulting in a strongly reduced

seed set. Surprisingly, all strong Chs RNAi lines yielded parthenocarpic fruits.We suggest the use

of Chs RNAi as a novel approach to obtain this desirable trait in plants.

Although a relation between flavonoids and parthenocarpic fruit development has never been

described, it is well-known that flavonoids present in the sculptured cavities of the pollen exine,

the so called pollen coat (Edlund et al., 2004), are essential for pollen development, germination

and pollen tube growth and hence play an essential role in plant reproduction. For example,

mutation of the two Chs genes in maize as well as the Petunia white anther (wha) mutant resulted

in white, flavonoid-lacking pollen that showed to be sterile. Furthermore, Petunia plants

harbouring a complete block of flavonoid production due to anti-sense Chs or sense Chs co-

suppression had white flowers and were male sterile (Van der Meer et al., 1992; Napoli et al.,

1999).

Especially flavonoids belonging to the class of flavonols have been shown to have strong

stimulatory effects on pollen development, germination, pollen tube growth and seed set (Ylstra

et al., 1992, 1996; Mo et al., 1992). The inability of pollen from the sterile wha mutant to

germinate normally could be complemented by the introduction of a functional Chs transgene

(Napoli et al., 1999) or by flavonol addition.When applied to Wt stigmas, tube growth of Chs

deficient sterile pollen and seed set could be partly rescued (Mo et al., 1992;Taylor et al., 1992).

This has led to the assumption that Chs deficient pollen lacks factors that are required for pollen

tube growth and that Wt stigmas can functionally complement with these factors (Mo et al.,

1992).

In accordance to this, we observed that pollen tube growth was also strongly inhibited in self-

pollinated Chs RNAi tomato plants, leading to parthenocarpic fruit development. Since both

male and female Chs RNAi parents were hemizygous, and hence produced gametes segregating

for the transgene, the observed effects on pollen tube growth, seed set and parthenocarpic

development are probably determined by parental tissues. The tapetum, and consequently

pollen wall assembly, as well as the maternal tissues such as stigma and the style can play crucial

roles in functional pollen rehydration, polarization and pollen tube migration into the stigma.

Control of these processes likely requires constant interaction between pollen tube and stigma

(Mascarenhas 1993; Edlund et al., 2004).

Pollen tube growth and seed set was fully rescued when CHS deficient pollen was applied on

WT stigmas. The reciprocal crossing (WT pollen on Chsi stigmas) resulted in only a partial

rescue of pollen tube growth and seed set, indicating that in Chs RNAi tomatoes, fertilisation is

mainly diminished due to the lack of flavonoids in the female reproductive organ.

48

Pollination appeared to be required for parthenocarpic fruit development in Chs RNAi lines,

since in the absence of pollination no fruits were obtained. This suggests that pollination is

required and sufficient to trigger fruit setting and that fertilization and subsequent seed set are

key determinants for normal fruit development and expansion.

Hormones play an important role in regulating fruit development. It is well known that pollen

produces gibberellins and that application of gibberellins can induce an increase in the content

of auxin in the ovaries of un-pollinated flowers of the tomato plant, thereby triggering fruit set

in the absence of fertilisation (Sastry and Muir, 1963).A crucial role for auxin in seedless tomato

fruit formation was directly demonstrated by ovule-specific over-expression of bacterial auxin

biosynthetic genes (Rotino et al., 1997). During normal fruit set, auxins are produced by the

pollen tube as it grows through the style and later on by the embryo and endosperm in the

developing seeds.The latter two sources of auxin are clearly diminished or even absent in Chs

deficient parthenocarpic tomato plants, suggesting that these auxin sources are not required to

induce fruit setting, but may be important in later stages of fruit development, such as fruit

expansion.

A possible direct role for flavonoids in auxin distribution and GA synthesis has been proposed

by several research groups. For example, loss of CHS activity in Arabidopsis causes an increase

in polar auxin transport (Brown et al., 2001). It is possible that reduction in flavonoid levels in

Chs RNAi tomatoes affects hormone synthesis, stability or distribution, thereby leading to

pathenocarpic fruit development. Such an interaction, however, remains to be demonstrated.

Several tomato mutant genotypes resulting in parthenocarpic fruit growth have been described

of which pat (Mazzucato et al., 2003), pat2 (Philouze et al., 1978) and pat3, pat4 (Nuez et al.,

1986) are the best characterised. In contrast to the Chs RNAi tomato, parthenocarpic fruit

development of all these pat mutants is independent of pollination. At least some of these

mutants (pat2, pat3 and pat4) contain increased GA levels in their parthenocarpic fruits,

suggesting that the ability of these mutants to develop parthenocarpic fruits is due to alterations

in GA metabolism (Fos et al., 2000, 2001).

In this paper we described the effect of decreasing flavonoid levels in Chs RNAi transgenic

tomato plants on pollination, fertility and fruit development. This approach provides a new

method to obtain pathenocarpic fruits. For a succesful commercial application of this

technology it is an essential prerequisite that these parthenocarpic fruits have a good taste.To

address whether or not the parthenocarpic phenotype dramatically affects fruit taste, we

measured the levels of the most important taste and flavour-related tomato metabolites

(sugars, organic acids and 16 volatiles (Yilmaz, 2001; Ruiz et al., 2005) in Chs RNAi and Wt

tomatoes. For both Wt and Chs RNAi fruits, the levels of flavour-related volatile compounds fell

well within the variation observed in a collection of 94 commercially available tomato cultivars

(Tikunov et al, 2005). Similar results were obtained for sugars (sucrose, fructose and glucose)

49

Cha

pter

2

and organic acids (citric acid and malic acid) (results not shown), suggesting that these

parthenocarpic tomatoes potentially have a normal tomato-like taste.

For commercial applications, controllable parthenocarpic fruit development with minimal side

effects would be of great value. The latter could be achieved by using flower or early fruit-

specific promoters to drive Chs RNAi gene expression. Inducible parthenocarpy could be

achieved by using inducible promoters, such as the ethanol-inducible alc gene expression system

(Deveaux et al., 2003). As an alternative to the Chs RNAi approach, parthenocarpic fruit

development can also be achieved by overexpression of the grape stilbene synthase gene.The

stilbene synthase enzyme competes with chalcone synthase for the same substrates and

overexpression resulted in decreased flavonoid levels and male sterile pollen in tobacco (Fisher

et al., 1997). Using this strategy, we observed a significantly decreased seed set in tomato fruits

(Schijlen et al., 2006).

Even more desirable for the breeding industry may be the development of parthenocarpic

tomato lines with inducible seed set rather than inducible parthenocarpy. For example, seed set

in parthenocarpic Chs RNAi plants could be rescued by stimulating the flavonoid pathway

through inducible over-expression of the transcription factors LC/C1 (Bovy et al., 2002) in Chs

RNAi lines.

This is the first report demonstrating the use of a flavonoid gene to induce parthenocarpic fruit

development in tomato. The strict requirement for pollination to obtain parthenocarpic fruit

development suggests a close mechanistic link to the essential role flavonoids play in pollen

development. Further research is needed, however, to better understand the role of flavonoids

in hormone-related processes such as parthenocarpic fruit development.

Experimental protocol

Plasmid construction

A full length cDNA encoding tomato (Solanum lycopersicum) naringenin-chalcone synthase-1

(Chs1; X55194) was obtained from a cDNA library of tomato fruits.

Two oligonucleotides, CHS-3’BamHI (GGATCCACTAAGCAGCAACAC) and CHS-5’SalI

(GTCTCGTCGACATGGTCACCGTGGAGGA) were used to introduce a BamHI restriction

site at the 3’end and a SalI site at the 5’end of the Chs-1 sequence. The PCR product was

digested and ligated as a BamHI / SalI fragment into pFLAP50, a pUC derived vector containing

a fusion of the double CaMV 35S promoter (Pd35S) and the Agrobacterium tumefaciens nos

terminator (Tnos). The resulting plasmid was designated as pHEAP-02. To create an inverted

repeat construct a sense cDNA fragment was cloned between the promoter sequence and the

anti-sense Chs-1. Therefore an 801 bp fragment was obtained by PCR amplification using two

primers with restriction sites for BglII (forward primer CCCAGATCTATGGTCAC

50

CGTGGAGGAGTA; reverse primer CCCAGATCTTCACGTAAGGT GTCCGTCAA). The

BglII digested PCR fragment was cloned in the BamHI digested plasmid HEAP-02 resulting in the

plasmid pHEAP-17. The Pd35S-Chs1 inverted repeat-Tnos construct was transferred as a

PacI/AscI fragment into pBBC90, a derivative of the plasmid pGPTV-KAN (Bovy et al., 2002) and

the final binary plasmid was designated pHEAP-20.

Plant transformation

The plasmid pHEAP-20 was transferred to A.tumefaciens strain COR308 by the freeze-thaw

method (Gynheung et al., 1988). The Agrobacterium mediated tomato (hypocotyls)

transformation (cv. Money maker) was performed according to the standard protocol (Fillati et

al., 1987). Kanamycin-resistant shoots were transferred to the greenhouse to grow on rock

wool.The transgenic status of the plants was confirmed by PCR specific for the introduced gene

and by Southern blot hybridisation (DIG labeling, Roche). Plants were allowed to self-pollinate

in order to give fruits and offspring.

For further analysis (HPLC,DNA and RNA) fruits were harvested when visually ripe. From each

plant at least three fruits were pooled for extraction to minimize sample variation.The fruit peel

(approximately 2mm consisting of cuticula, epidermis and sub-epidermis) was separated from

the flesh tissue (i.e. columella; jelly parenchyma and seeds excluded) and immediately frozen in

liquid nitrogen. Beside fruit material also young leaves were collected and frozen in liquid

nitrogen to store at -800C for later use.

HPLC analysis

Flavonoid content was determined both as glycosides and aglycons by preparing non-hydrolyzed

and acidic-hydrolyzed extracts respectively. Non hydrolyzed extracts were prepared in 75%

aqueous methanol using 15 minutes of sonication. Subsequent HPLC of the extracted flavonoids

was performed with a gradient of 5 to 50% acetonitrile in 0.1% formic acid.Absorbance spectra

and retention times of eluting peaks were compared with those of commercially available

flavonoid standards (Apin chemicals, Abingdon, UK). Analysis of flavonoids in the extracts was

performed by reverse phase HPLC (Phenomenex Luna 3mm C18, 150 * 4,50 mm column, at

400C) with photodiode array detection (Waters 996).

RNA isolation

Total RNA was isolated from tomato fruits as described previously (Bovy et al., 1995).After

DNAse-I treatment and RNeasy column purification (Qiagen GmbH), the total RNA yield was

measured by Absorption at 260 nm.To determine the RNA quality, a small amount (1 µg) of

each sample was evaluated on a 1% TAE agarose gel.

51

Cha

pter

2

RT-PCR gene expression analysis

Real time quantitative (RT) PCR analysis was performed to test the effect of the anti-sense

transcript on the endogenous gene expression levels of CHS. TaqMan sequence detection

primers were designed based on the published Chs sequences from tomato (Chs1; X55194 and

Chs2; X55195) by use of the SDS 1.9 Software (Applied Biosystems). The designed primer

combinations (table II) were synthesised by Applied Biosystems.Two µg total RNA was used for

cDNA synthesis using Superscript II reverse transcriptase (Invitrogen) in a 100 µl final volume

according to the standard protocol.The ABI 7700 sequence detection was used to measure the

gene expression of each gene in triple in the presence of the fluorescent dye SYBR-Green.The

expression of the genes Chs1 and Chs2 was related to the constitutively expressed gene

encoding ribosomal protein L33 (TC85035). Calculations of the expression in each sample were

carried out according to the standard curve method (PE Applied Biosystems).

Table II. Oligonucleotides used for SYBR Green RT-PCR analysis.

Gene ID Oligo name Sequence

TC85035 Le L33-259 F 5’ CGC ACT ATC GTT GCA TTT GG 3’

Le L33-315 R 5’ CAA CGC CAC TGT TTC CAT GT 3’

X55194 Chs1-505 F 5’ ATG CCC GGG TGT GAC TAC C 3’

Chs1-556 R 5’ CTG ATG GGC GAA GCC CTA G 3’

X55195 Chs2-1013 F 5’ GGC CGG CGA TTC TAG ATC A 3’

Chs2-1063 R 5’ TTT CGG GCT TTA GGC TCA GTT 3’

Enzyme assay

Naringenin (NAR) was from Roth (Karlsruhe, Germany). [2-14C] malonyl-CoA (spec. act. 53

mCi/mmol) was from Hartmann Analytic (Braunschweig, Germany). 4-coumaryol-CoA was a

gift from W. Heller (Neuherberg, Germany). [4a, 6, 8-14C] NAR) was prepared as described in

Martens et al. (2006) using recombinant chalcone synthase and chalcone isomerase.

Radioactivity incorporated in labeled substrate was quantified by scanning sample aliquots after

migration on cellulose plates (Merck, Darmstadt, Germany) using a bio-Imaging Analyzer Fuji

BAS FLA 2000 (Raytest, Straubenhardt, Germany) and by direct szintilation counting (LKB

Wallac 1214 Rackbeta, PerkinElmer Wallac,Turku, Finland).

Proteins were extracted from grounded fruit tissue as follows: 200 mg tissue was homogenized

with 100 mg sea sand, 200 mg Dowex 200-400 mesh (äquil. 0,1 M Tris-HCl, pH 7,5) in 1 µl 0,1

M Tris-HCl, pH 7,5 containing 20 mM sodium ascorbate. After two centrifugation steps at

10.000 x g (Sorvall RMC 14, Du Pont Nemours GmbH, Bad Nauheim, Germany), for 5 min at

4°C, the resulting supernatant was directly used for CHS assays. Protein concentration was

52

determined according to Bradford (1976), using BSA as a standard. For each sample two

independent preparations were performed.

Standard assays for CHS was performed in a final volume of 200 µl and contained : 140 µl 0.1

M Tris-HCl, pH 7.5, 50 µl crude extract (8 – 22 µg protein), 5 µl [2-14C] malonyl-CoA (1,5 nmol;

~1800 Bq) and 5 µl 4-coumaroyl-CoA (1 nmol).After incubation reactions were stopped and

extracted twice with 100 µl ethyl acetate.The pooled EtOAc phase from each assay was directly

subjected to szintilation counter for quantification or chromatographed on cellulose plates with

either CAW (chloroform : acetic acid : water; 50 / 45 / 5) or 15% acetic acid. For each enzyme

preparation CHS assays were performed in triplicate. Labeled products were localized and

quantified by scanning the plates as above described. Product identification was done by co-

chromatography with authentic samples.

In vivo pollen tube growth

Mature closed flowers were emasculated and pollinated.Two days after pollination (dap), pistils

were harvested and incubated overnight at 600C in 1 M KOH. After rinsing with water, pistils

were transferred to a microscope slide and stained with 0.005% aniline in 50% glycine. A

coverslip was placed on top and pressed gently. Callose in the pollen tubes was visualized by

UV light on a Zeiss Axioskop microscope, photographed using 400 ASA film. Slides were

scanned with an AGFA duoscan scanner.

Cryo-Scanning Electron Microscopy

Small samples of material were dissected from fresh fruits, mounted on a stub, and subsequently

frozen in liquid nitrogen. The samples were further prepared in an Oxford Alto 2500 cryo-

system (Catan, Oxford, UK), and then analysed in a JEOL JSM-6330F field emission electron

scanning microscope (JEOL,Tokyo, Japan).The frozen samples were fractionated inside the cryo

system for cross-views.

53

Cha

pter

2

54

Chapter 3

Transcriptional regulation of flavonoid

biosynthetic genes by Rosea and Delila in

anthocyanin producing tomato fruits

Elio G W M Schijlen, Eugenio Butelli, C H Ric de Vos, Harry H Jonker, Robert Hall,

Cathie Martin,Arjen J van Tunen and Arnaud G Bovy.

To be submitted

55

Cha

pter

3

Abstract

Tomato cv microtom overexpressing the Antirrhinum flavonoid transcription factors Rosea and

Delila are characterized by high levels of anthocyanins in their fruits.The aim of this study is to

get more insight into the transcriptional regulation of flavonoid biosynthesis of tomato fruits

overexpresssing different flavonoid transcription factors. Using various genetic tools, i.e.

subtraction library, DNA micro-arrays and RT-PCR analysis, we identified the target genes of the

Rosea and Delila transcription factors in tomato.These were compared to the target genes of

the monocot transcription factors LC and C1, which lead to the production of flavonols rather

than anthocyanins when expressed in tomato fruit.

The most striking difference between Ros/Del and LC/C1 plants is the strong upregulation of

the F3’5’H gene in Ros/Del plants and the lack of induction of this gene in LC/C1 plants. In

addition, in comparison with LC/C1 fruits, Ros/Del plants showed increased expression levels

of the phenylpropanoid genes PAL and C4H, and likewise accumulated higher levels of

phenylpropanoids.

56

Introduction

Anthocyanins are the largest group of water-soluble purple, red, and blue plant pigments,

common to many flowers, fruits and vegetables. They form a class of flavonoid end products,

and therefore belong to the huge family of polyphenolic secondary metabolites.

Although anthocyanins have a common C6-C3-C6 carbon structure, called the flavan nucleus,

they can be divided into distinct subclasses, based on the hydroxylation pattern of the ‘‘B’ ring,

the type of glycosidic subunits, and acyl substitution of the sugar moiety (Holton and Cornish.,

1995).The structure of anthocyanins, in particular the number of hydroxyl groups on the B-ring

and the modification with aromatic acyl groups, affects their final color.This shifts towards more

blue when the number of hydroxyl groups on the B-ring, as well as the number of attached

aromatic acyl groups increase (Goto 1987). Usually, anthocyanins are synthesized in the

cytoplasm and stored within vacuoles of plant cells (Tanaka et al. 2005).

Traditionally the biosynthetic pathway leading to the production of the anthocyanin pigments

received a lot of attention and appeared to be very useful as a model system for genetic

research. For example, in Mendel’s study on the inheritance of genes responsible for pea seed

coat colour, and in the research leading to the discovery of transposable elements interrupting

maize pigment biosynthetic genes by McClintock (McClintock 1967; Lloyd et al., 1992; Koes et

al., 1994).

To date, the flavonoid pathway leading to anthocyanins is one of the best studied biosynthetic

pathways. Using pigmentation mutants of various plant species, nearly all structural genes

belonging to the central flavonoid pathway have been identified (Mol et al., 1998;Winkel-Shirley,

2001). In addition to these structural genes, regulatory genes controlling pigmentation intensity

and pattern have been identified.

In general, the isolated regulatory genes can be divided into MYB and c-MYC (basic-Helix-Loop-

Helix) transcription factors, according to their vertebrate homologues (Mol et al., 1998).There

is a remarkable sequence homology between the flavonoid transcription factors from different

plant species, indicating that they are derived from a common ancestor (Koes et al., 1994). Some

of these transcription factors have already been successfully expressed ectopically in various

transgenic plant species such as tobacco, tomato and Petunia. In many cases this resulted in

elevated levels of flavonoids and revealed that these transcription factors have been functionally

conserved among plant species during evolution (Koes et al., 1994; Quattrochio et al., 1993). In

various plant species, tissue-specific regulation of structural flavonoid genes is controlled by a

combination of regulators from these two transcription factor families.

Of these regulators, the maize MYB type C1 and the MYC type LC are among the best

characterised. Although expressing the C1 gene alone had no effect on anthocyanin

accumulation in several plant species including tobacco, Arabidopsis, petunia and tomato (Lloyd

57

Cha

pter

3

et al., 1992; Bradley et al., 1998;Goldsbrough et al., 1996), expression of LC resulted in enhanced

pigmentation of tissues that are normally capable to produce these pigments. In LC over-

expressing cherry tomato plants, anthocyanins accumulated in leaves, stems, sepals, petal, main

vein and, to a lesser extent, in developing green fruits (Goldsbrough et al., 1996). Simultaneous

overexpression of LC and C1 resulted in a dramatic increase of flavonoid levels in the flesh of

tomato fruit, a tissue that normally does not accumulate any flavonoids. In this case, the fruits

mainly accumulated glycosides of the flavonol kaempferol, but remarkably no anthocyanins.

(Muir et al., 2001; Bovy et al., 2002;Verhoeyen et al. 2002).

From the dicot plant Antirrhinum, three anthocyanin regulatory genes – Delila, Eluta and Rosea –

have been identified. The Antirrhinum gene Delila, a MYC (bHLH) homologue, is required for

pigmentation. The first two steps of the endogenous flavonoid pathway, chalcone synthase

(CHS) and chalcone isomerase (CHI), show minimal regulation by Delila, but the subsequent

steps leading to pigmentation have an absolute requirement for the Delila gene product and

show quantitative regulation by Eluta and Rosea (Martin et al., 1991).

Over-expression of Delila in tobacco and tomato affected only the flowers in tobacco and

resulted in enhanced pigmentation of vegetative tissues in tomato (Mooney et al., 1995).

In recent years, increasing anthocyanin content in food products has become an attractive

target, since anthocyanins are good antioxidants and therefore proposed healthy nutrients

(Beekwilder et al., 2005; Butelli et al., 2006). In addition they have an attractive, recognizable

colour.Tomato (Solanum lycopersicum) fruit usually does not contain any anthocyanins, although

some related solanaceous species (i.e. egg plant), as well as the fruits of the tomato Aft mutant

do (Jones et al., 2003).

Using genetic engineering strategies, several attempts have been made to enhance anthocyanin

production in tomato fruits. For example, overexpression of the tomato MYB transcription

factor gene ANT1, a regulator of anthocyanin biosynthesis, resulted in up-regulation of the

flavonoid pathway and led to anthocyanin production in both vegetative tissues as well as

tomato fruits (Mathews et al., 2003). Recently, production of high anthocyanin levels in the fruits

of tomato cultivar microtom was accomplished by combined and fruit-specific overexpression

of the Antirrhinum transcription factors Rosea and Delila (Butelli et al.2006, in preparation).

However, despite the identification and characterization of several regulators of pigmentation

in various plant species, it is evident that the regulation of pigmentation is complex and that our

current understanding of these biological processes is still limited.The aim of this study is to

get more insight into the transcriptional regulation of the flavonoid biosynthetic pathway by the

transcription factors Rosea (Rosea-1: Schwinn et al., 2006) and Delila in transgenic tomato fruit.

Using various genetic tools, we identified the target genes of the Rosea and Delila transcription

factors in tomato. These were compared to the target genes of the monocot transcription

58

factors LC and C1, which lead to the production of flavonols rather than anthocyanins when

expressed in tomato fruit. This revealed the molecular basis for the metabolic differences

observed between tomatoes overexpressing these dicot or monocot transcription factors and

led to the identification of the gene crucial for anthocyanin production in tomato fruits.

Results

Biochemical analysis of Ros and Ros/Del tomato fruits

In this study we compared gene expression patterns of tomato fruits overexpressing the

Antirrhinum transcription factor gene Rosea alone (plant line Ros X), or in combination with

Delila (plant lines Ros/Del Y, Ros/Del C, Ros/Del N and Ros/Del Z). Biochemical analysis

revealed that in normal microtom fruits, the major flavonoids present are naringenin chalcone

and quercetin rutinoside (Figure 1). In fruits overexpressing the Rosea transcription factor only,

an increased content of phenolic acids and their glycosides was observed (mainly caffeic acid,

glucosides of ferrulic acid and caffeic acid, as well as two unidentified phenolic compounds;

Figure 1 upper panel). Fruits overexpressing both Rosea and Delila were deep purple in colour

(Butelli et al., 2006) due to a tremendous accumulation of anthocyanins in addition to the

above-mentioned phenolic compounds (Figure 1, lower panel).

59

Cha

pter

3

Figure 1

Max plot showing phenolic compounds as detected by HPLC analysis in Rosea overexpressing fruits compared to wild

type (A) and Rosea/Delila overexpressing tomato fruits compared to wild type (B). Colour figure on p.156

Of these anthocyanin accumulating lines N contained the highest levels of anthocyanins,

followed by line C,Y and Z. Interestingly, no clear effect of Rosea or Rosea/Delila was found on

the flavonols quercetin or kaempferol (data not shown). A typical max plot, showing a

chromatogram at absorbance maximum for each phenolic compound, of Rosea only and

Rosea/Delila fruits compared with wild type tomato fruits is given in Figure 1.

Gene expression analysis of Ros and Ros/Del fruits

In order to identify potential target genes of the Rosea and Delila transcription factors, three

different molecular strategies were used: (i) identification of differentially expressed genes using

a subtraction library, (ii) gene expression analysis using dedicated oligonucleotide micro-arrays,

and (iii) SYBR-green RT-PCR analysis of selected genes to confirm the micro-array results.These

will be discussed below.

In order to determine possible target genes of the combined transcription factors Rosea and

Delila, a subtraction library was made, using a mix of Ros/Del fruits (line N) harvested at different

ripening stages, which was subtracted from a comparable batch of WT fruits, and vice versa.This

subtraction library was used to identify genes which were differentially expressed in Rosea/Delila

overexpressing tomatoes relative to WT, using dot blot analysis. Randomly selected SSH clones

(96), supposed to be overexpressed in the Rosea/Delila fruits, were hybridized to labelled total

cDNA isolated from either Ros/Del or WT fruits. Differentially expressed clones (96) were

sequenced. The relative abundance of each sequenced clone was counted and its expression

level (relative to WT) was estimated (Table I). When compared to the wild type fruits, the

expression levels of many structural flavonoid biosynthetic genes were much higher in

Rosea/Delila fruits compared to WT, as can be concluded from both the number of clones

identified in the SSH library enriched for ‘Rosea/Delila specific genes’ as well as the expression

levels of these genes based on dot-blot analysis.

Phenylalanine ammonia lyase (PAL) was the most abundant transcript represented in the SSH

library. Although 5 unique clones were identified, they all encode the same primary tomato

isoform, PAL5.Transcript levels of flavonoid 3’,5’-hydroxylase (F3’5’H), dihydroflavonol reductase

(DFR), anthocyanidin synthase (ANS), a gene similar to chalcone isomerase (CHI-like) and p-

coumarate 3-hydroxylase (C3H), a phenylpropanoid biosynthetic gene not involved in

anthocyanin biosynthesis, were also upregulated in Rosea/Delila N fruits.The expression of genes

required for side chain modification of the anthocyanin molecule into the vacuole was also

induced. These include: flavonol-3-glucosyltransferase (3-GT), flavonol-5-glucosyltransferase (5-

GT), flavonol-3-glucoside-rhamnosyltransferase (RT) and a novel gene encoding a putative

anthocyanin acyltransferase (AAC).The procedure also revealed two genes potentially involved

in the transport of anthocyanin into the vacuole: a gene encoding a type-I glutathione S-

transferases (GST) and a gene encoding a putative anthocyanin transporter (PAT). In addition a

60

gene encoding y-thionin, a member of a multifunctional class of plant defense proteins, was

identified among the upregulated clones in Rosea/Delila tomatoes.

Table I.

Putative target genes for Rosea and Delila selected from subtraction library with their expression levels as determined

by dot-blot.

Gene Clone ID accession E-value total clones expression

(first hit blast X) level

PAL Phenylalanine ammonia-lyase P26600 8e-134 39 +++

Lycopersicon esculentum GI:129587

C3H Putative p-coumaroyl 3'- ABB83676.1 7e-51 1 ++

hydroxylase CYP98A-C1 GI:82570227

Coffea canephora

CHI (like) Putative chalcone isomerase 4 AAT94362.1 4e-48 2 +

Glycine max GI:51039630

F3’5’H Flavonoid 3',5'-hydroxylase AAV85472.1 5e-113 3 ++

Solanum tuberosum GI:56269782

DFR Dihydroflavonol reductase AAZ57436.1 7e-39 2 +

Solanum tuberosum GI:71983508

ANS Leucoanthocyanidin P51092 8e-82 9 +++

dioxygenase (LDOX) GI:1730108

Petunia x hybrida

3-GT Flavonoid 3-glucosyl AAX63403.1 5e-62 6 ++

transferase GI:62112651

Solanum tuberosum

5-GT Anthocyanin 5-O- BAA89009.1 5e-39 5 ++

glucosyltransferase GI:6683052

Petunia x hybrida

RT UDP rhamnose: anthocyanidin- CAA81057.1 1e-18 1 ++

3-glucoside rhamnosyl-transferase GI:397567

Petunia x hybrida

AAC Transferase NP_173852.1 8e-12 2 ++

Arabidopsis thaliana GI:15221746

GST Glutathione S-transferase CAA68993.1 5e-36 10 ++

Petunia x hybrida GI:1524316

PAT Putative anthocyanin permease AAQ55183.1 3e-59 3 ++

Lycopersicon esculentum GI:33867697

Defensin Gamma-thionin CAB42006.1 3e-37 5 +++

Lycopersicon esculentum GI:453797

61

Cha

pter

3

The microarray was used to identify possible target genes of Rosea alone or the combination

of Rosea/Delila.This 70-mer oligonucleotide array was designed to analyse expression patterns

of genes involved in secondary metabolite production and ripening and represents 1023

preselected genes. In contrast to the materials used for the subtractive hybridisations, the

microarray experiments were carried out with pooled red-staged fruits of individual primary

transformants (CY3 labelled), hybridised against a common reference (CY5 labelled). Two

hybridisations were performed with Rosea over expressing fruits (biological replicates RosX and

RosXa) whereas one hybridisation was carried out for each Rosea/Delila overexpressing line

(N,C,Y,Z) as well as for the wild type (WT) and control tomato.After subtracting background

levels, 576 genes showed a signal in at least 60% of the different hybridisation experiments and

were selected for further hierarchical clustering and principle component analysis (PCA).

Principal component (PC) analysis was used to find major discriminants between the

experiments. The first two PCs, explaining 60.1% of the experimental variation, revealed

differences between wild type or control fruits on one hand and transgenic fruits (Ros/Del lines

C and Y) on the other hand.This appeared to correlate with the expression of fruit-ripening

genes, such as e8, pectinesterase 1 precusor, polygalacturonase 2A precursor and phytoene synthase

and most probably reflects differences in ripeness of the fruits at harvest (Figure 2A).This is not

surprising, since the purple Ros/Del fruits are difficult to stage and were marked as "ripe" when

the concomitant WT fruits were ripe. Since these fruits were similar in age, these results suggest

that Rosea and Rosea/Delila fruits may be inhibited in certain aspects of fruit ripening. Differences

between Rosea/Delila fruits on the one hand and Rosea and WT fruits on the other hand became

apparent in PC3 and reflected differences in the expression of phenylpropanoid and late

flavonoid genes, required for the production of anthocyanins (Figure 2B). Indeed, the most

differentially expressed genes in Ros/Del fruits relative to WT, in addition to ripening-related

genes, consisted of phenylpropanoid and flavonoid genes and confirmed the results of the

subtractive hybridisation experiments (Table I).

Since Rosea and Delila affect the levels of phenylpropanoids and flavonoids, we focussed our

analyses on all genes on the microarray putatively involved in these pathways (53 oligos).

Hierarchical cluster analysis (Figure 3) revealed that duplicated profiles cluster close together.

In addition, expression profiles of WT and control line, the Rosea lines and the Rosea/Delila

overexpressing lines N, C and Y separated into five main clusters (clustering of columns, 40%

similarity; Figure 3).The first cluster consited of both control and wild type tomato.The second

cluster contained all the experiments performed with Rosea tomato, whereas the Rosea/Delila

overexpressing tomatoes were separated into three more clusters. These three clusters

correspond with the weak line Z, the strong line N and the intermediate lines C and Y.

Genes of the early phenyl-propanoid (including C4H and 4CL) and the early flavonoid pathway

(including CHS, and F3H) were upregulated in both Rosea only as well as Rosea/Delila microtom

62

fruits and appeared not to have an absolute requirement for the Delila gene product. In contrast,

the first gene in the phenylpropanoid pathway, PAL, and the late genes of the flavonoid pathway,

leading to the production of anthocyanins (i.e. ANS, F3’5’H and 3GT; Figure 3), required the

presence of both Rosea and Delila.

To confirm the data from the DNA micro-array experiments, the same tomato material (except

for Rosea/Delila line Y due to quantitative limitation of the material) was used for real time SYBR

green RT-PCR analysis of all flavonoid pathway genes leading to anthocyanins. Relative

expression levels of the phenylpropanoid and flavonoid genes of the transgenic lines are

presented in Figure 4. These RT-PCR results fully confirmed the microarray data and showed

that the early flavonoid genes, in particular CHS-2 and F3H, are upregulated in both Ros and

Ros/Del fruits,whereas the late flavonoid genes encoding DFR, F3’5’H,ANS and 3GT are strongly

upregulated in the tomato fruits overexpressing both Rosea and Delila.The highest relative gene

expression levels of these four late flavonoid genes was found in the transgenic line N, which is

consistent with the highest amount of anthocyanin accumulation found in fruits of this plant.

63

Cha

pter

3

Figure 2

Principal component analysis (PCA) of DNA micro-array experiments of Rosea (RosX, RosXa), Rosea/Delila (N,C,Y,Z),

Wt and control microtom fruits.

a) The first component (on the x-axis) and the second component (on the y-axis) explain 60.1 % of the original

variation, reflecting different ripening stages (green spots represent housekeeping genes whereas red spots are ripening

related genes). Duplicate measurements are presented by triangles.

b) Differential expression of flavonoid related genes (purple) were found when also the 3rd dimension was taken into

account, explaining cumulative 72.5% of the differences found. Second component represented by x-axis, third

component represented by y-axis. Duplicate measurements are presented by triangles. Colour figure on p.157

To get more insight into the transcriptional regulation of the flavonoid pathway genes by dicot

or monocot transcription factors, we compared the results from the Rosea/Delila

overexpressing tomatoes accumulating anthocyanins with tomato fruits overexpressing the

64

Figure 3

Hierarchical clustering (clustal W) of phenylpropanoid and flavonoid gene expression ratios, derived from DNA

microarray experi-ments. Relative expression levels of each gene for each experiment are indicated on a color scale

ranging from bright green (low expression; 2Log ratio -4) to red (high expression; 2Log ratio 4). Duplicate expression

profiles are indicated as -1 and -2 for each hybridisation experiment. Colour figure on p.158

maize transcription factor genes LC and C1, which accumulate flavonols (Bovy et al., 2002). Fruits

from three independent lines overexpressing LC and C1 were used for DNA microarray analysis

as described above. Genes with the highest expression levels in LC/C1 versus WT fruits are

shown in Table II. Comparison of the phenylpropanoid and flavonoid genes upregulated in LC/C1

plants and those in Ros/Del plants showed a large overlap in the genes induced (Table III).

65

Cha

pter

3

Figure 4

Differential gene expression of flavonoid genes, relative to abscissic fruit ripening protein, as detected by SYBR green

RT-PCR analysis. Ratios given are transgenic lines relative to wild type

(Rosea/Delila overexpressing lines N, Z, and C; Rosea overexpressing line X and Xa)

Table II.

Top ten most upregulated genes of LC/C1 overexpressing tomato fruits identified by DNA micro-array experiments.

Ratios are relative to Wild type fruits (average ± s.e.m; n=8; P values < 0.05, except for DFR (0.08))

Gene ID Ratio

F3H TC86916 28.2 ± 8.8

CHS-1 TC86565 18.9 ± 5.0

DFR Z18277 15.6 ± 7.2

putative protein TC95516 12.3 ± 4.5

ANS - 7.7 ± 2.4

RBC 2A precursor TC84834 3.8 ± 1.1

ACC synthase 4 TC90511 3.7 ± 0.9

γ-thionin TC93276 3.1 ± 0.6

Membrane protein BG135919 3.0 ± 0.7

Dihydrofolate synthase AW617849 2.8 ± 0.7

Table III.

Transcriptional regulation of the flavonoid biosynthetic pathway in tomato fruit by Rosea, Rosea/Delila and LC/C1

Gene Rosea Rosea/Delila LC/C1

PAL - + -

C4H + + -

4CL + + -

CHS + + +

CHI + + +

F3H + + +

FLS - +/- +

F3’H - - -

F3’5’H - + -

DFR - + +

ANS - + +

3GT - + +

Metabolites Phenolics Anthocyanins Kaempferoland phenolics

66

Discussion

The flavonoid pathway is one of the most characterized metabolic pathways in plants. Both

structural genes as well as regulatory genes have been cloned from several plant species and

subsequently used to modify the pathway in target crop plants (Muir et al., 2001; Bovy et al.,

2002; Colliver et al., 2002; Schijlen et al., 2006; Davuluri et al., 2005). Despite all knowledge of

the flavonoid biosynthetic pathway, results of pathway modifications are hard to predict,

indicating that the mechanistic complexity of these processes is still not fully understood. To

obtain more insight in the transcriptional regulation of the flavonoid pathway we analysed and

compared the effect of the dicot transcription factors Rosea and Delila and the monocot

transcription factors LC and C1 on the expression of target genes when ectopically expressed

in transgenic tomato fruits. Although regulators in various plant species have been

characterized, unraveling and subsequent manipulation of the transcriptional regulation of the

flavonoid biosynthesis has become a challenging task.

In maize, the transcription factors LC and C1 regulate all genes of the flavonoid pathway from

CHS up to 3GT. In dicot plants however, such as Petunia and Antirrhinum, distinct sets of

MYB/MYC transcription factors are responsible for regulating the early part (CHS towards F3H)

or the late part of the pathway (from DFR to 3GT).

In this study we examined the transcriptional regulation of flavonoid genes by Rosea and Delila

in transgenic tomato microtom fruits. Biochemical analysis showed that transgenic fruits had

increased levels of (simple) phenolics in both Rosea and Rosea/Delila lines. In addition, the

Rosea/Delila overexpressing fruits showed a strong accumulation of anthocyanins throughout

the fruits, however, no clear effect of both Rosea and/or Delila was found on the flavonols

quercetin or kaempferol, as was the case in LC and C1 overexpressing tomatoes. Both DNA

micro-array and real time RT-PCR analysis showed strongly increased expression levels of the

genes encoding DFR (up to 68 fold), F3’5’H (up to 863 fold),ANS (up to 71 fold) and 3GT (up

to 67 fold) in the anthocyanin accumulating fruits of Rosea/Delila microtom.When comparing

these data to micro-array data from LC/C1 overexpressing tomato (table II) the lack of induction

of F3’5’H gene expression in LC/C1 transgenic fruits is the most likely reason for the absence

of anthocyanins in the LC/C1 fruits.

Another interesting difference between Rosea/Delila and LC/C1 is the enhanced expression of

PAL in the Rosea/Delila fruits and the absence of this induction by LC/C1. This may explain,

together with the increased expression of C4H in both Rosea and Rosea/Delila fruits, but not in

LC/C1 tomato fruits, the presence of higher levels of (simple) phenolics in the fruits

overexpressing the dicot transcription factors.

In addition, there seems to be hardly any upregulation of the FLS gene by Rosea and Delila, which

could explain the lack of flavonol accumulation. In contrast, LC/C1 transgenic fruits showed a

67

Cha

pter

3

strong up regulation of FLS and consequently show strongly increased levels of flavonols (Bovy

et al., 2002).

However effects of a difference in the genetic background of the tomato can not be excluded

in this case and in case of F3’5’H as well. The transcriptional regulation of the flavonoid

biosynthetic pathway by Rosea, Rosea/Delila and LC/C1 and their final metabolites are

summarized in table III.

Combined biochemical and transcriptional analysis of the transgenic Rosea/Delila lines indicated

that the visible purple anthocyanins present were of the delphinidin-type (Butelli et al., 2006),

which is in accordance with previous reports on tomato anthocyanins (Bongue-Bartelsman and

Philips, 1995; Bovy et al., 2002). An explaination for this could be that in plants, anthocyanin

production can be initiated through the action of F3H resulting in the production of

dihydrokaempferol (DHK). On its turn, dihydrokaempferol can be used as a substrate by two

cytochrome P450 hydroxylases; F3’H and F3’5’H. This leads to the production of two other

dihydroflavonols, dihydroquercetin (DHQ) and dihydromyricetin (DHM). In general, these three

types of dihydroflavonols can serve as common precursors for the formation of three types of

anthocyanins (pelargonidin, cyanidin, and delphinidin) through the action of DFR. The

accumulation of delphinidin type anthocyanins and the lack of pelargonidin and cyanidin type

anthocyanins in Rosea/Delila tomatoes is most likely due to the strong preference of the tomato

dihydroflavonol reductase (DFR) enzyme for DHM as a substrate (Forkmann and Heller, 1999)

since the both precursors DHK and DHQ are formed in RosDel fruits.

In addition to the induction of flavonoid structural genes by Rosea/Delila as well as LC/C1, both

transcription factor combinations appeared to induce the expression levels of a gene encoding

γ-thionin, also called defensin (Table I and II). Plant γ-thionins are small basic peptides that

appeared to play diverse roles in nature, showing anti-fungal and/or anti-bacterial activity and

some of them have been shown to inhibit digestive enzymes of pest insects (Pelegrini and

Franco, 2005). Although these γ-thionins show strong sequence similarity, suggesting a high

conservation during evolution probably due to their important roles in plant defence, their

structural classification appeared to be insufficient to predict their biological activity.

Nevertheless are plant gamma thionins attractive candidates for pest and pathogen control

through genetic engineering, as plants with increased levels of g-thionins could increase

resistance and thereby reduce crop losses (Pelegrini and Franco, 2005). Indeed, overexpressing

γ-thionin in transgenic rice and tobacco resulted in increased resistance against bacteria and

fungi (Segura et al., 1998; Hughes et al., 2000).

Together, from these results we can conclude that overexpression of the Rosea and Delila

transcription factors in tomato fruit leads to a clear induction of the phenylpropanoid and late

flavonoid genes required for accumulation of phenolic compounds and anthocyanins. In

68

comparison, the lack of induced PAL and F3’5’H expression plus the high expression levels of

the genes CHI through FLS finally resulted in the corresponding lack of anthocyanins but

accumulation of flavonols in tomato fruits overexpressing the monocot transcription factors

LC/C1.

Thus, depending on the flavonoid transcription factors used, the flavonoid pathway can be

redirected in a different way, and tailor-made flavonoid can be obtained in genetically engineered

crop plants.

Material and methods

Tomato fruit material

For this study we used transgenic tomato cv microtom overexpressing Rosea only or both

Rosea and Delila (Martin et al., 2005). One line overexpressing Rosea and 4 independent lines

overexpressing both Rosea and Delila, as well as one wild type plant and one control plant that

went through tissue culture were used for HPLC, DNA micro-array and SYBR green RT-PCR

analysis.

From each plant at least three fruits were pooled, immediately frozen in liquid nitrogen and

stored at -80º C for later use.

To get more insight into transcriptional regulation differences between monocot and dicot

transcription factors, LC/C1 overexpressing tomato fruits (tomato variety FM6203; Bovy et al.,

2002) from two independent lines were used for RNA extraction and microarray analysis.

HPLC analysis

Phenolics and flavonoids of whole fruits were determined after extraction in 75% aqueous

methanol using 10 minutes of sonication. Analysis was performed by separation on a C18

reverse phase HPLC column (Phenomenex Luna, 3mm , 150 x 40 mm, 400C) with photodiode

array detection (type 996,Waters,The Netherlands). During 45 minutes, a gradient of 5 to 50%

acetonitrile in 0.1% tri-fluoro acetic acid was used as mobile phase.Absorbance spectra (240-

600 nm) and retention times of eluting peaks were used for identification by comparison with

authentic flavonoid standards (Apin chemicals,Abingdon, UK).

Suppression Subtractive Hybridisation (SSH)

To minimize the effect of "ripening" genes, 4 tomatoes from different stages of ripening (breaker,

turning, pink and red over-ripe) were used for extraction of the control RNA. Most of the RNA

was obtained from the two intermediate stages of fruit ripening, however, minor RNA amounts

of the breaker and over-ripe stages were included in the final RNA pool. For RNA extraction

from Rosea/Delila also 4 tomato fruits from corresponding ripening stages were used, although

69

Cha

pter

3

slightly differences of ripening stages can not be excluded, due to the purple phenotype of the

Rosea/Delila fruits which makes it difficult to pinpoint the various ripening stages.

Tomatoes transformed with Rosea alone were not used in the original SSH experiment, but

were used later on in Northern blot analysis.

RNA extraction from tomato fruits for SSH library construction [a]

Tissues to be extracted were harvested and immediately frozen in liquid nitrogen. Frozen

tissues, usually 3 g or more, were ground in a pre-chilled pestle and mortar and total RNA was

extracted according to a slightly modified version of the protocol of Chang et al (1993). PolyA+

mRNA was purified from total RNA using Amersham mRNA purification kit following the

manufacturer’s instructions.

Double strand cDNA synthesis [b]

Driver and tester double stranded cDNA were synthesized from 2 µg each of the different

plant polyA+ mRNA using 2 µl of oligonucleotide SP [10 µM] as a primer. First-strand synthesis

was carried out by incubating the reaction at 70ºC for 2 min, cooling on ice, adding 2 µl of dNTP

[10 mM each], 4 µl of 5x first-strand buffer [250 mM Tris-HCl pH 8.5, 40 mM MgCl2, 150 mM

KCl, 5 mM dithiothreitol] and 2 µl of SuperScript reverse transcriptase [Gibco BRL, 200

units/µl], and incubating the mixture at 42ºC for 2 h in a final volume of 20 µl. Second-strand

cDNA synthesis was carried out by adding 3.2 µl of dNTP [10 mM each], 32 µl of 5X second-

strand buffer [500 mM KCl, 50 mM ammonium sulfate, 25 mM MgCl2, 0.75 mM ß-NAD, 100

mM Tris-HCl pH 7.5, 0.25 mg/ml BSA], 8 µl 20x second-strand enzyme cocktail [DNA

polymerase I, Gibco BRL, 6 units/µl; RNase H, Pharmacia, 0.25 units/µl; E. coli DNA ligase, Gibco

BRL, 1.2 units/µl] and incubating the reaction for 3 h at 16ºC in a final volume of 160 µl. An

aliquot [4 µl] of T4 DNA polymerase [Gibco BRL, 3 units/µl] was then added and, after 45 min

at 16ºC, the cDNAs were extracted twice with phenol:chloroform:isoamyl alcohol [25:24:1],

ethanol-precipitated, and resuspended in 50 µl of de-ionised water.

Double stranded cDNA was digested with 20 units RsaI [Pharmacia], extracted twice with

phenol:chloroform:isoamyl alcohol [25:24:1], ethanol-precipitated, and resuspended in 5.5 µl of

de-ionised water.

RsaI-digested tester cDNA [0.4 µl] was incubated with 2 µl of adaptor 1 [10 µM] or adaptor

2R [10 µM] at 16ºC overnight in the presence of 2 µl 5x ligation buffer [250 mM Tris-HCl pH

7.8, 50 mM MgCl2 , 10 mM DTT, 0.25 mg/ml BSA] and 1 µl T4 DNA ligase [Gibco BRL, 400

units/µl].

First hybridisation was carried out by incubating 1.5 µl of adaptor 1-ligated tester or adaptor

2R-ligated tester [-d-] with 1.5 µl RsaI-digested driver cDNA [-c-] in the presence of 1 µl of 4x

hybridisation buffer [50 mM Hepes pH 8.3, 0.5 M NaCl, 0.02 mM EDTA pH 8.0, 10% [w/v] PEG

8000].The solution was overlaid with mineral oil, the DNA was denatured [90 s at 98ºC], and

then allowed to anneal for 8 h at 68ºC.

70

Second hybridisation [-f-]

After the first hybridisation, the two samples were combined and 1 µl of fresh heat-denatured

driver was added.The sample was allowed to hybridise overnight at 68ºC.The final hybridisation

was then diluted in 200 µl of dilution buffer [20 mM Hepes pH 8.3, 50 mM NaCl, 0.2 mM

EDTA], heated at 68ºC for 7 min and stored at -20ºC.

PCR amplification [-g-]

For each subtraction, two PCR amplifications were performed. The primary PCR was

conducted in a final volume of 25 µl. It contained 1.5 µl diluted, subtracted cDNA, 1 µl PCR

primer P1 [10 µM], 2.5 µl 10x PCR buffer, 0.5 µl dNTP mix [10 µM] and 0.5 µl TaqStart antibody

mix [Clontech]. PCR was performed with the following parameters: 75ºC for 5 min; 31 cycles

at 94ºC for 30 s; 64ºC for 30 s; 72ºC for 1.5 min; and a final extension at 72ºC for 10 min.The

amplified products were diluted 10-fold in de-ionised water. Some of the diluted product [1.5

µl] was then used as a template in secondary PCR were primer P1 was replaced by nested PCR

primer PN1 and PN2 under the following conditions: 17 cycles at 94ºC for 30 s; 66ºC for 30 s;

72ºC for 1.5 min.The PCR products were analysed by 2% [w/v] agarose gel electrophoresis.

Subtracted cDNA library construction [-h-]

The PCR products corresponding to genes putatively overexpressed in Rosea/Delila tomato

fruits compared to wild type were cloned using T/A cloning vector [Invitrogen] following the

manufacturer’s instructions. Transformation of competent cells with ligation reactions was

performed using a heat shock procedure (Sambrook et al. 1989).

Arraying subtracted clones [-i-]

Randomly picked white bacterial colonies (200) were grown in 100 ml of LB-amp medium in a

0.5 ml eppendorf tube at 37ºC for at least 2 h with shaking.To amplify the inserts, PCR was

conducted in 20 µl reaction buffer.This contained an aliquot [1 µl] of each bacterial culture, 1

µl primer PN1 [10 µM], 1 µl primer PN2 [10 µM], 2 µl 10x PCR buffer, 0.4 µl dNTP mix [10

µM] and 0.3 µl Taq polymerase. PCR was performed with the following parameters: 94ºC for 3

min; 25 cycles at [94ºC for 1 min; 60ºC for 1 min; 72ºC for 1 min] and a final extension at 72ºC

for 10 min. For each reaction, PCR products [5 µl] were combined with 5 µl 0.6 N NaOH.

Aliquots [2 µl] of each mixture were transferred on two nylon+ membranes [Amersham].The

blots were neutralised for 3 min in 0.5 M Tris-HCl pH 7.5, washed in H2O and UV cross-linked

[Stratagene].

Preparation of cDNA probes and hybridisation [-l-]

Total cDNA [about 50 ng] was labelled with a-32P dCTP using Redprime-II kit [Amersham]

following the manufacturer’s instructions. Hybridisation was performed overnight at 72ºC in a

solution containing 5x SSC, 5x Denhardt’s, 1% [w/v] SDS and 100 µg/ml herring sperm DNA.

The blots were washed at 68ºC four times in 2x SSC, 0.5% [w/v] SDS and twice in 0.2x SSC,

0.5 [w/v] SDS before exposing to a phosphoimaging plate [Fuji]. Plates were scanned in a Fuji

71

Cha

pter

3

Phospho-imager after 3 h at room temperature; auto-radiographic digital images were

generated using MacBas1000 software. Clones showing differential hybridisation signals were

sequenced using the Perkin-Elmer cycle sequencing kit in conjunction with an ABI 377 Prism

automated sequencer.

Oligonucleotides for SSH procedure

NAME SEQUENCE DESCRIPTION

SP 5’-TTTTGTACAAGCTT30N1N-3’ First-strand cDNA synthesis

SSH

Adaptor 1 5’-CTAATACGACTCACTATAGGGCTCGAGCGGCCGCC Adaptor ligation

CGGGCAGGT-3’ + 3’-GGCCCGTCCA-5` SSH

Adaptor 2R 5’-CTAATACGACTCACTATAGGGCAGCGTGGTCGCGG Adaptor ligation

CCGAGGT-3’ + 3’-GCCGGCTCCA-5’ SSH

P1 5’-CTAATACGACTCACTATAGGGC-3’ Primary PCR

SSH

PN1 5’-TCGAGCGGCCGCCCGGGCAGGT-3’ Secondary PCR

SSH

PN2 5’-AGCGTGGTCGCGGCGAGGT -3’ Secondary PCR

SSH

RNA isolation for DNA micro-array and SYBR green RT-PCR analysis

Total RNA was isolated from pooled fruits of each individual transgenic and control tomato line

by use of hot phenol/chloroform extraction as described earlier (Bovy et al., 1995).Additional

RNeasy column purification (Qiagen) was performed after DNAse–I treatment (Boehringer

Mannheim). Finally, the total RNA yield was measured by use of spectrophotometer (NanoDrop

Technologies inc.) at 260 nm method.To determine the RNA quality, a small amount (0.5 mg)

of each sample was evaluated on a 1% TAE agarose gel.

DNA Micro-arrays

DNA microarrays were composed of 1034 70-mer oligonucleotides (Qiagen Operon), each

representing a tomato EST selected based on bioinformatics analysis. These 1034 oligo’s

represent genes involved in metabolic and regulatory pathways related to fruit quality and

nutritional value (e.g. amino-acids, sugars, flavonoids, lignins, sterols, folate, vitamin E and K,

carotenoids and terpenoids). In addition to the selected tomato-specific oligonucleotides,

control oligo’s have been included for background subtraction. All oligonucleotides (0.5 µg/µL

in 5xSSC, 384 well microtiter plate format) were printed in quadruplet.This means each oligo

was spotted twice and each microtiter plate containing the oligonucleotides in solution was

72

entered two times into the printing device. Using a motion controlled capillary spotting device

(Cartesian Technologies) provided with a printing head containing split pins (ChipMaker), sub-

nanolitre droplets of each probe (160 µm spot density; 5.6 mm duplicate distance) were printed

in a serial order by direct contact on amino-silane coated glass slides (Corning BV).

After printing the slides were air-dried for several days, rehydrated and the DNA was cross-

linked using an UV-cross linker at 150 m Joules.The slides were then soaked twice in 0.2% SDS

for 2 min, twice in MQ for 2 minutes and once in boiling MQ for 2 minutes.After drying (5 min)

the slides were rinsed 3 times in 0.2% SDS for 1 minute and once in MQ for 1 minute. Finally

the slides were submerged in boiling MQ for 2 seconds.

cDNA labelling and hybridisation:

Five micro gram total RNA was used for each RT reaction and subsequent cDNA hybridisation

as described by the manufacturers protocol (Genisphere Inc.). Hybridisations were performed

with CY3 labelled cDNA from each individual Rosea, Rosea/Delila,Wild type and control tomato

line always compared to a common CY5 labelled reference (i.e. pooled cDNA composed of

equal amounts from each individual line).

Hybridisation of cDNA from three independent LC/C1 overexpressing tomato lines was

performed directly in combination with cDNA from wild type tomato. For each LC/C1

overexpressing lines two hybridisation were carried out. All micro-arrays were pre-hybridised

for 3 hours at 45ºC prior to overnight hybridisation in 120 ml volume. All hybridisation and

washing steps were carried out using an automatic hybridisation station (HybArray 12, Perkin

Elmer). The slides were dried by centrifugation prior to scanning. Detection of the CY3 and

CY5 signals was performed (ScanArray Express HT, Perkin Elmer). Spot identification and signal

quantification was obtained with Analytical Imaging Station AIS 4.0 software (IMAGING

Research inc.)

Microarray data analysis

Raw data was processed using a Microsoft® Excel based program.The background levels of the

micro-array experiments were calculated by raw data signals derived from 36 oligo spots of

non-plant origin. The mean values of these were subtracted from all others. Furthermore,

normalisation to correct for channel specific effects was carried out per duplicate

measurement, using the median hybridization signal for each experiment. Expression ratios

were calculated for each oligo in each sample when background subtracted spot intensity was

above threshold (0.5 x back ground).

The software package Gene Maths™ version 2.01 (Applied Maths) was used for hierarchical

cluster analysis and principal component analysis (PCA) of expression data. After column

standardization, clustering was done by Pearson’s algorithm.

73

Cha

pter

3

Expression data of LC/C1 tomato micro-arrays data was done by sorting and ranking the

expression ratios. Significance of differences found between the LC/C1 transgenic and control

fruits (n=6) was determined by Students T-test.

Real Time-PCR analysis

To verify the obtained results from the micro-array experiments, structural flavonoid genes

were selected to determine their gene expression level by real time PCR analysis. SYBR green

sequence detection primers were designed based on published sequences or cDNA sequences

cloned at our laboratory by use of the SDS 1.9 Software (Applied Biosystems).Oligonucleotides

were synthesised by Applied Biosystems. From the same material as was used for micro-array

hybridisation, 2 mg total-RNA was used for the cDNA synthesis in a 100 ml final volume

according to the standard protocol. The ABI 7700 sequence detection system was used to

measure the gene-expression of each gene in triplicate. Induction or repression of each gene,

related to the expression level of the housekeeping gene FRP encoding abscisic stress ripening

protein 1, was calculated according to the standard curve method (PE,Applied Biosystems).

74

Real time PCR sequence detection primers.

Oligo sequence Gene ID

FRP 88F CCTGTTCCACCACAAGGACAA Frp, abscisic stress ripening protein,TC93937

FRP 186R GTGCCAAGTTTACCGATTTGC

Pal 55F ATTGGGAAATGGCTGCTGATT Pal, phenyl alanine ammonia lyase, M83314

Pal 196R TCAACATTTGCAATGGATGCA

CHS 687F GTTCCGTGGACCCAGTGAAT Chs1, chalcone synthase 1, X55194

CHS 740R AAAAGGGCTTGGCCTACCA

CHI 550F GAAGCAGTGCTGGATTCCATAAT Chi, chalcone isomerase

CHI 625R GTTTTTCACAAACCAACAGTTCTGAT

F3H 661F CACACCGATCCAGGAACCAT F3h, flavanone 3 hydroxylase

F3H 712R GCCCACCAACTTGGTCTTGTA

FLS 514F GAGCATGAAGTTGGGCCAAT Fls, flavonol synthase

FLS 564R TGGTGGGTTGGCCTCATTAA

DFR 153F TCCGAAGACGACAACGGTTT Dfr, dihydroflavonol-4-reductase, Z18277

DFR 196R TGACAAGCCAAGAGCCGATAA

F3’H 118F GCACCACGAATGCACTTGC F3’h, flavanone-3’-hydroxylase

F3’H 180R CGTTAGTACCGTCGGCGAAT

F3’5’H 227F GGCAATTGGACGAGATCCTG F3’5’h, flavanone-3’5’-hydroxylase

F3’5’H 290R AAGGAACCTCTCGGGAGTGAA

ANS 122F GAACTAGCACTTGGCGTCGAA Ans, anthocyanidin synthase

ANS 290R TTGCAAGCCAGGCACCATA

3GT 474F CGAACGACGAAACACTGTTGA 3Gt, Flavonoid 3-glucosyl transferase

3GT 588R TGCAGCATAGATGGCATTGG

75

Cha

pter

3

76

Chapter 4

Pathway engineering for healthy

phytochemicals leading to the production of

novel flavonoids in tomato fruit

Elio Schijlen, C.H.Ric de Vos, Harry Jonker, Hetty van den Broeck, Jos Molthoff,

Arjen van Tunen, Stefan Martens and Arnaud Bovy.

Plant Biotechnology Journal 4, 433-444 (2006)

77

Cha

pter

4

Summary

Flavonoids are a large family of plant polyphenolic secondary metabolites. Although they are

widespread throughout the plant kingdom, some flavonoid classes are specific for only a few

plant species. Due to their presumed health benefits there is growing interest in the

development of food crops with tailor-made levels and composition of flavonoids, designed to

exert an optimal biological effect.

In order to explore the possibilities of flavonoid engineering in tomato fruits, we have targeted

this pathway towards classes of potentially healthy flavonoids which are novel for tomato. Using

structural flavonoid genes (encoding stilbene synthase, chalcone synthase, chalcone reductase,

chalcone isomerase and flavone synthase) from different plant sources,we were able to produce

transgenic tomatoes accumulating new phytochemicals. Biochemical analysis showed that the

fruit peel contained high levels of stilbenes (resveratrol and piceid), deoxychalcones (butein and

isoliquiritigenin), flavones (luteolin-7-glucoside and luteolin aglycon) and flavonols (quercetin-

and kaempferol glycosides).

Using an on-line HPLC antioxidant detection system, we demonstrated that, due to the

presence of the novel flavonoids, the transgenic tomato fruits displayed altered antioxidant

profiles. In addition, total antioxidant capacity of tomato fruit peel with high levels of flavones

and flavonols was more than 3-fold increased.

These results on genetic engineering of flavonoids in tomato fruit demonstrate the possibilities

to change the levels and composition of health related polyphenols in a crop plant and provide

more insight in the genetic and biochemical regulation of the flavonoid pathway within this

world wide important vegetable.

78

Introduction

Flavonoids form a large family of polyphenolic plant secondary metabolites. Based on their

chemical structure, flavonoids can be divided in several classes, including chalcones, flavanones,

dihydroflavonols, flavonols, flavones isoflavonoids and anthocyanins (Koes et al., 1994, Figure 1).

Since flavonoids are highly abundant in fruits and vegetables they form an integral part of the

human diet (Hertog et al., 1993).

It is widely accepted that a healthy diet is an important factor in preventing chronic diseases,

such as cancer and coronary heart diseases. Increasing evidence from epidemiological and

animal feeding studies, as well as from in vitro studies, suggests that dietary polyphenols are likely

candidates for the beneficial effects of nutrition on the prevention of chronic diseases

(Middleton et al., 2000). Both the basic skeleton (e.g. position of free OH-groups) and

modification patterns (e.g. position of glycosylation) appear to determine the bioactivity and

bioavailability of flavonoids in human (Ross and Kasum, 2002). Depending on their structure,

flavonoids are ascribed to exert a large diversity of health-related effects, including the

scavenging of damaging free radicals and modifying the activity of enzymes. Consequently, the

ingestion of different flavonoid species may be more beneficial to human health than ingestion

of only a few species. However, in most fruit and vegetable crop plants, only one or a few

flavonoid classes are represented by a limited set of flavonoids species. For instance, tomato

fruit contains only chalcones (naringenin-chalcone) and flavonols (quercetin and kaempferol

glycosides) (Muir et al., 2001)

One particular group of polyphenols for which a positive effect on health has gained increasing

support during the last decade (Renaud et al., 1998; 1992) is that of the flavonoid related

stilbenes, specifically trans-resveratrol and its glucoside piceid (Constant, 1997). Red wine is the

main dietary source of stilbenes and the inverse correlation observed between cardiac

mortality and regular intake of red wine has largely been attributed to these polyphenolic

compounds (Hung et al., 2000). Indeed, stilbenes display numerous biological activities in vitro,

such as antioxidant activity, inhibition of inflammation and anti-tumor activity, mediated through

cell cycle regulation, induction of differentiation and apoptosis (reviewed by Pervaiz, 2003). At

present, the most promising experimental data point towards a cancer chemo preventive

activity of resveratrol in vivo, thereby providing a high clinical potential of this natural compound

(Pervaiz, 2003).

In addition to resveratrol, several classes of flavonoids have been shown to protect against

cancer in vitro and in various animal models. These flavonoids include deoxychalcones (e.g.

isoliquiritigenin and butein), which are only present in legumes (Dixon et al., 1995), and flavones

(e.g. apigenin and luteolin), which are more commonly found throughout the plant kingdom, but

are present in only a few food crops (Forkmann and Martens, 2001). Inhibition of proliferation

79

Cha

pter

4

by cell cycle arrest, modulation of signal transduction pathways and induction of apoptosis are

several possible mechanisms by which these flavonoids exert their chemo preventive activity

against several cancer cell lines (Ko, et al., 2002;Wang et al., 2004;Takahashi et al., 2004;Yin et

al., 2001;Van Dross et al., 2003; O’Prey et al., 2003; Martens and Mithöfer, 2005).

Due to their presumed health benefits there is growing interest in the development of food

crops with tailor-made levels and composition of flavonoids, designed to exert an optimal

bioavailability or biological effect. Genetic engineering is a promising tool to modify the

composition of flavonoids in food crops. Previously, we and others have used several transgenic

approaches to increase the levels of the endogenous flavonols quercetin and kaempferol in the

peel and flesh of tomato fruits. Ectopic expression of a single CHI gene from Petunia resulted in

a tissue specific increase of total flavonols in the fruit peel. This was mainly due to an

accumulation of the flavonols rutin (quercetin 3-rutinoside), quercitrin (quercetin-3-glucoside),

and to smaller but still substantial increases in kaempferol glycosides. In these high-flavonol

transformants, naringenin chalcone levels were strongly reduced, suggesting that the natural

naringenin chalcone pool was utilized by CHI to stimulate the flux through the endogenous

flavonoid pathway (Muir et al., 2001;Verhoeyen et al., 2002).

Up-regulation of the flavonoid pathway in tomato fruit flesh, a tissue that normally does not

produce flavonoids, was achieved by the introduction and co-ordinate expression of the maize

regulatory genes Lc and C1.Total flavonol content of ripe transgenic tomatoes over-expressing

Lc/C1 was about 20-fold higher than that of the control fruits, mainly due to accumulation of

kaempferol glycosides. (Bovy et al.,2002; Le Gall et al., 2003). Alternatively, RNAi-mediated

suppression of the tomato regulatory gene DET1 resulted in a "high pigment" fruit phenotype,

consisting of an up to 3.5 fold increase in flavonoid content in addition to enhanced carotenoid

levels (Davuluri et al., 2005). Recently, Giovinazzo et al. (2005) reported on the production of

stilbenes in transgenic tomato, suggesting that it is indeed possible to introduce new branches

of the flavonoid pathway, at least at its first step, by introducing foreign structural genes.

However, branching off further downstream in the pathway by structural genes has not been

reported so far.

In order to further explore the possibilities of flavonoid engineering in tomato fruits, we have

targeted this pathway towards classes of flavonoids which are normally not present in tomato.

Using structural genes from several plant sources and combinations thereof, we were able to

produce transgenic tomatoes accumulating high levels of stilbenes, deoxychalcones or flavones.

These fruits displayed altered antioxidant profiles and an up to 3-fold increase in total

antioxidant activity of the fruit peel.

80

Results & Discussion

Strategy to produce novel flavonoids in tomato

In cultivated tomato fruits flavonoids are only found in the peel. The main flavonoids

accumulating are naringenin-chalcone and the flavonol rutin (quercetin-3-rutinoside). In fruit

flesh, the pathway is hardly active and structural genes required for the production of flavonoids

are expressed at very low levels, relative to fruit peel (Muir et al, 2001; Bovy et al., 2002) (Figure

1).

In order to introduce new flavonoid biosynthetic branches, three binary gene constructs were

made (Figure 2).To target the pathway towards the production of stilbenes, we introduced a

gene construct expressing the grape stilbene synthase (STS) cDNA under control of the

constitutive cauliflower mosaic virus double 35S promoter (CaMV d35S).

81

Cha

pter

4

Figure 1. Schematic overview of the flavonoid pathway

In wild type tomato fruit peel the flavonoid pathway is active leading to the accumulation of 6-hydroxychalcones and

flavonols (solid black arrows).

Overexpression of flavonoid pathway genes (black) led to a stimulated flux through the pathway (bold black arrow) and

the introduction of new branches of this pathway (bold grey arrows).The dotted arrow represents the pathway leading

to anthocyanins, which normally is not active in tomato fruit.

Abbreviations: CHS, chalcone synthase; STS, stilbene synthase; CHR, chalcone reductase; CHI, chalcone isomerase;

F3H, flavanone 3 hydroxylase; FNS, flavone synthase; FLS, flavonol synthase; DFR, dihydroflavonol reductase;

ANS, anthocyanidin synthase.

This enzyme acts independent of CHS (Schröder and Schröder, 1990) and therefore it was

expected that expression of the corresponding gene alone would result in the accumulation of

stilbenes in both peel and flesh.

However, to produce deoxychalcones independently of the endogenous tomato CHS gene-

expression levels during the tomato fruit ripening, we reasoned that both chalcone synthase

(CHS) and chalcone reductase (CHR) genes were required (Figure 1).Therefore, a double gene

construct was made, consisting of the petunia CHS1 cDNA and the alfalfa CHR cDNA (Balance

and Dixon, 1995), both expressed under control of the d35S promoter.

The third construct aimed at producing flavones, which are produced from flavanones through

the action of flavone synthase (FNS).We reasoned that at least two genes are required to target

the pathway in tomato peel towards flavones: a gene encoding chalcone isomerase (CHI) to

relief the block in the pathway in the fruit peel at CHI (Muir et al., 2001) and an FNS gene to

convert the CHI product 2S-naringenin into flavones (Figure 1). So, the third construct used

consisted of the petunia CHI gene (Muir et al., 2001 ) in combination with the Gerbera FNS-II

gene (Martens and Forkmann,1999), both expressed under control of the d35S promoter.

These three gene constructs were expressed in tomato cv. Moneymaker through Agrobacterium

tumefaciens-mediated transformation. In total 10 STS, 16 CHS/CHR and 17 CHI/FNS primary

transformants were obtained carrying one to three copies of these transgenes. Plants were

grown to maturity and fruits were harvested when visually ripe.

82

Figure 2. Schematic overview of gene constructs.

In all gene constructs, transgene expression was under control of the CaMV double 35S promoter (Pd35S ) and

terminated by the Agrobacterium tumefaciens nos terminator (Tnos).

Abbreviations of transgenes: STS (Stilbene synthase), CHS (Chalcone synthase), CHR (Chalcone reductase), CHI

(Chalcone iso-merase), FNS (Flavone synthase); RB, right border; LB left border.

From each plant at least 3 fruits were harvested, and peel tissue was screened for flavonoid

composition by HPLC.This initial screening revealed that several transgenic lines accumulated

the expected compounds in the peel of their fruits: stilbenes in STS, deoxychalcones in CHS/CHR

and flavones in CHI/FNS transgenic plants.Transgenic plants producing highest levels of stilbenes

(3 plants), deoxychalcones (6 plants), and flavones (5 plants) were selected for detailed

molecular and biochemical analyses. Of each selected transgenic plant and of a wild-type plant

three cuttings were made and all plants were simultaneously grown to maturity. Ripe fruits from

individual plants were pooled and peel tissue was analysed for the composition and levels of

flavonoids by HPLC (Fig. 3).

Production of stilbenes

The introduction of a grape STS cDNA in tomato resulted in the accumulation of three

stilbenes in fruit peel (Figure 3): the main stilbenes produced were resveratrol aglycon (20.3 ±

9.6 mg per kg Fresh Weight peel tissue; mean ± SD, n=3 plants from best producing line) and

its glucoside (piceid, 11.5 ± 4.2 mg per kg Fresh Weight peel tissue). In addition, a relatively small

peak of a second,more polar resveratrol-glycoside (not yet identified) was present in peel tissue

of fruits of some plants (data not shown). Since the stilbene synthase introduced competes with

endogenous chalcone synthase for their common substrate 4-coumaroyl CoA (Schröder and

Schröder, 1990), STS overexpression may lead to a reduced level of flavonoids normally present.

Although levels of naringenin chalcone were quite variable, they appeared to be lowered in STS

fruit peel as compared to WT peel. This decrease was statistically significant (p=0.024) when

naringenin chalcone levels of more transgenic fruits were compared with data obtained from a

larger set of wild type measurements. In contrast to naringenin chalcone, the flavonol rutin was

not significantly affected in STS fruit peel (Figure 3).

Whereas flavonoids normally do not accumulate in fruit flesh, significant levels of stilbenes were

detected in this tissue as well (up to 9.3 mg/kg FW). On a whole fruit basis (n=4 plants) 10.4 ±

1.4 mg/kg FW of total stilbenes were measured.The highest levels of stilbenes were found in

peel of T1 STS plants (up to 37.5 mg/kg FW). Interestingly, these levels are significantly higher

than those found in different red wines (ranging from 0.5 to 10 mg/L), the most common source

of resveratrol (Celotti et al., 1996).

Production of deoxychalcones

Distribution of deoxychalcones in the plant kingdom is mainly restricted to the Leguminoseae,

where the production of 6'-deoxychalcones results from a combination of chalcone reductase

and chalcone synthase activity (Davies et al., 1998). Overexpression of both CHS and CHR in

tomato indeed resulted in the accumulation of deoxychalcones (up to 265 mg total

deoxychalcones per kg FW fruit peel).The main deoxychalcones were identified as butein (up

83

Cha

pter

4

to 89 mg/kg FW) and isoliquiritigenin (up to 176 mg/kg FW; Figure 3). The fact that other

deoxychalcone-related flavonoid classes were not accumulating in these tomato indicates that

the 6’-deoxychalcones synthesized in CHS/CHR tomato fruits were not incorporated into the

subsequent 5-deoxy(iso)flavonoid pathway. This can be explained by the lack of endogenous

type II CHI activity in tomato, necessary for 5-deoxy flavonoid biosynthesis, which is restricted

to leguminous plants (Heller and Forkmann, 1993). Similarly, transgenic Petunia flowers

overexpressing CHR accumulate deoxychalcones.Although the accumulation of deoxychalcones

in our tomato was less then reported in CHR Petunia (Davies et al., 1998) in both plant species

the same efficiency rate, i.e. ratio between hydroxy flavonoids and deoxychalcones (3:2) was

obtained. The higher deoxychalcone accumulation in Petunia flowers (up to 22 g/ kg DW) is

likely due to a much (10 fold) higher total flavonoid background level of these petals compared

to tomato peel. In agreement with results obtained in CHR-overexpressing Petunia and tobacco

plants (Joung et al., 2003), overexpression of CHR in tomato resulted in strong competition for

common substrates between the endogenous hydroxy flavonoid and the introduced

deoxyflavonoid pathway. As a consequence, accumulation of deoxychalcones was accompanied

by a clear loss of 6-hydroxyflavonoids: in CHR tomato fruit peel, average naringenin chalcone

and rutin levels were reduced to approximately one third of wild type levels (Figure 3).

Production of flavones

To produce flavones, firstly a single gene construct encompassing the Gerbera FNS-II cDNA was

introduced into tomato. Of the obtained transgenic plants, three lines accumulated small but

significant quantities of flavones (luteolin and luteolin-7-glucoside: up to 6.7 ± 3.9 mg /kg FW,

n=5 plants (F1) from the best line) in their fruit peel. Rutin levels of these FNS-II tomato peel

(23.2 ± 3.6 mg/kg FW, n=5 plants) were approximately 30% of those found in wild type,

suggesting that flavone production was clearly competing with endogenous flavonol synthesis.

To further increase the production of flavones, the FNS-II gene was expressed in combination

with the petunia CHI gene, to relieve the block in the pathway at CHI in tomato fruit peel (Muir

et al., 2001).These tomatoes accumulated high levels of flavones in their peel, mainly present as

luteolin aglycon (up to 340 mg/kg FW) and luteolin 7-glucoside (up to 150 mg/kg FW; Figure

3). In addition to flavones, several flavonols were increased in the peel of these transgenic fruits

as compared to wild-type. Based on their retention time and PDA spectrum, these flavonols

were identified as quercetin-3,7-trisaccharide, quercetin-3-trisaccharide, rutin, isoquercetin,

quercetin-3-rhamnoside, kaempferol-3-rutinoside, kaempferol-3-glucoside (Muir et al, 2001) and

quercetin aglycon. The accumulation of quercetin aglycon and isoquercetin (quercetin-3-

glucoside), both precursors of rutin, suggests that both the glucosyl transferase and the

subsequent rhamnosyl transferase required for the production of rutin (=quercetin-3-

rutinoside) become rate limiting in the peel of CHI/FNS transgenic fruits.

84

Levels of the flavonols rutin and quercetin aglycon were quantified using chemical standards.

Quercetin accumulated in peel of these tomatoes up to 34.1 ± 23.1 mg/kg FW (Figure 3). In

addition, rutin levels in fruit peel of CHI/FNS overexpressing tomatoes accumulated up to 900

mg/kg FW, i.e. 16-fold higher than those in wild type (Figure 3). In analogy to plants

overexpressing CHI alone (Muir et al., 2001;Verhoeyen et al., 2002), naringenin chalcone levels

in fruit peel were strongly reduced in CHI/FNS plants, indicating that CHI/FNS overexpression

leads to an increased flux through the pathway towards flavones and flavonols at the expense

of the CHI substrate naringenin chalcone (Figure 3).

85

Cha

pter

4

Figure 3. Flavonoid composition in tomato fruit peel (mg/kg Fresh Weight).

Upper panel: Levels of the endogenous flavonoids naringenin chalcone (nc) and rutin, determined by HPLC analysis of

STS (left), CHS/CHR (middle) and CHI/FNS overexpressing lines compared to wild type (* n=2).

Middle panel: Levels of stilbenes (resveratrol and piceid), deoxychalcones (butein and isoliquiritigenin), flavones (luteolin

and luteolin-7-glucoside) and quercetin aglycone found in, respectively, STS (left), CHS/CHR (middle) and CHI/FNS (right)

overexpressing tomato fruit peel (* n=2).

Bottom panel: Relative expression levels of introduced genes in transgenic and wild type tomato fruit peel (Log scale;

ND = not determined). Note different scales in flavonoid as well as expression levels.

Although flavones are ubiquitous in plants, they are not commonly found in crops. On whole

fruit basis, transgenic tomatoes reported here contained up to three times higher levels of

luteolin than celery (13 mg/kg FW; USDA, 2003), a major natural food source rich in flavones

(Haytowitz et al., 2003). Furthermore, the CHI/FNS fruits accumulated quercetin (mainly

present as rutin) to levels as high as those found in onions (132 mg/kg FW; USDA, 2003), one

of the richest dietary sources of the flavonol quercetin (Haytowitz et al., 2003).

In all transgenic tomatoes described above, the production of new tomato flavonoids in peel

extracts corresponded with the presence of transgene mRNA (Figure 3, bottom panel) as

determined by real time RT-PCR analysis. However, no clear correlation could be found

between metabolite levels and transgene expression.This indicates that other factors such as

substrate availability, expression levels of endogenous genes and competition between enzymes

for common substrates may also determine final product levels.

86

Figure 4. On line antioxidant detection.

HPLC analysis of peel extracts from Wild type, STS, CHR/CHS and CHI/FNS tomato fruits. Photodiode array detection

indicating flavonoids, measured at 360 nm (black line) with corresponding antioxidant detection, visualized by a negative

peak in absorption at 412 nm due to reduction of the ABTS radical (red line).

Abbreviations: n.c. = naringenin chalcone; isoliq. = isoliquiritigenin; ND = not determined; q-3-g. = quercetin-3-glucoside;

K-rut. = kaempferol-3-rutinoside; K-3-g = kaempferol-3-glucoside. Colour figure on p.159

Novel flavonoid-antioxidants in transgenic tomato fruit

Since at least part of the presumed health properties of flavonoids has been attributed to their

antioxidant activity, we used an HPLC-coupled on-line antioxidant detection system

(Beekwilder et al., 2005) to analyse the antioxidant activity of the individual compounds

produced in our transgenic tomatoes.Wild-type and transgenic peel extracts (pooled material

from > 50 fruits of three cuttings of the lines with the highest levels of stilbenes,

deoxychalcones, or flavones and flavonols) were separated by HPLC and for each eluting

metabolite, its PDA spectrum and antioxidant activity were on-line recorded sequentially

(Figure 4). Subsequently, the relative contribution of each metabolite to the total antioxidant

activity of the extract, which was calculated by summation of all integrated antioxidant peak

areas, was determined and, if appropriate, trolox equivalent antioxidant capacity (TEAC) values

were calculated (Table I).

In all chromatograms a large polar antioxidant peak was visible at the injection peak (rt ~3 min).

This antioxidant peak comprised polar antioxidant compounds such as vitamin C, glutathione

and cysteine and had a similar response area in all chromatograms, suggesting that the levels of

these polar antioxidants were not altered in the transgenic plants (Figure 4). In wild type fruit

peel this injection peak contributed to nearly half of the total antioxidant activity, while

naringenin chalcone and rutin were the major flavonoid antioxidants contributing to the other

half of the antioxidant activity (Figure 4 and Table I). Compared to the wild type, STS

overexpressing tomato peel revealed the presence of one small additional antioxidant peak,

which could be attributed to resveratrol aglycon. The antioxidant activity of the resveratrol

glycosides remained below detection limit (i.e. less than one percent of the total antioxidant

acticity).

In CHS/CHR overexpressing fruits, novel deoxychalcones were produced at the expense of

naringenin chalcone and, to a lesser extent, of rutin.As these novel deoxychalcones were good

antioxidants, their accumulation clearly led to an altered antioxidant profile.Although the levels

of butein in these peel extracts were 60% lower than those of isoliquiritigenin (Figure 3), the

relative contribution of both compounds to the total antioxidant activity of CHS/CHR peel

extracts was more or less equal (Table I).This result corresponds with the fact that butein is a

better antioxidant than isoliquiritigenin (TEAC value of 2.01 versus 0.98;Table II). The higher

antioxidant capacity of butein compared to isoliquiritigenin is apparently due to the second

hydroxylgroup at position 2 in the B-ring of butein (3’,4’,2,4-tetrahydroxychalcone). This is

comparable to the difference in antioxidant activity between the flavonols quercetin (2 hydroxyl

groups in the B-ring) and kaempferol (1 hydroxyl group in the B-ring), and the flavones luteolin

and apigenin, respectively (Rice-Evans et al., 1996). In CHI/FNS overexpressing fruit peel, both

flavonols and flavones were found to be the major antioxidants. In these fruits, rutin,

87

Cha

pter

4

isoquercetin, several kaempferol derivatives, quercetin and luteolin contributed for 83.4 percent

of total antioxidant activity (Table I). Likewise, polar compounds eluting in the injection peak,

though not changed in absolute amount compared to WT, contributed only 15.8% to the total

antioxidant activity. Flavones and flavonols are well-known antioxidants and share several

structural features which contribute to their antioxidant activity: both flavonoid classes have a

phenolic B-ring which can be hydroxylated at the 3’, 4’ and/or 5’ position and a C2-C3 double

bond. In addition, flavonol aglycons contain a hydroxyl group at the C3 position, which makes

flavonols even better antioxidants than flavones. (Table I; Rice-Evans, 1996).The total antioxidant

activity of the transgenic peel extracts was determined in two ways: (i) by calculating the sum

of all individual antioxidant peaks eluting from the HPLC column and (ii) by analysing the same

crude extracts using the TEAC assay in 96-wells plates.As shown in Figure 5, both approaches

produced comparable results and indicated that the total aqueous-methanol soluble antioxidant

activity was statistically significant increased in CHI/FNS fruit peel (up to 3.5-fold).The difference

in increased antioxidant activity between both methods could be a result of the presence of

other antioxidant compounds, such as polar carotenoids, within the abstract.Within the HPLC

based antioxidant detection system, improper elution of these compounds could result in

higher relative differences between the samples. Despite the very good antioxidant activity of

resveratrol (TEAC value is 2.57,Table I), the level of this compound in our transgenic STS plants

was still too low to have a significant impact on the total antioxidant activity. Recently,

Giovinazzo et al. (2005) used a similar approach to constitutively express the grape STS gene in

tomato cultivar Moneymaker.Their best performing STS plants contained levels of stilbenes that

were up to 5-fold higher than in our study. A significant increase in total antioxidant activity

(measured as ABTS decoloration by hydrophilic and lipophilic antioxidants in aqueous and

organic phase separately) of the transgenic fruits could be observed in their highest expressing

lines.

In our CHS/CHR plants high levels of the deoxychalcones butein and isoliquiritigenin were

produced.Although these deoxychalcones appeared to be good antioxidants, their accumulation

was clearly at the expense of hydroxy flavonoids resulting in a decrease in both naringenin

chalcone and rutin. As a consequence, the total antioxidant activity of fruit peel of CHS/CHR

tomato lines was equal to that of wild type plants.

88

Table I. Relative contribution of individual flavonoids to the total antioxidant activity of tomato fruit peel extracts.

For each compound eluting from the column, antioxidant activity was quantified by calculating its peak area at 412 nm

and expressed relative to the sum of all antioxidant peaks (in %).

The antioxidant peak at rt 37.4 min comprises of both quercetin and luteolin (2.9 ± 0.3 and 18.8 ± 1.4 % of total

antioxidant activity, respectively). TEAC values of flavonoids were calculated by expressing antioxidant activity as

TROLOX equivalents/mole.All values are mean values ± sd; n=3 extractions (* n=12, ** quercetin TEAC value based

on fruit peel extracts from plants (n=5) overexpressing CHI only, *** n=9).

rt (min) Compound Wt STS CHR/CHS CHI/FNS TEAC value

2.5-3.2 injectionpeak 44.4 ± 0.7 45.8 ± 0.3 49.5 ± 2.0 15.8 ± 0.7

4.7 unknown 1.0 ± 0.0

16.8 unknown 1.2 ± 0.1

17.9 unknown 1.6 ± 0.2

23.4 unknown 1.8 ± 0.1 1.1 ± 0.0

24.3 unknown 1.2 ± 0.0

25.2 rutin 5.2 ± 0.1 3.0 ± 0.2 2.7 ± 0.1 27.9 ± 0.8 1.83 ± 0.18*

26 quercitrin 28.5 ± 0.7

Kaempferol-

28.1 rutinoside 3.4 ± 0.1

Kaempferol-3-

29.1 glucoside 1.9 ± 0.1

32.4 resveratrol 6.1 ± 0.3 2.57 ± 0.12

Quercetin and 4.91 ± 1.82 **

37.4 Luteolin 21.7 ± 1.7 1.84 ± 0.12

40.7 unknown 2.0 ± 0.4 1.1 ± 0.1

40.7 butein 10.3 ± 1.0 2.01 ± 0.22

41.2 Nar. chalcone 44.0 ± 2.4 38.3 ± 0.1 17.0 ± 1.6 0.84 ± 0.11

***

42.8 isoliquiritigenin 12.6 ± 1.0 0.98 ± 0.09

42.3 unknown 3.9 ± 0.4

total 98.5 ± 0.4 95.8 ± 0.8 96.7 ± 0.4 99.3 ± 0.6

Total TEAC (µmol/g FW) 36.5 ± 4.3 38.8 ± 0.6 39.2 ± 1.5 124.7± 12.7

89

Cha

pter

4

Fruit phenotype and inheritance of transgenic plants

After determination of the transgene copy number, the offspring of single copy plants was

tested for the inheritance of the transgene and the stability of the "novel flavonoid" trait. In

subsequent generations tested (F1 and F2), the "novel flavonoid" phenotype segregated with the

corresponding transgene.All transgenes, except STS, were inherited according to Mendelian law:

75% of the F1 off-spring contained the transgene. Inheritance of the STS trait, however, occurred

at a 1:1 ratio (p value <0.05, n=20), which is less than the expected ratio of 3:1.This suggests

that homozygote STS offspring may be lethal.

The vegetative phenotype of all transgenic plants was indistinguishable from the parental variety.

In fruits, however, some phenotypic changes were observed. In STS overexpressing plants,

reduced seed set and occasionally parthenocarpic fruits with reduced fruit size were observed

in lines with highest stilbene levels.This is in line with the observation of Giovinazzo et al. (2005)

that all fruits of their STS overexpressing tomatoes, which accumulated up to 5-fold higher

stilbene levels than our STS tomatoes, were seedless. The reduced fertility of STS

overexpressing plants may be due to a, yet unknown, biological effect of stilbenes, or,

90

Figure 5.Total antioxidant activity.

Total antioxidant activity of wild type, STS, CHS/CHR and CHI/FNS overexpressing tomato fruit peel.

Total antixidant activity was measured in two ways: using the TEAC assay with peel extracts in 96-well plates (striped

bars) and by calculating the sum of all antioxidant peaks eluting from the HPLC column after separation of the same

peel extracts (solid bars).

alternatively, may be caused by reduced flavonoid levels as a result of substrate competition

between endogenous chalcone synthases and the introduced stilbene synthase. Indeed, reduced

fertility due to a reduction in flavonoid levels has been reported in petunia plants in which

flavonoid biosynthesis was blocked through antisense suppression of chalcone synthase (Van

der Meer et al., 1992;Ylstra et al., 1992) as well as in tobacco plants overexpressing stilbene

synthase (Fisher et al., 1997). In the latter case, fertility could be restored by exogenous

application of flavonoids to the stigma, suggesting that a lack of endogenous flavonoids rather

than the accumulation of stilbenes lead to reduced fertility. Clearly additional research is needed

to unravel the mechanisms underlying the reduced fertility and seedless phenotype of STS

overexpressing tomato plants.

Occasionally, in some CHS/CHR and CHI/FNS overexpressing lines, the color of red ripe fruits

was changed from orange-red to more pink-red (result not shown).This color change is likely

due to the decrease in levels of the yellow colored flavonoid naringenin chalcone, which

normally accumulates in high levels in the epidermal layers of wild type tomato fruits (Figure 3;

Hunt and Baker, 1980) resulting from the increased flux towards deoxychalcones in case of

CHS/CHR, and towards flavones and flavonols in case of CHI/FNS. A similar pink-red phenotype

has been described in CHI overexpressing tomato lines accumulating high levels of flavonols but

lacking naringenin chalcone (Muir et al., 2001).

In relation to its potential value for other phenotypic characteristics, also the presence of

different flavonoids in other tissues would be of potential interest for future research, for

example, in view of putative increased resistance.

Conclusions

We explored and demonstrated the possibilities to target the flavonoid pathway in tomato

towards classes of flavonoids or stilbenes that are normally not present in tomato fruit. In this

report we focused on producing phenolic compounds that have potential health effects but are

not very abundant in the Western diet, e.g. stilbenes, deoxychalcones and flavones. We

successfully produced significant levels of these target compounds in tomato peel.These novel

flavonoids are good antioxidants and peel extracts of the obtained transgenic fruits showed

altered antioxidant profiles. In addition these flavonoids may show different bioavailability and

or bioactivity as compared to endogenous flavonoids normally found within most cultivated

tomatoes. In case of CHI/FNS, total antioxidant activity was increased up to 3.5-fold. To our

knowledge, this is the first report describing the production of deoxychalcones and flavones in

an edible crop plant. These genetically engineered tomatoes may be very useful to study the

potential health benefits of specific natural flavonoids present in the same tomato-based food

matrix.

91

Cha

pter

4

Experimental Procedures

Gene cloning

A full length cDNA encoding stilbene synthase ((STS), X76892; Sparvoli et al., 1994)) was

isolated from ripe grape skin tissue Vitis vinifera cv Lavelee by RT-PCR strategy using the

following gene specific oligonucleotides: 3’end oligo: 5’AATACCTTACTCCTATTCAACA3’; 5’

end oligo: 5’GATCAATGGCTTCAGTCGAG3’. The amplified cDNA fragment was subcloned

into pGEMT-easy vector according to standard protocols. Upstream of the STS cDNA, a BamHI

restriction site was introduced by PCR, followed by subcloning of the STS coding region as an

NcoI/SalI fragment into the pMOGEN18 (Sijmons et al., 1990) derivative pHB003.The resulting

plasmid pHB022 encompasses a fusion of the double CaMV 35S promoter (Pd35S), an Alfalfa

Mosaic Virus translation enhancing 5’UTR, the inserted STS cDNA sequence, and the

Agrobacterium tumefaciens nopaline synthase terminator (Tnos).

An alfalfa (Medicago sativa) cDNA sequence encoding chalcone reductase (CHR; Balance and

Dixon, 1995) was obtained as original clone.Cloning of the full length cDNA sequence encoding

the Petunia chalcone synthase (CHS; Koes et al., 1989) was described earlier (Colliver et al.,

2002). In order to create the double gene construct Pd35S-CHS-Tnos//Pd35S-CHR-Tnos, three

initial single gene constructs had to be made. First, the plasmid FLAP600 was digested by BamHI

followed by self ligation of the 5119 bp fragment resulting in a plasmid containing Pd35S-CHS-

Tnos, called pHEAP28. A second gene construct including Pd35S-CHS-Tnos (pHEAP29) was

obtained after exchanging the e8 promoter of plasmid pFlap600 by the d35S promoter derived

from EcoRI/BamHI digestion of pFlap50 (Colliver et al., 2002). Third, a single gene construct

encompassing Pd35S-CHR-Tnos was obtained after PCR amplification of the original CHR cDNA

using oligonucleotides creating a 5’BamHI and a 3’SalI restriction site. Subsequently, the CHS

cDNA of pHEAP28 was replaced by the BamHI/SalI CHR cDNA fragment resulting in plasmid

pHEAP33. Finally, the double gene construct containing Pd35S-CHS-Tnos//Pd35S-CHR-Tnos was

created by ligating the Pd35S-CHS-Tnos from pHEAP29 as a NotI/AscI fragment into plasmid

pHEAP33.The resulting double gene construct was called pHEAP34.

Cloning of the Petunia chalcone isomerase (Chi-a; Van Tunen et al., 1988) has been described

previously (Muir et al., 2001). The Gerbera hybrida cDNA clone encoding flavone synthase-II

(FNS-II; Martens and Forkmann,1999) was obtained as original gene construct. After

introduction of proper restriction sites by PCR, the FNS-II encoding cDNA was cloned as

BamHI/SalI fragment into pFLAP50 (Muir et al., 2001).The resulting gene construct, pFLAPFNS

encompass fusions of the Pd35S promoter, followed by the cDNA sequence and the

Agrobacterium tumefaciens nopaline synthase terminator (Tnos) terminator. To create a double

gene construct Pd35S-CHI-Tnos//Pd35S-FNSII-Tnos, the EcoRI/BamHI fragment of the former

construct, encompassing 35S-FNSII-Tnos, was ligated into the 4577 bp EcoRI/BamHI fragment

92

derived from FLAP600 (Colliver et al., 2002).

Finally, single and double gene constructs were transferred as PacI/AscI fragment into the binary

vector pBBC50 (Muir et al., 2001).The resulting gene constructs are shown in figure 2.

Plant transformation and growth

Binary plasmids were transferred into Agrobacterium tumefaciens strain COR308 (Hamilton et

al, 1995) by a freeze-thaw method (Höfgen and Willmitzer, 1988).

To obtain transgenic tomato plants (Solanum lycopersicum cv. Money maker), 8 days old

hypocotyls were used for Agrobacterium-mediated transformation according to Fillatti (1987).

Kanamycin-resistant shoots were grown from spring 2003 through autumn 2004 under

controlled greenhouse conditions in Wageningen,The Netherlands. Plants were grown on rock-

wool plugs connected to an automatic irrigation system comparable with standard commercial

cultivation conditions with a minimum temperature set point of 19°C during daytime and 17°C

at night.To compensate for the lack of sunlight, between autumn and spring, supplementary high

pressure sodium light was provided with a minimum light intensity of, on average, 17 W m_2 at

a photoperiod of 16 h light: 8 h dark.

All plants were self-pollinated to produce fruits and offspring.The transgenic status of tomato

plants was confirmed by PCR analysis on young leaf material with gene specific primers

according to manufacturers protocol (X-amp PCR, Sigma-Aldrich).

High-molecular-weight genomic DNA was isolated from young leaves of tomato, as described

by Dellaporta et al. (1983). Insert copy number of transgenic plants was determined by

Southern blot hybridization, according to manufacturer’s protocol (DIG labeling, Roche) using

10 mg Bgl II-digested genomic DNA and npt-II as probe.

For further biochemical and gene expression analyses, fruits were harvested when visually ripe.

From each plant at least three fruits were pooled for extraction to minimize sample variation.

Fruit peel (approximately 2mm thick, consisting of the cuticula, epidermis and sub-epidermis)

and fruit flesh (i.e. columella; jelly parenchym; seeds excluded) were collected separately, frozen

in liquid nitrogen and stored at -800C until further analysis.

HPLC analysis of flavonoids

Flavonoids were determined after extraction in 75% aqueous methanol with 15 minutes of

sonication. Compounds were separated on a C18 reverse phase HPLC column (Luna C18(2),

3mm , 150 x 4 mm, Phenomenex, USA) at 400C, and analyzed by photodiode array detection

(type 996,Waters,The Netherlands).A gradient of 5 to 50% acetonitrile in 0.1% tri-fluoro acetic

acid was used as mobile phase.Absorbance spectra (240-600 nm) and retention times of eluting

compounds were used for identification by comparison with authentic flavonoid standards

(Apin chemicals,Abingdon, UK).

93

Cha

pter

4

Antioxidant activity

On-line HPLC detection of antioxidant activity of corresponding eluting compounds was based

on the post-column antioxidant reaction system firstly described by Koleva et al (2000) and

subsequently modified by Beekwilder et al (2005). Shortly, compounds eluted from the HPLC

column and passed through the PDA detector were allowed to react for 30 seconds with a

buffered solution of ABTS (2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonic acid; Roche) cation

radicals on-line, before passing through a second detector, monitoring the ABTS radicals at

412nm.Antioxidant activity of compounds was expressed as trolox (a water-soluble vitamin E

analog) equivalents, using a calibration curve of trolox injected in the same HPLC system.

Total antioxidant activity of the same extracts was measured by mixing 10 µl of extract with

90 µl of ABTS reagent (pH 7.4, final concentration: 400 µM). Decrease of absorbance at 412

nm was immediately determined using a spectra fluor plate reader (Tecan,Austria) and

expressed as trolox equivalents..

RNA isolation

Total RNA was isolated from tomato fruit tissues by hot phenol extraction and lithium

chloride precipitation (Pawlowski et al., 1994). After DNAse-I treatment (Boehringer

Mannheim, Germany) followed by RNeasy column purification (Qiagen), total RNA yield was

measured by absorption at 260 nm (nanodrop) and evaluated on a 1% TAE agarose gel.

RT-PCR gene expression analysis

Real time quantitative (RT) PCR analysis was performed to test expression levels of

introduced transgenes.Taqman sequence detection primers (Applied Biosystems,Warrington

UK) were designed using SDS 1.9 Software (table II).Two mg total-RNA was used for cDNA

synthesis by Superscript II reverse transcriptase (Invitrogen) in a 100 ml final volume

according to standard protocol. Expression levels of each gene were measured as triplicate

reactions, performed with the same cDNA pool, in presence of fluorescent dye (SYBR-

Green) using an ABI 7700 sequence detection system.The constitutively expressed mRNA

encoding tomato fruit abscisic stress ripening protein-1 (L08255), was used as internal

reference.This gene was previously shown to be constitutively expressed during tomato fruit

ripening (Bovy et al., 2002). Oligonucleotides used for detection of expression levels from

transgenes are given in table II. Calculations of each sample were carried out according to the

comparative CT method (PE Applied Biosystems).

94

Table II. Oligo nucleotides used for SYBR Green RT-PCR analysis.

Oligo Sequence 5’ - 3’ Gene ID Source

CHR-536F TTG CCA CTG TTC TTC CAG CA chalcone reductase (CHR 7) Medicago sativa

CHR-586R GCC ATG CAA GGT TCA TTT CC U13925

FNS-197F CGC TCT CTC CAC TCG CTA CG flavone synthase II (CYP93B2) Gerbera hybrida

FNS-247R ACT GAG CCG AGA CGG AGG T AF156976

STS-530F CCT TCG AAC CGC TAA GGA TCT stilbene synthase Vitis vinifera

STS-582R CAA GAA CTC GTG CTC CTG CAT (StSy) X76892

CHS-516F GGT TCT TCG GTT AGC CAA GGA chalcone synthase Petunia hybrida

CHS-620R GTA TCA TTT GGC CCA CGG AA (CHS) AF233638

CHI-338F GGC ACG ACC CTC ATC ATC A chalcone isomerase A Petunia hybrida

CHI-405R AGG TGG CGG AGA ATT GTG TT (CHI A) AF233637

ASRIP-88F CCT GTT CCA CCA CAA GGA CAA fruit abscisic stress ripening Lycopersicon

ASRIP-186R GTG CCA AGT TTA CCG ATT TGC protein-1 (TOMASRIP) L08255 esculentum

AcknowledgementsThe authors wish to thank Dr Richard Dixon for providing the CHR cDNA.

This research was supported by the EU as part of the PROFOOD project

(QLK1-CT-2001-01080).

95

Cha

pter

4

96

97

Cha

pter

5

Chapter 5

Tomato intake reduces markers of cardiovascular

risk in human CRP transgenic mice:

Additional benefits from transgenic

flavonoid tomato

Dietrich Rein, Elio Schijlen,Teake Kooistra, Karin Herbers, Lars Verschuren, Robert Hall,

Uwe Sonnewald,Arnaud Bovy, and Robert Kleemann.

Journal of Nutrition 136, 2331-2337 (2006)

98

Abstract

Increased consumption of fruits and vegetables is associated with reduced cardiovascular

disease.The molecular basis of this health effect is not fully understood; yet dietary flavonoids

are thought to play an important role. Genetic engineering enabled us to overexpress specific

flavonoids (flavones and flavonols) in tomato fruit.

Human C-reactive protein transgenic (CRPtg) mice express markers of cardiovascular risk and

allow studying putative health effects of wild-type tomato (wtTom) and flavonoid-enriched

tomato (flTom). We analyzed whether consumption of wtTom, at a dose achievable with a

human diet, has beneficial effects on cardiovascular risk markers and whether flTom may

enhance such effects. CRPtg mice received a diet containing 4 g/kg w/w wtTom or flTom peel,

or vehicle (Con), or 1 g/kg w/w fenofibrate (FF), which reportedly reduces cardiovascular risk,

for 7 weeks. Markers of general health (bodyweight, food intake, alanine aminotransferase

(ALAT)) and of cardiovascular risk (CRP, fibrinogen, E-selectin, cholesterol) were analyzed over

time.

All groups displayed comparable food intake and bodyweight gain. Plasma ALAT levels increased

moderately in Con and strongly upon FF treatment, whereas ALAT remained unchanged in

wtTom and flTom. Compared to t=0, wtTom and flTom significantly reduced basal human CRP

concentrations by 43% and 56%, respectively. The effects of flTom on CRP were reversible

within a 2-wk washout. WtTom and flTom had no effect on fibrinogen, but comparably

repressed E-selectin expression and upregulated HDL cholesterol.

Tomato peel consumption improved cardiovascular risk factors in CRPtg mice, a beneficial

effect that was further enhanced by enrichment of the flavonoid content.

99

Cha

pter

5

Introduction

Large prospective cohort studies have demonstrated an inverse relationship between

consumption of fruits and vegetables and the development of cardiovascular disease and stroke

in both males and females (Hung et al., 2004; He et al., 2006). However, the biological

mechanisms whereby fruit and vegetables may exert their beneficial effects on human health are

not fully understood and are likely to be multiple (Bazzano et al., 2003).A possible explanation

may be their high content of bioactive flavonoids and flavonoid derivatives (Manach et al., 2004).

In line with this, a growing body of recent experimental evidence supports the view that dietary

constituents of the flavonoid class exert important vasculoprotective effects, among which are

lowered blood pressure, anti-thrombotic, anti-oxidative and anti-inflammatory effects (Stoclet

et al., 2004; Kim et al., 2004; Kris-Etherton et al., 2004). For example, the flavonoid quercetin has

been shown to attenuate blood pressure in hypertensive rats (Machha and Mustafa, 2005) and

the flavone luteolin has been reported to mitigate adhesion molecule expression by quenching

the pro-inflammatory master regulator, nuclear factor kappa B (NF-KB) in human endothelial

cells (Choi et al., 2004).

In the past few years, several crops have been genetically modified to increase specific

constituents that are considered to be beneficial for human health. For example,

eicosapentaenoic acid and docosahexaenoic acid have been introduced in Brassica juncea (Wu

et al., 2005) and resveratrol in Brassica napus seed (Husken et al., 2005). Other valuable

nutrients that have been enriched include ß-carotene in tomato fruit (Romer et al., 2000) and

zeaxanthin in potato tubers (Romer et al., 2002). In the present study, genetic engineering

technology has been applied to increase the flavonoid content of tomato peel by stimulating the

endogenous flavonoid pathway and by introducing a new biosynthetic branch (described in

more detail in (Schijlen et al., 2006).These modifications resulted in tomatoes with high levels

of flavonols (e.g., quercetin, kaempferol and glycosides thereof) and flavones (e.g., luteolin and

luteolin-7-glucoside) in their peel tissue.

Since most genetically modified products claiming enhanced health benefit have not yet been

approved for human consumption, it is not yet proven whether they do indeed exert beneficial

effects on human health and, for example, improve surrogate biomarkers of disease. In vitro

human cell models are often inadequate because many food constituents, such as flavonoids,

undergo significant metabolic modification by hydrolysis and conjugation during absorption in

the small intestine, the colon and the liver (Spencer, 2003).As an alternative, the efficacy of these

products could be evaluated in animal models that mimic the situation in humans.

In the present study we have therefore used a humanized animal model, CRPtg mice (Szalai and

McCrory, 2002; Kleemann et al., 2004). Human CRP is a highly sensitive inflammation marker

and constitutes a strong independent predictor of future cardiovascular events in humans

100

(Ridker et al., 2004). Dietary treatment of CRPtg mice with wild-type tomato fruit and

genetically modified, flavonoid-enriched tomato fruit, enabled us to study putative health effects

of tomato fruit in general and of specific flavonoids in particular. The tomato quantity fed to

CRPtg mice, on an energy basis, equals 2.3 g peel or approximately 230 g fresh tomato per day

in humans (human energy intake 10 MJ/d), and thus constitutes a portion which is achievable in

a human diet. The effect of tomato fruit in CRPtg mice was compared to treatment with

fenofibrate, an established hypolipidemic, anti-inflammatory drug, which is known to lower

markers of cardiovascular risk including CRP, and which reduces coronary heart disease

(Despres et al., 2004). In addition to human CRP, we analyzed markers that reflect the general

health status (bodyweight, food intake, ALAT) and markers that predict future cardiovascular

risk independent from CRP (fibrinogen, E-selectin and cholesterol).

Materials and methods

Generation and characterization of wild-type and flavonoid-enriched tomato peel

Gene cloning and tomato transformation was carried out as described in detail previously

(Schijlen et al., 2006). Briefly, full-length cDNA sequences encoding Petunia chalcone isomerase

(CHI) and Gerbera hybrida flavone synthase-II (FNS) were used to create the double gene

construct Pd35S-Chi-Tnos-Pd35S-FnsII-Tnos. This construct was subsequently cloned into the

binary vector BBC50 (Muir et al., 2001) followed by transfer to Agrobacterium tumefaciens. To

obtain transgenic tomato plants (Solanum lycopersicum cv. Money maker), hypocotyls were used

for Agrobacterium-mediated transformation. Kanamycin-resistant shoots were grown on rock-

wool plugs, under controlled greenhouse conditions.Wild-type tomato plants (n=3) as well as

plants (n=3) derived from the transgenic tomato-line with highest levels of flavones and

flavonols were grown to harvest ripe fruits (>50 of each variety). Fruits were peeled and the

peel was immediately frozen in liquid nitrogen and stored at –800C. Flavonoid levels and

composition of pooled peel tissue of each variety were determined after extraction in 75%

aqueous methanol with 15 minutes of sonication. Compounds were separated on a C18 reverse

phase HPLC column (Luna C18(2), 3mm , 150 x 4 mm, Phenomenex, USA) at 400C, and analyzed

by photodiode array detection (type 996, Waters, The Netherlands). A gradient of 5 to 50%

acetonitrile in 0.1% tri-fluoro acetic acid was used as mobile phase.Absorbance spectra (240-

600 nm) and retention times of eluting compounds were used for identification by comparison

with authentic flavonoid standards (Apin chemicals, Abingdon, UK). Both wild-type and

transgenic tomato peel tissue were lyophilized separately (Snijders Scientific freeze dryer,

Tilburg,The Netherlands), stored at -800C and analyzed for flavonoids by HPLC before addition

into experimental diets. Tomato peel constituted approximately 100 g/kg of fresh tomato

weight. Lyophilization reduced the peel weight for another 90% approximately.

101

Cha

pter

5

Mice and diets

All animal experiments described in this report conformed to the rules and regulations set

forward by the Netherlands Law on Animal Experiments and were approved by the Institutional

Animal Care and Use Committee of TNO. Male CRPtg mice were used for this study. CRPtg

mice carry a 31-kb human DNA fragment containing the human CRP gene including all known

cis-acting regulatory elements, i.e. the entire human CRP promoter.The human-like pattern of

expression of CRP in CRPtg mice has been described (Szalai and McCrory, 2002; Kleemann et

al., 2004). CRPtg mice of the specific pathogen free breeding stock of TNO were screened for

inheritance of the CRP transgene using a human CRP-specific PCR reaction. Mice were housed

in Macrolon cages at 21°C, 50-60% relative humidity, with a 12 h light cycle (6:00 a.m.-6:00 p.m.)

and free access to a commercial standard rodent diet (ssniff R/M-H, Spezialdiäten GmbH; Soest;

Germany; crude nutrients (in g/kg dry matter): protein 216, N-free extract 617, fat 38, fiber 56,

ash 73, supplemented with vitamins and minerals; 16.0 MJ/kg metabolizable energy), and to tap

water until the start of the experimental treatment (t=0).

At t=0, mice were matched into four experimental groups on the basis of their basal plasma

CRP level. From t=0 onwards, mice had free access to a commercial experimental rodent diet

(AM-II Hope Farms, Woerden, The Netherlands; crude nutrients (in g/kg dry matter): protein

272, carbohydrates 561, fat 72, fiber 41, ash 54, supplemented with vitamins and trace minerals;

17.6 MJ/kg metabolizable energy), and to tap water.To test wtTom and flTom with respect to

putative benefits in vivo, equal amounts of either wtTom or flTom peel were separately mixed

into this experimental diet. Specifically, the diet was supplemented with vehicle (Con group;

n=10; Con), or 4 g/kg w/w dried wild-type tomato peel (wtTom group; n=10), or 4 g/kg w/w

flavonoid-enriched tomato peel (flTom group; n=8). An additional control group was treated

with 1 g/kg w/w fenofibrate (FF group; n=10), a hypolipidemic drug known to reduce

cardiovascular risk and to lower plasma inflammation markers such as CRP and fibrinogen in

CRPtg mice (Kleemann et al., 2004) and humans (Gervois et al., 2004). Bodyweight and food

intake was determined weekly during the experimental period of 7 wk. In wk 6, an inflammatory

response was induced in all mice by intraperitoneal injection of 85,000 IU interleukin-1ß (IL-1ß;

Sanvertech, Heerhugowaard,The Netherlands) per mouse as described (Kleemann et al., 2004).

Plasma CRP was determined in tail blood collected before (i.e. at the t=6 wk sampling point)

and 10 h after IL-1ß injection. Subsequently, after mice had recovered and CRP levels had

returned to baseline levels again (Kleemann et al., 2004), the mice were subjected to a washout

follow-up study from wk 7 to 9.At wk 7, experimental diet treatment was stopped, and all mice

received standard maintenance diet for 2 wk.Then, plasma was collected and mice were killed

by CO2 asphyxiation, and their livers were weighed.

102

Analysis of plasma inflammation markers

The plasma concentrations of the systemic inflammation markers CRP and fibrinogen were

determined in tail blood plasma samples by ELISA ( Kleemann et al., 2003). Plasma levels of E-

selectin and ALAT were quantified by ELISA (R&D Systems Europe Ltd., Abingdon, United

Kingdom) and kit no. 745138 (Roche Diagnostics,Almere,The Netherlands), respectively. Since

mice were matched on the basis of their baseline plasma CRP levels at t=0, baseline levels of

other plasma markers such as fibrinogen and E-selectin showed some variation between groups.

Therefore, to allow direct comparison, the initial plasma levels of fibrinogen and E-selectin levels

at t=0 were set 100% and treatment-dependent changes were expressed as a percentage

thereof.The absolute concentrations of plasma fibrinogen and E-selectin at t=0, i.e. the control

value used for normalization, are given in the legend of figure 2.

Lipid and lipoprotein analysis

Total plasma cholesterol levels were measured using kits No-1489437 (Roche Diagnostics,

Almere, The Netherlands). Lipoprotein profiles were obtained by SMART analysis using the

ÅKTA FPLC system (Pharmacia, Roosendaal,The Netherlands) as described (Verschuren et al.,

2005).The triglyceride content of the lipoprotein fractions was determined using kit No 337-B

(Sigma Aldrich Chemie BV, Zwijndrecht,The Netherlands).

Statistical analysis

Results are expressed as means ± SD, except for Figure 1 (means ± SEM). Changes over time

within a group were analyzed by repeated measures ANOVA in combination with Dunnett

post-hoc analysis (InStat software package, GraphPad, San Diego, USA), and significant changes

compared to t=0 are indicated *P<0.05. Differences between groups at a particular time point

were analyzed by one-way ANOVA followed by a least significant difference (LSD) post–hoc test

(SPSS version 11.5 for Windows; SPSS Chicago, USA). Means without a common letter differ,

P<0.05.The stimulating effect of IL-1ß on CRP was analyzed by two-way ANOVA in combination

with a Bonferroni post-hoc analysis. Significant stimulations are indicated #P<0.05.

Results

Generation and characterization of wild-type and flavonoid-enriched tomato peel

WtTom peel flavonoids mainly consisted of naringenin chalcone and moderate amounts of

quercetin-3-rutinoside (Table 1). Overexpression of CHI and FNS resulted in a strong decrease

of naringenin chalcone in flTom (3% compared to wtTom), as CHI and FNS use the naringenin

103

Cha

pter

5

chalcone pool for production of flavonols and flavones, respectively. Overexpression of CHI and

FNS in flTom was accompanied by a strong increase of the flavonols quercetin-3-rutinoside (19-

fold of wtTom) and kampferol-rutinoside (>37-fold of wtTom). Furthermore, quercetin-3-

glucoside and kaempferol-3-glucoside were detected (not quantified) in the fruit peel of flTom.

WtTom do not contain flavones because the biochemical branch leading to this flavonoid class

is dependent on the presence of FNS, an enzyme absent in wtTom. The introduction of the

transgenes (in flTom) also resulted in the occurrence of the flavones luteolin-7-glucoside and

luteolin. Compounds other than flavonoids, for example the content of chlorogenic acid (a

precursor of the flavonoids), were comparably expressed in wtTom and flTom (mean ± SD; 56

± 5 and 68 ± 8 mg/kg DW, respectively).

Table I. Flavonoid composition of lyophilized tomato peel tissue from wild-type or genetically engineered flavonoid

tomato.

Expressed per dry weight. tomato peel constituted approximately 100 g/kg of fresh tomato weight. Lyophilization

reduced the peel weight for another 90%.Values are means ± SD, 1 not detected.

wtTom peel flTom peel

mg/kg mg/kg

Flavanone

Naringenin chalcone 3707 ± 505 115 ± 2

Flavonols

Quercetin aglycon ND1 275 ± 12

Quercetin-3-rutinoside (rutin) 630 ± 50 12120 ± 760

Kaempferol-rutinoside ≤ 53 1985 ± 118

Flavones

Luteolin aglycon ND 3343 ± 243

Luteolin-7-glucoside ND 1547 ± 131

Flavonoid precursors

Chlorogenic acid 56 ± 5 68 ± 8

Effect of tomato peel-feeding on general health markers in CRPtg mice

The food intake during the treatment period was comparable in all groups. Mean intake was 4.7

± 0.3 g in the Con group, 4.3 ± 0.6 g in the wtTom group, 4.5 ± 0.5 g in the flTom group and

4.5 ± 0.5 g in the FF group.The changes in bodyweight during the treatment period (wk 0 to 7)

and during the subsequent washout period (wk 7 to 9), during which all mice received

maintenance diet again, were analyzed (Table II).

104

Compared to the initial bodyweight at t=0, bodyweight increased significantly and comparably

in all groups from t=4 wk onwards, except in the FF group. In this group, significant increases in

bodyweight were observed at later time points (from t=6 wk onwards). The total gain in

bodyweight during the experimental period was not statistically different between groups.

When compared to the initial level at t=0 (27.7 ± 5.6 IU/L; mean±SD), plasma ALAT levels were

slightly increased in the Con group at the end of the treatment period of 6 wk (45.8 ± 15.2

IU/L, P<0.05).This increase in ALAT was not observed in the tomato peel-treated wtTom and

flTom groups, both of which displayed plasma ALAT concentrations comparable to the initial

values at t=0 (wtTom, 23.1 ± 2.4 IU/L; flTom; 20.7 ± 3.0 IU/L). In the FF group, plasma ALAT level

was strongly and significantly elevated (117 ± 29.9 IU/L).The liver weight to bodyweight ratios,

as assessed after termination at t=9 wk, were comparable between the Con group (0.051 ±

002; mean±SD), the wtTom group (0.052 ± 0.006) and the flTom group (0.054 ± 0.004), whereas

a slight and significant increase was found in the FF group (0.057 ± 0.004 g; P<0.05 vs Con).

Table II. Bodyweight change over time in CRPtg mice

Con wtTom flTom FF

Time, wk Bodyweight, g

0 27.8±1.5 26.5±2.6 28.1±1.1 28.4±2.3

1 29.0±1.7* 27.5±2.9 28.3±1.4 29.0±2.2

2 28.8±1.7* 27.1±2.6* 28.1±1.3 28.3±2.2

3 28.9±1.1* 27.9±2.9* 28.7±1.3 29.0±2.3

4 30.1±2.2* 28.2±3.2* 28.8±1.2* 29.0±2.4

5 30.6±2.3* 28.8±3.2* 30.0±1.4* 29.3±2.3

6 30.5±2.3* 28.4±3.1* 29.5±1.3* 29.4±2.8*

7 31.2±2.3* 29.1±3.2* 30.6±1.4* 29.8±2.2*

9 31.5±2.4* 29.2±3.1* 30.4±1.6* 29.9±2.1*

Values are means ± SD; n=10 (Con, wtTom, FF), n=8 (flTom).

*Different from t=0 values within a group.

Effect of tomato peel-feeding and its withdrawal on plasma CRP

All groups had comparable initial plasma CRP levels at t=0 (mean: 9.7 mg/L), and the CRP levels

of the Con group remained at this level during the complete experimental period (Figure 1A).

Treatment with wild-type tomato peel significantly reduced CRP already after 2 wk, and a

maximal reduction was observed after 4 wk of treatment (43% reduction compared to t=0,

105

Cha

pter

5

P<0.05). CRP levels remained low in the wtTom group for the remainder of the treatment

period.The CRP-lowering effect in the flTom was even more pronounced (by 56% reduction

compared to t=0, P<0.05), and plasma CRP concentrations in this group were constantly lower

than in the wtTom group at all treatment time points.The additional CRP-reducing effect in the

flTom group compared to the wtTom group became significant at the end of the treatment

period, i.e. at t=6 wk and t=7 wk. In the FF group, CRP levels declined rapidly and stronger than

in both tomato peel-fed groups (93% reduction compared to t=0 at t=2 wk; P<0.05). CRP

concentrations remained at this low level during the period that mice received FF.After 6 wk

of experimental dietary treatment mice were challenged with intraperitoneally injected acute

inflammatory stimulus, IL-1ß. Analysis of plasma CRP concentrations before and 10 h after

stimulation with IL-1ß showed that induction of CRP expression was comparable in all groups,

except for the FF group, in which the IL-1ß-dependent induction of CRP was almost fully

suppressed (Figure 1B; Of note, IL-1ß-induced CRP values are not shown in Figure 1A.)

Figure 1. Basal (A) and interleukin-1ß (IL-1ß)-induced (B) CRP expression in CRPtg mice.Values are means ± SEM; n=10

(Con, wtTom, FF), n=8 (flTom).The un stimulated CRP value in (B) is equivalent to the basal CRP value in (A) at t=6

wk. (A) *Different from the t=0 value within a specific group, P<0.05. Means without a common letter differ at a specific

time point, P<0.05. (B) #Different from un stimulated, P<0.05.

106

When dietary treatment with wtTom and flTom was stopped and mice received maintenance

diet again (Figure 1A, 7 wk to 9 wk, washout), CRP levels in the wtTom group were still lower

at t=9 wk than at t=0, whereas the flTom group returned to a level comparable to baseline.A

similar effect was seen in the FF group, which also returned to the initial level indicating that

the decrease in CRP in the flTom and FF groups was a specific treatment effect.

Effect of tomato peel-feeding on cardiovascular risk factors other than CRP

The plasma levels of fibrinogen (a hepatic acute phase reactant involved in coagulation), E-

selectin (a sensitive marker of vascular inflammation) and total cholesterol at t=0, t=4 wk and

t=7 wk were determined (Figure 2). Since mice were matched into groups on the basis of their

baseline CRP level at t=0, the initial concentrations of fibrinogen, E-selectin and cholesterol

varied between groups (cf. absolute concentrations in legend of Figure 2).Therefore, initial levels

were set 100% and treatment-dependent changes were expressed relative to that.

There was no significant change in plasma fibrinogen in the Con group or in the two tomato

peel-treated groups (data not shown). By contrast, strongly reduced plasma fibrinogen levels

were found with FF treatment in wk 4 (31% reduction compared to t=0; P<0.05) and wk 7 (20%

reduction; P<0.05). During the experimental period, plasma E-selectin concentrations increased

significantly in the Con group and, compared to t=0, elevations of 63% (P<0.05) and 40%

(P<0.05) were found at wk 4 and 7, respectively (Figure 2A).This increase in E-selectin was not

observed in the wtTom and flTom groups both of which displayed E-selectin levels that were

comparable to the initial level at t=0. Fenofibrate had a similar quenching effect, with plasma E-

selectin concentrations also remaining at baseline (t=0) levels.

In the Con group, the plasma cholesterol level did not significantly change over time, i.e.

comparable levels were observed at the beginning and at the end of the experimental period

(Figure 2B). In both tomato peel treated groups, total plasma cholesterol concentrations

increased slightly, and after 7 wk of treatment a comparable increase was observed (7% in the

wtTom and 5% in the flTom).Analysis of the lipoprotein profile at this time point revealed that

the cholesterol-elevating effect of tomato fruit could mainly be ascribed to an increase in HDL

cholesterol (Figure 2C).A similar HDL-increasing effect was observed in the FF group, with total

cholesterol being significantly increased by 11% at t=7 wk.

DiscussionSeveral epidemiological studies have demonstrated that a high intake of fruit and vegetables

correlates with a decreased risk for cardiovascular pathologies (Hung et al., 2004-3).Among the

nutrients that are considered to be responsible for this protective effect are the dietary

flavonoids. In recent years, genetic engineering technologies have allowed the generation of

107

Cha

pter

5

transgenic plants, which accumulate specific nutrients, including flavonoids (Schijlen et al., 2006;

Muir et al., 2001; Bovy et al., 2002), with potentially favorable effects (Rein and herbers, 2006).

High flavonoid transgenic plants have not been tested in clinical studies so far. It thus remains

unclear whether their consumption may improve human health or surrogate markers thereof.

Figure 2. Normalized plasma E-selectin (A) and total cholesterol levels (B), and lipoprotein distribution (C) in CRPtg

mice. (A, B) Changes are relative to the value at t=0 which was set 100%, i.e. the t=0 value is the control value used

for normalization.The absolute values at t=0 for the Con, wtTom, flTom and FF groups were 95.9, 83.8, 92.4 and 98.5

mg E-selectin/L; 2.00, 1.86, 2.09 and 1.88 mmol/L total cholesterol, respectively.Values are means ± SD. *Different from

the t=0 value within a specific group, P<0.05. Means without a common letter differ at a specific time point, P<0.05. (C)

Plasma lipoprotein profile of pooled plasma at 7 wk.

108

In this study, we used human CRPtg mice (Szalai et al., 2002; Kleemann et al., 2004;Verschuren

et al., 2005) to examine the in vivo effects of wtTom and transgenic flavone- and flavonol-rich,

but flavanone-reduced tomato, flTom, on markers of general health and cardiovascular risk.The

diet fed to CRPtg mice reflected a human intake of approximately 2.3 g tomato peel or 230 g

fresh fruit (about 3 medium tomatoes) per day. Our results show that 1) consumption of

wtTom peel has beneficial effects on the plasma levels of human CRP, E-selectin and HDL

cholesterol and 2) consumption of flTom additionally improves the beneficial effects of wtTom

by further lowering human CRP levels.To our knowledge, this is the first time that a) a specific

fruit has been demonstrated to reduce human CRP and b) transgenic overexpression of specific

flavonoids results in a further reduction of this important cardiovascular risk marker. Most

importantly, these findings have been obtained in a humanized in vivo model.

A growing body of epidemiological evidence supports the view that flavonoids, and in particular

the subclasses of flavonols and flavones, exert cardioprotective health effects (Graf et al., 2005).

Among the fruits and vegetables that are rich in flavonols (mostly quercetin) are (in mg/kg FW)

tomatoes 5-30, onions 150-500, brewed black and green tea 40-50, apples 15-70 and red grapes

30-40. Flavones (mg/kg FW) occur mainly in celery 60, hot peppers 50-100, and herbs such as

parsley 3000 and peppermint 200, but hardly occur in tomatoes (USDA, 2003, Hertog and

Hollman, 1996).

The transgenic tomatoes used in this study were engineered to overexpress CHI, resulting in

high accumulation of flavonols, predominantly quercetin and kampferol with their respective

glucosides and rutinosides. Similarly, the expression of the gene construct introduced luteolin

and its glucosides into tomato.The flavonol and flavone concentrations achieved in fresh tomato

peel (flavonols, 1400 mg/kg; flavones almost 500 mg/kg) indicate high concentrations in the fruit.

Tomato skin contains >95% of the fruit flavonoids (Stewart et al., 2000). Beside flavonoids,

carotenoids are substantial secondary metabolites of tomato peel.The major carotenoids found

in peel extracts were lycopene and ß-carotene, contributing 90-95% and 5-10% of total

carotenoid content respectively. Measurements of these carotenoids in the freeze-dried peel of

wtTom and flTom showed similar concentration (data not shown). Thus, through genetic

engineering, tomato fruit were generated that rivals those edible food plants with the highest

flavonol and flavone concentrations. A similar upregulation of flavonols in tomato plants has

recently been reported after overexpression of petunia CHI (Muir et al., 2001).

Plasma ALAT levels in the Con group increase within 6 weeks after the switch from a

maintenance diet to an experimental diet that contained about 2-fold more fat. Increased

consumption of dietary fat, as during experimental diet feeding, has been shown to result in an

upregulation of hepatic factors associated with stress and organ damage (reviewed in

(Kleemann and Kooistra, 2005)). Our data demonstrate that tomato peel mixed into the

experimental diet prevented an experimental diet-induced upregulation of plasma ALAT, a

serum marker of possible tissue damage (Edgar et al., 1998). In contrast to the beneficial effects

of tomato peel on the liver, fenofibrate treatment strongly increased plasma ALAT

concentrations and also increased liver weight to bodyweight ratio. Elevation of plasma ALAT

levels by fibrates has been shown to occur in a PPARα-dependent way in rodents (Kok et al.,

2003). This effect may be related to the well-documented enlargement of rodent livers by

fibrates and the adverse (carcinogenic) effects of PPARα-activators in rodents (Makowska et al.,

1992; Gonzalez et al., 1998).

A major finding of this study is the suppression of CRP expression by tomato peel, an effect

even more pronounced with transgenic flavonoid tomato peel (24% further reduction).To our

knowledge, results from this study demonstrate for the first time that a genetically engineered

fruit with enhanced flavonoids levels can have anti-inflammatory effects that exceed the effects

of its wild-type counterpart. An important regulator of CRP gene expression is NFKB

(Kleemann et al., 2003). NFKB is a pro-inflammatory, redox-sensitive transcription factor that is

induced by cytokines such as IL-1ß and that plays an important role in the development of

cardiovascular pathologies (de Winther et al., 2005). Other genes that are regulated by NFKB

include vascular cell adhesion molecule-1 and endothelial cell adhesion molecule (E-selectin)

(Kleemann and Kooistra, 2005).

Tomato peel contains several components that have been shown to suppress NFKB signaling.

Among the components that potentially interfere with the NFKB signaling route are the

carotenoids lycopene and ß-carotene, both of which were present in wtTom and flTom at

similar concentrations. For example, lycopene inhibits mitogen-activated NFKB in a murine

dentritic cell model (Kim et al., 2004) and ß-carotene blocks the lipopolysaccharide-induced

nuclear translocation of NFKB in macrophages (Bai et al., 2005). In line with this, epidemiological

data show a positive correlation between high ß-carotene and lycopene plasma levels and low

CRP expression (Herpen-Broekmans et al., 2004; Ford et al., 2003).

Among the components overexpressed in flTom are the flavonoids quercetin and luteolin, and

their conjugates. Clinical studies suggest that flavonols and flavones affect antioxidant

biomarkers. For instance, dietary quercetin reduces lymphocyte DNA strand breakage,

decreases urinary 8-hydroxy-2’-deoxyguanosine concentrations, increases plasma antioxidant

capacity and improves the oxidative resistance of LDL (Hertog and Hollman, 1996;Williamson

and manach, 2005). However, the effects of dietary quercetin on inflammatory markers in

humans are not consistent (Williamson and manach, 2005) and evidence for anti-inflammatory

effects of flavonols and flavones comes predominantly from cell culture studies. For example,

the flavonol quercetin inhibits NFKB activation in cultured human synovial cells (Sato et al.,

1997) and rat aortic smooth muscle cells (Rangan et al., 1999), and reduces IL-1ß-induced NFKB

activation in rat hepatocytes (Martinez-Florez et al., 2005). The flavones luteolin and apigenin

109

Cha

pter

5

interfere with the NFKB-pathway thereby inhibiting the production of pro-inflammatory

cytokines (Hougee et al., 2005) and circulating inflammatory markers (Ueda et al., 2002), and

repressing the induction of cell adhesion molecules (Choi et al., 2004, Chen et al., 2004).We

cannot exclude that a reduction of the flavanone content (i.e. naringenin chalcone) in genetically

engineered flTom may have contributed to the effects observed in the flTom group (eg. CRP-

lowering). Naringenin chalcone has been shown to inhibit histamine release and to act anti-

allergic (Yamamoto et al., 2004), but potential direct pro-inflammatory effects have so far not

been described. In case of its isomer, naringenin, neutral or mild anti-inflammatory properties

have been reported such as the inhibition of lipopolysaccharide-induced NO synthase

expression in RAW 264.7 cells (Tsai et al., 1999).Together, the above findings demonstrate that

predominantly flavonols and flavones exert anti-inflammatory activities on NFKB-regulated

genes, which supports our finding that the consumption of flavonoid-rich flTom reduces human

CRP levels beyond the level achieved with wtTom.

Our data show that tomato peel effectively lowered baseline human CRP, i.e. a chronic low-

grade inflammatory state, but did not suppress an acute inflammatory stimulus, i.e. an

intraperitoneal injection of IL-1ß resulting in a subsequent elevation of human CRP plasma

levels. This is in contrast to the effects seen with the more potent anti-inflammatory,

hypolipidemic drug, fenofibrate. Fibrates strongly suppress the upregulation of CRP by IL-1ß in

CRPtg mice and in primary human hepatocytes (Kleemann et al., 2004; Kleemann et al., 2003;

Verschuren et al., 2005). Besides lowering plasma CRP, fenofibrate also reduced plasma

fibrinogen concentrations as shown recently in mice and humans (Gervois et al., 2004).WtTom

and flTom had no effect on fibrinogen in CRPtg mice, further underlining that wtTom and flTom

are less potent regarding their anti-inflammatory action at the concentrations used.

We observed that total plasma cholesterol concentrations increased slightly and comparably in

both the wtTom group and the flTom group. Plasma cholesterol in mice is mainly confined to

the HDL lipoprotein fraction and only to a minor extent to VLDL and LDL/IDL lipoprotein

particles.While VLDL and LDL are atherogenic, HDL is atheroprotective. Increased HDL levels

correlate with a reduced incidence of cardiovascular events (Lewis and Rader, 2005). Our

plasma lipoprotein analysis shows that consumption of wtTom and flTom increased the amount

of HDL and decreased the amount of VLDL and LDL particles.These findings are in line with

the inverse association between fruit and vegetable intake and plasma LDL levels as reported

in some, though not all clinical studies (Djousse et al., 2004).

Similar to the favorable effects of flavonoid-enriched tomato peel in this study, other dietary

ingredients such as plant sterols (Ostlund, 2004) and very long chain n-3 fatty acids (Calder,

2004) have been shown to affect human cardiovascular risk factors in a beneficial way. A

combination of such active dietary ingredients may thus, by additive or even synergistic action,

110

exert effects resembling those of established pharmacological drugs (Jenkins et al., 2003).

Genetic enhancement of valuable dietary components in plant foods, such as specific flavonoids

in tomatoes, may allow us to optimize human food composition and may help to reduce the

burden of cardiovascular disease.

111

Cha

pter

5

112

Chapter 6

Summarizing Discussion

113

Cha

pter

6

114

Summarizing discussion

In order to adapt to a constantly changing environment, plants use their enormous metabolic

capacity to produce a large variety of secondary metabolites. Flavonoids are polyphenolic

compounds that comprise the most common group of plant secondary metabolites.

In nature flavonoids are involved in a wide range of biological functions. For example, they are

responsible for pigmentation of many flowers, fruits and seeds to attract pollinators and seed

dispersers. Furthermore, they are involved in plant protection against UV light, plant defence

against pathogens, as well as acting as signal molecules within plant-microbe interactions. In

addition, flavonoids play a role in plant fertility and pollen germination (Koes et al.,1994; Dixon

and Paiva, 1995; Dooner et al, 1991). Their wide occurrence, large diversity and manifold of

functions have made flavonoids a very attractive subject for research on a genetic, bio-chemical,

enzymatic and molecular biological level. A vast amount of knowledge on flavonoids has

accumulated during the last decades and this has provided the subsequent tools and the know-

how for successful metabolic engineering of the flavonoid pathway in several plant species

(Forkmann and Martens, 2001).

There are two main reasons for modification of the secondary metabolite compo-sition in

plants. 1) In horticultural plant species, flower colour is one of the most important traits

attracting consumer attention. As such it is a critical factor for the commercial success of

ornamental plants at the marketplace. Anthocyanins, carotenoids and betalain are the main

flower pigments of which the first have been most studied and manipulated to change flower

colour (Forkmann 1993).

2) From an agricultural point of view, the nutriceutical potential of flavonoids is one of the major

reasons to modify flavonoid levels and composition in crop plants.There is increasing evidence

for the health-protecting properties of flavonoids. Depending on the flavonoid structure. anti-

oxidative, anti-tumour, anti-inflammatory and anti-atherosclerotic activities have been

described. However, major nutritional crop plants often lack the desired flavonoids or contain

only small amounts of them in the relevant tissues. Metabolic engineering has now provided a

means to improve flavonoid content and composition in a broad range of crop plants. In the

first chapter, an overview of the current status of the genetic modification of flavonoid

biosynthesis in crop plants is described.

In this thesis, the aim was to genetically modify the flavonoid pathway in tomato fruit. This

research was carried out for two main reasons: First, to gain more insight into the genetic

regulation of the flavonoid biosynthetic pathway, and second, to further explore the possibilities

to obtain tomato fruits with increased levels of flavonoids, presumed to exert beneficial effects

on human health.

115

Cha

pter

6

For this, we have used tomato (Solanum lycopersicum) as a model plant for several reasons:

Tomato is a world wide crop, among vegetables second only after potato, with high commercial

importance for both fresh market and processing industry.

From a scientific point of view, tomato can be regarded as model plant for fleshy fruits. In

tomato the flavonoid pathway is already (partially) active resulting in the accumulation of

flavonoids in the fruit peel. Furthermore, during the past few years, tomato has been successfully

subjected to genetic modification by several research groups (Muir et al 2001; Bovy et al., 2002;

Davuluri et al., 2005; Giovinazzo et al., 2005) resulting in a modified flavonoid content.

Pathway engineering as a proof of principle

This thesis describes various approaches for metabolic engineering of flavonoid biosynthesis in

tomato. In order to obtain more insight in the role of flavonoids in tomato fruits, we blocked

the flavonoid biosynthesis in tomato by RNAi mediated suppression of the gene encoding

chalcone synthase (described in chapter 2), the first step of the flavonoid pathway.HPLC analysis

revealed that this resulted in plants bearing fruits with strongly decreased flavonoid levels. In

addition, these transgenic fruits displayed an altered colour due to the absence of the yellow

coloured chalcones and surprisingly, these fruits were devoid of seeds.

A relationship between flavonoids and plant fertility has been described in other Solanaceous

specious, tobacco and petunia, where the lack of flavonoids results in male sterile plants (Van

der Meer et al., 1992; Ylstra et al., 1992,1996; Mo et al., 1992). This was most likely due to

disturbed pollen tube growth, thus preventing the pollen tubes to reach and fertilize the ovules.

Likewise, in the self-pollinated Chs RNAi tomato plants we observed that pollen tube growth

was strongly inhibited and although the developmental program leading to fruit ripening was

initiated, this finally resulted in seedless (parthenocarpic) fruits. Pollen tube growth and seed set

were fully rescued when Chs deficient pollen was applied on WT stigmas, whereas reciprocal

crossings (WT pollen on Chs RNAi stigmas) resulted in only a partial rescue of pollen tube

growth and seed set. These results indicate that in Chs RNAi tomato, fertilisation is mainly

diminished due to the lack of flavonoids in the female reproductive organ. Further research is

needed, however, to better understand the role of flavonoids in processes of pollen(tube)

formation, in communication between pollen tube and maternal tissue, as well as in the

interaction with hormone-related processes involved in fruit development.

To get more insight into the transcriptional regulation of the flavonoid pathway in tomato, we

used transgenic tomato overexpressing different flavonoid transcription factors which were

used to increase flavonoid biosynthesis in tomato fruit. In chapter 3 we describe the use of

several molecular tools to identify putative target genes of the Antirrhinum majus transcription

factors Rosea and Delila and the transcription factors Lc and C1 from maize

Whereas overexpression of Lc and C1 in tomato resulted mainly in the accumulation of

116

flavonols, introduction and simultaneous overexpression of Rosea and Delila resulted in high

levels of phenylpropanoids and anthocyanins. In both cases, the flavonoid pathway was strongly

induced in the flesh of the fruit, a tissue that normally does not accumulate flavonoids. In

addition overexpression of these transcription factors to an enhanced flavonoid biosynthesis in

fruits peel.The different flavonoid end product in LC/C1 and Rosea/Delila overexpressing tomato

fruits resulted from differences of endogenous flavonoid target genes that were switched on by

either LC/C1 or Ros/Del.The most striking difference was the strong upregulation of the gene

F3’5’H in Ros/Del plants and the lack of induction of this gene in LC/C1 plants. Furthermore,

Ros/Del plants showed increased expression levels of the phenylpropanoid genes PAL and C4H,

and likewise accumulated higher levels of phenylpropanoids when compared to LC/C1 tomato

fruits. On the other hand, the lack of induced PAL and F3’5’H expression plus the high

expression levels of the genes CHI through FLS finally resulted in the corresponding lack of

anthocyanins but accumulation of flavonols in tomato fruits overexpressing the monocot

transcription factors.

Thus using flavonoid transcription factors from different origin, various sets of endogenous

structural flavonoid genes can be switched on, also in tissue normally lacking any flavonoid

biosynthesis. In combination with the expression of endogenous structural genes this leads to

different flavonoid metabolites accumulation in tomato fruit.

Pathway engineering for improved phytochemical composition.

To explore possibilities to create new flavonoid pathway branches, we introduced several

structural flavonoid genes from foreign plant species in order to obtain specific flavonoid

classes. Thereby, we focused on producing particular phenolic compounds (stilbenes,

deoxychalcones, flavones and flavonols) that have been reported to exert health promoting

bioactivities, but are not very abundant in the Western diet and low or completely absent in

tomato fruit.

Flavonoids as antioxidants

The best-described health related property of almost every group of flavonoids is their capacity

to act as antioxidants. Human body cells and tissues are continuously threatened by the damage

caused by free radicals and reactive oxygen species, which are produced during normal oxygen

metabolism or are induced by exogenous damage (Nijveldt et al., 2001).The exact mechanisms

and sequence of events by which free radicals interfere with cellular functions are not fully

understood, but one of the most important events seems to be lipid peroxidation, which results

in cellular damage.To protect themselves from reactive oxygen species, living organisms have

developed several effective mechanisms to deal with free radicals (Pietta et al., 2000; Nijveldt et

al., 2001). The antioxidant-defence mechanism of the human body includes enzymes such as

117

Cha

pter

6

superoxide dismutase, catalase, and glutathione peroxidase, but also non-enzymatic

counterparts such as glutathione, ascorbic acid and _-tocopherol. Increased production of

reactive oxygen species results in consumption and depletion of the pool of endogenous

scavenging compounds.Antioxidants obtained from the diet, such as flavonoids, may therefore

have an additive effect to the endogenous radical scavenging capacity.

In chapter 4 the generation of transgenic tomato fruits with novel flavonoid antioxidants is

described.The flavonoid composition of the transgenic fruit peel extracts was determined by

HPLC analysis.The fruit peel tissue of the different tomato lines showed a broad variation of

newly produced phytochemicals: resveratrol and its glucoside piceid in Sts overexpressing

tomatoes, butein and isoliquiritigenin in Chs/Chr overexpressing tomatoes and luteolin, luteolin-

7-glucoside plus high amounts of kaempferol- and quercetin glycosides in Chi/Fns overexpressing

tomato. It was demonstrated that these transgenic fruits have altered antioxidant profiles due

to changed flavonoid composition. Especially the flavonols and flavones produced, displayed a

good antioxidant activity in vitro. In Chi/Fns tomatoes, the total antioxidant activity of peel tissue

was increased up to 3.5-fold. In addition to their antioxidant activity, flavonoids newly produced

in these transgenic tomatoes may show a different bioavailability and or bioactivity as compared

to endogenous flavonoids normally found within most cultivated tomatoes. Bioavailability of

dietary flavonoids is an important factor in possible health beneficial effects in humans. In natural

food sources, flavonoids exist predominantly in a glycosylated form rather than as aglycons and

the form of the flavonoid glycoside influences the rate of absorption. For example, it has been

shown that quercetin glycosides are absorbed more readily then the aglycon form (Hollman and

Katan 1999;Williamson et al., 2000; Arts et al., 2004). Although basic research, animal models,

and human studies suggest an inverse relationship between flavonoid intake and the risk of

several age-related chronic diseases, data on the absorption, metabolism and excretion of

flavonoids in humans are contradictory and scarce (Graf et al., 2005; Nijveldt et al., 2001).

It is generally accepted that the metabolism of flavonoids in the human body begins with the

conjugation of a glucuronide moiety, mediated by enzymes in the gastro-intestinal tract. The

flavonoid is then bound to albumin and transported to the liver. In the liver, conjugation of the

flavonoid can be extended by adding a sulphate group, a methyl group or both (Scalbert and

Williamson 2000; Nijveldt et al., 2001; Graf et al., 2006).The addition of these groups increases

the circulatory elimination time and probably also decreases toxicity.The type of conjugation

and its position on the flavonoid skeleton will most likely influence the antioxidant activity, and

other probable bioactivities such as enzyme inhibiting capacity exerted by the flavonoid.

The phytochemical composition of the human diet, including the content of individual flavonoids

and flavonoid subclasses, can vary markedly, even between similar food products (Lapointe et

al., 2006). In addition, there is only limited information on the availability and biotransformation

of flavonoids present in different food sources.The genetically engineered tomatoes described

118

in chapter 4 may be very useful to study the potential health benefits of specific natural

flavonoids present in the same tomato-based food matrix.

The last chapter of this thesis (Chapter 5), describes an application of genetically modified food

sources to investigate the presumed relationship between increased consumption of fruits and

vegetables and reduced cardiovascular diseases. It is generally assumed that flavonoids

contribute for a large part to this beneficial effects of fruits and vegetables.To study putative

health effects of flavonoids present in tomato fruit, peel of wild type tomatoes and flavonoid-

enriched tomatoes (i.e. high flavone and high flavonol fruits, described in chapter 4) were used

for feeding experiments with transgenic mice expressing human C-reactive protein (CRP).This

CRP is a highly sensitive marker for inflammation and constitutes a strong independent

predictor of future cardiovascular events in human. Cardiovascular risk markers expressed by

these mice were analyzed to investigate potential effects due to tomato consumption and to

study additional effects of flavonoid enriched tomatoes. The results described in chapter 5

showed that tomato peel lowered the baseline levels of human CRP, i.e. a lowered chronic low-

grade inflammatory state, but did not suppress an acute inflammatory stimulus.This effect was

pronounced by flavonoid enriched tomato. In addition, serum lipoprotein analysis of these mice

showed that consumption of both wild type and high flavonoid tomato peel increased the

amount of athero-protective HDL and decreased the amount of atherogenic VLDL and LDL

particles.These findings support the beneficial effects of fruit and vegetables as well as flavonoid

intake on cardiovascular diseases.

Because individual polyphenolic compounds of fruits and vegetables potentially have similar or

overlapping mechanisms which could be conducive to additive, synergistic or even antagonistic,

more research is needed to study the effect of combinations of polyphenols on various health

issues.Tomato fruits with different flavonoid composition as described in the chapters 2 through

4 of this thesis, could be very useful to study bio-availability, bio-activity and structure-function

relation of different flavonoid classes within the same food matrix. The advantage of the

described flavonoid modified tomato approach is that different classes of flavonoids are

enhanced in a natural fruit context, which is different and potentially more powerful compared

to studies on the effects of a one single compound situation.

Metabolomics approaches could allow for the identification of specific combinations of

polyphenolics which may be more or less beneficial in their natural matrix or environment at

relevant doses. Once known which levels and structures are most beneficial for human health,

flavonoid biosynthesis could be engineered or selected by classical breeding to select for

optimal composition in tomato fruit. However, even after identification of one or a few ‘healthy’

metabolites, we have to keep in mind that we do not expect to much from a particular

compound.The huge diversity of flavonoids and other secondary metabolites present in plants

certainly reflects the requirement of a varied diet.

119

Cha

pter

6

Public acceptance of genetically modified crops: technology versus society?

For thousands of years crops have been improved, mainly by selection of plants by people who

needed them for food, feed, fibers and pharmaceuticals. Plants that were most productive were

collected and cultivated and this was the driving force in crop domestication, long before people

began to understand the scientific principles underlying heredity.

During the history of traditional plant breeding through to current methods of genetic

modification the major motivation has been to identify and select for genes that confer

desirable crop characteristics. Especially during the past two decades there have been

considerable advances in methods of crop improvement. An effective initiation of the

biotechnology revolution in the agro-food sector was in 1986, when the first plant

transformation was achieved.The first generation of genetically modified (GM) products, were

mainly created to optimize input and yield performance. Probably the most well known example

among them are the Bt-cotton and Bt-corn with increased insect resistance, and the Roundup

Ready™ soybean with herbicide tolerance.The second-generation GM plants included the Flavr

Savr™ tomatoes that were engineered to reveal a longer shelf life.These FlavrSavr tomato was

the first transgenic food crop on the market, but unfortunately, this was subjected to

commercial failure (Phillips, 2002).

Although the introduction of GM food crops encounters many obstacles, public concerns and

protest actions, the global area with GM crop production has grown steadily.To date, more than

15 crops have been genetically modified.The main crops, accounting for 99% of the total acreage

planted are soybean, maize, cotton and canola. Nowadays, more then 222 million acres (James

C., 2004; ISAAA) are used for GM crop cultivation, mostly by the following five countries: USA,

Argentina, Brasil, Canada and China.

The application of biotechnology within the agro-food sector has raised many social and ethical

questions. Some of them legitimate and specific to biotechnology, but some of them artificial

and criticizing modern industrial economies in general. Opinions towards GM differ strongly

and this issue is therefore heavily debated. Consumer attitudes are generally negative towards

GM in food production (Grunert et al., 2003). It has been suggest that this negative attitude

towards GM is embedded in a system of more general attitudes and are partially based on miss

information, frightening and emotional feelings (Dale, 1999; Nielsen, 2003;Tenbült et al., 2005).

Critics of modern GM consider this technology sometimes to be imprecise and capable of

disturbing the natural genetic balance of organisms. In fact, one important feature of transgenic

plants is that they can be analyzed with molecular precision that is impossible for characteristics

obtained by traditional breeding methods, where changes usually occur at random in unknown

genes and may potentially involve much broader genome rearrangements.

Furthermore, some people reject GM food because they are afraid of unknown long-term

effects on human health and ecological balance. For this, the use of antibiotic resistance markers

120

in GM crops is doubtful. Extensive studies have concluded, however, that the use of resistance

genes (e.g. Kanamycine) present no enhanced risk to human health and or the environment

(Bertoni and Marsan, 2005). In addition, nowadays, various research programs avoid the use of

these selection markers or eliminate them afterwards. Finally the risks of introducing toxins or

allergens in food crops is minimized by assessment of all transgenes (allergenic or non allergenic

source) and their encoded proteins (amino-acid comparison with known allergens as well as

their stability to digestion) (Lehrer and Bannon, 2005). So monitoring changes at genomic,

transcriptomic, proteomic and metabolomic level in GM crops, as required by safety assessment

procedures, will result in enormous amounts of data. Integration of these data in the context

of systems biology will be a big challenge with the ultimate goal to predict strategies and results

of genetic engineering, optimize the potential benefits of this technology and avoid unintended

and unpredicted effects.

Therefore, we should use scientific developments with optimal care and responsibility for the

benefits of GM for humankind and the wider environment. Failing to understand non-scientific

perspectives will inevitably lead to a breakdown of communication, decision- and progress-

making.What is important to individuals from different cultures and why it is important to them

needs to be made more leading in the GM food debate, because the prospects for a better

bioengineered world will not be determined by science but by the capacity of public, research

and government to adapt, adopt and implement the new technology in commercially and

socially beneficial ways.

121

Cha

pter

6

122

References

Abad, M., Monteiro,A.A. (1989) The use of auxins for the production of greenhouse tomatoes in mild

winter conditions: a review. Sci Hort 38, 167-192

Abrahams, S., Tanner, G.J., Larkin, P.J., Ashton, A.R. (2002) Identification and biochemical

characterization of mutants in the proanthocyanidin pathway in Arabidopsis. Plant Phys. 130,

561-576.

Aerts, R.J., Barry, T.N., McNabb, W.C. (1999) Polyphenols and agriculture: beneficial effects of

proanthocyanidins in forages. Agric. Ecosyst. Environ. 75, 1-12.

Aharoni,A., De Vos, C.H.,Wein, M., Sun, Z., Greco, R., Kroon,A., Mol, J.N., O'Connell,A.P. (2001) The

strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in

transgenic tobacco. Plant J. 28, 319-32.

Aida, R., Kishimoto, S.,Tanaka,Y., Shibata, M. (2000) Modification of flower color in torenia (Torenia

Fournieri Lind.) by genetic transformation. Plant Sci. 153, 33-42.

Aida, R.,Yoshida, K., Kondo,T., Kishimoto, S., Shibata, M. (2000) Copigmentation gives bluer flowers

on transgenic torenia plants with the antisense dihydroflavonol-4-reductase gene. Plant Sci.

160, 49-56.

Arts, I.C., Seseink,A.L., Faassen-Peters, M., Hollman, P.C. (2004) The type of sugar moiety is a major

determinant of the small intestine uptake and subsequent biliary excretion of dietary

quercetin glucosides. Br J Nutr. 91, 841-847

Bai, S.K., Lee, S.J., Na, H.J., Ha, K.S., Han, J.A., Lee, H., Kwon,Y.G., Chung, C.K., Kim,Y.M. (2005) beta-

Carotene inhibits inflammatory gene expression in lipopolysaccharide-stimulated

macrophages by suppressing redox-based NF-kappaB activation. Exp Mol Med. 37, 323-334.

Ballance GM, Dixon RA. (1995) Medicago sativa cDNAs encoding chalcone reductase. Plant Phys. 107,

1027-1028.

Bartel, B., Matsuda, S.P.T. (2003) Seeing red. Science 299, 352-353.

Bazzano, L.A., Serdula, M.K., Liu, S. (2003) Dietary intake of fruits and vegetables and risk of

cardiovascular disease. Curr Atheroscler Rep. 5, 492-499.

Beekwilder, J., Jonker, H., Meesters, P., Hall, R.D., van der Meer, I.M., Ric de Vos, C.H. (2005)

Antioxidants in raspberry: on-line analysis links antioxidant activity to a diversity of individual

metabolites. J Agric Food Chem. ,53, 3313-20.

Beekwilder, J., Hall, R.D., and de Vos C.H. R. (2005) Identification and dietary relevance of antioxidants

from raspberry. BioFactors 23, 197–205.

Bertoni, G. and Marsan, P.A. (2005) Safety risks for animals fed genetic modified (GM) plants.

Veterinary Res.Communications 29, 13-18.

Bongue-Bartelsman, M., and Philips, D.A. (1995). Nitrogen stress regulates gene expression of

enzymes in the flavonoid biosynthetic pathway of tomato. Plant Physiol. Biochem. 33, 539–546.

123

Bovy,A., van den Berg, C., de Vrieze, G.,Thompson,W.F.,Weisbeek, P., and Smeekens, S. (1995) Light-

regulated expression of the Arabidopsis thaliana ferredoxin gene requires sequences

upstream and downstream of the transcription initiation site. Plant Mol. Biol. 27, 27-39.

Bovy, A., de Vos, R., Kemper, M., Schijlen, E., Almenar Pertejo, M., Muir, S., Collins, G., Robinson, S.,

Verhoeyen, M., Hughes, S., Santos-Buelga, C., van Tunen, A. (2002) High-flavonol tomatoes

resulting from heterologous expression of the maize transcription factor gene LC and C1.

Plant Cell 14, 2509-2526.

Bradley, J.M., Davies, K.M., Deroles, S.C., Bloor, S.J., Lewis, D.H. (1998) The maize LC regulatory gene

up-regulates the flavonoid biosynthetic pathway of Petunia. Plant J. 13, 381-392.

Bradley, J.M., Deroles, S.C., Boase, M.R., Bloor, S., Swinny, E., Davies, K.M. (1999) Variation in the ability

of the maize LC regulatory gene to upregulate flavonoid biosynthesis in heterologous

systems. Plant Sci. 140, 31-39.

Breithaupt, H. (2004) GM plants for your health. EMBO reports 5, 1031-1034.

Britsch, L., Ruhnau-Brich, B., Forkmann, G. (1992) Molecular cloning, sequence analysis, and in vitro

expression of flavanone 3 beta-hydroxylase from Petunia hybrida. J Biol Chem. 267, 5380-5387.

Britsch, L., Dedio, J., Saedler, H., Forkmann, G. (1993) Molecular characterization of flavanone 3 beta-

hydroxylases. Consensus sequence, comparison with related enzymes and the role of

conserved histidine residues. European Journal of Biochemistry 217, 745-754.

Brown, D.E., Rashotte, A.M., Murphy, A.S., Normanly, J., Tague, B.W., Peer,W.A., Taiz, L., Muday, G.K.

(2001) Flavonoids act as negative regulators of auxin transport in vivo in arabidopsis. Plant

Physiol. 126, 524-535.

Burbulis, I.E., Winkel-Shirley, B. (1999) Interactions among enzymes of the Arabidopsis flavonoid

biosynthetic pathway. Proc. Natl. Acad. Sci. 96, 12929-12934.

Butelli, E., Mock, H-P., Matros,A., Peterek, S., Schijlen, E.G.W.M., Hall, R., Bovy,A.G., Smith,A.C., Souza-

Marques, D., and Martin, C. (2006) Ectopic production of anthocyanins results in purple

tomatoes with increased antioxidant capacity and extended shelf life. in preparation.

Calder, P.C. (2004) n-3 Fatty acids and cardiovascular disease: evidence explained and mechanisms

explored. Clin Sci (Lond). 107, 1-11.

Castelluccio, C., Paganga, G., Melikian, N., Bolwell, P.G., Pridham, J., Sampson, J., Rice-Evans, C. (1995)

Antioxidant potential of intermediates in phenylpropanoid metabolism in higher plants. FEBS

Letters 368, 188-192.

Celotti E, Ferrarini R, Zironi R, Conte LS. (1996) Resveratrol content of some wines obtained from

dried Valpolicella grapes: Recioto and Amarone. J Chromatogr A. 730, 47-52.

Chen, C.C., Chow, M.P., Huang, W.C., Lin,Y.C., Chang,Y.J. (2004) Flavonoids inhibit tumor necrosis

factor-alpha-induced up-regulation of intercellular adhesion molecule-1 (ICAM-1) in

respiratory epithelial cells through activator protein-1 and nuclear factor-kappaB: structure-

activity relationships. Mol Pharmacol. 66, 683-693.

124

Choi, J.S., Choi,Y.J., Park, S.H., Kang, J.S., Kang,Y.H. (2004) Flavones mitigate tumor necrosis factor-

alpha-induced adhesion molecule upregulation in cultured human endothelial cells: role of

nuclear factor-kappa B. J Nutr. 134, 1013-1019.

Colliver, S., Bovy,A., Collins, G., Muir, S., Robinson, S., de Vos, C.H.R.,Verhoeyen, M.E. (2002) Improving

the nutritional content of tomatoes through reprogramming their flavonoid biosynthetic

pathway. Phytochem Rev. 1, 113-123.

Cone, K.C., Burr, F.A., Burr, B. (1986). Molecular analysis of the maize anthocyanin regulatory locus

C1. Proc. Natl. Acad. Sci. 83, 9631-5.

Constant, J. (1997) Alcohol, ischemic heart disease, and the French paradox. Coron Artery Dis. 8, 645-

649.

Courtney-Gutterson, N., Napoli, C., Lemieux, C., Morgan, A., Firoozabady, E., Robinson, K.E. (1994)

Modification of flower color in florist's chrysanthemum: production of a white-flowering

variety through molecular genetics. Biotechnology 12, 268-71.

Dale, P.J. (1999) Public reactions and scientific responses to transgenic crops. Curr Opinion Biotech. 10,

203-208.

Davies, K.M., Bloor, S.J., Spiller, G.B., Deroles, S.C. (1998) Production of yellow colour in flowers:

redirection of flavonoid biosynthesis in Petunia. Plant J. 13, 259-266.

Davuluri, G.R., van Tuinen, A., Fraser, P.D., Manfredonia, A., Newman, R., Burgess, D., Brummell, D.A.,

King, S.R., Palys, J., Uhlich, J., Bramley, P.M., Pennings, H.M.J. and Bowler, C. (2005) Fruit-specific

RNAi-mediated suppression of DET1 enhances carotenoid and flavonoid content in

tomatoes. Nature Biotech. 23, 890-895.

Debeaujon, I., Peeters,A.J.M., Leon-Kloosterziel, K.M., Koornneef, M. (2001) The TRANSPARENT TESTA

12 gene of Arabidopsis encodes a multidrug secondary transporter-like protein required for

flavonoid sequestration in vacuoles of the seed coat endothelium. Plant Cell 13, 853-871.

Deboo, G.B., Albertsen, M.C., Taylor, L.P. (1995) Flavanone 3-hydroxylase transcripts and flavonol

accumulation are temporally coordinate in maize anthers. Plant J. 7, 703-13.

Dellaporta, S.,L.,Wood, J., Hicks, J.B. (1983) A plant DNA minipreparation: version II. Plant Mol Biol

Rep. 1, 1921.

Deroles S.C., Bradley, J.M., Schwinn, K.E., Markham, K.R., Bloor, S., Manson, D.G., Davies, K.M. (1998)

An antisense chalcone synthase cDNA leads to novel colour patterns in lisianthus (Eustoma

grandiflorum) flowers. Mol. Breeding 4, 59-66.

Despres, J.P., Lemieux, I., Robins, S.J. (2004) Role of fibric acid derivatives in the management of risk

factors for coronary heart disease. Drugs 64, 2177-2198.

Deveaux Y, Peaucelle A, Roberts GR, Coen E, Simon R, Mizukami Y,Traas J, Murray JA, Doonan JH,

Laufs P. (2003) The ethanol switch: a tool for tissue-specific gene induction during plant

development. Plant J. 36, 918-930.

125

De Vos, R., Bovy,A., Busink, H., Muir, S., Collins, G.,Verhoeyen, M. (2000) Improving health potential of

crop plants by means of flavonoid pathway engineering. Polyphenols Commun. 1, 25-26.

Dixon, R.A., Paiva, N.L. (1995) Stress-Induced Phenylpropanoid Metabolism. Plant Cell 7, 1085-1097.

Dixon., R.A., Harrison, M.J., Paiva, N.L. (1995) The isoflavonoid phytoalexins pathway: from enzyme to

genes to transcriotion factors. Physiol. Plant, 93, 385-392.

Dixon, R.A., Lamb, C.J., Masoud, S., Sewalt, V.J.H. and Paiva, N.L. (1996) Metabolic engineering:

prospects for crop improvement through the genetic manipulation of phenylpropanoid

biosynthesis and defense responses – a review. Gene 179, 61-71.

Dixon, R.A., Steele, C.L. (1999) Flavonoids and isoflavonoids - a gold mine for metabolic engineering.

Trends Plant Sci. 4, 394-400.

Djousse, L.,Arnett, D.K., Coon, H., Province, M.A., Moore, L.L., Ellison, R.C. (2004) Fruit and vegetable

consumption and LDL cholesterol: the National Heart, Lung, and Blood Institute Family Heart

Study. Am J Clin Nutr. 79, 213-217.

Dooner, H.K. ,Robbins,T.P., Jorgensen, R.A. (1991) Genetic and developmental control of anthocyanin

biosynthesis. Annu.Rev.Genet. 25, 173-199.

Eckermann, C., Schröder, G., Eckermann, S., Strack, D., Schmidt, J., Schneider, B., Schröder, J. (2003)

Stilbenecarboxylate biosynthesis: a new function in the family of chalcone synthase-related

proteins. Phytochemistry 62, 271-286.

Edgar,A.D.,Tomkiewicz, C., Costet, P., Legendre, C.,Aggerbeck, M., Bouguet, J., Staels B., Guyomard,

C., Pineau, T., Barouki, R. (1998) Fenofibrate modifies transaminase gene expression via a

peroxisome proliferator activated receptor alpha-dependent pathway. Toxicol Lett. 98, 13-23.

Edlund,A.F., Swanson, R. and Preuss, D. (2004) Pollen and stigma structure and function:The role of

diversity in pollination. Plant Cell. 16, S84-S97.

Eldik, G.J., Reijnen, W.H., Ruiter, R.K., van Herpen, M.M.A., Schrauwen, J.A.M., Wullems, G.J. (1997)

Regulation of flavonol biosynthesis during anther and pistil development, and during pollen

tube growth in Solanum tuberosum. Plant J. 11, 105-113.

Falavigna, A., Baldino, M., Soressi, G.P. (1978) Potetial of the mono Mendelian factor pat in tomato

breeding for industry. Genet Agraria 32, 159-160.

Fettig, S., Hess, D. (1999) Expression of a chimeric stilbene synthase gene in transgenic wheat lines.

Transgenic Res. 8, 179-189.

Fillatti, J.J., Kiser, J., Rose, R., and Comai, L. (1987) Efficient transfer of a glyphosate tolerance gene into

tomato using a binary Agrobacterium tumefaciens vector. Bio.Technol., 5, 726-730.

Finkel,T. (2003) Ageing: a toast to long life. Nature 425, 132-133.

Finucane, M. L. (2002) Mad cows, mad corn and mad communities: the role of socio-cultural factors

in the perceived risk of genetically-modified food. Proc. Nutrition Society 61, 31–37.

Fischer, R., Budde, I., Hain, R. (1997) Stilbene synthase gene expression causes changes in flower

colour and male sterility in tobacco. Plant J. 11, 489-498.

126

Ford, E.S., Liu, S., Mannino, D.M., Giles,W.H., Smith, S.J. (2003) C-reactive protein concentration and

concentrations of blood vitamins, carotenoids, and selenium among United States adults. Eur

J Clin Nutr. 57, 1157-1163.

Forkmann, G. (1991) Flavonoids as flower pigments: the formation of the natural spectrum and its

extension by genetic engineering. Plant Breed. 106, 1-26.

Forkmann, G., Martens, S. (2001) Metabolic engineering and applications of flavonoids. Curr. Opin.

Biotechnol. 12, 155-160.

Forkmann, G. and Heller,W. (1999) Biosynthesis of Flavonoids. In: Comprehensive Natural Products

Chemistry.Amsterdam, Elsevier, 713-748.

Fos, M., Nuez, F., García-Martínez, J.L. (2000) The pat-2 gene, which induces natural parthenocarpy,

alters gibberellin content in unpollinated tomato ovaries. J. Plant Physiol. 122, 471-479.

Fos, M., Proaño, K., Nuez, F., García-Martínez, J.L. (2001) Role of gibberellins in parthenocarpic fruit

development induced by the genetic system pat-3/pat-4 in tomato. Physiologia plantarum 111,

545-550.

Fukui, Y., Tanaka, Y., Kusumi, T., Iwashita, T., Nomoto, K. (2003) A rationale for the shift in colour

towards blue in transgenic carnation flowers expressing the flavonoid 3’,5’-hydroxylase gene.

Phytochemistry 63, 15-23.

Gervois, P., Kleemann, R., Pilon, A., Percevault, F., Koenig, W., Staels, B., Kooistra, T. (2004) Global

suppression of IL-6-induced acute phase response gene expression after chronic in vivo

treatment with the peroxisome proliferator-activated receptor-alpha activator fenofibrate. J

Biol Chem. 279, 16154-16160.

Giovinazzo, G., D’Amico, L., Paradiso, A., Bollino, R., Sparvoli, F., DeGara, L. (2005) Antioxidant

metabolite profiles in tomato fruit constitutively expressing the grapevine stilbene synthase

gene. Plant Biotechnol. J. 3, 57-69.

Goldsbrough A., Belzile, F.,Yoder, J.I. (1994) Complementation of the tomato anthocyanin without (aw)

mutant using the dihydroflavonol 4-reductase gene. Plant Physiol. 105, 491-496.

Goldsbrough,A.P.,Tong,Y.,Yoder, J.I. (1996) LC as a non-destructive visual reporter and transposition

excision marker gene for tomato. Plant J. 9, 927-933.

Gonzalez, F.J., Peters, J.M., Cattley, R.C. (1998) Mechanism of action of the nongenotoxic peroxisome

proliferators: role of the peroxisome proliferator-activator receptor alpha. J Natl Cancer Inst.

90, 1702-1709.

Goodrich, J., Carpenter, R., Coen, E.S. (1992) A common gene regulates pigmentation pattern in

diverse plant species. Cell 68, 955-64.

Goto,T., 1987. Structure, stability and color variation of natural anthocyanins. In: Herz ,W., Grisebach,

H., Kirby, G.E.,Tamm, C. (eds) Progress in Chemistry of Organic Natural Products. Springer-Verlag,

Wien, 113-158.

127

Graf, B.A., Milbury, P.E., Blumberg, J.B. (2005) Flavonols, flavones, flavanones, and human health:

epidemiological evidence. J Med Food. 8, 281-290.

Graf, B.A., Ameho, C., Dolnikowski, G.G., Milbury, P.E., Chen, C-Y., Blumberg, J.B. (2006) Rat

gastrointestinal tissues metabolize quercetin. J. Nutrition 136, 39-44.

Grotewold, E., Drummond, B.J., Bowen, B., Peterson,T. (1994) The myb-homologous P gene controls

phlobaphene pigmentation in maize floral organs by directly activating a flavonoid

biosynthetic gene subset. Cell 76, 543-553.

Grotewold, E., Chamberlin, M., Snook, M., Siame, B., Butler, L., Swenson, J., Maddock, S., St.Clair, G.,

Bowen, B. (1998) Engineering secondary metabolism in maize cells by ectopic expression of

transcription factors. Plant Cell 10, 721-740.

Grunert, K.G., Bredahl, L., Scholderer, J. (2003) Four questions on European consumers’ attitudes

toward the use of genetic modification in food production. Innov.Food Sci. Emerg.Technol. 4,

435-445.

Gustafson, F.G. (1942) Parthenocarpy: natural and artificial. Bot Rev. 8, 599-654.

Gynheung,A.N., Ebert, P.R., Mitra,A., and Ha, S.B. (1988) Binary vectors. In: Plant Molecular Biology

Manual, S.B. Gelvin, R.A. Schilperoort, and D.P.S. Verma, eds (Dordrecht, The Netherlands:

Kluwer Academic Publishers), pp.A3/1–A3/19.

Hain, R., Reif H.J., Krause, E., Langebartels, R., Kindl, H.,Vornam, B.,Wiese,W., Schmelzer, E., Schreier,

P.H., Stöcker, R.H., Stenzel, K. (1993) Disease resistance results from foreign phytoalexin

expression in a novel plant. Nature 361, 153-156.

Hall, S.S. (2003) Longevity research in vino vitalis? Compounds activate life-extending genes.

Science 29, 1165.

Hamilton, C.M., Frary,A. , Lewis, C. and Tanksley, S.D. (1995) Stable transfer of intact high molecular

weight DNA into plant chromosomes. Proceedings of Natural Academy of Science USA,93, 9975-

9979

Harborne, J.B. and Williams C.A. (2000) Advances in flavonoid research since 1992. Phytochemistry 55,

481-504.

Haytowitz, D.B., Eldridge,A.L., Bhagwat, S., Gebhardt, S.E. , Holden, J.M., Beecher, G.R., Peterson, J., and

Dwyer, J. (2003) International Research Conference on Food, Nutrition and Cancer. July 17-

18,Washington D.C.

He, F.J., Nowson, C.A., MacGregor, G.A. (2006) Fruit and vegetable consumption and stroke: meta-

analysis of cohort studies. Lancet 367, 320-326.

Heller,W. and Forkmann, G. (1993) In: The Flavonoids: Advances in research since 1986, p. 399-425

(Ed.J.B.Harborn), Chapman and Hall, London.

128

129

Herpen-Broekmans, W.M., Klopping-Ketelaars, I.A., Bots, M.L., Kluft, C., Princen, H., Hendriks, H.F.,

Tijburg, L.B., van Poppel, G., Kardinaal,A.F. (2004) Serum carotenoids and vitamins in relation

to markers of endothelial function and inflammation. Eur J Epidemiol. 19, 915-921.

Hertog, M.G.L., Hollman, P.C., Katan, M.B., Kromhout, D. (1993) Intake of potentially anticarcinogenic

flavonoids and their determinants in adults in the Netherlands. Nutr Cancer 20, 21-29.

Hertog, M.G., Hollman, P.C. (1996) Potential health effects of the dietary flavonol quercetin. Eur J Clin

Nutr. 50, 63-71.

Höfgen,R.,Willmitzer, L. (1988) Storage of competent cells for Agrobacterium transformation.Nucleic

Acids Research, 16, 9877.

Hollman, P.C. and Katan, M.B. (1999) Dietary flavonoids: intake, health effects and bioavailability. Food

Chem Toxicol. 37, 937-942.

Holton,T.A., Brugliera, F.,Tanaka,Y. (1993) Cloning and expression of flavonol synthase from Petunia

hybrida. The Plant Journal 4, 1003 -1010.

Holton,T.A., Cornish, E.C. (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell

7, 1071-1083.

Hughes, P., Dennis, E.,Whitecross, M., Llewellyn, D. and Gage, P. (2000) The cytotoxic plant protein, b-

purothionin, forms ion channels in lipid membranes. J Biological Chem. 275, 823-827.

Hougee, S., Sanders, A., Faber, J., Graus,Y.M., van den Berg, W.B., Garssen, J., Smit, H.F., Hoijer, M.A.

(2005) Decreased pro-inflammatory cytokine production by LPS-stimulated PBMC upon in

vitro incubation with the flavonoids apigenin, luteolin or chrysin, due to selective elimination

of monocytes/macrophages. Biochem Pharmacol. 69, 241-248.

Hrazdina,G. and Jensen, R.A. (1992) Spatial Organization of Enzymes in Plant Metabolic Pathways.

Annu. Rev. Plant. Physiol. Plant Molec. Biol. 43, 241-267.

Hrazdina G,Wagner GJ. (1985) Metabolic pathways as enzyme complexes: evidence for the synthesis

of phenylpropanoids and flavonoids on membrane associated enzyme complexes. Arch.

Biochem. Biophys. 237, 88-100.

Hunt, G.M. and Baker, E.A. (1980) Phenolic constituents of tomato cuticles. Phytochemistry 19, 1415-

1419.

Hung, L.M., Chen, J.K., Huang, S.S., Lee, R.S., Su, M.J. (2000) Cardio protective effect of resveratrol, a

natural antioxidant derived from grapes. Cardiovascular Research 47, 549-555.

Hung, H.C., Joshipura, K.J., Jiang,R., Hu, F.B., Hunter, D., Smith-Warner, S.A., Colditz, G.A., Rosner, B.,

Spiegelman, D., Willett, W.C. (2004) Fruit and vegetable intake and risk of major chronic

disease. J Natl Cancer Inst. 96,1577-1584.

130

Husken, A., Baumert, A., Milkowski, C., Becker, H.C., Strack, D., Mollers, C. (2005) Resveratrol

glucoside (Piceid) synthesis in seeds of transgenic oilseed rape (Brassica napus L.). Theor Appl

Genet. 14, 1-10.

Hwang, E.I., Kaneko, M., Ohnishi,Y., Horinouchi, S. (2003) Production of plant specific flavanones by

Escherichia coli containing an artificial gene cluster. Applied and Environmental Microbiology 69,

2699-2706.

Jackson, D., Roberts, K., Martin, C. (1992) Temporal and spatial control of expression of anthocyanin

biosynthetic genes in developing flowers of Anthirrinum majus. Plant J. 2, 425-434.

James, C. (2004) Global Status of CommercializedTransgenic Crops, ISAAA Briefs;

http://isaaa.org/publications/briefs/isaaa_briefs.htm.

Jang, M.S., Cai, E.N., Udeani, G.O., Slowing, K.V., Thomas, C.F., Beecher, C.W.W., Fong, H.H.S.,

Farnsworth, N.R., Kinghorn, A.D., Mehta, R.G., Moon, R.C. and Pezzuto J. (1997) Cancer

chemopreventive activity of resveratrol, a natural product derived from grapes. Science 275,

218-220.

Jeandet, P., Douillet-Breuil,A.-C., Bessis, R., Debord, S., Sbaghi, M.,Adrian, M. (2002) Phytoalexins from

the Vitaceae: biosynthesis, phytoalexins gene expression in transgenic plants, antifungal activity

and metabolism. J. Agric. Food Chem. 50, 2731-2741.

Jenkins, D.J., Kendall, C.W., Marchie,A., Faulkner, D.A.,Wong, J.M., de Souza R., Emam A., Parker,T.L.,

Vidgen, E. et al. (2003) Effects of a dietary portfolio of cholesterol-lowering foods vs lovastatin

on serum lipids and C-reactive protein. JAMA. 290, 502-510.

Jones, C.M., Mes, P., Myers, J.R. (2003) Characterization and inheritance of the Anthocyanin fruit (Aft)

tomato. Journal of Heredity 94, 449-456.

Jorgensen, R.A., Cluster, P.D., English, J., Que, Q., Napoli, C.A. (1996) Chalcone synthase

cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs

and single-copy vs. complex T-DNA sequences. Plant Molecular Biology 31, 957-973.

Joung, J.-Y., Kasthuri, M., Park, J.-Y., Kang,W.-J., Kim, H.-S.,Yoon, B.-S., Joung, H., Jeon, J.-H. (2003) An

overexpression of chalcone reductase of Pueraria montana var. lobata alters biosynthesis of

anthocyanin and 5’-deoxyflavonoids in transgenic tobacco. Biochem. Biophys. Res. Comm. 3003,

326-331.

Kim, H.P., Son, K.H., Chang, H.W., Kang, S.S. (2004) Anti-inflammatory plant flavonoids and cellular

action mechanisms. J Pharmacol Sci. 96, 229-245.

Kim, G.Y., Kim, J.H.,Ahn, S.C., Lee, H.J., Moon, D.O., Lee, C.M., Park,Y.M. (2004) Lycopene suppresses

the lipopolysaccharide-induced phenotypic and functional maturation of murine dendritic

cells through inhibition of mitogen-activated protein kinases and nuclear factor-kappaB.

Immunology 113, 203-211.

Kleemann, R., Gervois, P.P.,Verschuren, L., Staels, B., Princen, H.M., Kooistra,T. (2003) Fibrates down-

regulate IL-1-stimulated C-reactive protein gene expression in hepatocytes by reducing

nuclear p50-NFkappa B-C/EBP-beta complex formation. Blood 101, 545-551.

Kleemann, R., Verschuren, L., de Rooij, B.J., Lindeman, J., de Maat, M.M., Szalai, A.J., Princen, H.M.,

Kooistra,T. (2004) Evidence for anti-inflammatory activity of statins and PPARalpha activators

in human C-reactive protein transgenic mice in vivo and in cultured human hepatocytes in

vitro. Blood 103, 4188-4194.

Kleemann, R., Kooistra, T. (2005) HMG-CoA Reductase Inhibitors: Effects on Chronic Subacute

Inflammation and Onset of Atherosclerosis Induced by Dietary Cholesterol. Current Drug

Targets - Cardiovascular & Hematological Disorders. 5, 441-453.

Ko., W.G., Kang, T.H., Lee, S.J., Kim, Y.C., Lee, B.H. (2002) Effects of luteolin on the inhibition of

proliferation and induction of apoptosis in human myeloid leukaemia cells. Phytother. Res. 16,

295-298.

Kobayashi, S., Ding, C.K., Nakamura,Y., Nakajima, I., Matsumoto, R. (2000) Kiwifruits (Actinidia deliciosa)

transformed with a Vitis stilbene synthase gene produce piceid (resveratrol-glucoside). Plant

Cell Rep. 19, 904-910.

Koes, R.E., Spelt, C.E., van den Elzen, P.J., and Mol, J.N. (1989) Cloning and molecular characterization

of the chalcone synthase multigene family of Petunia hybrida. Gene 81, 245–257.

Koes, R.E., Quattrocchio, F. and Mol, J.N.M. (1994) The flavonoid biosynthetic pathway in plants:

function and evolution. BioEssays 16, 123-132.

Kok, T., Bloks, V.W., Wolters, H., Havinga, R., Jansen, P.L., Staels, B., Kuipers, F. (2003) Peroxisome

proliferator-activated receptor alpha (PPARalpha)-mediated regulation of multidrug

resistance 2 (Mdr2) expression and function in mice. Biochem J. 369, 539-547.

Koleva, I.I., Niederlander, H.A., van Been,T.A. (2000) An on-line HPLC method for detection of radical

scavenging compounds in complex mixtures. Anal Chem. 72, 2323-2328.

Kristiansen, K.N. and Rohde, W. (1991) Structure of the Hordeum vulgare gene encoding

dihydroflavonol-4-reductase and molecular analysis of ANT18 mutants blocked in flavonoid

synthesis. Mol.Gen.Genet. 230, 49-59.

Kris-Etherton, P.M., Lefevre, M., Beecher, G.R., Gross, M.D., Keen, C.L., Etherton,T.D. (2004) Bioactive

compounds in nutrition and health-research methodologies for establishing biological

function: the antioxidant and anti-inflammatory effects of flavonoids on atherosclerosis. Annu

Rev Nutr. 24, 511-538.

Kuo, S-M (1997) Dietary flavonoids and cancer prevention: evidence and potential mechanism. Critical

reviews in oncogenesis 8, 47-69.

Lapointe, A., Couillard, C., Lemieux S. (2006) Effects of dietary factors on oxidation of low-density

lipoprotein particles. J.Nutr.Biochem. (in press)

131

Lehrer, S.B., Bannon, G.A. (2005) Risk of allergic reactions to biotech proteins in foods: perception

and reality. Allergy 60, 559-564.

Leckband, G., Lörz, H. (1998) Transformation and expression of a stilbene synthase gene of Vitis

vinifera L. in barley and wheat for increased fungal resistance. Theor.Appl. Genet. 96, 1004-1012.

Le Gall, G., DuPont, M.S., Mellon, F.A., Davis,A.L., Collins, G.J.,Verhoeyen, M.E., Colquhoun, I.J. (2003)

Characterization and content of flavonoid glycosides in genetically modified tomato

(Lycopersicon esculentum) fruits. J. Agric. Food. Chem. 51, 2438-2446.

Lewis, G.F., Rader, D.J. (2005) New insights into the regulation of HDL metabolism and reverse

cholesterol transport. Circ Res. 96, 1221-1232.

Liu, C.-J., Blount, J.W., Steele, C.L., Dixon, R.A. (2002) Bottlenecks for metabolic engineering of

isoflavone glyconjugates in Arabidopsis. Proc. Natl. Acad. Sci. USA 99, 14578-14583.

Lloyd,A.M.,Walbot,V., Davis, R.W. (1992) Arabidopsis and Nicotiana anthocyanin production activated

by maize regulators R and C1. Science 258, 1773-1775.

Luka_in, R., Wellmann, F., Britsch, L., Martens, S., Matern, U. (2003) Flavonol synthase from Citrus

unshiu is a bifunctional dioxygenase. Phytochemistry 62, 287-292.

Lukaszewicz, M., Matysiak-kata, Skala, J., Fecka, I., Cisowski,W., Szopa, J. (2004) Antioxidant capacity

manipulation in transgenic potato tuber by changes in phenolic compounds content. J. Agric.

Food. Chem. 52, 1526-1533.

Machha,A., Mustafa, M.R. (2005) Chronic treatment with flavonoids prevents endothelial dysfunction

in spontaneously hypertensive rat aorta. J Cardiovasc Pharmacol. 46, 36-40.

Makowska, J.M., Gibson, G.G., Bonner, F.W. (1992) Species differences in ciprofibrate induction of

hepatic cytochrome P450 4A1 and peroxisome proliferation. J Biochem Toxicol. 7, 183-191.

Manach, C., Scalbert, A., Morand, C., Remesy, C., Jimenez, L. (2004) Polyphenols: food sources and

bioavailability. Am J Clin Nutr. 79, 727-747.

Marles, S.M.A., Ray, H., Gruber, M.Y. (2003) New perspectives on proanthocyanidin biochemistry and

molecular regulation. Phytochemistry 64, 367-383.

Martens, S.,Teeri,T., Forkmann, G. (2002) Heterologous expression of dihydroflavonol 4-reductases

from various plants. FEBS Letters 531, 453-458.

Martens S, Forkmann G. (1999) Cloning and expression of flavone synthase II from Gerbera hybrids.

Plant Journal. 20, 611-8.

Martens, S., Forkmann, G., Britsch, L.,.Wellmann, F., Matern, U., Luka_in R. (2003) Divergent evolution

of flavonoid 2-oxoglutarate-dependent dioxygenase in parsley. FEBS Letters 544, 93-98.

Martens S., Mithöfer,A. (2005) Flavones and flavone synthases. Phytochem. 66, 2399-2407.

Martens, S., Witte, S., Gebhardt, Y., Lohner, K., Wenzel, U. and Matern, U. (In preparation, 2006)

Enzymatic synthesis of 14C-labeled flavones.

132

Martin, C., Prescott,A., Mackay, S., Bartlett, J.,Vrijlandt, E. (1991) Control of anthocyanin biosynthesis

in flowers of Antirrhinum majus. Plant J. 1, 37-49.

Martin, C., Jin, H., Schwinn, K. (2001) Mechanisms and applications of transcriptional control of

phenylpropanoid metabolism. In: ‘Regulation of phytochemicals by molecular techniques’. Eds.

J.T. Romeo, J.A. Saunders, B.F. Matthews. Elsevier Science Ltd, Oxford, 179-195.

Martinez-Florez, S., Gutierrez-Fernandez, B., Sanchez-Campos, S., Gonzalez-Gallego, J., Tunon, M.J.

(2005) Quercetin attenuates nuclear factor-kappaB activation and nitric oxide production in

interleukin-1beta-activated rat hepatocytes. J Nutr. 135, 1359-1365.

Mascarenhas, J.P. (1993) Molecular mechanisms of pollen tube growth and differentiation. Plant Cell.

5, 1303-1314.

Mathews, H., Clendennen, S. K., Caldwell, C. G., Liu, X.L., Connors, K., Matheis, N., Schuster, D.K.,

Menasco, D.J.,Wagoner,W., Lightner, J., and Ry Wagner, D., (2003) Activation tagging in tomato

identifies a transcriptional regulator of anthocyanin biosynthesis, modification and transport.

The Plant Cell 15, 1689-1703.

Mazzucato, A., Olimpieri, I., Ciampolini, F., Cresti, M., Soressi, G.P. (2003) A defective pollen-pistil

interaction contributes to hamper seed set in the parthenocarpic fruit tomato mutant. Sex

plant reprod. 16, 157-164.

McClintock, B. (1967) Regulation of pattern of gene expression by controlling elements in maize.

Carnegie Inst.Yearb. 65, 568-578.

Memelink, J., Menke, F.L.H., van der Fits, L., Kijne, J.W. (2000) Transcriptional regulators to modify

secondary metabolism. In: Metabolic engineering of plant secondary metabolism. , Eds. R.

Verpoorte and W. Alfermann, Kluwer Academic Publishers, Dordrecht, 111-125.

Middleton E, Kandaswami, C. and Theoharides, C.T. (2000) The effects of plant flavonoids on

mammalian cells: implications for inflammation, heart disease and cancer. Pharmacol Rev. 52,

673-751

Mo, Y., Nagel, C., Taylor, L.P. (1992) Biochemical complementation of chalcone synthase mutants

defines a role for flavonols in functional pollen. Proc. Natl. Acad. Sci. USA 89, 7213-7217.

Mol, J., Grotewold, E., Koes, R. (1998) How genes paint flowers and seeds. Trends Plant Sci. 3, 212-217.

Mol, J., Cornish, E., Mason, J., Koes, R. (1999) Novel coloured flowers. Curr. Opinion Biotech. 10, 198-

201.

Mooney, M., Desnos, T., Harrison, K., Jones, J., Carpenter, R., Coen, E. (1995) Altered regulation of

tomato and tobacco pigmentation genes caused by the Delila gene of Antirrhinum. Plant J. 7,

333-339.

Morelli, R., Das, S., Bertelli,A., Bollini, R., Lo Scalzo, R., Das, D.K., Falchi, M. (2006) The introduction of

the stilbene synthase gene enhances the natural antiradical activity of Lycopersicon esculentum

mill. Mol. Cell. Biochem. 282, 65-73.

133

Muir, S.R., Collins, G.J., Robinson, S., Hughes, S., Bovy, S., De Vos, C.H., van Tunen,A.J.,Verhoeyen, M.E.

(2001) Overexpression of petunia chalcone isomerase in tomato results in fruit containing

increased levels of flavonols. Nature Biotech. 19, 470-474.

Nakayama, T., Yonekura-Sakakibara, K., Sato, T., Kikuchi, S., Fukui, Y., Fukuchi-Mizutani, M., Ueda, T.,

Nakao, M.,Tanaka,Y., Kusumi,T., Nishino,T. (2000) Aureusidin synthase: a polyphenol oxidase

homolog responsible for flower coloration. Science 290, 1163-1166.

Napoli, C.A., Fahy, D., Wang, H.-Y., Taylor, L.P. (1999) White anther: a Petunia mutant that abolishes

pollen flavonol accumulation, induces male sterility, and is complemented by a chalcone

synthase transgene. Plant Physiol. 120, 615-622.

Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M., Lepiniec, L. (2000) The TT8 gene encodes

a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in

Arabidopsis siliques. Plant Cell 12, 1863-1878.

Nesi, N., Jond, C., Debeaujon, I., Caboche, M., Lepiniec, L. (2001) The Arabidopsis TT2 gene encodes

a R2R3 domain protein that acts as a key determinant for proanthocyanidin accumulation in

developing seed. Plant Cell 13, 2099-2114.

Nichenametla, S.N., Taruscio, T.G., Barney, D.L., Exon, J.H. (2006). A review of the effects and

mechanism of polyphenolics in cancer. Critical Rev. Food Sci Nutrition 46, 161-183.

Nielsen, K., Deroles, S.C., Markham, K.R., Bradley, M.J., Podivinsky, E., Manson, D. (2002) Antisense

flavonol synthase alters co-pigmentation and flower color in lisianthus. Mol. Breeding 9, 217-

229.

Nielsen, K.M. (2003) Transgenic organisms – time for conceptual diversification? Nature Biotechnology

21, 227-228.

Nijveldt, R.J., van Nood, E., van Hoorn, D.E.C., Boelens, P.G., van Norren, K., van Leeuwen, P.A.M.

(2001) Flavonoids: a review of probable mechanisms of action and potential applications.

Am.J.Clin Nutr. 74, 418-425.

Noda, K., Glover, B.J., Linstead, P., Martin, C. (1994) Flower colour intensity depends on specialized

cell shape controlled by a Myb-related transcription factor. Nature 369, 661-664.

Nuez, F., Costa, J., Cuartero, J. (1986) Genetics of the parthenocarpy for tomato varieties ‘Sub-Arctic

Plenty’, ‘75/59’ and ‘Severianin’. Z Pflanzenzüchtung 96, 200-206.

O’Prey, J., Brown, J., Fleming, J., Harrison, P.R. (2003) Effects of dietary flavonoids on major signal

transduction pathways in human epithelial cells. Biochem Pharmacol. 66, 2075-2088.

Ostlund, R.E., Jr. (2004) Phytosterols and cholesterol metabolism. Curr Opin Lipidol. 15, 37-41.

Parr,A.J. and Bowell, G.P. (2000) Phenols in the plant and in man.The potential of possible nutritional

enhancement of the diet by modifying the phenol content or profile. J.Sci.Food Agric. 80, 985-

1012.

Pawlowski, K., Kunze, R., De Vries, S., Bisseling, T. (1994) Isolation of total, poly (A) and polysomal

134

RNA from plant tissues. In: Plant Molecular Biology Manual (Gelvin, S.B., Shilperoort, R.A.,

eds),. pp. 113. Dordrecht: Kluwer Academic Publishers.

Pelegrini, P.B. and Franco, .O.L. (2005) Plant gamma-thionins: novel insights on the mechanism of

action of a multi-functional class of defense proteins. Int J Biochem Cell Biol. 37, 2239-2253

Pelletier, M.K., Burbulis, I.E.,Winkel-Shirley, B. (1999) Disruption of specific flavonoid genes enhances

the accumulation of flavonoid enzymes and end-products in Arabidopsis seedlings. Plant

Molecular Biology 40, 45-54.

Pervaiz, S. (2003) Resveratrol: from grapevines to mammalian biology. FASEB J. 14, 1975-1985.

Phillips, P. (2002) Biotechnology in the global agri-food system. Trends Biotechn. 20, 376-381.

Philouze, J., Maisonneuve, B. (1978) Heredity of the natural ability to set parthenocarpic fruits in the

Soviet variety Severianin. Tomato Genet Coop Rep. 28, 12-13.

Pietta, P-G. (2000) Flavonoids as antioxidants. J.Nat.Prod. 63, 1035-1042.

Quattrocchio, F.,Wing, J.F., Leppen, H., Mol, J., Koes (1993) Regulatory Genes Controlling Anthocyanin

Pigmentation Are Functionally Conserved among Plant Species and Have Distinct Sets of

Target Genes. Plant Cell 5, 1497-1512.

Quattrocchio , F., Wing, J.F., van der Woude, K., Mol, J.N.M., Koes, R. (1998) Analysis of bHLH and

MYB-domain proteins: species-specific regulatory differences are caused by divergent

evolution of target anthocyanin genes. Plant J. 13, 475-488.

Ramsay, N.A.,Walker,A.R., Mooney, M., Gray, J.C. (2003) Two basic-helix-loop-helix genes (MYC-146

and GL3) from Arabidopsis can activate anthocyanin biosynthesis in a white-flowered

Matthiola incana mutant. Plant Mol. Biol. 52, 679-688.

Rangan, G.K., Wang, Y., Tay, Y.C., Harris, D.C. (1999) Inhibition of NFkappaB activation with

antioxidants is correlated with reduced cytokine transcription in PTC. Am J Physiol. 277, F779-

F789.

Ranish J.A., Hahn, S. (1996) transcription: basal factors and activation. Current Opinion Genes and

Development 6, 151-158.

Ray, H.,Yu, M.,Auser, P., Blahut-Beatty, L., McKersie, B., Bowley, S.,Westcott, N., Coulman, B., Lloyd,A.,

Gruber, M.Y. (2003) Expression of anthocyanins and proanthocyanidins after transformation

of alfalfa with maize LC. Plant Physiology 132, 1448-1463.

Rein, D., Herbers, K. (2006) Enhanced nutritional value of food crops. In: Halford NG, editor. Plant

Biotechnology: Current and Future Applications of Genetically Modified Crops.Chichester:

John Wiley & Sons, 91-117.

Renaud, S., de Lorgeril, M. (1992) Wine, alcohol, platelets and the French paradox for coronary heart

disease. Lancet 339, 1523-1526.

Renaud, S.C.,Gueguen,R., Schenker, J., d’Houtaud,A. (1998) Alcohol and mortality in middle aged men

from eastern France. Epidemiology 9, 184-188.

135

Rice-Evans, C.A., Millier, N.J., Paganga, G. (1995) Structure-antioxidant activity relationships of

flavonoids and phenolic acids. Free Radical Biology & Medicine 20, 933-956.

Rice-Evans, C.A., Miller, N.J., Paganga, G. (1997) Antioxidant properties of phenolic compounds. Trends

in Plant Science 2, 2152-2159.

Ridker, P.M., Wilson, P.W., Grundy, S.M. (2004) Should C-reactive protein be added to metabolic

syndrome and to assessment of global cardiovascular risk? Circulation 109, 2818-2825.

Romer, S., Fraser, P.D., Kiano, J.W., Shipton, C.A., Misawa, N., Schuch,W., Bramley, P.M. (2000) Elevation

of the provitamin A content of transgenic tomato plants. Nat Biotechnol. 18, 666-669.Ross, J.A.

and Kasum, C.M. (2002) Dietary flavonoids: bioavailability, metabolic effects, and safety. Annual

Review of Nutrition 22, 19-34.

Romer, S., Lubeck, J., Kauder, F., Steiger, S.,Adomat, C., Sandmann, G. (2002) Genetic engineering of a

zeaxanthin-rich potato by antisense inactivation and co-suppression of carotenoid

epoxidation. Metab Eng. 4, 263-272.

Rotino, G.L., Perri, E., Zottini, M., Sommer, H. Spena,A. (1997) Genetic engineering of parthenocarpic

plants. Nature Biotech 15, 1398-1401.

Ruiz, J.J.,Alonso,A., Garcia-Martinez, S.,Valer, M., Blasco, P., Ruiz-Bevia, F. (2005) Quantitative analysis

of flavour volatiles detects differences among closely related traditional cultivars of tomato. J

Sci Food Agric. 85, 54–60.

Sarkar, F.H. and Li,Y. (2003) Soy isoflavones and cancer prevention. Cancer invest. 21, 817-818.

Sastry, K., Muir, R. (1963) Gibberellin: effect on diffusible auxin in fruit development. Science 140, 494-

495.

Sato, M., Miyazaki, T., Kambe, F., Maeda, K., Seo, H. (1997) Quercetin, a bioflavonoid, inhibits the

induction of interleukin 8 and monocyte chemoattractant protein-1 expression by tumor

necrosis factor-alpha in cultured human synovial cells. J Rheumatol. 24, 1680-4.

Scalbert, A. and Williamson G. (2000) Dietary intake and bioavailability of polyphenols. J. Nutr. 130,

2073S-2085S.

Schijlen, E., de Vos C.H.R, Jonker, H., van den Broeck, H., Molthoff, J., van Tunen, A., Martens, S. and

Bovy,A. (2006) Pathway engineering for healthy phytochemicals leading to the production of

novel flavonoids in tomato fruit. Plant Biotechnology Journal 4, 433-444.

Schröder, J., Schröder, G. (1990) Stilbene and chalcone synthases: related enzymes with key functions

in plant-specific pathways. Z Naturforsch. 45, 1-8.

Schröder, J. (1997) A family of plant-specific polyketide synthases: facts and predictions. Trends in Plant

Sciences 2, 373-378.

Schröder, G., Schröder, J. (1992) A single change of histidine to glutamine alters the substrate

preference of a stilbene synthase. J Biol Chem. 267, 20558-60.

Sévenier, R., van der Meer, I.M., Bino, R., Koops, A.J. (2002) Increased production of nutriments by

genetically engineered crops. J. American College Nutrition 21, 199S-204S.

136

Sijmons, P.C., Dekker, B.M., Schrammeijer, B.,Verwoerd,T.C., van den Elzen P.J., Hoekema, A. (1990)

Production of correctly processed human serum albumin in transgenic plants. Biotechnology 8,

217-221.

Sparvoli, F., Martin, C., Scienza,A., Gavazzi, G. and Tonelli, C. (1994) Cloning and molecular analysis of

structural genes involved in flavonoid and stilbene biosynthesis in grape (Vitis vinifera L.) Plant

Mol. Biol. 24, 743-755.

Spencer, J.P. (2003) Metabolism of tea flavonoids in the gastrointestinal tract. J Nutr. 133, 3255S-61S.

Stafford, H.A. (1974) Possible multi-enzyme complexes regulating the formation of C6-C3 phenolic

compounds and lignins in higher plants. Rec Adv Phytochem. 8, 53-79.

Stark-Lorenzen, P., Nelke, B., Hänssler, G., Mühlbach, H.P.,Thomzick, J.E. (1997) Transfer of a grapevine

stilbene synthase gene to rice (Oryza sativa L.) Plant Cell Rep. 16, 668-673.

Stewart, A.J., Bozonnet, S., Mullen, W., Jenkins, G.I., Lean, M.E., Crozier, A. (20000 Occurrence of

flavonols in tomatoes and tomato-based products. J Agric Food Chem. 48, 2663-2669.

Stobiecki, M., Matysiak-Kata, I., Fra_ski, R., Ska_a, J., Szopa, J. (2002) Monitoring changes in anthocyanin

and steroid alkaloid glycoside content in lines of transgenic potato plants using liquid

chromatography/mass spectrometry. Phytochemistry 62, 959-969.

Stoclet, J.C., Chataigneau, T., Ndiaye, M., Oak, M.H., El Bedoui, J., Chataigneau, M., Schini-Kerth,V.B.

(2004) Vascular protection by dietary polyphenols. Eur J Pharmacol. 500, 299-313.

Styles, E.D., and Cheska, O. (1975) Genetic control of 3-hydroxy- and 3-deoxy-flavonoids in Zea mays.

Phytochemistry 14, 413-415.

Suzuki, H., Nakayama,T.,Yonekura-Sakakibara, K., Fukui,Y., Nakamura, N.,Yamaguchi, M-A.,Tanaka,Y.,

Kusumi, T., Nishino, T. (2002) cDNA cloning, heterologous expression, and fuctional

characterization of malonyl-Coenzyme A: Anthocyanidin 3-O-Glucoside-6’-O-

malonyltransferase from Dahlia flowers. Plant Physiology 130, 2142-2151.

Szalai, A.J., McCrory, M.A. Varied biologic functions of C-reactive protein: lessons learned from

transgenic mice. Immunol Res. 26, 279-287.

Szankowski, I., Briviba, K., Fleschhut, J., Schonherr, J., Jacobsen, H.J., Kiesecker, H. (2003) Transformation

of apple with the stilbene synthase gene from grapevine and PGIP gene from kiwi. Plant Cell

Reports 22, 141-149.

Takahashi, T., Takasuka, N., Ligo, M., Baba, M., Nishino, H., Tsuda, H., and Okuyama, T. (2004)

Isoliquiritigenin, a flavonoid from licorice, reduces prostaglandin E2 and nitric oxide, causes

apoptosis, and suppresses aberrant crypt foci development. Cancer Sci. 95, 448-453.

Tamagnone, L., Merida,A., Parr,A., Mackay, S., Culianez-Macia, F.A., Roberts, K., Martin, C. (1998) The

AmMYB308 and AmMYB330 transcription factors from antirrhinum regulate

phenylpropanoid and lignin biosynthesis in transgenic tobacco. Plant Cell 10, 135-54.

Tanaka,Y.,Tsuda, S., Kusumi,T. (1998) Metabolic engineering to modify flower color. Plant Cell. Physiol.

39, 1119-1126.

137

Tanaka,Y., Katsumoto,Y., Brugliera, F., Mason, J. (2005) Genetic engineering in floriculture. Plant Cell

Tissue and organ Culture 80, 1-24.

Tanner, G.J., Francki, K.T.,Abrahams, S.,Watson, J.M., Larkin, P.J.,Ashton,A.R. (2003) Proanthocyanidin

biosynthesis in plants. Purification of legume leucoanthocyanidin reductase and molecular

cloning of its cDNA. J Biol Chem. 278, 31647-56.

Taylor, L.P., Jorgensen, R. (1992) Conditional male fertility in chalcone synthase-deficient Petunia. J of

Heredity 83, 11-17

Tenbült, P., de Vries, N.K., Dreezens, E., Martijn, C. (2002) Perceived naturalness and acceptance of

genetically modified food. Appetite 45, 47-50.

Tikunov,Y., Lommen,A., de Vos, C.H.R.,Verhoeven,H.A., Bino, R.J., Hall, R.D. and Bovy,A.G. (2005) A

novel approach for nontargeted data analysis for metabolomics. Large-Scale Profiling of

Tomato Fruit Volatiles. Plant Physiol., 139, 1125–1137.

Toda, K.,Yang, D.,Yamanaka, N.,Watanabe, S., Harada, K.,Takahashi, R. (2002) A single-base deletion in

soybean flavonoid 3’-hydroxylase gene is associated with gray pubescence color. Plant

Molecular Biology 50, 187-196.

Tropf, S., Lanz,T., Rensing, S.A., Schröder, J., Schröder , G. (1994) Evidence that stilbene synthases have

developed from chalcone synthases several times in the course of evolution. Journal of

molecular Evolution 38, 610-618.

Tsai, S.H., Lin-Shiau, S.Y., Lin, J.K. (1999) Suppression of nitric oxide synthase and the down-regulation

of the activation of NFkappaB in macrophages by resveratrol. Br J Pharmacol. 126, 673-680.

Ueda, H., Yamazaki, C., Yamazaki, M. (2002) Luteolin as an anti-inflammatory and anti-allergic

constituent of Perilla frutescens. Biol Pharm Bull. 25, 1197-1202.

Ueyama,Y., Suzuki, K.-I., Fukuchi-Mizutani, M., Fukui,Y., Miyazaki, K., Ohkawa, H., Kusumi, K.,Tanaka,Y.

(2002) Molecular and biochemical characterization of torenia flavonoid 3’-hydroxylase and

flavone synthase II and modification of flower color by modulating the expression of these

genes. Plant Sci. 163, 253-263.

USDA Database for the Flavonoid Content of Selected Foods. Agricultural Research Service,

Beltsville Human Nutrition Research Center, US Department of Agriculture, Beltsville, MD,

March 2003.Avaliable from: www nal usda gov/fnic/foodcomp/Data/Flav/flav pdf. 2003 Mar.

Van der Krol,A.R., Lenting, P.E.,Veenstra, J.,Van der Meer, I.M., Koes, R.E., Gerats,A.G.M., Mol, J.N.M.,

Stuitje,A.R. (1988) An anti-sense chalcone synthase gene in transgenic plants inhibits flower

pigmentation. Nature 333, 866-869.

Van der Meer, I.M.,Stam, M.E., Van Tunen, A.J., Mol, J.N., Stuitje, A.R. (1992) Antisense inhibition of

flavonoid biosynthesis in petunia anthers results in male sterility. Plant Cell 4, 253-62.

Van Dross, R., Xue, Y., Knudson A., Pelling, J.C. (2003) The chemopreventive bioflavonoid Apigenin

modulates signal transduction pathways in keratinocyte and colon carcinoma cell lines. Journal

of Nutrition 133, 3800S-3804S.

138

Van Houwelingen, A., Souer, E., Spelt, K., Kloos, D., Mol, J., Koes, R. (1998) Analysis of flower

pigmentation mutants generated by random transposon mutagenesis in Petunia hybrida. Plant

J. 13, 39-50.

Van Tunen A.J., Koes, R.E., Spelt, C.E., van der Krol,A.R., Stuitje,A.R., Mol, J.N. (1988) Cloning of the

two chalcone flavanone isomerase genes from Petunia hybrida: coordinate, light-regulated and

differential expression of flavonoid genes. EMBO Journal 7, 1257-63.

Varoquaux, F., Blanvillain, R., Delseny, M., Gallois, P. (2000) Less is better; new approaches for seedless

fruit production. Trends Biotech 18, 233-242.

Verhoeyen, M.E., Bovy,A., Collins, G., Muir, S., Robinson, S., de Vos, C.H.R., Colliver, S. (2002) Increasing

antioxidant levels in tomatoes through modification of the flavonoid biosynthetic pathway. J. Exp.

Botany. 53, 2099-2106.

Verschuren, L., Kleemann, R., Offerman, E.H., Szalai,A.J., Emeis, S.J., Princen, H.M., Kooistra,T. (2005)

Effect of low dose atorvastatin versus diet-induced cholesterol lowering on atherosclerotic

lesion progression and inflammation in apolipoprotein E*3-Leiden transgenic mice. Arterioscler

Thromb Vasc Biol. 25, 161-167.

Vom Endt, D., Kijne, J.W., Memelink, J. (2002) Transcription factors controlling plant secondary

metabolism: what regulates the regulators? Phytochem. 61, 107-114.

Wang, W., Van Alstyne, P.C., Irons, K.A., Chen, S., Stewart, J.W., Birt, D.F. (2004) Individual and

interactive effects of apigenin analogs on G2/M cell cycle arrest in human colon carcinoma cell

lines. Nutr. Cancer 48, 106-114.

Welle, R. and Grisebach, H. (1988) Isolation of a novel NADPH-dependent reductase which coacts

with chalcone synthase in the biosynthesis of 6’-deoxychalcone. FEBS Letters 236, 221-225.

Williamson, G., Day, A.J., Plumb, G.W., Couteau, D. (2000) Human metabolic pathways of dietary

flavonoids and cinnamates. Biochem Soc Trans. 28, 16-22.

Williamson, G., Manach, C. (2005) Bioavailability and bioefficacy of polyphenols in humans. II. Review

of 93 intervention studies. Am J Clin Nutr. 81, 243S-255S.

Wiermann, R. (1979) Stage specific phenylpropanoid metabolism during pollen development.

Regulation of Secondary Product and Plant Hormone Metabolism. Luckner and Schreiber, eds

(Oxford: Pergamon Press), 231-239.

Winkel-Shirley, B. (1999) Evidence for enzyme complexes in the phenyl propanoid and flavonoid

pathways. Physiol.Plant. 107, 142-149.

Winkel-Shirley, B. (2001) Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell

biology, and biotechnology. Plant Physiol. 126, 485-493.

Winther de, M.P., Kanters, E., Kraal, G., Hofker, M.H. (2005) Nuclear factor kappaB signaling in

atherogenesis. Arterioscler Thromb Vasc Biol. 25, 904-914.

139

Wu, G.,Truksa, M., Datla, N.,Vrinten, P., Bauer, J., Zank,T., Cirpus, P., Heinz, E., Qiu, X. (2005) Stepwise

engineering to produce high yields of very long-chain polyunsaturated fatty acids in plants. Nat

Biotechnol. 23, 1013-1017.

Xie, D.-Y, Sharma, S.B., Paiva, N.L., Ferreira, D., Dixon, R.A. (2003) Role of anthocyanidin reductase

encoded by BANYULS in plant flavonoid biosynthesis. Science 299, 396-399.

Yamamoto,T.,Yoshimura, M.,Yamaguchi, F., Kouchi,T.,Tsuji, R., Saito, M., Obata,A., Kikuchi, M. (2004)

Anti-allergic activity of naringenin chalcone from a tomato skin extract. Biosci Biotechnol Biochem.

(2004) 68, 1706-1711.

Yang, C.S., Landau, J.M., Huang, M.T. and Newmark, H.L. (2001) Inhibition of carcinogenesis by dietary

polyphenolic compounds. Annual Review of Nutrition 21, 381-406.

Yilmaz, E. (2001) The Chemistry of Fresh Tomato Flavor. Turk J Agric For 25, 149-155.

Yin, F., Giuliano,A.E., Law, R.E.,Van Herle,A.J. (2001) Apigenin inhibits growth and induces G2/M arrest

by modulating cyclin-CDK regulators and ERK MAP kinase activation in breast carcinoma cells.

Anticancer Research 21, 413-420.

Ylstra, B.,Touraev,A., Benito Moreno, R.M., Stöger, E., van Tunen,A.J.,Vicente, O., Mol, J.N.M., Heberle-

Bors, E. (1992) Flavonols stimulate development, germination and tube growth of tobacco pollen.

Plant Physiol. 100, 902-907.

Ylstra, B., Busscher, J., Franken, J., Hollman, P.C.H., Mol, J.N.M., van Tunen, (1994) Flavonols and

fertilization in Petunia hybrida: localization and mode of action during pollen tube growth. Plant J.

6, 201-212.

Yoder, J.I., Belzile, F., Tong, Y., Goldsbrough, A. (1994) Visual markers for tomato derived from the

anthocyanin biosynthetic pathway. Euphytica 79, 163-167.

Yu, O., Jung, W., Shi, J., Croes, R.A., Fader, G.M., McGonigle, B., Odell, J.T. (2000) Production of the

isoflavones genistein and daidzein in non-legume dicot and monocot tissues. Plant Physiol. 124,

781-793.

Yu, O., Shi, J., Hession,A.O., Maxwell, C.A., McGonigle, B., Odell, J.T. (2003) Metabolic engineering to

increase isoflavone biosynthesis in soybean seed. Phytochemistry 63, 753-763.

Zuker,A.,Tzfira,T., Ben-Meir, H., Ovadis, M., Shklarman, E., Itzhaki, H., Forkmann, G., Martens, S., Neta-

Sharir, I., Weiss, D.,Vainstein, A. (2002) Modification of flower color and fragrance by antisense

suppression of the flavanone 3-hydroxylase gene. Mol. Breeding 9, 33-41.

140

141

142

Appendices

Samenvatting

Dankwoord

Curriculum Vitae

List of publications

Colour figures

143

144

Samenvatting

Planten beschikken over een enorme capaciteit om een breed scala aan secundaire

metabolieten te produceren waarmee ze kunnen reageren op hun continue veranderende

omgeving. Flavonoïden, een van de meest voorkomende secundaire metabolieten, zijn laag

moleculaire stoffen die van nature in vrijwel alle planten voorkomen. Ongeveer 6000

verschillende flavonoïden zijn inmiddels bekend, welke gevormd worden door slechts kleine

structurele veranderingen en/of toevoegingen aan de gemeenschappelijke flavonoïd

kernstructuur.

Flavonoïden zijn bij uiteenlopende natuurlijke processen betrokken. Zo ontstaat bijvoorbeeld de

rode, blauwe en paarse kleur van veel bloemen door de aanwezigheid van anthocyanen, een

specifieke klasse van flavonoïd pigmenten. Ook rijpe vruchten danken hun kleur vaak aan deze

klasse van flavonoïden. Als gevolg daarvan spelen anthocyanen een belangrijke rol bij het

aantrekken van insecten en andere dieren, die verantwoordelijk zijn voor bestuiving en

zaadverspreiding. Daarnaast spelen flavonoïden een rol bij processen zoals bescherming van

planten tegen schadelijke UV straling, afweer tegen infecties, pollenvorming en fertiliteit.

Daar flavonoïden wijdverspreid voorkomen in het plantenrijk, vormen deze stoffen een

permanent onderdeel van ons plantaardig voedsel. Een deel van de gezondheidsbevorderende

effecten van groenten en fruit wordt toegeschreven aan de aanwezigheid van bepaalde

flavonoïden. Hoewel flavonoïden in vrijwel alle planten voorkomen, zijn sommige klassen

specifiek voor een bepaalde plantensoort, terwijl deze ondervertegenwoordigd of geheel

afwezig kunnen zijn in andere plantensoorten.Vanuit dit oogpunt kan het wenselijk zijn om te

selecteren voor gewassen met bepaalde (hoeveelheden van) flavonoïden, danwel de

samenstelling daarvan aan te passen. Onderzoek naar de mogelijkheden om de productie van

flavonoïden in planten te veranderen wordt veelal uitgevoerd om de aantrekkelijkheid van

sierteeltgewassen te verhogen, óf met als doel het verhogen van de voedingswaarde van

bepaalde gewassen.

Het onderzoek dat beschreven is in dit proefschrift behandelt de genetische modificatie van de

flavonoïd biosyntheseroute in tomaat, één van de belangrijkste groenten wereldwijd voor zowel

industrie als direkte consumptie. De doelstelling van dit onderzoek was ten eerste, meer inzicht

te verkrijgen in de endogene flavonoïd biosynthese van tomaat en ten tweede, het onderzoeken

van de mogelijkheden om nieuwe flavonoïden te produceren die van nature niet voorkomen in

tomaten.

Hoofdstuk 1 geeft een overzicht van de flavonoïd biosynthese in gewasplanten en de huidige

mogelijkheden tot ingrijpen in deze metabole route door middel van genetische modificatie.

De volgende drie hoofdstukken beschrijven verschillende benaderingen voor genetische

modificatie van de flavonoïd biosynthese in tomaat. Hoofdstuk 2 beschrijft de ontwikkeling van

145

tomaten waarbij de endogene flavonoïd biosynthese vrijwel geheel is uitgeschakeld. Door

middel van RNAi suppressie van het gen coderend voor chalcone synthase (CHS) werd zowel

de genexpressie als enzymactiviteit van chalcone synthase, de eerste stap in de flavonoïd

biosyntheseroute, geblokkeerd. Dit resulteerde in vruchten met sterk verlaagde hoeveelheden

flavonoïden en enkele fenotypische veranderingen, waarvan de vorming van zaadloze

(parthenocarpe) vruchten het meest opvallend was. Deze parthenocarpie bleek volledig op te

heffen middels kruisingen van wild type tomaat met pollen van CHS RNAi tomaat. Daar

reciproke kruisingen resulteerden in een partiële opheffing van parthenocarpie, lijkt de

verminderde fertilisatie van CHS RNAi tomaat het gevolg van een gebrek aan flavonoïden in de

vrouwelijke bloemdelen.

Hoofdstuk 3 beschrijft de toepassing van verschillende moleculair biologische technieken om

potentiële target-genen van transcriptiefactoren betrokken bij de flavonoïd biosynthese in

tomaat te identificeren. Om meer inzicht te krijgen in de transcriptionele regulatie van de

flavonoïd biosyntheseroute in tomaat werd gebruik gemaakt van genetisch gemodificeerde

tomaten waarin verschillende transcriptiefactoren tot overexpressie zijn gebracht.Anthocyaan

accumulerende tomaten (met de transcriptiefactoren Rosea en Delila uit Leeuwebekje) en

flavonol ophopende tomaten (met de transcriptiefactoren LC en C1 uit mais) werden

onderworpen aan genexpressie-analyse door middel van DNA micro-arrays, RT-PCR en

differentiële kloonidentificatie vanuit een subtractie cDNA bank.

De fenotypische verschillen tussen Rosea/Delila en LC/C1 tomaten konden worden herleid tot

specifieke structurele genen die wel door de ene, maar niet door de andere combinatie van

transcriptiefactoren aangestuurd worden. De sterk verhoogde expressie van het gen F3’5’H in

Rosea/Delila tomaten en het ontbreken van deze inductie in LC/C1 transgene tomaten bleek

het meest opvallende verschil tussen beide lijnen.

Daarmee is op genexpressie niveau aangetoond dat door het inbrengen van verschillende

transcriptiefactoren het uiteindelijke resultaat op metabolietniveau sterk kan verschillen.

In hoofdstuk 4 wordt de introductie van nieuwe vertakkingen in de flavonoïd

biosyntheseroute van tomaat beschreven. Door genen uit andere plantensoorten (druif, alfalfa,

petunia en gerbera) in te bouwen in het genoom van tomaat, zijn deze transgene planten in staat

om flavonoïden te produceren die van nature niet in tomaten voorkomen. Zodoende zijn

tomaten verkregen met stilbenen, tomaten met deoxychalconen en tomaten met zowel

flavonen als verhoogde concentraties flavonolen.Voor deze klassen van flavonoïden is gekozen

omwille van de veel beschreven potentiële gezondheidsbevorderende eigenschappen. De meest

bekende gezondheidsgerelateerde eigenschap van vrijwel elke klasse van flavonoïden is hun

sterke anti-oxidant werking.Anti-oxidanten kunnen bijdragen aan een beperking van de schade

aan cellen, weefsels en organen die ontstaat door de voortdurende aanwezigheid van vrije

radicalen in elk organisme. Als gevolg van de moleculaire samenstelling, waaronder de

146

aanwezigheid van reactieve hydroxygroepen, zijn flavonoïden goede anti-oxidanten. Echter de

anti-oxidantcapaciteit van verschillende flavonoïden varieert sterk en is gerelateerd aan de

chemische samenstelling van het betreffende flavonoïd.

Om aan te tonen dat de verschillende transgene tomaten een veranderde samenstelling aan

flavonoïd anti-oxidanten bevatten werd de biochemische bepaling van flavonoïden in deze

vruchten gekoppeld aan een on-line HPLC anti-oxidant detectiesysteem. Daarmee kon worden

bepaald welke van de nieuwe flavonoïden een sterke anti-oxidantcapaciteit bevatten en of de

variatie in samenstelling van flavonoïden uiteindelijk leidde tot een verschil in de totale anti-

oxidantcapaciteit van de gemodificeerde vruchten. Hoewel de tomaten met stilbenen en de

tomaten met deoxychalconen nieuwe antioxidanten bevatten was de totale

antioxidantcapaciteit van deze vruchten vergelijkbaar met die van wild type tomaten. In tomaten

met verhoogde concentraties flavonen en flavonolen bleek de totale antioxidantcapaciteit van

de vruchtschil circa driemaal verhoogd.

Hoofdstuk 5 beschrijft een concrete en maatschappelijk relevante toepassing van genetisch

gemodificeerde tomaten met een veranderde samenstelling van flavonoïden. Om potentiële

gezondheidsbevorderende effecten van tomaat flavonoïden te onderzoeken werden zowel wild

type als gemodificeerde tomaten (met verhoogde concentraties van flavonen en flavonolen)

toegepast in een voedingsstudie met transgene muizen die het humane C-reactive protein

(CRP) tot expressie brengen. Dit CRP is een marker voor het ontstaan van hart- en vaatziekten

bij de mens.

De resultaten van deze studie laten zien dat de CRP concentratie in het bloed van deze muizen

verlaagd was als gevolg van consumptie van tomatenschillen. Dit effect werd versterkt door de

inname van tomaten met verhoogde concentraties flavonoïden. Daarnaast bleek uit serum

lipoproteinen analyse dat de consumptie van zowel gewone als gemodificeerde tomaten leidde

tot verhoogde concentraties HDL en lagere concentraties VLDL en LDL. Deze bevindingen

ondersteunen de algemeen aanvaarde stelling dat een dieet rijk aan groenten en fruit een

positief effect heeft op het voorkomen van hart- en vaatziektes en dat flavonoïden daarbij

mogelijk een rol spelen.

Dit proefschrift eindigt met een algehele samenvatting en discussie, beschreven in hoofdstuk

6. Het hier beschreven onderzoek wordt in dit hoofdstuk in een breder kader geplaatst waarbij

enkele maatschappelijke relevante kwesties omtrent dit onderzoek worden besproken.

147

148

Dankwoord

Na vele bergen werk verzet te hebben ligt dan hier eindelijk dit proefschrift, waaraan velen een

steen(tje) hebben bijgedragen. Er zijn zo veel collega’s, maar ook mensen buiten de Bussiness

Unit Bioscience die ik moet bedanken voor hun steun, dat dit haast onmogelijk is.Wanneer ik

iedereen apart zou noemen zouden nog vele pagina’s aan dit proefschrift toegevoegd moeten

worden. Daarom wil ik beginnen met IEDEREEN van de B.U. Bioscience te bedanken die op een

of andere manier heeft bijgedragen aan de geweldige sfeer op het lab en de kamer, in de

wandelgangen, aan de koffietafel, tijdens de labuitjes en andere evenementen.Tevens BEDANKT

voor alle hulp, belangstelling, vriendschap en alle goede herinneringen die ik voor altijd bij mij

zal dragen.

Toch ontkom ik er niet aan om enkele namen expliciet te noemen.Allereest natuurlijk Arnaud.

Ik ben je erg dankbaar voor al je steun, ideeën en hulp bij zowel proefopzet, interpretatie van

data als het verwoorden van onze bevindingen in presentaties en publicaties. Ik heb ontzettend

veel van jou geleerd en zonder jou was dit boekje nooit tot stand gekomen. Dan natuurlijk

Arjen, mijn promoter, die tevens aan de wieg van dit onderzoek stond, hetgeen nog niet te

voorzien was toen je mij aannam als onderzoeksassistent bij de afdeling celbiologie. De

samenwerking met jou en het steeds ‘kort maar krachtig’ overleg heb ik als erg prettig ervaren.

Wanneer ik terugdenk aan ‘t prille begin, dan denk ik ook meteen aan Ingrid en Oscar. Door de

leuke en leerzame stage periode die ik bij jullie gevolgd heb, ben ik destijds met veel plezier aan

een baan begonnen binnen deze afdeling en kon ik later de kleine overstap naar dit flavonoïden

onderzoek maken.Al die tijd kwam ik graag bij jullie voor een praatje of een ‘vraagje’ langs en

kreeg daarbij telkens veel hulp.

Wanneer ik door de hoofdstukken blader dan zie ik Ric en Harry op bijna elke titelpagina staan.

Natuurlijk is dat niet voor niets. Jullie beiden zijn van onschatbare waarde geweest bij de

biochemische analyses. Ric bedankt voor jouw hulp bij de interpretatie van die vele pieken, wat

je daar nou wel en niet over mocht concluderen, en bedankt voor het kritisch nakijken van de

manuscripten. Harry, ontzettend bedankt voor je steun bij de vele HPLC analyses. Met al die

tomaten die je geoogst en geanalyseerd hebt zou je inmiddels wel een aardige groentenwinkel

kunnen vullen!

Verder wil ik Jos en Hetty bedanken voor hun bijdrage aan het moleculaire werk binnen het

project en de sfeer op het lab.Wanneer ik aan de vele labplekken terugdenk, ja we moesten nog

wel eens verhuizen van tijd tot tijd, dan denk ik met veel plezier terug aan de tijden die ik met

Jeroen, Mark, Froukje, Margo, Roel, Bart, Roy, Hetty,Adèle, Robert (Sevenier),Tjitske, Jos, Gerard,

Oscar en "Bert" heb beleefd.

Ook de discussies tijdens onze werkbesprekingen waren van zeer grote waarde. Speciale dank

ben ik daarvoor verschuldigd aan Dirk en Robert, maar ook aan Jules, Ingrid, Harrie, Harro,

149

Hans, Dion, Asaph, Mazen en Joost die kritisch mijn voortgang volgden en met frisse ideeën

aankwamen. Voor alle hulp bij de statistische interpretatie van de verkregen en beschreven

resultaten wil ik Chris bedanken. Robert (Hall) bedankt voor je hulp met de Engelse gramatica

bij het schrijven van manuscripten, brieven en mails.Verder ben ik Raoul nog dankbaar voor het

vertrouwen dat je in mij had toen ik aan het onderzoek begon, het aansturen van de hele B.U.

en je interesse in het verloop van het onderzoek.

Met veel plezier heb ik een viertal studenten begeleid tijdens hun afstudeerstage; Justin

Franssen, Peter van Esse, Ellen Kesseler en Hemradj Bihari wil ik bedanken voor hun inzet en

bijdrage aan dit project.

Mijn huidige Greenomics collega’s;Thamara, Marleen, Marjo, Sander, Jan, Roeland en René wil ik

bedanken voor hun interesse en de prettige werksfeer die het mede mogelijk maakte om naast

het werk dit promotie onderzoek nog af te ronden.

Dat er voor mij ook nog een ‘leven naast het flavonoïden onderzoek’ bestaat is voor iedereen

wel duidelijk. Grote dank ben ik dan ook verschuldigd aan mijn klim-, hardloop- en fietsvrienden

voor de nodige afleiding tijdens vele gezellige sportieve uurtjes.

Last  but not least wil ik mijn ouders en de rest van de familie bedanken.   Pap en mam,  speciale

dank voor jullie getoonde interesse en de mogelijkheid die jullie mij gaven om biologie te gaan

studeren. De meest bijzondere plek in dit dankwoord is echter toch voor Carlette. Lieverd,

bedankt voor alle steun, het vertrouwen dat je mij gaf en de leuke tijd die ik steeds samen met

jou heb, thuis, tijdens onze ‘weekendjes weg’ en overal op reis. Zonder jouw steun was dit

promotieonderzoek misschien wel nooit af gekomen.

Kortom allen bedankt !!!

Op naar de volgende uitdaging.... :-)

150

Curriculum vitae

Elio Schijlen werd geboren op 20 februari 1972 te Maastricht. Na het behalen van het HAVO

diploma in 1990 begon hij in september datzelfde jaar aan de Hogeschool Tilburg met de

opleiding tot leraar biologie. Het afstudeeronderzoek bij Organon Teknika te Boxtel onder

begeleiding van Dr.Wilma Paulij was gericht op de bruikbaarheid van recombinant Hepatitis B

virus e Antigen als biomateriaal voor diagnostische testen. In 1992 begon Elio aan de

deeltijdopleiding milieubiologie aan de Hogeschool Tilburg die in 1996 werd afgerond met een

onderzoeksstage bij het Nederlands Instituut voor Oecologisch Onderzoek (NIOO) te Yerseke

onder begeleiding van Dr. Mathieu Starink. Hier verrichtte hij gedurende een half jaar onderzoeknaar de zuurstof efflux van helofyten naar het sediment. Het verrichten van wetenschappelijk

onderzoek beviel Elio dusdanig goed dat hij na het behalen van het diploma leraar biologie 2e

graads (juli 1994) begon aan de studie biologie aan de Universiteit van Utrecht. Tijdens de

specialisatiefase moleculare biologie deed hij gedurende de tweede helft van het jaar 1997

onderzoek bij het Hubrecht Laboratorium te Utrecht. Onder begeleiding van Dr. Jacqueline

Deschamps werd onderzoek verricht naar Generation of ES cell lines to approach gain of

function mutant analysis in chimeric embryos.

Vervolgens werd door Elio gedurende een half jaar onderzoek gedaan naar ‘Pathway engineering

for essential amino acids in potato’ bij het CPRO-DLO te Wageningen onder begeleiding van

Dr. Ingrid van der Meer. Tijdens dit laatste afstudeeronderzoek werd Elio de mogelijkheid

geboden een functie als onderzoeksassistent te vervullen bij het CPRO-DLO waar hij in januari

1998 in dienst trad bij de afdeling Celbiologie. Na het behalen van het doctoraal diploma

biologie (mei 1998) werkte hij ruim anderhalf jaar als senior onderzoeksassistent aan meerdere

projecten bij het CPRO, later Plant Research International. In het jaar 2000 is hem de

mogelijkheid geboden om het hier beschreven promotieonderzoek vorm te geven als junior

onderzoeker bij de Bussines Unit Bioscience van het huidige Plant Research International. Dit

onderzoek en het uiteindelijke proefschrift is tot stand gekomen onder begeleiding van Dr.

Arnaud Bovy en onder het toeziend oog van Prof. Dr. Arjen Van Tunen, verbonden aan de

Universiteit van Amsterdam.

151

152

List of publications

Hans Bakker, Elio Schijlen, Theodora de Vries,Wietske E.C.M. Schiphorst,Wilco Jordi, Arjen

Lommen, Dirk Bosch and Irma van Die (2001). Plant members of the α1→3/4-

fucosyltransferase gene family encode an α1→4-fucosyltransferase, potentially involved

in Lewis biosynthesis, and two core α1→3-fucosyltransferases FEBS Letters 507, 307-312

Arnaud Bovy, Ric de Vos, Mark Kemper, Elio Schijlen, Maria Almenar Pertejo, Shelagh Muir,

Geoff Collins, Sue Robinson, Martine Verhoeyen, Steve Hughes, Celestino Santos-Buelga,

and Arjen van Tunen (2002). High flavonol tomatoes resulting from the heterologous

expression of the maize transcription factor genes Lc and C1. Plant Cell 14 , 2509–2526

Angelo Pietro Femia , Giovanna Caderni, Maura Ianni, Maddalena Salvadori, Elio Schijlen, Geoff

Collins,Arnaud Bovy and Piero Dolara (2003). Effect of diets fortified with tomatoes or

onions with variable quercetin-glycoside content on azoxymethane-induced aberrant

crypt foci in the colon of rats. European Journal of Nutrition 42, 346-352.

Elio G W M Schijlen, C H Ric de Vos, Arjen J van Tunen and Arnaud G Bovy (2004).

Modification of flavonoid biosynthesis in crop plants. Phytochemistry 65, 2631-2648.

Elio G W M Schijlen, C H Ric de Vos, Harry H Jonker, Faye M Rosin, Jos W Molthoff, Gerco

C Angenent, Arjen J van Tunen, Arnaud G Bovy (2006). Inhibition of tomato flavonoid

biosynthesis results in parthenocarpic fruits. Submitted.

Elio Schijlen, C.H.Ric de Vos, Harry Jonker, Hetty van den Broeck, Jos Molthoff, Arjen van

Tunen, Stefan Martens and Arnaud Bovy (2006). Pathway engineering for healthy

phytochemicals leading to the production of novel flavonoids in tomato fruit. Plant

Biotechnology Journal 4, 433-444

Dietrich Rein, Elio Schijlen, Teake Kooistra, Karin Herbers, Lars Verschuren, Robert Hall, Uwe

Sonnewald, Arnaud Bovy, Robert Kleemann (2006). Tomato intake reduces markers of

cardiovascular risk in human CRP transgenic mice: Additional benefits from transgenic

flavonoid tomato. The Journal of Nutrition 136, 2331-2337.

153

154

Colour figures

155

Chapter 1, Figure 1

156

Chapter 1, Figure 2

157

Chapter 2, Figure 7

158

Chapter 3, Figure 1

159

Chapter 3, Figure 2

160

Chapter 3, Figure 3

161

Chapter 4, Figure 4