Proc. Nati. Acad. Sci. USAVol. 87, pp. 3067-3071, April 1990Immunology

T-cell receptor v6 and y transgenic mice suggest a role of a y genesilencer in the generation of c48 T cells

(T-celi lineages/allelic exclusion)

ISAO ISHIDA*, SJEF VERBEEKt, MARC BONNEVILLE*, SHIGEYOSHI ITOHARA*, ANTON BERNSt,AND SUSUMU TONEGAWA**Howard Hughes Medical Institute at Center for Cancer Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139;and tThe Netherlands Cancer Institute, Division of Molecular Genetics and the Department of Biochemistry of the University of Amsterdam, Amsterdam,The Netherlands

Contributed by Susumu Tonegawa, February 6, 1990

ABSTRACT A T lymphocyte expresses on its surface oneof two types of antigen receptor, T-cell receptor a.8 or T-cellreceptor v8, encoded by a pair ofsomatically rearranged a and(3 or y and 8 genes. It has been suggested that a(3 T cells aregenerated only from precursor T cells that failed to rearrangey and 6 genes in a functional form. However, we found thattransgenic mice constructed with functionally rearranged yand 8 genes produce a normal number of aig T cells. Thetransgene y present in these afi T cells is repressed apparentlythrough an associated cis DNA element (silencer). We proposethat some T-cell precursors are committed to generate a(3 Tcells independent of the rearrangement status of their y geneand that this commitment involves activation of a factor(s) thatinteracts with the y gene-associated silencer.

The search for the genes encoding the antigen receptor of Tcells, T-cell receptor (TCR) afl, led to the identification of athird set of TCR genes, y (1-3), which in time led to thediscovery of a second TCR, TCR y8 (4-6). One interestingissue raised by the discovery of y8 T cells is their develop-mental relationship with a/3 T cells. During thymic ontogeny,rearrangement and cell-surface expression of y and 8 genesprecede those ofa and / genes (7-9). In peripheral a/3 T cells,some y genes are rearranged, often but not always, in anonproductive (i.e., out-of-frame) form (2, 10-12). In con-trast, in y8 thymocytes or peripheral y8T cells, B genes arealmost always in an incompletely rearranged D-J form (D,diversity; J, joining), while a genes are never rearranged(13-15). In addition, cells bearing both TCR a/3 and TCR y8or "hybrid" TCRs such as /38 or ay heterodimers do not existor are very rare (8, 9, 16). On the basis of these observations,Pardoll et al. (8) and Allison and Lanier (17) proposed that ifthe y and 8 gene rearrangements are both productive, thecells proceed to surface expression of TCR y8, which, inanalogy with the immunoglobulin system (18), inhibits furtherrearrangement of any other TCR gene. ad T cells aregenerated only from those cells that failed to productivelyrearrange both y and 8 genes.We tested this model by analyzing transgenic (Tg) mice

constructed with a pair of productively rearranged y and 8genes cloned from a ye T-cell hybridoma. Since all T-cellprecursors in these mice should have productively re-arranged Tg y and 8 genes, the model would predict thatgeneration of a,8 T cells would be blocked. However, wefound that a normal number of a/3 T cells is produced in theseTg mice. The y and 8 Tg are transcriptionally silent in a,3 Tcells and the repression of y gene expression seems to bemediated by a cis-acting DNA element (a silencer) present inthe flanking regions of the y gene. We suggest that some

precursor T cells are programmed to repress the expressionof y (and also perhaps 8) genes, which may be eitherproductively or nonproductively rearranged, by a mechanismmediated by the silencer element(s) and that it is from theseprecursor T cells that afB T cells are generated.

MATERIALS AND METHODSMonoclonal Antibodies (mAbs). Anti-TCR y3 (3A10) and

anti-clonotypic KN6 (5C10) mAbs have been described (9).Anti-TCR a(3 (H57-597) was a gift from R. Kubo (NationalJewish Center for Immunology and Respiratory Medicine,Denver) (19).DNA Probes and Primers. The V.44, J,61, and V85 (V,

variable) probes have been described (15). The C,, and Ca (C,constant) probes have also been described (1). The Thy-I andactin probes were prepared from clone pMT8 (20) and anactin cDNA clone (21), respectively.

Construction of Tg Mice. For the production of y8 doubleTg mice, the inserts of the p8-23/15 and py-4 cosmids clonedin the pWE15 vector (22) were dissected by Sma I and NotI, respectively, and coinjected (4 Ag/ml each) into fertilizedmouse eggs from superovulated (CBA/BrA x C57BL/LiA)F1 females that had been mated with F1 males (23). TheTg mice were identified by the tail DNA-blotting methodusing 32P-labeled Vy4 and V85 probes. The y single Tg micewere similarly prepared by using the EcoRI/Sal I insert ofthephage A clone py-L.

Southern and Northern Blot Analyses and Quantitation ofBand Intensity. DNA and RNA were purified by the standardprocedures and subjected to analysis according to Chom-czynski and Qasba (24) using probes labeled by a randompriming method (25). The autoradiographic bands were de-tected and intensities were quantitated by using a FujiBioimage analyzer BA100 (26). This machine detects radio-activity recorded on photoexcitable phosphor upon stimula-tion by a laser beam and is at least 100 times more sensitivethan conventional autoradiography with x-ray film for thedetection of 32p. The machine also detects a wide range ofradioactivity (50-104 dpm) in a linear fashion, enabling highlyaccurate quantitation of band intensity.Polymerase Chain Reaction (PCR). Ten micrograms of total

RNA from each T-cell hybridoma was incubated with 0.5 AMsynthetic 3' primer (GTCCATAATGTGAAATACAAT), 0.5mM dNTPs, 50 mM Tris'HCl (pH 8.3), 10 mM MgCl2, 8 mMdithiothreitol, 2 units of RNasin (Amersham), and 10 units ofreverse transcriptase (Amersham) in total vol of 20 Al. After45 min at 420C, the reaction mixture was diluted to 100 Al with50 mM KCI, 10 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2,together with 1 mM synthetic 5' primer (CTCTCTAACTCA-

Abbreviations: TCR, T-cell receptor; Tg, transgenic or transgene(s);mAb, monoclonal antibody; D, diversity; J, joining; V, variable; C,constant; PCR, polymerase chain reaction.

3067

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

May

3, 2

021

Proc. Natl. Acad. Sci. USA 87 (1990)

p6-23/15 (V5DJ1Cb) Cosmid (43 kb)+- -4~

Ja 2B4

5'(n ;s m3 v 0_ 0

V65DJ61

1mm m00 0l0 0 0mm o.DD 2Z

J62

IICoz mZ 70 0

-* D

X m ;X0

_ 'A _1r; _._ p6 -23

P.,-4 (V4J1C17) Cosmid (40 kb)

V-l7 VY4JYl

z con cn m0 3 0

-= 0

* - ~~~M

C-yi

U, -I IX c) ODX X w0

:1 - 33 01:3 -II +

15 kb)Vy4J-y1 C-y

5' * R

m 0 XDW O Xww iT-

o iT 3 3 - :-II

m X cnon n0

'a

- 3'cnDw

IrII 3'D mcn

3owD

FIG. 1. Restriction maps of y and 8 genomicDNA clones. The cosmids, p8-23/15 and py-4,containing the productively rearranged V5DJ1C8 and V4JC1 ygenes, respectively, were clonedfrom genomic DNA from a C57BL/6 y8 T-cellhybridoma KN6. p8-23/15 is a composite clone

3' constructed from two primary clones p8-23 andp8-15. The Not I* sites were created during thecloning procedures. The phage A clone py-Lcontains another V4J1C1 ygene expressed on thesurface of another T-cell hybridoma 3D10(C3H). The Xba I' site present in the 3' un-translated region of the Cy,1 gene segment wasdestroyed in clone pV-L by a filling-in reactionwith Klenow DNA polymerase. The Xba I andEcoRI maps of clone py-4 are incomplete. Solidboxes designate exons or gene segments andarrows above them indicate the direction oftranscription.

CATCACCTC), 250 AM dNTPs, and 0.5 unit of Thermusaquaticus DNA polymerase (Taq polymerase) (Perkin-Elmer/Cetus), PCR cycles were run according to ref. 27 with1 min at 92°C, 2 min at 50°C, and 3 min at 720C.Flow Cytometry and Fluorescence-Activated Cell Sorting.

Flow cytometry was carried out as described (9) using aFACScan (Becton Dickinson). For the purification of aB Tcells, splenic T cells from y8-1355 mice were enriched by anylon wool column and stained with biotin-coupled anti-apmAb and phycoerythrin-streptavidin and sorted. The purifi-cation of y5 T cells from y8-1355 mice was carried out asdescribed (28).

Generation ofT-Cell Hybridomas. For the generation aB andy8 hybridomas, total thymocytes or splenic T cells and CD4-CD8- (double negative) thymocytes were fused with an aBTCR-negative thymoma BW5147 (29) as described (14).

RESULTSConstruction of yv Double Tg Mice. Three y5 double Tg

mice (yS-1355, y8-1314, and y6-1313) were obtained bycoinjection oftwo cosmid clones, Py-4 and P6-23/15 (Fig. 1),which carry the y and 8 genes, respectively, encoding theTCR of a y3 T-cell hybridoma KN6 (14). The three Tg linescarry a single to a few copies of the injected y and 8 genes(Table 1). Their splenocytes and thymocytes (Table 1) but notlivers (data not shown) contain elevated levels of y and 8RNA of appropriate sizes, suggesting that the Tg are ex-

pressed in the lymphoid organs of these mice. The presence

of Tg-encoded RNA in the thymus was confirmed by aseparate experiment in which synthetic oligonucleotideprobes specific to the V-J or V-D-J junctional sequences ofthe Tg were used (data not shown).An Increased but Still Minor Proportion of Thymocytes and

Splenic T Cells Expresses the Tg on the Cell Surface. The totalnumber ofthymocytes and splenocytes is equivalent betweenthe Tg mice and their non-Tg littermates (Table 2). Usingappropriate mAbs in flow cytometry, we quantitated the y8TCR- and ap TCR-expressing cells among the various cellpopulations. Less than 0.2% of thymocytes and <1% ofsplenocytes from normal mice bear 'y8 TCRs, and cellsbearing KN6 'y8 TCRs are too low to be detected in either cellpopulation (Table 2; ref. 9). By contrast, in the yO Tg mice,2-3% of thymocytes and 3-4% of splenocytes bear 'yS TCRs,of which a large proportion (80-100%) is KN6 clonotypepositive (Table 2). These results strongly suggest that theTg-encoded TCRs dominate the 'y8 T-cell population. How-ever, y5 T cells still compose a relatively small proportion(<4%) of thymocytes and splenocytes in the Tg mice.

Indeed, analysis with the af3 TCR mAb indicated thatneither the absolute number nor the proportion (72-75% oftotal thymocytes and 22-28% of total splenocytes) of aB Tcells is significantly altered in the thymus and spleen of theTg mice (Table 2). These thymocytes and splenocytes exhibita normal expression pattern of CD4 and CD8 glycoproteins

Table 1. Copy number of Tg and relative level of their transcripts in the various Tg miceCopy

number of V,,4 transcripts in V,65 transcripts in

Mice 3yTg8 Tg Thymocytes Splenocytes Thymocytes SplenocytesLM control 0.008 0.004 0.032 0.004lyS-1355 2 5 0.160 0.028 0.352 0.049yB-1314 2 1 0.045 0.008 0.025 0.006yS-1313 1 5 0.078 0.019 0.454 0.071y-817 10 1.091 0.943y-818 1 0.276 0.292y-819 6 0.433 0.468The copy numbers of the Tg were estimated from the intensity of the Southern blot bands obtained

by hybridizing EcoRI-digested liver DNA with the V-,4 or V85 probe. A known amount of EcoRI-digested pV-4 and p8-23/15 cosmid DNA electrophoresed side by side with the liver DNA provided thestandard. The y and 8 RNAs were detected by the Vy4 and V85 probes, respectively, and their relativecontent was estimated from the band intensity using the actin RNA as the internal control. Results areexpressed in arbitrary units.

5'

3068 Immunology: Ishida et al.

P-y -L(V4 J, Cl-y) (1

Dow

nloa

ded

by g

uest

on

May

3, 2

021

Proc. Natl. Acad. Sci. USA 87 (1990) 3069

Table 2. Surface expression of y8 TCR and a,8 TCR on thymocytes and splenocytes of y8 Tg mice

Age, Total Thymocytes (x10-6) stained with Total Splenocytes (x10-6) stained withMice weeks thymocytes Anti-yS Anti-KN6 Anti-a13 splenocytes Anti-y8 Anti-KN6 Anti-a/

y3-1313 9 79 1.26 (1.6) 1.02 (1.3) 56.8 (71.9) 153 6.32 (4.1) 6.27 (4.1) 43.0 (28.1)LM 9 78 0.16 (0.2) 0.00 (0.0) 55.9 (71.7) 167 0.66 (0.4) 0.00 (0.0) 43.6 (26.1)y8-1355 8 100 2.66 (2.7) 2.66 (2.7) 72.7 (72.7) 161 4.% (3.1) 4.83 (3.0) 36.1 (22.4)LM 8 99 0.10 (0.1) 0.00 (0.0) 74.2 (74.9) 152 0.89 (0.6) 0.00 (0.0) 39.7 (26.1)Numbers in parentheses indicate percent. LM, non-Tg littermates.

(data not shown) and, as the a/3 T cells in normal mice (9), donot coexpress ySTCRs at a detectable level (data not shown).These results indicate that a stringent mechanism for restrict-ing the expression of TCR to one of the two types on a giventhymocyte or splenic T cell is active in the Tg mice. Fur-thermore, the results suggest that in these Tg mice, andprobably in normal mice, the yS and a,8 T-cell lineagesbranch out from common precursor T cells before either ofthe two types of TCR is expressed on the cell surface.The yand 6 Tg Persist in the aBT Cells but Their Transcripts

Are Absent. To investigate why the Tg products are notexpressed on the surface of aB T cells, we purified aB T cells(and, as a control, yS T cells) from y8-1355 mice by using aFACS and analyzed their DNA (Fig. 2A) and RNA (Fig. 2B).The aB T-cell population from yB-1355 mice carries on average1.1 copy per cell of V-y4 gene segments in the germ-line con-figurations. Therefore, at most 0.9 (i.e., 2.0 copies minus 1.1copies) copy per cell of the endogenous V-y4 gene segment isexpected to have rearranged. The observed 2.3 copies per cellof the V4J1C1 y gene (Fig. 2A) indicate that at least 1.4 (2.3minus 0.9) copies per cell of V4J1C1 y can be attributed to theTg. This is the minimum estimate of the Tg copy numberbecause it is likely that some of the endogenous V-y4 gene seg-ments are deleted by rearrangement of the Jy1-distal Vy7 genesegment to the Jyj or Jy4 gene segment (15). Thus, these resultsconfirm that the y Tg is retained in the majority of af3 T cells.

Fig. 2A also shows the analysis of the 6 Tg in the y8-1355mouse. The af3 T-cell population retains as many copies(about 4) of the Vr5 gene segment rearranged to J81 as does theyS T-cell population, which clearly indicates that the 8 Tg isretained in the a/3 T cells. Analysis ofDNA from yS-1313 andy8-1314 led to the same conclusion as to the retention of theTg (data not shown).

A'o £:LE

I.Xa)

Vy4- and Vy5-specific RNAs were barely detectable in thea/3 T cells purified from y3-1355 splenocytes in contrast tothe y8T cells purified from the same mice (Fig. 2B). Virtuallythe same results were obtained with y8-1313 and y3-1314(data not shown). We confirmed these findings at the level ofcloned T cells: none of four randomly chosen a/3 T-cellhybridomas prepared from y8-1355 thymocytes, in contrastto two y3 T-cell hybridomas similarly prepared, containedRNA detectable with either the Vy4 or V85 probe, despitetheir retention of the y and 8 Tg (data not shown). Thus, theexpression of the Tg in the af3 T cells of the yS Tg mice seemsto be blocked at the level of RNA.A Transcriptional Silencer in the Flanking Region of the y

Gene. One possible interpretation of the absence of y tran-scripts in af T cells ofthe yv Tg mice, and ofnormal mice (31),is that the ygene carries in its flanking region a cis-acting DNAelement that down-regulates its own transcription in thesecells. To test this possibility in vivo, we constructed anotherset of Tg mice by using a genomic DNA fragment, py-L (Fig.1), that contains essentially the same y gene as py-4 but muchless flanking sequence. The copy numbers of the y Tg and theaugmented levels of the y gene transcripts present in thethymocytes and splenocytes ofthree founder yTg mice, y-817,y-818, and y-819, are summarized in Table 1.

a,B T cells purified from the spleens of these Tg mice, incontrast to those from the y8 Tg mice (Fig. 2B), harboredabundant y RNA of an appropriate size [1.5 kilobases (kb)]detected by the Vy4 probe (data not shown). Since the rear-rangement of the endogenous V4J1 y gene was not inhibited inthe a,3 T cells of these Tg mice (data not shown), the V4probe-positive RNA may have been transcribed either fromthe y Tg or the endogenously rearranged V4J1 y gene or both.To investigate this issue, we prepared a8 T-cell hybridomas

EB

X

kb

23 - O - V-Y4JtY C- - 2.0 2.39.4 - *

465- - - V74gI. - 0.6}2.0

4.4-_WW~- V'Y4gl. - 2.1 1.1 1.4

V655

I- 18S

- 18S

- V65DJI - 4.3

_ J51 g. - 1.2DJji 0.9

copy numbers Cc2 - 18 S

FIG. 2. Southern and Northern blot analyses of nucleic acids from the a,8 TCR+ and yS TCR+ splenic T-cell populations of the Tg mousey-1355. (A) DNAs extracted from the purified T-cell subpopulations as well as from C57BL/6 embryos (emb.) were digested with EcoRI andanalyzed (5 ,ug per lane) with the Vy4, J81, or Thy-I probe. The band assignments were made according to previous studies (12, 30). gl. designatesthe respective gene segment in the germ-line configuration. V,,4 gl.* designates an incompletely digested Vy4 gene segment in the germ-lineconfiguration (31). To deduce the copy numbers of the y and 8 genes and their fragments, the relative intensity obtained for each band wasnormalized for input DNA variation by using the intensity of the Thy-I band in the same lane. The copy number was then calculated by dividingthe normalized relative intensity by that of the Vy4 or J&1 germ-line band of the embryo DNA and then multiplying by 2. (B) RNAs extracted fromthe purified T-cell subpopulations were analyzed (10 ,g per lane) with the Vy4, V55, or Ca probe. The position ofthe 18S ribosomal RNA is indicated.

23 - -

9.4 - qwJ6 1 6.5 - w VW

4.4 -

9.4 -

Thyl6.5 -

4.00.70.3 2.0

Immunology: Ishida et al.

__W .,

Dow

nloa

ded

by g

uest

on

May

3, 2

021

Proc. Natl. Acad. Sci. USA 87 (1990)

(and, as a control, y8T hybridomas) from the thymocytes ofthe y Tg mice y-817. As expected, each of these hybridomas,in contrast to the ap T-cell hybridomas prepared from the yvTg mice, contained the Vy4 probe-positive, 1.5-kb RNA (datanot shown). Also as expected, most of these hybridomascontained, in addition to the y Tg, an endogenously rearrangedV4J1 y gene(s) and/or the V4J1 y gene derived from the fusionpartner BW5147 (15, 32) (Fig. 3A).We prepared cDNA from total RNA extracted from the ap

T hybridomas (as well as from the control y8T hybridomas)and amplified a 200-base-long segment of the V4J1 y cDNA bythe PCR (27) using appropriate oligonucleotide primers. ThePCR products were incubated with the restriction enzymeXbaI and the reaction products were analyzed by agarose gelelectrophoresis. Since the unique Xba I site is destroyed in thepy-L Tg (Fig. 1), the amplified DNA corresponding to the Tgwill be resistant to Xba I digestion, while any amplified DNAderived from endogenous or BW5147-derived V4J1 ygenes willbe split into 150- and 50-base-pair (bp) fragments. As shown inFig. 3B, the three control y8T-cell hybridomas (nos. 9, 11, and12) yielded both 200- and 150-bp DNA fiagments (the 50-bpDNA fragment, the other product of the Xba I digestion, wastoo short to be visualized clearly in this agarose gel). Bycontrast, all eight a/3 T-cell hybridomas examined yielded onlythe 200-bp fragment indicative of transcripts from the y Tg.Essentially the same results were obtained with the other twopy-tL-derived Tg mice, 'y-818 and y-819 (data not shown).

In conclusion, there exist abundant transcripts from theV4J1 y Tg in the T-cell hybridomas derived from the apthymocytes of the py-L Tg mice. In contrast, virtually notranscripts of the endogenously rearranged and/or BW5147-derived V4J1 y gene(s) are detected in the same T-cellhybridomas (Fig. 3B). Since these results were obtained with

A

kbp

(Q /

three Tg founder mice it is unlikely that the differentialexpression of the Tg and endogenous (and/or the thymomaderived) y genes is caused by the specific sequence contextin which the Tg are integrated. Thus, these results suggestthat the y gene carries, in its flanking regions, a cis-actingDNA element that down-regulates the amount of y transcriptin a/3 T cells. The results further suggest that this silencerelement is in the flanking regions present on the py-4 clonebut absent on the py-L clone.

DISCUSSIONOur finding that af3 T cells are generated in the y8 double Tgmice as abundantly as in non-Tg littermates does not supportthe Pardoll-Allison model. The a(3 T cells retain the Tg butthey are apparently transcriptionally silent. The analysis ofTgmice constructed with the short y gene clone (py-<L) stronglysuggests that the transcription of V4J1 genes present in a/3 Tcells is repressed via a DNA element (a silencer) located in itsflanking region. In light of these findings we propose a modelfor the differentiation of al3 and 'y8 T cells (Fig. 4). The newmodel, like the Pardoll-Allison model, assumes that y and 8gene rearrangements occur prior to the completion (i.e., V toDJjoining) of 3 gene rearrangement and the initiation ofa generearrangement. Productive rearrangements of both y and 8genes are, of course, a prerequisite for the generation of y5thymocytes. However, the failure to rearrange both y and 8genes productively is not a requirement for the generation ofa,3 thymocytes. We suggest that the putative machinery actingon the y silencer is activated in a fraction of immaturethymocytes and that it is from these cells that al3 thymocytesare generated. If the activation of the silencer machineryoccurs prior to y and 8 gene rearrangements, a/3 and y8 T-celllineages are completely separate and no aB thymocyte pre-

-y (5

LM 1 2 3 4 5 6 7 8 9 1 0 2 Bv "3 4

w-|------up,-.. _Fw ._''w:Ww. .Wq

i i k BI

1

2.mmsm"mnz ~~~~~1~

Without Xba With Xba

V4J.Cl RNA 5__

Terul ala e-Ie

Exoecteci PCR F ron-. Tc RNA - -

or :cctRs aefter Fro "or%.T_X .) a ri iq' e s t io r RNA

FIG. 3. Southern blot and PCR-aided Southern blotanalyses of nucleic acids from T-cell hybridomas pre-pared from Tg mouse y-817. (A) DNAs extracted fromeight (lanes 1-8) y-817-derived a/3 T-cell hybridomas,six (lanes 9-14) y-817-derived y8 T-cell hybridomas,one (lane LM) normal mouse-derived a/3 T-cell hybrid-oma, and the fusion partner thymoma BW5147 (laneBW) were digested with EcoRI and analyzed (5 ,ug perlane) with the Vy4 probe. Since the Tg (10 copies) areconcatemerized, they appear as a heterogeneous band(Tg V4J1Cl) containing large (>30 kb) DNA fragmentsin contrast to the 16-kb band containing the endoge-nously rearranged and/or BW5147-derived V4J1Cj ygene. Note that the lack ofgerm-line Vy4 band (Vy4 gl.)and/or the augmented intensity of rearranged V4J1Cj ygene band of the non-Tg type (Endo V4J1Cl) over theintensity of the corresponding band of BW5147 DNAindicate that at least one copy of the endogenous Vy4alleles is rearranged in most hybridomas. (B) PCRproducts of RNA from the eight (lanes 1-8) a,8 T-cellhybridomas and three (lanes 9, 11, and 12) y8 T-cellhybridomas, all derived from the Tg mouse y-817, wereanalyzed by Southern blotting with and without predi-gestion with Xba I. The 3' C,,1 probe used was theHindIII/Pvu II fragment (700 bp) from clone py-L (Fig.1).

23

9.4

6. 5

4.4

____

..114~_P En C4- C.

3070 Immunology: Ishida et al.

B -1 (

i, ;:.! ."I I

_N

Dow

nloa

ded

by g

uest

on

May

3, 2

021

Proc. Natl. Acad. Sci. USA 87 (1990) 3071

-y6 TCR

FIG. 4. The silencer model of afi and SyO T-cell differentiation.Superscripts 0 and + denote that the gene is in the germ-lineconfiguration and productively rearranged, respectively, while su-perscripts a and p designate that the gene is in any state (i.e., ingerm-line configuration, productively or nonproductively rearrangedor deleted) and partially rearranged (i.e., D-J joined), respectively.See text for more details.

cursors will ever express y8 TCRs. We favor this possibilitybecause no a(3 TCR-y8 TCR double producers are detectablein either normal mice (9) or in the y8 double Tg mice.However, activation of the machinery could occur simultane-ously or shortly after the completion of y and gene rear-rangements, in which case precursors of some af3 T cells mayexpress y8 TCRs transiently.

It is possible that the generation of afB T cells was notblocked in the y8 Tg mice because the expression of the y or8 Tg was abnormally delayed in these mice. We argue thatthis is unlikely because cells bearing Tg-encoded TCRsappear earlier than af3 thymocytes in developing thymuses(unpublished results). Furthermore, in the y8 T cells ofthe Tgmice y8-1355, Vy4 -* Jyl. and V8 -- DJ&1 rearrangements are

completely inhibited (Fig. 2A) by allelic exclusion (18) andvirtually all y8 TCRs expressed are Tg-encoded (Table 2).Should the surface expression of the Tg-encoded y8 TCR beabnormally delayed in the y8 Tg mice, the endogenous y andgenes would have rearranged and been expressed on the

surface of y8 T cells.It should be noted that the present study deals with the

major y8 T-cell subset expressing the Cyl-associated y genesand does not directly address the lineage relationship involv-ing the C.,4-expressing y8 T cells. However, since the lattery genes are also repressed in af3 T cells (Y. Takagaki andS.T., unpublished data) we suspect that a similar mechanismapplies to this y3 T-cell subset. In contrast, the V2J2C2 ygeneutilizing the third Cy gene segment is not usually repressed ina,8 T cells (1, 2, 31). However, no freshly isolated T cell hasever been shown to express the product of these y genes onthe cell surface.

Recently, the issue of whether af and y. T-cell lineagesare completely separate was addressed by analysis of extra-chromosomal circular DNA generated by Vj-J, joinings, buttwo groups came up with opposite conclusions (33, 34). Wenote that the y silencer model presented here would makemore sense if the gene rearrangement is not entirelyrepressed in the precursors of a/3 T cells.The present study was not designed to determine the

precise location of the putative y silencer element. However,we can conclude that it is outside of the sequences containedin the 15-kb py-L clone. The finding that the y Tg is repressedin af3 T cells of the y8 Tg mice suggests that the silencer ison the 40-kb py-4 clone. However, since these Tg mice weremade by coinjection of the yand gene clones and coinjectedDNAs are known to be cointegrated, it is possible that the yTg is repressed by a 6gene-associated silencer. We argue thatthis is unlikely because the gene, at least in the 43-kb

construct used, does not seem to be transcriptionally silent inan aj3 T-cell clone (28).

Finally, the silencer model of T-cell development is sup-ported by our recent finding that the generation of a/3 T cellsis severely blocked in Tg mice carrying y and 6 Tg without theassociated silencer (35).We thank Ralph Kubo for mAb H57-597, Osami Kanagawa for

hybridoma KN6, Yohtaro Takagaki for the synthetic oligonucleo-tides, Edvins Krecko and Anneloes Beenders for excellent technicalassistance, and Elly Basel for secretarial help. This work wassupported by grants from the Howard Hughes Medical Institute, theNational Institutes of Health, Ajinomoto Co., Ltd., and the Amer-ican Cancer Society to S.T., and The Netherlands Cancer Founda-tion to S.V. and A.B.. 1.1. was supported in part by ToyoboBiotechnology Foundation.1. Saito, H., Kranz, D. M., Takagaki, Y., Hayday, A. C., Eisen, H. N. &

Tonegawa, S. (1984) Nature (London) 309, 757-762.2. Kranz, D. M., Saito, H., Heller, M., Takagaki, Y., Haas, W., Eisen,

H. N. & Tonegawa, S. (1985) Nature (London) 313, 752-755.3. Hayday, A. C., Saito, H., Gillies, S. D., Kranz, D. M., Tanigawa, G.,

Eisen, H. N. & Tonegawa, S. (1985) Cell 45, 259-269.4. Brenner, M. B., McLean, J., Dialynas, D. P., Strominger, J. L., Smith,

J. A., Owen, F. L., Seidman, J. G., Ip, S., Rosen, F. & Krangel, M. S.(1986) Nature (London) 322, 145-149.

5. Bank, I., DePinho, R. A., Brenner, M. B., Cassimeris, J., Alt, F. W. &Chess, L. (1986) Nature (London) 322, 179-181.

6. Weiss, A., Newton, M. & Crommie, D. (1986) Proc. Nati. Acad. Sci.USA 83, 6998-7002.

7. Raulet, D. H., Garman, R. D., Saito, H. & Tonegawa, S. (1985) Nature(London) 314, 103-107.

8. Pardoll, D. M., Fowlkes, B. J., Bluestone, J. A., Kruisbeek, A., Maloy,W. L., Coligan, J. E. & Schwartz, R. H. (1987) Nature (London) 326,79-82.

9. Itohara, S., Nakanishi, N., Kanagawa, O., Kubo, R. & Tonegawa, S.(1989) Proc. Nati. Acad. Sci. USA 86, 5094-5098.

10. Reilly, E. B., Kranz, D. M., Tonegawa, S. & Eisen, H. N. (1986) Nature(London) 321, 878-880.

11. Rupp, F., Frech, G., Hengartner, H., Zinkernagel, R. M. & Joho, R.(1986) Nature (London) 321, 876-878.

12. Heilig, J. S. & Tonegawa, S. (1987) Proc. Natl. Acad. Sci. USA 84,8070-8074.

13. Korman, A. J., Galesic, S. M., Spencer, D., Kruisbeek, A. M. & Raulet,D. (1988) J. Exp. Med. 168, 1021-1039.

14. Ito, K., Bonneville, M., Takagaki, Y., Nakanishi, N., Kanagawa, O.,Krecko, E. & Tonegawa, S. (1989) Proc. Natl. Acad. Sci. USA 86,631-635.

15. Takagaki, Y., Nakanishi, N., Ishida, I., Kanagawa, 0. & Tonegawa, S.(1989) J. Immunol. 142, 2112-2121.

16. Hochstenbach, F. & Brenner, M. B. (1989) Nature (London) 340, 562-565.17. Allison, J. P. & Lanier, L. L. (1987) Immunol. Today 8, 293-295.18. Alt, F. W., Blackwell, T. & Yancopoulos, G. D. (1987) Science 238,

1079-1086.19. Kubo, R. T., Born, W., Kappler, J. W., Marrack, P. & Pigeon, M. (1989)

J. Immunol. 142, 2736-2742.20. Hedrick, S. M., Cohen, D. I., Nielsen, E. A. & Davis, M. M. (1984)

Nature (London) 308, 149-153.21. Spiegelman, B. M., Frank, M. & Green, H. (1983) J. Biol. Chem. 258,

10083-10089.22. Dillelu, A. G. & Woo, S. L. C. (1985) Focus 7, 1-5.23. Uematsu, Y., Ryser, S., Dembic, Z., Borgulya, P., Krimpenfort, P.,

Berns, A., von Boehmer, H. & Steinmetz, M. (1988) Cell 52, 831-841.24. Chomczynski, P. & Qasba, P. K. (1984) Biochem. Biophys. Res. Com-

mun. 122, 340-344.25. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 6-11.26. Amemiya, Y. & Miyahara, J. (1988) Nature (London) 336, 89-90.27. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R.,

Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 239,487-491.28. Bonneville, M., Ito, K., Krecko, E. G., Itohara, S., Kappes, D., Ishida,

I., Kanagawa, O., Janeway, C. A., Jr., Murphy, D. B. & Tonegawa, S.(1989) Proc. Natl. Acad. Sci. USA 86, 5928-5932.

29. Born, W., White, J., O'Brien, R. & Kubo, R. J. (1988) Immunol. Res. 7,279-291.

30. Chien, Y-h., Iwashima, M., Wettstein, D. A., Kaplan, K. B., Elliott,J. F., Born, W. & Davis, M. M. (1987) Nature (London) 330, 722-727.

31. Heilig, J. S. & Tonegawa, S. (1986) Nature (London) 322, 836-840.32. Heilig, J. S., Glimcher, L. H., Kranz, D. M., Clayton, L. K., Green-

stein, J. L., Saito, H., Maxam, A. M., Burakoff, S. J., Eisen, H. N. &Tonegawa, S. (1985) Nature (London) 317, 68-70.

33. Winoto, A. & Baltimore, D. (1989) Nature (London) 338, 430-432.34. Takeshita, S., Toda, M. & Yamagishi, H. (1989) EMBOJ. 8, 3261-3270.35. Bonneville, M., Ishida, I., Mombaerts, P., Katsuki, M., Verbeek, S.,

Berns, A. & Tonegawa, S. (1989) Nature (London) 342, 931-934.

Immunology: Ishida et A

Dow

nloa

ded

by g

uest

on

May

3, 2

021