JOURNAL OF VIROLOGY,0022-538X/98/$04.0010

Jan. 1998, p. 42–47 Vol. 72, No. 1

Copyright © 1998, American Society for Microbiology

Varicella-Zoster Virus Gene 21: Transcriptional StartSite and Promoter Region

RANDALL J. COHRS,1* MICHAEL BARBOUR,1 AND DONALD H. GILDEN1,2

Departments of Neurology1 and Microbiology,2 University of Colorado Health SciencesCenter, Denver, Colorado 80262

Received 11 June 1997/Accepted 1 October 1997

Varicella-zoster virus (VZV) causes chicken pox (varicella), becomes latent in dorsal root ganglia, andreactivates decades later to cause shingles (zoster). During latency, the entire VZV genome is present in acircular form, from which genes 21, 29, 62, and 63 are transcribed. Immediate-early (IE) VZV genes 62 and 63encode regulators of virus gene transcription, and VZV gene 29 encodes a major DNA-binding protein.However, little is known about the function of VZV gene 21 or the control of its transcription. Using primerextensions, we mapped the start of VZV gene 21 transcription in VZV-infected cells to a single site located at279 nucleotides (nt) with respect to the initiation codon. To identify the VZV gene 21 promoter, the 284-bpregion of VZV DNA separating open reading frames (ORFs) 20 and 21 was cloned upstream from thechloramphenicol acetyltransferase gene. In transient-transfection assays, the VZV gene 21 promoter wastransactivated in VZV-infected, but not uninfected, cells. Further, the protein encoded by ORF 62 (IE62), butnot those encoded by VZV ORFs 4, 10, 61, and 63, transactivates the VZV gene 21 promoter. By use oftransient-cotransfection assays in conjunction with 5* deletions of the VZV gene 21 promoter, a 40-bp segmentwas shown to be responsible for the transactivation of the VZV gene 21 promoter by IE62. This region waslocated at 296 to 256 nt with respect to the 5* start of gene 21 transcription.

Varicella-zoster virus (VZV), a neurotropic alphaherpesvi-rus, causes childhood chicken pox (varicella), becomes latentin dorsal root ganglia at all levels of the neuraxis, and mayreactivate decades later to produce shingles (zoster) (18). Theentire 125,884-bp VZV genome has been sequenced, and 71open reading frames (ORFs) have been identified (14). Tran-scripts mapping to most of the predicted ORFs have beendetected in VZV-infected cells, although fewer than 20 VZVgenes have been analyzed in detail (29, 35, 37). The VZVgenome is compact: the 71 ORFs are separated by an averageof 211 bp, indicating that the promoters are close to the genesthey control.

Coordinated control of virus gene expression is a hallmarkof herpesvirus lytic replication (21). Because VZV is highly cellassociated and does not grow to high titers, experiments in-volving high multiplicities of infection and single-step virusgrowth have been difficult. Nevertheless, it appears that likethat of the prototype alpha-herpesvirus, herpes simplex virustype 1 (HSV-1), VZV gene transcription during productiveinfection is highly regulated and follows a complex cascade ofevents (8). VZV immediate-early (IE) genes are the first to betranscribed, and their promoters are recognized by the existingcellular transcription factors. VZV IE proteins transactivatepromoters for the VZV genes involved in virus DNA replica-tion (early proteins). During this time, the input linear herpes-virus DNA circularizes in preparation for replication via arolling-circle mechanism (3, 25). Following the initiation ofvirus DNA replication, late viral genes are transcribed andtranslated. Late gene promoters are not recognized by unmod-ified cellular transcription factors, and their transactivation byIE proteins is only marginal. However, gene amplification re-sulting from virus DNA replication overcomes late promoter

inefficiency, and late gene transcripts accumulate in infectedcells.

During latency, productive VZV replication is blocked,VZV is not seen by electron microscopy in otherwise normalhuman ganglia, and infectious virus cannot be recovered (17).The VZV genome exists in an episomal form from which atleast four virus genes (genes 21, 29, 62, and 63) are transcribed(6, 9, 13). VZV genes 62 and 63 encode IE phosphoproteinswhich orchestrate virus gene transcription (2, 15, 16, 24, 26, 27,36), and VZV gene 29 encodes a 130-kDa early DNA-bindingprotein (28). The function of the VZV gene 21 protein has notbeen studied, although its HSV-1 homolog, UL37, binds toHSV-1 ICP8, the homolog of the VZV gene 29 protein (39,40). To begin studying the structure and regulation of VZVgene 21, we used primer extensions to identify the 59 start ofVZV gene 21 transcription and transient-transfection assays tolocate the promoter for VZV gene 21 in infected cells.

MATERIALS AND METHODS

Virus and cells. VZV (Ellen strain) was propagated in a continuous line ofAfrican green monkey kidney cells (BSC-1) in Dulbecco’s minimal essentialmedium supplemented with 10% fetal calf serum. Infected cells were coculti-vated with uninfected cells as described previously (19).

RNA extraction and primer extension. Uninfected and VZV-infected BSC-1cells were disrupted with guanidine lysis buffer, and total RNA was extractedwith acid-phenol (5). Table 1 shows the sequences of the oligonucleotides usedfor priming cDNA synthesis. T4 polynucleotide kinase and [32P]ATP were usedfor 59-end labeling of oligonucleotides; this was followed by electrophoresis on20% polyacrylamide gels or affinity chromatography (30). For primer extension,8.9 3 104 cpm of labeled primer was annealed to 5 mg of total RNA at 65°C for10 min and cDNA was synthesized at 48°C for 60 min with Moloney murineleukemia virus reverse transcriptase (Superscript H2; Gibco-BRL, Gaithersburg,Md.). The extended products along with the DNA sequence (Sequenase; U.S.Biochemicals, Cleveland, Ohio) of the SalI C fragment of VZV DNA wereresolved on sequencing gels (11).

Northern blot analysis. Total RNA (20 mg) from VZV-infected and controlBSC-1 cells was resolved by electrophoresis in 1% agarose gels containing 0.5mM methylmercury(II) hydroxide (Johnson Matthey, Ward Hill, Mass.), trans-ferred to Zeta-Probe membranes (Bio-Rad, Hercules, Calif.), and probed witheither the entire VZV gene 21 ORF, which extends from nucleotide (nt) 30759to nt 33872 on the VZV genome (14), or a human b-actin cDNA (10, 12).

* Corresponding author. Mailing address: Department of Neurol-ogy, University of Colorado Health Sciences Center, 4200 E. NinthAve., Box B-182, Denver, CO 80262. Phone: (303) 315-8100. Fax: (303)315-8720. E-mail: randall.cohrs@uchsc.edu.

42

on March 23, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

Double-stranded DNA probes were radiolabeled with [32P]dCTP by nick trans-lation (30).

Plasmid construction. The initiation codons for VZV ORFs 20 and 21 arelocated at nt 30475 and nt 30759, respectively, and the ORFs are oriented inopposite directions (14). The 284-bp intergenic region separating ORFs 20 and21 was amplified from pBSalC (11) by PCR with oligonucleotide primers con-taining either KpnI or MluI restriction endonuclease sites (Table 1). PCR con-ditions were reported previously (12). The PCR product was resolved by agarosegel electrophoresis, digested with KpnI and MluI, and inserted into a promoter-less chloramphenicol acetyltransferase (CAT) reporter plasmid (pCAT3basic;Promega, Madison, Wis.). Before the PCR product was inserted into the re-porter plasmid, the multiple cloning site was modified to invert the orientation ofthe KpnI and MluI sites. Inversion of the KpnI and MluI sites of pCAT3basic wasobtained by digesting pCAT3basic with KpnI and MluI and then ligating adouble-stranded adapter consisting of annealed oligonucleotides KpnI-MluI-p1and KpnI-MluI-p2 (Table 1). The fidelity of PCR and cloning was verified byDNA sequencing.

To construct plasmids placing VZV ORFs 4, 10, 61, 62, and 63 under thecontrol of the cytomegalovirus (CMV) IE promoter (pCIneo; Promega), theVZV ORFs, along with 6 to 1,817 bp of flanking sequences, were shuttled intothe vector, pAlter-1 (Promega). Following DNA sequencing to determine theorientation of the insert, single-stranded phage DNA and oligonucleotide prim-ers (Table 1) were used to synthesize chimeric double-stranded plasmid DNA.After transformation of Escherichia coli INVaF9 (In Vitrogen, San Diego, Calif.)and selection of tetracycline-sensitive, ampicillin-resistant organisms (antibioticswitch), the plasmid inserts were partially sequenced to confirm the introductionof the desired restriction endonuclease site. The VZV ORFs were then shuttledfrom pAlter-1 to pCIneo and again the inserts were partially sequenced toconfirm the correct construct. Oligonucleotide primers used to introduce therestriction endonuclease sites were designed to leave unchanged the virus DNAsequence around the initiation codon.

DNA transfection and reporter gene assay. BSC-1 cells (0.7 3 106 cells) wereseeded into 90-mm-diameter dishes and grown for 18 to 24 h at 37°C in ahumidified CO2 incubator. Supercoiled plasmid DNA, extracted by affinity chro-matography (Qiagen, Santa Clarita, Calif.), was diluted to 20 mg in 500 ml ofHanks balanced salt solution. Each transfection reaction mixture consisted of 15mg of reporter plasmid and 5 mg of b-galactosidase-expressing plasmid DNA(pSV-bGal; Promega) and was precipitated at room temperature for 20 min withthe addition of CaCl2 to 0.124 M (20). The DNA-CaPO4 precipitate was addeddirectly to the cell monolayer, and cells were harvested and lysed 48 h aftertransfection and assayed for total protein and b-galactosidase activity (30). Cellextracts were diluted to yield equal amounts of b-galactosidase activity, andacetylation of [14C]chloramphenicol was determined by ascending thin-layerchromatography (30). Where promoter activity was determined as a response to

transactivation by various VZV proteins, equal amounts of cell protein extractwere used in CAT assays.

RESULTSVZV gene 21 transcriptional unit. Northern blot analysis of

total RNA extracted from VZV-infected cells demonstratedthat the VZV gene 21 transcript is a single species of approx-imately 3.1 kb (Fig. 1). We have previously determined the39-terminal structure of VZV gene 21 from both lytically in-fected cells in tissue culture and from latently infected humantrigeminal ganglia (9, 12). The VZV gene 21 ORF is followedby 45 to 52 nt of untranslated RNA containing a typical eu-karyotic polyadenylation signal and a poly(A)1 tail. To deter-mine the structure of the VZV gene 21 transcript at the 59 end,primer extensions were used in which RNA extracted fromproductively infected cells was reverse transcribed with various32P-end-labeled oligonucleotides complementary to ORF 21(Table 1). The sizes of the extended products were comparedto those of a DNA sequencing ladder obtained by sequencingthe SalI C fragment of VZV DNA with each primer. Figure 2shows that for each primer used, the reverse transcriptionproduct terminated at the identical adenosine (nt 30681), lo-cated at 279 with respect to the initiation codon for VZV gene21. Faint bands were observed at 2110 with respect to theinitiation codon for VZV gene 21 when the VZV-infectedBSC-1 RNA was extended with primer 21pe1 and at 2117when the RNA was extended with primer 21pe2. These prod-ucts may indicate the presence of minor gene 21 transcriptsinitiating from a subordinate TATA box; however, since theyare not coterminal and not observed when primer 21pe3 isused to extend VZV-infected BSC-1 RNA, these products maybe artifacts of the reverse transcription reaction. No productwas observed when the primers were used to extend uninfectedBSC-1 cell RNA. Identical results were obtained when theexperiment was repeated with a different preparation of in-

TABLE 1. Oligonucleotide primers

Primer Sequence (59 to 39)a 59 startb 39 endb Use

21pe1 CTTCTTGTACTTTCAAGTTAC 30808 30828 Primer extension21pe2 GTTTTCTCTGGTGACCATGG 30853 30862 Primer extension21pe3 GGAATTTTCTGGGTAGATCG 30897 30916 Primer extension21-mlu GCGACGCGTAGCTGAGGGGTTAAATTCACA 30475 30497 59-end p21, p21D21-mluA GCGACGCGTGGTAGGAGGAGCC 30585 30597 59-end p21A21-mluB GCGACGCGTGGTTCTTCAACTTACCGTG 30626 30644 59-end p21B21-mluC GCGACGCGTGCGTTTTTATTGATGTTAC 30663 30682 59-end p21C21-mluZ GCGACGCGTCGGGGTCACGTCCAGCCTGTG 29979 30000 59-end p21Z21-kpn GCGGGTACCGGTATATTCTACGCTGACTTAAC 30758 30736 39-end p21, p21A, p21B, p21C21-kpnA GCGGGTACCGGCTCCTCCTACC 30597 30585 39-end p21DKpnI-MluI-p1 TACGCGTGGAATTCCGGTACCG NAc NA Modify pCAT3basicKpnI-MluI-p2 CGCGCGGTACCGGAATTCCACGCGTAGTAC NA NA Modify pCAT3basic4-HindIII CAAAATATCTGACAA(GC)TTGCGTGTTTGCAG 4147 4175 Introduce HindIII site 59 of ORF 44-SpeI CAAATTAGTATGTTTTGAC(TAGT)AGCATGAAAAAGG 2739 2771 Introduce SpeI site 39 of ORF 410-EcoRI CTTATTTAAACTAAAGA(A)TT(C)TTACTCTATAAG 12128 12158 Introduce EcoRI site 59 of ORF 1010-XbaI CGCGTTAAACGTC(TAG)ATTGGGGTAGAG 13385 13409 Introduce XbaI site 39 of ORF 1061-HindIII GAATACAGCCAA(G)CTTGTTACCATGG 104505 104482 Introduce HindIII site 59 of ORF 6161-SpeI GAAGTCCTAGTT(AC)T(A)GTTGGGAGGGGG 103091 103067 Introduce SpeI site 39 of ORF 6162-EcoRI GGGTACGTCTA(G)AATTCACCCCAG 109160 109138 Introduce EcoRI site 59 of ORF 62d

63-HindIII GGTGCAAAACATGTCC(AAGC)TTGGGGCCGTAGTA 110592 110563 Introduce HindIII site 59 of ORF 6363-SpeI TGTATTTATTTATAA(CT)AG(T)ACTACACGCCATGGG 111435 111404 Introduce SpeI site 39 of ORF 63EcoRI-HindIII-p1 AATTCCTGGA NA NA Link EcoRI site to HindIII site in pCIneoEcoRI-HindIII-p2 AGCTTCCAGG NA NA Link EcoRI site to HindIII site in pCIneo

a MluI sites are indicated by a single underline. KpnI sites are indicated by a double underline. Parentheses enclose nucleotides added to introduce the desiredrestriction endonuclease.

b Nucleotide position of the oligonucleotide on the VZV genome.c NA, not available.d The 39 cloning site (XbaI) was supplied by the pAlter-1 vector.

VOL. 72, 1998 VZV GENE 21 PROMOTER 43

on March 23, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

fected cell RNA. Thus, the VZV gene 21 transcript is a single3.1-kb poly(A)1 RNA containing a 3,113-nt ORF bounded byuntranslated regions of 79 nt at the 59 end and 45 to 52 nt at the39 end.

The VZV gene 21 promoter is silent in uninfected cells. Toinvestigate the VZV gene 21 promoter, the 284-bp DNA seg-ment separating ORF 20 and ORF 21 (Fig. 3) was cloned intothe CAT reporter plasmid. Figure 4 shows that in controlBSC-1 cells, the VZV gene 21 promoter induces CAT at levelsbeneath detection under the circumstances used. Further, thefunction of a VZV-induced protein is required for gene 21promoter activity.

The VZV gene 21 promoter is transactivated by the proteinencoded by ORF 62 (IE62). Since the VZV gene 21 promoteris silent in uninfected cells and active during virus infection,one or more VZV-induced proteins must function to transac-tivate the gene 21 promoter. The most likely candidates areVZV IE proteins or the tegument-associated transactivatingprotein (encoded by ORF 10). Therefore, we constructed ex-pression plasmids in which VZV IE protein genes correspond-ing to ORF 4, 61, 62, and 63, along with ORF 10, were placedunder the control of the CMV IE3 promoter. Western blotanalysis was used to confirm the ability of each construct toexpress the respective protein in transient-transfection assays(data not shown). Figure 5 shows that the VZV gene 21 pro-moter is silent in uninfected BSC-1 cells or in BSC-1 cellsexpressing ORF 4, 10, 61, or 63. However, cotransfection ofBSC-1 cells with the gene 21 promoter-CAT construct with theORF 62 expression plasmid transactivated the VZV gene 21promoter 42-fold more than cotransfection with the gene 21promoter alone.

5* boundary of the gene 21 promoter. Figure 6 shows theresults of transient transfection of BSC-1 cells with various 59truncations of the VZV ORF 20-ORF 21 intergenic region

FIG. 1. Northern blot analysis of VZV-infected BSC-1 RNA. (A) Total RNA(20 mg) extracted from control BSC-1 cells (lanes C) and VZV-infected BSC-1cells (lanes V) along with RNA standards (lane M; Gibco-BRL) was resolved in1% agarose gels containing 0.5 mM methylmercury(II) hydroxide and stainedwith 0.5 mg of ethidium bromide per ml in 0.5 M ammonium acetate. (B and C)RNA was transferred to a nylon-based membrane and probed for VZV gene 21transcripts (B) or b-actin transcripts (C). VZV gene 21 transcripts are visible asa discrete 3.1-kb band in VZV-infected cell RNA. Both control and VZV-infected cell RNA contain discrete 1.8-kb b-actin transcripts.

FIG. 2. Location of the 59 start of RNA transcription for VZV gene 21. Total RNA (5 mg) from either VZV-infected (lanes V) or uninfected (lanes C) BSC-1 cellswas annealed to oligonucleotide primer 21pel, 21pe2, or 21pe3 end labeled with 32P (Table 1). First-strand cDNA was synthesized, and the extended product wasresolved by gel electrophoresis. The DNA sequence of the SalI C fragment of VZV DNA primed with the respective oligonucleotides was used to size the cDNAproducts. The entire gel image as well as an enlargement of the region containing extended products is shown. With all three primers, the cDNA product obtained fromVZV-infected cell RNA (closed arrows in lanes V) terminated at the identical adenosine located at nt 30681 on the VZV genome. Minor extended products obtainedfrom VZV-infected cell RNA (open arrows in lanes V) were also observed. No product was observed when uninfected cell RNA was used in the cDNA synthesisreaction (lanes C).

44 COHRS ET AL. J. VIROL.

on March 23, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

inserted into the CAT reporter plasmid. Inspection of the ORF20-ORF 21 intergenic region indicates the presence of threeTATAA-like boxes. The plasmids were constructed to eliminatesuccessively these putative transcriptional regulatory elements. Todetermine if transcriptional regulatory elements exist upstream ofthe ORF 20-ORF 21 intergenic region that controls expression ofgene 21, a further CAT construct that extended 496 bp into the 59end of ORF 20 was made (p21Z-CAT). Since we had determinedthat IE62 is required for gene 21 promoter activity, all transfec-tions included the IE62 expression vector. The CAT activity ofp21Z-CAT was similar to that of p21-CAT, indicating that theVZV gene 21 promoter is contained entirely within the segmentof DNA spanning ORFs 20 and 21. Deletion of the 111 bp fromposition 30475 to position 30585 had little effect on VZV gene 21promoter activity and reduced CAT activity only from 90.6 to80.8%. Deletion of the 152 bp from position 30475 to position30626, however, had a marked effect on VZV gene 21 promoterfunction and reduced its activity to background levels. Further 59truncations of the VZV gene 21 promoter also resulted in back-ground CAT activities. These results indicate that the 59 boundaryof the gene 21 promoter regulatory region of the VZV gene 21promoter lies between nt 30585 and nt 30626. Since this regioncontains a TATAA box that could direct the 59 start of transcrip-tion, plasmid p21D, which consists of the DNA segment from nt30475 to nt 30597 inserted into the CAT reporter plasmid, wasconstructed. In transient-cotransfection assays, p21D demon-strated no CAT gene translation products in the presence of IE62(Fig. 6), indicating a lack of promoter activity.

DISCUSSION

VZV gene 21 consists of a 3,113-nt ORF bounded by a 59untranslated region of 79 nt and by a 39 untranslated region of45 to 52 nt. During productive infection in tissue culture, VZV

FIG. 3. Schematic representation of the VZV DNA between ORFs 20 and 21. The VZV genome consists of unique long (UL) and unique short (US) segments ofDNA, each bounded by inverted and repeated DNA sequences (TRL/IRL and IRS/TRS). ORFs 20 and 21 are oriented in opposite directions, and both map within theSalI C fragment (positions 23454 to 35936) within the UL. The 284-bp DNA segment separating ORFs 20 and 21 contains one potential IE62 binding site and threeTATAA-like boxes. The 59 start site of gene 21 transcription is located at nt 30681, and the 39 end of the transcript has been mapped to nt 33888 and nt 33895 (7, 10).The boundary of the CAT reporter constructs used to locate the VZV gene 21 promoter are shown.

FIG. 4. The VZV gene 21 promoter is silent in uninfected cells. The 284-bpVZV DNA segment separating ORFs 20 and 21 was inserted into the CATreporter plasmid and used to transfect either uninfected cells (lane 2) or VZV-infected cells (lane 4). Controls included the CAT reporter plasmid lacking apromoter transfected into uninfected cells (lane 1) or VZV-infected cells (lane3) and a CMV IE promoter driving CAT transfected into uninfected cells (lane5). CAT assays were performed in duplicate, and the average acetylation ofchloramphenicol (%CAT) showed that the VZV gene 21 promoter does notfunction in uninfected cells (2VZV) but is active in VZV-infected cells(1VZV). The amount of promoter activity in infected cells above that in unin-fected cells (fold) showed that gene 21 promoter activity was approximately650-fold higher in VZV-infected cells than in uninfected cells.

VOL. 72, 1998 VZV GENE 21 PROMOTER 45

on March 23, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

gene 21 transcripts appear as a single, discrete 3.1-kb band ondenaturing agarose gels. We produced antibodies in rabbitsdirected against VZV gene 21–glutathione S-transferase fusionproteins and located gene 21 protein predominantly in thecytoplasm as well as in the nucleus of productively infectedcells (29a). Although the protein encoded by VZV gene 21 hasnot been studied, it is homologous (47%) to HSV-1 UL37 (40),a 120-kDa phosphoprotein synthesized after the onset of virusDNA replication (1). In HSV-1-infected cells, UL37 is bothcytoplasmic and nuclear and incorporates into the tegument ofprogeny virions (31, 38). HSV-1 UL37 and ICP8 (the VZVgene 29 product homolog) form a DNA-binding complex (39,40).

During VZV latency, polyadenylated transcripts mapping toVZV gene 21 are present in human trigeminal ganglia (9, 12).While no animal model of VZV latency and reactivation cur-rently exists, simian varicella virus (SVV) infection in monkeysclosely mimics VZV infection in humans (18), and polyadenyl-ated transcripts corresponding to the SVV homolog of VZVgene 21 have been demonstrated in monkey ganglia latentlyinfected with SVV (7).

The consistent detection of VZV gene 21 transcripts in la-tently infected human ganglia (9, 10, 12) and its SVV homologin latently infected monkey ganglia (7) suggests that VZV gene21 is vital to the maintenance of varicella latency or that itstranscription is constitutive because cellular transcription fac-tors recognize the promoter. We have identified the VZV gene21 promoter and have shown that it is silent in uninfected cells,indicating that its activity depends upon a virus-induced pro-tein. We have further identified IE62 as the virus proteincapable of transactivating the VZV gene 21 promoter. Alongwith VZV gene 21 transcripts, polyadenylated transcripts map-ping to ORF 29 have been detected in latently infected human

ganglia (9, 32). Like the promoter for VZV gene 21, the VZVgene 29 promoter is silent in uninfected cells but is transacti-vated by VZV IE62 (33, 34). VZV IE62 is a promiscuoustransactivator that recognizes numerous VZV, HSV-1, humanimmunodeficiency virus, and cellular promoters (22, 23, 36).VZV IE62 DNA binding has been located to a nonpalindromicpentamer, ATCGT, and inspection of the VZV gene 21 pro-moter region shows this potential binding site for region II ofIE62 (4, 41, 42). However, deletion of the potential IE62 bind-ing site did not diminish the transactivation of gene 21 pro-moter by IE62. VZV IE62 transactivation has also been asso-ciated with the ubiquitously present cellular transcriptionfactor USF (34). However, the minimal VZV gene 21 pro-moter domain responsive to IE62 transactivation lacks theconsensus USF DNA binding sequence CACGTG. Thus, thepromoter for gene 21 may unlock a novel mechanism by whichIE62 maintains gene regulation.

ACKNOWLEDGMENTS

This work was supported in part by Public Health Service grants AG06127 and NS 32623 from the National Institutes of Health.

We thank Paul Kinchington for antisera against proteins encoded byVZV ORFs 4, 10, 61, and 62. We also thank Mary Devlin for editorialreview and Cathy Allen for preparation of the manuscript.

REFERENCES

1. Albright, A. G., and F. J. Jenkins. 1993. The herpes simplex virus UL37protein is phosphorylated in infected cells. J. Virol. 67:4842–4847.

2. Baudoux, L., P. Defechereux, S. Schoonbroodt, M.-P. Merville, B. Rentier,and J. Piette. 1995. Mutational analysis of varicella-zoster virus major im-mediate-early protein IE62. Nucleic Acids Res. 23:1341–1349.

3. Ben-Porat, T., and F. J. Rixon. 1979. Replication of herpesvirus DNA. IV.Analysis of concatemers. Virology 94:61–70.

4. Betz, J. L., and S. G. Wydoski. 1993. Functional interaction of varicellazoster virus gene 62 protein with the DNA sequence bound by herpessimplex virus ICP4 protein. Virology 195:793–797.

5. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979.Isolation of biologically active ribonucleic acid from sources enriched in

FIG. 6. 59 boundary of the gene 21 promoter. Duplicate CAT assays wereperformed on extracts of uninfected cells that had been transfected with CATreporter constructs containing either the entire 284-bp DNA segment separatingORF 20 and ORF 21 (p21), a 496-bp extension (p21Z), or various 59 truncationmutations (p21A, p21B, p21C, and p21D) in the presence of the IE62 expressionplasmid. The 59 boundary of the gene 21 promoter was located to a regionbetween nt 30585 (p21A) and nt 30626 (p21B). %CAT, average percent chlor-amphenicol acetylation; sd, standard deviation.

FIG. 5. The VZV gene 21 promoter is transactivated by IE62. CAT reporterplasmids, either promoterless (lane 1) or containing the 284-bp VZV ORF20-ORF 21 intergenic region (lanes 2 to 7) or the CMV IE promoter (lane 8),were transfected into cells either alone (lanes 1, 2, and 8) or with plasmidsexpressing various VZV transactivators (ORFs 4, 10, 61, 62, and 63) (lanes 3 to7). Duplicate CAT assays indicated that the VZV gene 21 promoter is transac-tivated by VZV IE62 but not by the proteins encoded by VZV genes 4, 10, 61,and 63. Transactivation of VZV gene 21 promoter by IE62 is ;42-fold higherthan VZV gene 21 promoter activity in the absence of IE62. %CAT, averagepercent chloramphenicol acetylation; sd, standard deviation.

46 COHRS ET AL. J. VIROL.

on March 23, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

ribonuclease. Biochemistry 18:5294–5299.6. Clarke, P., T. Beer, R. Cohrs, and D. H. Gilden. 1995. Configuration of latent

varicella zoster virus DNA. J. Virol. 69:8151–8154.7. Clarke, P., W. L. Matlock, T. Beer, and D. H. Gilden. 1996. A simian varicella

virus (SVV) homolog to varicella-zoster virus gene 21 is expressed in monkeyganglia latently infected with SVV. J. Virol. 70:5711–5715.

8. Cohen, J. J., and S. E. Straus. 1996. Varicella-zoster virus and its replication,p. 2525–2547. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fieldsvirology, 3rd ed. Lippicott-Raven, Philadelphia, Pa.

9. Cohrs, R., R. Mahalingam, A. N. Dueland, W. Wolf, M. Wellish, and D. H.Gilden. 1992. Restricted transcription of varicella-zoster virus in latentlyinfected human trigeminal and thoracic ganglia. J. Infect. Dis. 166(Suppl.1):S24–S29.

10. Cohrs, R. J., M. Barbour, and D. H. Gilden. 1996. Varicella-zoster virus(VZV) transcription during latency in human ganglia: detection of tran-scripts mapping to genes 21, 29, 62, and 63 in a cDNA library enriched forVZV RNA. J. Virol. 70:2789–2796.

11. Cohrs, R. J., M. B. Barbour, R. Mahalingam, M. Wellish, and D. H. Gilden.1995. Varicella-zoster virus (VZV) transcription during latency in humanganglia: prevalence of VZV gene 21 transcripts in latently infected humanganglia. J. Virol. 69:2674–2678.

12. Cohrs, R. J., K. Srock, M. B. Barbour, G. Owens, R. Mahalingam, M. E.Devlin, M. Wellish, and D. H. Gilden. 1994. Varicella-zoster virus (VZV)transcription during latency in human ganglia: construction of a cDNAlibrary from latently infected human trigeminal ganglia and detection of aVZV transcript. J. Virol. 68:7900–7908.

13. Croen, K. D., J. M. Ostrove, L. J. Dragovic, and S. E. Straus. 1988. Patternsof gene expression and sites of latency in human nerve ganglia are differentfor varicella-zoster and herpes simplex viruses. Proc. Natl. Acad. Sci. USA85:9773–9777.

14. Davison, A. J., and A. J. Scott. 1986. The complete DNA sequence ofvaricella-zoster virus. J. Gen. Virol. 67:1759–1816.

15. Debrus, S., C. Sadzot-Delvaux, A. F. Nikkels, J. Piette, and B. Rentier. 1995.Varicella-zoster virus gene 63 encodes an immediate-early protein that isabundantly expressed during latency. J. Virol. 69:3240–3245.

16. Felser, J. M., P. R. Kinchington, G. Inchauspe, S. E. Straus, and J. M.Ostrove. 1988. Cell lines containing varicella-zoster virus open reading frame62 and expressing the “IE” 175 protein complement ICP4 mutants of herpessimplex virus type 1. J. Virol. 62:2076–2082.

17. Gilden, D. H., and A. Vafai. 1989. Varicella-zoster, p. 229–247. In P. J.Vinken, G. W. Bruyn, and H. L. Klawans (ed.), Handbook of clinical neu-rology. Elsevier Science Publishing Co. Inc., New York, N.Y.

18. Gilden, D. H., R. Mahalingam, A. N. Dueland, and R. Cohrs. 1992. Herpeszoster: pathogenesis and latency. Prog. Med. Virol. 39:19–75.

19. Gilden, D. H., Y. Shtram, A. Friedmann, M. Wellish, M. Devlin, A. Cohen,N. Fraser, and Y. Becker. 1982. Extraction of cell-associated varicella-zostervirus DNA with Triton X-100-NaCl. J. Virol. Methods 4:263–275.

20. Graham, R. L., and A. J. van der Eb. 1973. A new technique for the assay ofinfectivity of human adenovirus 5 DNA. Virology 52:456–467.

21. Honess, R. W., and B. Roizman. 1974. Regulation of herpes simplex virusmacromolecular synthesis. I. Cascade regulation of the synthesis of threegroups of viral proteins. J. Virol. 14:8–19.

22. Inchauspe, G., and J. M. Ostrove. 1989. Differential regulation by varicella-zoster virus (VZV) and herpes simplex virus type-1 trans-activating genes.Virology 173:710–714.

23. Inchauspe, G., S. Nagpal, and J. M. Ostrove. 1989. Mapping of two varicella-zoster virus-encoded genes that activate the expression of viral early and lategenes. Virology 173:700–709.

24. Jackers, P., P. Defechereux, L. Baudoux, C. Lambert, M. Massaer, M. P.Merville-Louis, B. Rentier, and J. Piette. 1992. Characterization of regula-tory functions of the varicella-zoster virus gene 63-encoded protein. J. Virol.

66:3899–3903.25. Jacob, R. J., L. S. Morse, and B. Roizman. 1979. Anatomy of herpes simplex

virus DNA. XII. Accumulation of head-to-tail concatemers in the nuclei ofinfected cells and their role in the generation of the four isomeric arrange-ments of viral DNA. J. Virol. 29:448–457.

26. Kinchington, P. R., D. Bookey, and S. E. Turse. 1995. The transcriptionalregulatory proteins encoded by varicella-zoster virus open reading frames(ORFs) 4 and 63, but not ORF 61, are associated with purified virus parti-cles. J. Virol. 69:4274–4282.

27. Kinchington, P. R., J. K. Hougland, A. M. Arvin, W. T. Ruyechan, and J.Hay. 1992. The varicella-zoster virus immediate-early protein IE62 is a majorcomponent of virus particles. J. Virol. 66:359–366.

28. Kinchington, P. R., G. Inchauspe, J. H. Subak-Sharpe, F. Robey, J. Hay, andW. T. Ruyechan. 1988. Identification and characterization of a varicella-zoster virus DNA-binding protein by using antisera directed against a pre-dicted synthetic oligopeptide. J. Virol. 62:802–809.

29. Maguire, H. F., and R. W. Hyman. 1986. Polyadenylated, cytoplasmic tran-scripts of varicella-zoster virus. Intervirology 26:181–191.

29a.Mahalingam, R. Personal communication.30. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a

laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

31. McLauchlan, J., K. Liefkens, and N. D. Stow. 1994. The herpes simplex virustype 1 UL37 gene product is a component of virus particles. J. Gen. Virol.75:2047–2052.

32. Meier, J. L., R. P. Holman, K. D. Croen, J. E. Smialek, and S. E. Straus.1993. Varicella-zoster virus transcription in human trigeminal ganglia. Vi-rology 193:193–200.

33. Meier, J. L., and S. E. Straus. 1993. Varicella-zoster virus DNA polymeraseand major DNA-binding protein genes have overlapping divergent promot-ers. J. Virol. 67:7573–7581.

34. Meier, J. L., X. Luo, M. Sawadogo, and S. E. Straus. 1994. The cellulartranscription factor USF cooperates with varicella-zoster virus immediate-early protein 62 to symmetrically activate a bidirectional viral promoter. Mol.Cell. Biol. 14:6896–6906.

35. Ostrove, J. M., W. Reinhold, C.-M. Fan, S. Zorn, J. Hay, and S. E. Straus.1985. Transcription mapping of the varicella-zoster virus genome. J. Virol.56:600–606.

36. Perera, L. P., J. D. Mosca, W. T. Ruyechan, and J. Hay. 1992. Regulation ofvaricella-zoster virus gene expression in human T lymphocytes. J. Virol.66:5298–5304.

37. Reinhold, W. C., S. E. Straus, and J. M. Ostrove. 1988. Directionality andfurther mapping of varicella zoster virus transcripts. Virus Res. 9:249–261.

38. Schmitz, J. B., A. G. Albright, P. R. Kinchington, and F. J. Jenkins. 1995.The UL37 protein of herpes simplex virus type 1 is associated with thetegument of purified virions. Virology 206:1055–1065.

39. Shelton, L. S., A. G. Albright, W. T. Ruyechan, and F. J. Jenkins. 1994.Retention of the herpes simplex virus type 1 (HSV-1) UL37 protein onsingle-stranded DNA columns requires the HSV-1 ICP8 protein. J. Virol.68:521–525.

40. Shelton, L. S. G., M. N. Pensiero, and F. J. Jenkins. 1990. Identification andcharacterization of the herpes simplex virus type 1 protein encoded by theUL37 open reading frame. J. Virol. 64:6101–6109.

41. Tyler, J. K., and R. D. Everett. 1993. The DNA binding domain of thevaricella-zoster virus gene 62 interacts with multiple sequences which aresimilar to the binding site of the related protein of herpes simplex virus type1. Nucleic Acids Res. 21:513–522.

42. Wu, C. L., and K. W. Wilcox. 1991. The conserved DNA-binding domainsencoded by the herpes simplex virus type 1 ICP4, pseudorabies virus IE180,and varicella-zoster virus ORF62 genes recognize similar sites in the corre-sponding promoters. J. Virol. 65:1149–1159.

VOL. 72, 1998 VZV GENE 21 PROMOTER 47

on March 23, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from