Synergy of WEE1 and mTOR inhibition in mutant KRAS-

driven lung cancers

Josephine Hai1,2, Shengwu Liu1,2, Lauren Bufe1, Khanh Do1,2, Ting Chen1,3, Xiaoen Wang1,

Christine Ng4, Shuai Li1,2, Ming-Sound Tsao4, Geoffrey I. Shapiro1,2 and Kwok-Kin Wong1,2,3

1Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA2Department of Medicine, Harvard Medical School, Boston, MA, USA3Perlmutter Cancer Center, New York University Langone Medical Center, New York, New

York 10016, USA4Princess Margaret Cancer Centre/University Health Network, Toronto, ON, CA

Supplemental Methods

Supplemental Tables 1-4

Supplemental Figures 1-8

1

Supplemental Methods

Flow Cytometry

Apoptosis was determined using the Annexin V assay (Biolegend, San Diego, CA). After

treatment, cells were collected and stained with Annexin V-FITC and/or propidium iodide

solution as per the manufacturer’s protocol and analyzed by flow cytometry. Cell death was

recorded in a FACSCanto II (BD Biosciences, San Jose, CA) in the total population (10,000

cells) and data were analyzed using FlowJo (Ashland, OR).

Supplemental Tables Supplemental Table 1. sgRNA and PAM sequences

Target gene sgRNA ID Target sequence (5’ to 3’) PAM Region

LacZ sglacZ TGCGAATACGCCCACGCGAT CGG  

CCND1 D1_A GTCGTTGAGGAGGTTGGCAT CGG Exon 1

CCND1 D1_B TGTTCCTCGCAGACCTACGG AGG Exon 2

CCND1 D1_C ACATTTGAAGTAGGACACCG AGG Exon 1

Supplemental Table 2. The IC50 values for AZD2014 and AZD1775 in NSCLC cellsSingle agent Combination

IC50 (nM) AZD2014:AZD1775 (1:3.75) IC50 (nM)

Cell line KRAS AZD2014 AZD1775 AZD2014 AZD1775A427 mutant 12270 833 27 102H23 mutant 4114 499 54 203

H441 mutant 445 1262 65 245H460 mutant >20000 4800 160 588

H1355 mutant 236 790 60 250H2009 mutant 421 755 68 278

PDX239 mutant 640 2411 62 226PDX277 mutant 37 224 15 58PDX462 mutant 106 753 27 101PDX267 WT 246 111 30 113

HCC4006 WT 450 8961 319 1198H1975 WT 64 979 63 236H3255 WT 99 997 93 350H1650 WT 996 1434 213 800

HCC827 WT 17 271 15 39

2

Supplemental Table 3. Mutational status of human cell line models.Model Type TP53 EGFR RAS STK11 CDKN2A

A427 NSCLC WT WT K G12D mutant mutantH1355 AD mutant WT K G13C mutant MetH23 AD mutant WT K G12C mutant MetH460 LC WT WT K Q61H mutant mutantH2009 AD mutant WT K G12A WT WTH358 AD Null WT K G12C WT WTCalu1 NSCLC Null WT K G12C WT MetHCC827 AD mutant E746 - A750del WT WT WTHCC4006 AD mutant L747 - E749del WT WT HDH1975 AD mutant T790M, L858R WT WT mutantH3255 AD mutant L858R WT WT HDH1650 AD mutant E746_A750del WT WT HDH441 AD mutant WT K G12V WT WTPDX239 ADC WT WT K G12C n/a n/aPDX277 ADC WT WT K G12C n/a n/aPDX267 SCC n/a WT WT n/a n/aPDX462 SCC n/a WT K G12S n/a n/a

Abbreviations: AD: adenocarcinoma; WT: wild-type; HD: homozygous deletion; Met: methylation; n/a: not available.

3

Supplemental Table 4. CalcuSyn combination indices.Combination indices AUC AZD2014 AUC AZD1775 AUC combo

KRAS Status ED50: ED75: ED90:

AU

C

Std.

Err

or

95%

CI

AU

C

Std.

Err

or

95%

CI

AU

C

Std.

Err

or

95%

CI

PDX462 Mutant 0.832 0.939 1.111 8520 562.2 7419 to 9622 8705 700.6 7332 to 10078 6843 690.4 5490 to 8196

PDX277 Mutant 0.613 1.221 2.659 7452 403.5 6661 to 8243 7425 760.4 5935 to 8915 5210 449.8 4328 to 6091

PDX239 Mutant 0.27 0.423 0.662 10277 293.8 9701 to 10853 9247 321.2 8617 to 9876 8140 241.1 7667 to 8612

H460 Mutant 0.461 0.432 0.416 8820 159.3 8508 to 9132 9267 227.2 8821 to 9712 7498 273.1 6963 to 8034

H441 Mutant 0.784 1.839 4.327 9830 223.6 9392 to 10268 8967 193.6 8588 to 9347 7221 303.1 6627 to 7815

H358 Mutant 1.492 2.074 3.388 7333 127.5 7083 to 7583 9137 236.8 8673 to 9601 7217 78.32 7063 to 7370

H23 Mutant 0.837 0.782 0.733 9170 107.2 8960 to 9380 9270 121.2 9032 to 9508 7617 132.5 7357 to 7876

H2009 Mutant 0.201 0.026 0.004 7218 730.7 5786 to 8650 7218 730.7 5786 to 8650 5883 223.5 5445 to 6321

H1355 Mutant 0.873 0.708 0.607 9087 60.55 8968 to 9205 9290 83.86 9126 to 9454 8467 52.28 8364 to 8569

Calcu1 Mutant 1.038 0.834 0.843 7257 188.7 6887 to 7626 9747 169.5 9414 to 10079 7473 159 7162 to 7785

A427 Mutant 0.413 0.584 0.831 9685 295 9107 to 10263 8993 392 8225 to 9762 7310 73.48 7166 to 7454

PDX267 WT 1.328 2.119 3.559 9720 160.8 9405 to 10035 6800 184.1 6439 to 7161 6617 199.8 6225 to 7008

HCC827 WT 1.065 1.901 5.725 5103 196.5 4718 to 5488 8103 255.7 7602 to 8605 4793 153.2 4493 to 5094

HCC4006 WT 547.498 4122.565 31045 8797 80 8640 to 8953 10013 198.7 9624 to 10403 8867 149.9 8573 to 9160

H3255 WT 1.864 2.447 5.45 7187 331.3 6537 to 7836 10063 144 9781 to 10346 7577 192.3 7200 to 7954

H1975 WT 1.364 1.6 2.703 7197 43.2 7112 to 7281 10537 73.48 10393 to 10681 7437 94.52 7251 to 7622

H1650 WT 1.229 1.354 2.249 7170 128.1 6919 to 7421 10220 100.3 10023 to 10417 7737 86.41 7567 to 7906

Abbreviations: AUC:: area under the curve.

4

Supplemental Figures

Supplemental Figure 1. Dose response curves. Exponentially growing cell lines were incubated with AZD2014, AZD1775 or in combination for three days. AZD2014 and AZD1775 was combined at 1:3.75 constant ratio and dose response curves are shown separately.

Supplemental Figure 2. Combined mTOR and WEE1 inhibition induces synergistic apoptotic caspase activity. (A) Representative live time-course imaging used to detect the mean number of caspase3/7-positive cells induced under treatment on H23 cells. Each time point represents 3 wells in duplicates (n=6). (B) Number of caspase3/7 positive cells of the course of treatment on H23 cells. Scale bar: 400µm.

5

Suppplemental Figure 3. Combination treatment suppresses human KRAS-driven tumor xenografted growth. No toxicity events were observed in mice treated with single agent or dual therapy as compared to control cohort. Treatment-induced toxicity is characterized by a decrease in body weight to 15% or below (dotted line) relative to pretreatment weight. Data points represent mean animal weights of treatment cohort.

6

Supplemental Figure 4. Mice with active KRAS-driven lung cancer show significant tumor response upon dual AZD1775 and AZD2014 therapy. (A) Effect of dual treatment on rate of tumor growth from week one to three. (B) Waterfall plot indicating the percent tumor burden of mice treated with vehicle, AZD2014 alone, AZD1775 alone or combination at week 2. (C) No toxicity events were observed in mice treated with dual therapy as compared to control cohort. Treatment-induced toxicity is characterized by a decrease in body weight to 15% or below (dotted line) compared to pretreatment weight. Data points represent mean animal weights of treatment cohort. (ns: not significant, p>0.05)

7

Supplemental Figure 5. Rad51 foci-forming ability of NSCLC cells in response to gemcitabine and etoposide treatment.Cells were assayed for subnuclear foci of Rad51 as a surrogate for HR proficiency by immunofluorescence. Mean percent of cells containing RAD51 foci treated with indicated drugs in A427 (A), H23 (B) and H1355 (C) cells over three experiments. Cells were dosed as follows: 20ug/ml of gemcitabine, 10ug/ml of etoposide, 80nM AZD2014 and 0.01% DMSO (vehicle) for 48 hours. The p-values were calculated using one-way ANOVA with post Tukey testing. Representative Rad51 foci-containing H1355 cells treated with indicated drugs are shown on the right panel. Scale bar: 10µm.

8

Supplemental Figure 6. Ectopic expression of LKB1 is sufficient to overcome the loss of the LKB1-mediated sensitization to dual AZD2014 and AZD1775 therapy. (A) Flow cytometry analysis was used on H1355 and H23 expressing either empty vector (EV) control, human wild-type (WT) LKB1, or kinase-dead (KD) LKB1 to detect Annexin-V and propidium iodide staining after treatment with either AZD2014 (80nM), AZD1775 (300nM), or combination for 48 hours. (B) Representative flow cytometry plots of H23 cells treated with indicated drugs.

9

Supplemental Figure 7. Loss of LKB1 in KRAS-mutant cell lines confers partial resistance to dual WEE1 and mTOR therapy. (A) Western blot analyses on H1355 and H23 expressing either empty vector (EV) control or human wild-type (WT) LKB1 showed changes in H2AX, pS5 and pAKT protein levels after treatment with either AZD2014 (80nM), AZD1775 (300nM), or dual therapy for 48 hours. (B) Dose-response curves of H1355 cells expressing either EV or LKB1-WT untreated or treated with indicated therapy for three days.

10

Supplemental Figure 8. Ectopic expression of LKB1 is sufficient to overcome the loss of the LKB1-mediated sensitization to dual AZD2014 and AZD1775 therapy. Detection of Rad51, γ-H2AX and DAPI by immunofluorescence in H23 cells expressing empty vector (EV) or wild-type LKB1 (WT), untreated or treated with either AZD2014 (80nM), AZD1775 (300nM), or in combination. Representative foci-containing cells are shown at high power magnification (100x).

11