INFECTION AND IMMUNITY, Jan. 2010, p. 400–412 Vol. 78, No. 10019-9567/10/$12.00 doi:10.1128/IAI.00533-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Virulence, Inflammatory Potential, and Adaptive ImmunityInduced by Shigella flexneri msbB Mutants�†

Ryan T. Ranallo,1#* Robert W. Kaminski,1# Tonia George,1‡ Alexis A. Kordis,1 Qing Chen,1§Kathleen Szabo,2¶ and Malabi M. Venkatesan1

Division of Bacterial and Rickettsial Diseases, Walter Reed Army Institute of Research, Silver Spring, Maryland 20910,1 andDivision of Diagnostic Pathology, Walter Reed Army Institute of Research, Silver Spring, Maryland 209102

Received 13 May 2009/Returned for modification 26 June 2009/Accepted 22 October 2009

The ability of genetically detoxified lipopolysaccharide (LPS) to stimulate adaptive immune responses is anongoing area of investigation with significant consequences for the development of safe and effective bacterialvaccines and adjuvants. One approach to genetic detoxification is the deletion of genes whose products modifyLPS. The msbB1 and msbB2 genes, which encode late acyltransferases, were deleted in the Shigella flexneri 2ahuman challenge strain 2457T to evaluate the virulence, inflammatory potential, and acquired immunityinduced by strains producing underacylated lipid A. Consistent with a reduced endotoxic potential, S. flexneri2a msbB mutants were attenuated in an acute mouse pulmonary challenge model. Attenuation correlated withdecreases in the production of proinflammatory cytokines and in chemokine release without significantchanges in lung histopathology. The levels of specific proinflammatory cytokines (interleukin-1� [IL-1�],macrophage inflammatory protein 1� [MIP-1�], and tumor necrosis factor alpha [TNF-�]) were also signif-icantly reduced after infection of mouse macrophages with either single or double msbB mutants. Surprisingly,the msbB double mutant displayed defects in the ability to invade, replicate, and spread within epithelial cells.Complementation restored these phenotypes, but the exact nature of the defects was not determined. Acquiredimmunity and protective efficacy were also assayed in the mouse lung model, using a vaccination-challengestudy. Both humoral and cellular responses were generally robust in msbB-immunized mice and affordedsignificant protection from lethal challenge. These data suggest that the loss of either msbB gene reduces theendotoxicity of Shigella LPS but does not coincide with a reduction in protective immune responses.

Shigellosis, or bacillary dysentery, is an acute colitis causedby Shigella flexneri, a gram-negative enteroinvasive bacteriumthat is transmitted to humans via the fecal-oral route. Shigellatriggers its uptake into the M cells of the lower intestine, wherethey are taken up by the underlying antigen-presenting cells(macrophages and dendritic cells) (18). Shigella bacteria arereleased from macrophages after inducing cell death (12, 29)and invade the surrounding enterocytes, where they begin tomultiply and spread to adjacent cells. Effector proteins se-creted through a molecular-needle-like complex called thetype III secretion system (TTSS) mediate the processes ofmacrophage cytotoxicity, enterocyte invasion, and modulationof the host cell immune response. The TTSS and associatedeffector proteins are encoded on a large virulence plasmid thatis present in all invasive strains of Shigella (46). During repli-cation and dissemination in host cells, components of the bac-

terial cell wall (lipopolysaccharide [LPS] and peptidoglycan)are released, inducing proinflammatory cytokines and chemo-kines which activate the innate immune response (reviewed inreference 31). Although the immune mechanisms of protectionremain relatively undefined, previous infection with one sero-type of Shigella confers a high level of protection from rein-fection with a homologous serotype, suggesting that LPS is akey protective antigen (13).

Lipid A is a bioactive component of LPS and serves toanchor it in the outer membrane through hydrophobic inter-actions involving fatty acids, such as laurate and myristate. InShigella, Escherichia coli, and Salmonella enterica serovar Ty-phimurium, the htrB and msbB gene products function as latefatty acyltransferases and are therefore responsible for thefinal steps of assembling hexa-acylated lipid A (5, 6). Theresults of several studies have indicated that inactivation ofhtrB leads to morphological changes, such as bulging and fila-mentation, as well as a conditional lethal phenotype at tem-peratures above 33°C (22). In contrast, deletion of the msbBgene in E. coli K-12 reduces lipid A acylation without causingobservable phenotypes (39). Moreover, purified LPS from anE. coli msbB mutant induced significantly less tumor necrosisfactor alpha (TNF-�) from adherent monocytes and had areduced ability to stimulate E-selectin production by humanendothelial cells (39). The characteristics of E. coli msbB mu-tants encouraged investigations into using msbB mutants ofother bacteria to produce live bacterial vaccines or other ther-apeutics which contain less-toxic LPS (42). Since this initialreport, msbB homologues have been characterized in manydifferent pathogenic bacteria, including Shigella spp., Salmo-

* Corresponding author. Mailing address: Division of Bacterial andRickettsial Diseases, Walter Reed Army Institute of Research, SilverSpring, MD 20910. Phone: (301) 319-9517. Fax: (301) 319-9801. E-mail:ryan.ranallo@amedd.army.mil.

† Supplemental material for this article may be found at http://iai.asm.org/.

# These authors contributed equally.‡ Current address: Boehringer Ingelheim Vetmedica, Inc., St. Jo-

seph, MO 64506.§ Current address: Division of Bacterial, Parasitic, and Allergenic

Products, Center for Biologics Evaluation and Research, Food andDrug Administration, Bethesda, MD 20892.

¶ Current address: Charles River Laboratories, Frederick, MD21701.

� Published ahead of print on 2 November 2009.

400

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

nella spp., Neisseria spp., Yersinia pestis, Klebsiella pneumoniae,and enterohemorrhagic E. coli (EHEC) (1, 4, 9, 23, 24, 33).All of these investigations have led to a general consensus thatthe deletion of late acyltransferases, such as msbB, results inpathogen attenuation due to underacylated or less-toxic lipidA. Interestingly, some of these reports also suggest that changesin lipid A acylation can affect virulence by influencing outermembrane function, including TTSS-mediated protein secre-tion and cell division (4, 28, 32, 40, 49).

Among enteric pathogens, Shigella and EHEC are uniquebecause they contain a second functional paralog of the msbBgene (msbB2) (2, 46). The msbB2 gene in both Shigella andEHEC is situated within the shf-wabB-virK (ecf3)-msbB2 locusfound on the virulence plasmids of each organism. In S. flexneri2a, the msbB2 gene appears to be transcriptionally regulated byPhoPQ in response to magnesium concentration (14). Thisdifferential regulation may be a mechanism by which lipid Amodifications contribute to Shigella pathogenesis, but this hasnot been demonstrated directly. Loss of either msbB gene in S.flexneri reduces the amount of hexa-acylated lipid A understandard growth conditions, indicating that neither paralog isfunctionally redundant (9, 14). Loss of both msbB genes in adifferent background (S. flexneri 5) results in mostly penta-acylated lipid A, which correlates with a dramatic reduction inboth TNF-� production and histopathology in infected rabbitileal loops. Infection of rabbit ileal loops with an msbB singlemutant leads to a less dramatic but still significant level ofattenuation compared to the virulence of wild-type strains (9).

Several other studies have demonstrated the feasibility ofgenerating less-endotoxic LPS through deletion of the msbBgene (4, 23, 25, 40, 44, 49). Collectively, they demonstrate adirect correlation between loss of msbB and reduced innateimmune responses; however, few have measured the adaptiveimmune responses in the context of live attenuated bacterialvaccines (25). To address the relationship between the inflam-matory potential and adaptive immunity induced by ShigellamsbB mutants, a series of S. flexneri 2a mutants were con-structed which lack either one or both copies of the msbB gene.The studies described herein represent the first comprehensiveimmunological evaluation of S. flexneri msbB mutants andidentify a strategy for incorporating these mutations into liveattenuated S. flexneri vaccine strains.

MATERIALS AND METHODS

Bacterial strains and growth conditions. Shigella strains were propagated at37°C on tryptic soy agar (TSA) plates containing 0.2% galactose and 0.005%(wt/vol) Congo red (CR). The wild-type S. flexneri 2a strain 2457T (10) is part ofthe Walter Reed Army Institute of Research (WRAIR) collection of virulentstrains. 2457T-CR is a S. flexneri 2a strain which has spontaneously lost the largeinvasion plasmid and was selected as a white colony on CR agar plates. Loss ofthe invasive phenotype for 2457T-CR was confirmed by colony immunoblot usingIpaB (2F1) (27) antibodies and gentamicin protection assays (described below).

Deletion of the msbB1 and msbB2 genes in the S. flexneri 2a strain 2457T. TheS. flexneri 2a strains carrying single deletions in the msbB1 (WR10) and msbB2(WR20) genes were made in 2457T as previously described (34). In an earlierreport, WR10 and WR20 were referred to as 2457T(�msbB1) and2457T(�msbB2), respectively. The WR30 strain used throughout all of our stud-ies was constructed from WR20 by deleting the msbB1 gene. However, a secondversion of WR30 was constructed from WR10 and used to confirm phenotypesobserved in the plaque assays. Thus, both WR10 and WR20 were independentlyused to generate strain WR30, with deletions of both the msbB1 and msbB2 gene.All gene deletions were performed by lambda red recombineering using proto-

cols that we described previously (34). PCR from genomic DNA using twodifferent primer sets was used to confirm each deletion.

Plasmid construction. A plasmid containing the msbB1 gene was constructedusing pBR322 as a starting vector (New England BioLabs [NEB], Beverly, MA).The msbB1 open reading frame, including 320 bp upstream and 150 bp down-stream, was amplified from Shigella genomic DNA by using PCR. Both PCRprimers (5� msbB1.BamHI, ATACGCGGATCCCCACGCGTATTTTAACGGTA, and 3� msbB1.BamHI, ATACGCGGATCCGTGAAACGTGGCGACCGTAT) were designed to introduce a BamHI site, which was used to insert thePCR fragment into the BamHI site of pBR322, creating pmsbB1. The pmsbB1plasmid was verified using multiple restriction enzyme digestions.

Cellular invasion and plaque assays. Invasion assays or gentamicin protectionassays were done using confluent (�90%) HeLa cell monolayers (CCL-2;ATCC) cultured overnight in 8-well chamber slides (Lab-Tek Chamber SlideSystem) using minimal essential medium supplemented with 10% fetal bovineserum (FBS) and L-glutamine (cMEM). Cells were infected with log-phase bac-terial cultures at a multiplicity of infection (MOI) of �50 as determined bymeasurements of optical density at 600 nm (OD600), followed by plating on TSAplates. Infected cells were incubated in a humidified CO2 incubator at 37°C for1.5 h, washed three times with Hank’s balanced salt solution (HBSS), andincubated in cMEM containing 50 �g/ml of gentamicin for 2 h. Cells werewashed with HBSS, fixed with 100% methanol, and stained with Giemsa stain.Infected cells were observed under �180 magnification using a bright-field mi-croscope. The ratio of infected cells (containing at least 1 bacterium) to nonin-fected cells was determined for each experiment. An average of 886 HeLa cellswere counted for each strain per invasion assay. Additional invasion experimentsperformed in 24-well plates were designed to evaluate bacterial uptake and didnot include a gentamicin incubation step (see Fig. S3 in the supplemental ma-terial). HeLa cells were infected using an MOI of 100, incubated for 45 min asdescribed above, and then washed 10 times with HBSS. An aliquot of the lastHBSS wash was plated to LB agar in order to enumerate the extracellularbacteria remaining after washing. Intracellular bacteria were recovered by lysingthe HeLa cells using 0.1% Triton X-100. The number of intracellular bacteriawas determined by subtracting the number of extracellular bacteria from thetotal number recovered from lysed cells. The data presented in Table 3 and thesupplemental material (see Fig. S3) represent the average levels of invasion from3 to 4 independent experiments.

Plaque assays were carried out using BHK-21 (CCL-10; ATCC) cells as de-scribed previously (34). Plaquing efficiency was calculated in assays using MOIsthat ranged from 5.0 to 5.0 � 10�3. MOIs were determined as described above.Average plaque sizes were determined using 10 plaques per strain (72 h postin-fection) from two separate experiments, using a Finescale Comparator (Fines-cale, Inc., Orange, CA).

Macrophage infections and in vitro cytokine measurements. Macrophage in-fection assays were done as previously described, with a few modifications (35).J774A.1 (TIB-67; ATCC) macrophages were grown in RPMI 1640 supplementedwith 10% FBS and 2 mM L-glutamine (cRPMI) and used to seed a 96-well plate.After overnight growth, cells representing a monolayer were washed using freshcRPMI and infected (in triplicate) with log-phase cultures of each strain, usingMOIs of 2.0 and 0.2 as determined by plating and OD600 measurements. Afterthe addition of bacteria, the 96-well plate was centrifuged (1,500 � g) and placedat 37°C, and culture supernatants were removed at different times (0, 120, 180,and 240 min) after infection. Wells that did not receive bacteria served as anegative control for spontaneous lysis. Lactate dehydrogenase (LDH) activitywas measured from freshly harvested supernatants and used to estimate thepercent cellular cytotoxicity according to the manufacturer’s instructions (Pro-mega, Madison, WI). The assay was performed three times, and the data (%cytotoxicity) were averaged and plotted as a function of time. Additional aliquotsof culture supernatant from each macrophage infection assay were stored(�20°C) and later analyzed for the presence of three different proinflammatorycytokines (interleukin-1 [IL-1], macrophage inflammatory protein 1� [MIP-1�], and TNF-�). Cytokine levels from culture supernatants were measuredusing a quantitative enzyme-linked immunosorbent assay (ELISA) accordingto the manufacturer’s recommendations (R&D Systems, Minneapolis, MN). Apreliminary kinetic analysis revealed that each cytokine reached a maximum levelat different time points (data not shown). Therefore, the concentrations ofindividual cytokines were measured prior to saturation. The cytokine levelsreported represent the averages from three independent experiments.

Intraconjunctival challenge assay (Sereny test). Shigella strains used in theSereny test were assayed for invasiveness using an in vitro gentamicin protectionassay as described above. The bacteria recovered were subcultured and preparedfor ocular inoculation as previously described (35). For each strain tested, 4 maleHartley guinea pigs (�250 to 300 g; purchased from Charles River Laboratories)

VOL. 78, 2010 CHARACTERIZATION OF S. FLEXNERI msbB MUTANTS 401

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

were sedated with a mixture of ketamine (10 to 35 mg/kg) and xylazine (2 to 5mg/kg), and the conjunctival sac of the eye was inoculated with 25 �l of abacterial suspension containing 1.25 � 107 to 2.0 � 107 CFU. Guinea pigsreceiving 2457T were inoculated in one eye (a total of 4 eyes), while guinea pigsreceiving WR10, WR20, or WR30 were inoculated in both eyes (a total of 8 eyesper strain). Using saline-inoculated eyes as a control, the level of inflammationfor all animals was monitored for 5 days. The level of inflammation for eachanimal was rated numerically on day 3 using the following scale, modified slightlyfrom the original publication: 0, no disease or mild conjunctivitis; 1, mild kera-toconjunctivitis or late development and/or rapid clearing of disease; 2, kerato-conjunctivitis with multifocal punctate corneal ulcerations and minimal oculardischarge; and 3, fully developed keratoconjunctivitis with purulence, copiousocular discharge, and corneal ulcerations affecting the entire cornea (16). Re-search was conducted in compliance with the Animal Welfare Act and otherfederal statutes and regulations relating to experiments involving animals andadhered to principles stated in the Guide for the Care and Use of LaboratoryAnimals (28a).

In vivo immunogenicity and challenge studies. (i) Challenge studies. Bacterialsuspensions used to inoculate mice were prepared from frozen stocks made fromshaken broth cultures incubated at 37°C in LB. Bacteria were harvested duringearly log phase (OD600 of 0.2 to 0.3), suspended in M9 salts containing 15%glycerol, and quickly frozen in liquid nitrogen. Each stock (2457T, WR10, WR20,and WR30) was very similar with respect to CFU and percentage of CR-positivecolonies. Accurate dosing was accomplished through dilution (in 0.9% saline) ofeach stock prior to inoculation. Six- to eight-week-old BALB/cJ (Jackson Lab-oratories, Bar Harbor, ME) female mice (n 6 to 8 mice/group) were anesthe-tized intramuscularly with a 50-�l injection of ketamine HCl (90 mg/kg of bodyweight) and xylazine (10 mg/kg). Shigella strains were administered intranasally(2.5 � 107 or 5 � 107 CFU/mouse) in 30-�l volumes as small droplets to theexternal nares. Mice were evaluated for death twice daily for 3 days (72 hpostinoculation). Mice that remained after 72 h were euthanized and processedfor colonization and cytokine production assays and histopathology as describedbelow. Challenge studies were performed twice for lethality and cytokine mea-surements and once for colonization assays and histology. Lung histopathologywas performed on tissue that was harvested from the chest cavity, inflated with10% neutral buffered formalin (NBF), and fixed in NBF for 4 days. The tissueswere paraffin embedded, sectioned at 5 �m, mounted on a glass slide, andstained with hematoxylin and eosin (H&E). Quantification of the histologicalexamination was based on criteria outlined elsewhere (3) and included thequantification (using a score of 0 to 4) of six different parameters. These para-meters included the thickening of the interstitium, desquamation of the intra-alveolar epithelium, degree of mucopurulent exudate in the airways, number ofneutrophils and mononuclear cells per field (�400 magnification), and degree ofbronchus-associated lymphoid tissue activation. Bacterial colonization in lungtissue after challenge was determined by placing tissue samples in 5 ml of coldphosphate-buffered saline (PBS), pH 7.2, and homogenizing them to dislodgebacteria. Tenfold serial dilutions of the homogenate were plated on LB agarplates and incubated at 37°C. Cytokine production in lung tissue was assessed bywashing the mouse lungs with 2 ml of lavage fluid containing PBS supplementedwith a protease inhibitor cocktail for mammalian tissues (Sigma). The lung washwas centrifuged at 1,200 � g, and the supernatant analyzed by Luminex-basedmultiplex (22-plex) immunoassay to determine the concentrations of granulocytecolony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulatingfactor (GM-CSF), IFN-�, IL-10, IL-12, IL-13, IL-15, IL-17, IL-1�, IL-1, IL-2,IL-4, IL-5, IL-6, IL-7, IL-9, IP-10, KC, MCP-1�, MIP-1�, RANTES, and TNF-�,following the manufacturer’s recommendations (LINCO Research, Inc., St.Charles, MO).

(ii) Immunogenicity and protection studies. Adaptive immune responses wereassessed using a vaccination-challenge study in which groups (n 20 mice/group) of BALB/cJ mice were administered Shigella strains intranasally (3 � 105

CFU/mouse) on days zero and 21 as described above. Each group of micereceived 2457T, WR10, WR20, or WR30. Control mice were inoculated with 30�l of 0.9% saline. Animals were bled by tail snip on days zero, 14, 28, and 42.Lung and intestinal wash fluids were collected on day 35 from 5 mice/group aspreviously described (21). Splenocytes from individual mice (n 5/group) wereaseptically removed and homogenized to create single-cell suspensions, contam-inating red blood cells were lysed, and splenocytes were diluted to 1 � 106

cells/ml for use in proliferation assays (see below). Four weeks after the lastimmunization (day 49), the remaining animals (15/group) were challenged witha lethal dose (1.2 � 107 CFU) of 2457T. Mice were monitored for weight loss(data not shown) and death for 14 days. Antigen-specific antibody responses insera and mucosal wash samples were assessed by ELISA as previously described(21). The coating concentrations of the various antigens plated at 50 �l/well were

Invaplex 50 (1 �g/ml), S. flexneri 2a strain 2457T LPS (20 �g/ml), IpaB (1 �g/ml),and IpaC (4 �g/ml). The Shigella invasin complex (Invaplex) is isolated fromwater extracts of S. flexneri 2a (2457T) using column chromatography, and themain constituents are LPS, IpaB, and IpaC (43). Sample endpoint titers weredetermined for individual animals as the reciprocal maximum dilution at whichthe mean OD405 of duplicate samples was greater than twice the mean plus 10standard deviations of the results for casein-only controls or 0.2, whichever washigher. S. flexneri 2a Invaplex-specific serum immunoglobulin G1 (IgG1) andIgG2a responses were assessed as a measure of Th1 and Th2 responses aspreviously described (21). Cellular proliferation after in vitro restimulation ofmurine splenocytes with S. flexneri 2a Invaplex 24 (5 �g/ml) or S. flexneri 2a LPS(1 �g/ml) was assessed using a nonradioactive method as previously described(21). Cell culture supernatants collected after 5 days of in vitro antigenic stim-ulation were assessed for Th1 and Th2 cytokine production using a Luminex-based multiplex bead assay according to the manufacturer’s directions (Bio-Source, Camarillo, CA). The concentrations of each cytokine were determinedfrom a standard curve run in parallel with unknowns.

Statistical analysis. All statistical comparisons were performed using Prism 4for Macintosh (GraphPad, San Diego, CA). Invasion assay data were analyzed bycomparing the mean invasion rate for three separate assays using a one-wayanalysis of variance (ANOVA) followed by Bonferroni’s multiple-comparisonposttest. Endpoint titers from ELISA experiments were log transformed, and atwo-way ANOVA or a one-sample t test was performed to detect differencesbetween groups. P values for all cytokine analysis were determined using one-wayANOVA followed by Bonferroni’s multiple-comparison posttest. Survival ratesafter challenge were analyzed using the log-rank test. P values of �0.05 wereconsidered significant. The median lethal dose (LD50) was estimated using aprobit analysis based on the SAS system.

RESULTS

Construction of msbB mutants in S. flexneri 2a strain 2457T.The S. flexneri msbB genes encode late acyltransferases shownto be essential for hexa-acylation of lipid A (9, 14). Deletion ofthese genes, either separately or in combination, producesShigella strains that induce less TNF-� production from humanmonocytes and are significantly attenuated in a rabbit ilealloop model (9). A series of isogenic deletion mutants wereconstructed in the S. flexneri 2a strain 2457T in order to eval-uate the role of msbB in a virulent human challenge strain. Themutants lacked the chromosomally encoded msbB1 (WR10),the plasmid-borne msbB2 (WR20), or both copies of the msbBgene (WR30) (Table 1). Routine propagation of WR30 in LBrevealed that this strain grew slightly more slowly than the wildtype when incubated at 37°C (see Fig. S1 in the supplementalmaterial). This was unexpected, because previous investiga-tions of S. flexneri msbB mutants did not report growth defectsafter deletion of both msbB genes (9, 14). However, the growthphenotype of WR30 is consistent with that of Salmonella,where deletion of msbB induced growth defects, including slowgrowth, filamentation, and sensitivity to MacConkey agar (28).Indeed, it was found that WR30 was sensitive to growth onMacConkey plates and was filamentous (�10 to 30% of totalbacteria) during log-phase growth at 37°C (data not shown).These phenotypes were complemented after transformation ofWR30 with a low-copy-number plasmid containing the msbB1gene (pmsbB1), indicating that the defects were not related tosecondary mutations introduced during strain construction(data not shown).

Virulence and inflammatory potential of Shigella msbB mu-tants in a murine pulmonary model. The mouse pulmonarymodel is useful for assessing the virulence and inflammatorypotential of Shigella strains, including but not limited to theproduction of soluble cytokines, lung colonization, and acutelethality due to necrosuppurative bronchoalveolar pneumonia

402 RANALLO ET AL. INFECT. IMMUN.

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

(3, 45). Each S. flexneri msbB mutant was assayed in this model,using a dose that is 100% lethal for wild-type Shigella 72 h afterinfection (Table 2). This same dose (5 � 107 CFU) only pro-duced 37 to 50% lethality using either single or double msbBmutant strains. A similar trend was observed using a lowerdose of bacteria (2.5 � 107 CFU), which caused 25% lethalityusing 2457T and 0 to 6% for the msbB derivatives. All Shigellastrains colonized the lung tissue at similar levels, with onlyslight reductions for the msbB mutants (Table 2).

The inflammatory and immunostimulatory potential of eachmsbB mutant was evaluated by comparing cytokine levels inlung wash fluids of mice 72 h after inoculation with 2.5 � 107

CFU of S. flexneri 2a 2457T, WR10, WR20, or WR30. Thecytokines evaluated included hallmarks of inflammation (IL-1�, IL-1, IL-6, MIP-1�, TNF-�, G-CSF, and GM-CSF), cy-tokines involved in chemotaxis (IP-10, KC, MCP-1, IL-17, andRANTES), and immunomodulatory cytokines [IFN-�, IL-10,IL-12(p70), IL-13, IL-15, IL-2, IL-4, IL-5, IL-7, and IL-9].

The levels of IL-9, IL-4, IL-2, Il-10, GM-CSF, IL-17, and KCwere not elevated in any of the groups inoculated with saline orbacteria (data not shown). The levels of IL-5, IFN-�, IL-1�,IL-12, IL-6, IL-13, and TNF-� were elevated in groups inocu-lated with 2457T, WR10, WR20, or WR30 compared with thelevels in saline-inoculated mice, but no significant differenceswere detected between groups inoculated with 2457T and themsbB mutants (Fig. 1 and data not shown). The concentrationsof immunomodulatory cytokines in lung wash fluids were lowfor all cytokines measured and comparable between groupsinoculated with saline, 2457T, or the msbB mutants, with theexception of IL-7 and IL-15, which were significantly decreasedin mice inoculated with the msbB mutants compared to theirlevels in 2457T-inoculated mice (Fig. 1).

Of the inflammatory cytokines measured, significantly lowerconcentrations of MIP-1�, IL-1, and G-CSF were found inthe lungs of mice inoculated with msbB mutants compared tothe concentrations in the lungs of mice inoculated with 2457T(Fig. 1), indicating a lower inflammatory potential of the msbB

mutants at the 72-h time point. Inoculation of mice with2457T induced high levels of the chemotactic cytokines IP-10, Rantes, and MCP-1, which were significantly reduced inmice inoculated with some msbB mutants (Fig. 1). Collec-tively, the results of the cytokine analysis demonstrate thatthe msbB mutants induced lower levels of proinflammatoryand chemotactic cytokine production than inoculation withwild-type bacteria.

Histological analysis of infected mouse lung tissue was alsoconducted and scored using criteria outlined elsewhere (3).As expected, lung tissue in the wild-type Shigella inoculationgroup had interstitium thickening, intra-alveolar desquama-tion, and necrotic cellular debris, as well as increased levels ofinflammatory (polymorphonuclear leukocytes) and mononu-clear cells. However, there were no differences between groupsof mice inoculated with 2457T or msbB mutant strains (datanot shown).

Characterization of S. flexneri msbB mutants in culturedmurine macrophages. The results described above suggestedthat Shigella strains lacking msbB have a reduced ability toelicit inflammatory responses in mouse lungs. To investigatethe inflammatory potential of each strain in more detail, J774A.1murine macrophages were infected with either wild-type ormsbB mutant strains. Culture supernatants collected duringthe macrophage infections were analyzed for LDH (see Fig. S2in the supplemental material), as well as for the presence ofthree proinflammatory cytokines (TNF-�, MIP-1�, and IL-1),using a quantitative ELISA (Fig. 2). Cytokine production wassimilar for all strains when infections were done at an MOI of2.0. However, infections using an MOI of 0.2 consistently re-sulted in a significant decrease in the amount of all threeproinflammatory cytokines (Fig. 3). Complementation of themsbB double mutant using pmsbB1 [WR30(pmsbB1)] resultedin the restoration of proinflammatory cytokine production tolevels that exceeded the levels with 2457T.

These data indicate that Shigella msbB mutants were fullycytotoxic to murine macrophages. However, the ability to elicitthe release of proinflammatory cytokines was significantly re-duced in Shigella strains lacking either one or both copies ofthe msbB gene.

Characterization of Shigella msbB mutants in different mod-els of cellular invasion. Invasion of epithelial cells is a criticalaspect of Shigella pathogenesis and was therefore evaluated for

TABLE 2. Strain lethality and colonization in mouse lungs

Strain orcontrol

% Lethality with indicatedinoculuma,b

Mean no. of CFU in lungs withindicated inoculumc

5 � 107 CFU 2.5 � 107 CFU 5 � 107 CFU 2.5 � 107 CFU

Saline 0 0 0 02457T 100 25 ND 9.0 � 104

WR10 56 0 9.8 � 104 2.0 � 104

WR20 50 0 6.6 � 104 4.0 � 104

WR30 37 6 5.5 � 104 4.4 � 104

a Eight mice per group were infected intranasally with the indicated no. ofCFU, and lethality was determined 72 h postinfection. The experiment wasperformed twice and the data averaged.

b The LD50s for 2457T (3.0 � 107 CFU), WR10 (4.9 � 107 CFU), WR20(5.0 � 107 CFU), and WR30 (5.7 � 107 CFU) were estimated using a probitanalysis.

c Determined from 5 mice per group from a single experiment.

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Genotype Reference orsource

Strains2457T Wild-type S. flexneri 2a strain WRAIR

collection2457T-CR Plasmid-cured isolate of

2457TThis study

WR10 msbB1 single deletionmutant of 2457T

34

WR20 msbB2 single deletionmutant of 2457T

34

WR30a msbB1 msbB2 doubledeletion mutant of 2457T

This study

WR30(pmsbB1) WR30 transformed withpmsbB1; Apr

This study

PlasmidspBR322 Apr and Tcr low-copy-

number cloning vectorNew England

BiolabspmsbB1 pBR322 with the S. flexneri

msbB1 gene; AprThis study

a This strain was independently derived from both WR10 and WR20.

VOL. 78, 2010 CHARACTERIZATION OF S. FLEXNERI msbB MUTANTS 403

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

each S. flexneri msbB mutant. The efficiency of HeLa cell in-vasion was evaluated by determining the number of intracel-lular bacteria early after infection (45 min). Unlike the msbBsingle mutants and the wild type, WR30 was recovered frominfected HeLa cells at reduced levels (see Fig. S3 in the sup-plemental material). Since defects in cellular invasion had notbeen previously reported for Shigella msbB mutants, the inva-sion defect was verified by counting the number of infectedcells using a gentamicin protection assay (Table 3) (9, 14).Interestingly, microscopic examination of HeLa cells infectedwith WR30 revealed that the vast majority of infected cells hadfilamentous bacteria in the cytoplasm (data not shown). Aswith the other phenotypes, both the invasion defect and fila-mentation of WR30 were fully complemented with a plasmidexpressing the msbB1 gene [WR30(pmsbB1)] (Table 3), indi-cating that at least one copy of msbB was required for wild-typelevels of invasion in a 2457T background.

The plaque assay was used to further investigate the abilityof each strain to invade, replicate, and spread within BHK cellmonolayers, a process that results in areas of cell death orplaques after �72 h (30). As expected, WR10 and WR20formed plaques comparable to those formed by 2457T withrespect to plaque size and plaquing efficiency. However, mono-

layers that were infected with WR30 did not contain visibleplaques (Table 3). When a very high MOI was used (MOI of5), only a few small areas of cell lysis were visible after infec-tion with WR30. Interestingly, WR30 complemented withpmsbB1 displayed wild-type plaquing efficiency but producedplaques that were smaller in size. To address the possibilitythat additional mutations were introduced into WR30 duringconstruction, the strain was independently derived a secondtime and the assay was repeated, producing the same result.these data suggest that complete complementation of all msbBphenotypes may not be achievable with pmsbB1 (data notshown).

A Sereny test, which is an in vivo assay for invasion andspread within epithelial cells, was used to evaluate the viru-lence of each S. flexneri msbB mutant strain. In this assay,bacteria are inoculated into the eye of a guinea pig, where theycause a purulent keratoconjunctivitis as a consequence of in-vasion, replication, and spread throughout the corneal epithe-lium. Consistent with its defects in cellular invasion andplaque-negative phenotype, WR30 was Sereny negative, whileWR10 and WR20 induced a severe keratoconjunctivitis reac-tion (grade 3) that was indistinguishable from that induced by2457T (Table 3).

FIG. 1. Mice were intranasally inoculated with 2.5 � 107 CFU of S. flexneri 2a 2457T, WR10, WR20, or WR30. At 72 h postinoculation, micewere euthanized and lung wash fluids collected from individual mice and stored at �30°C until being assayed for cytokine concentrations usinga Luminex-based multiplexed assay. The data shown are representative of two studies and represent the mean standard error of the mean foreach group (n 5 mice/group). Asterisks indicate a significant decrease in the mean cytokine concentration compared to the concentration in2457T-inoculated animals (one-way ANOVA; P � 0.05).

404 RANALLO ET AL. INFECT. IMMUN.

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

To investigate the basis for the invasion-related defects,all three msbB mutant strains were assayed for TTSS-medi-ated protein secretion. Log-phase broth cultures were grownin the presence or absence of the TTSS activator Congo red.The addition of Congo red to msbB mutant strains inducedsecretion profiles that were identical to those of wild-typecultures (see Fig. S4B in the supplemental material). Undernoninducing conditions, very few proteins were secretedinto culture supernatants, indicating that TTSS protein se-cretion was regulated normally and the presence of effectorproteins was not due to bacterial lysis. The identity andrelative quantity of both IpaB and IpaC were verified via

Western blot with monoclonal antibodies 2F1 and 2G2 (27),respectively (data not shown). Similar results were obtainedfor strains grown on agar plates, where TTSS secretion ofIpaB was detected via colony blot (see Fig. S4A in thesupplemental material).

Overall, the results indicate significant defects in epithelialcell invasion for the msbB double mutant (WR30). Althoughthe basis for these defects is currently unknown, they areclearly related to the absence of a functional msbB gene. Thevirulence assays collectively indicate that S. flexneri strains lack-ing msbB are attenuated in both cell culture and animal modelsof infection. However, the nature and magnitude of the atten-

FIG. 2. Cytokine concentrations in supernatants of infected J774A.1 murine macrophages. Culture supernatants from infected macrophageswere collected at various time points and tested for the presence of TNF-� (180 min), MIP-1� (120 min), and IL-1 (180 min). Macrophages wereinfected at two different multiplicities of infection (MOI), as indicated above each graph. Data represent the means standard deviation of themeans of the cytokine concentrations from three independent assays. Differences in mean concentrations were determined using one-wayANOVA; asterisks are used to indicate a significant (P � 0.05) difference between groups.

VOL. 78, 2010 CHARACTERIZATION OF S. FLEXNERI msbB MUTANTS 405

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

uation are different depending on the model system used (i.e.,mouse lung versus Sereny test).

Immunogenicity of S. flexneri msbB mutants in a murine pul-monary model. The mouse lung model was used to assess the

adaptive immune responses induced by each Shigella msbB mu-tant strain. Mice were intranasally inoculated on days zero and 21with �3.0 � 105 CFU of 2457T, WR10, WR20, or WR30 andthen challenged with a lethal dose (1 � 107) 4 weeks after the lastinoculation. Blood samples collected on days zero, 28, and 42were analyzed by ELISA for serum IgG and IgA responsesagainst S. flexneri 2a LPS, IpaB, and IpaC. Antigen-specific re-sponses were not detected in samples collected before immuni-zation (day zero) or from saline-immunized animals. In contrast,LPS-specific IgG and IgA responses were detected on days 28 and42 in all immunization groups regardless of the strain used forvaccination (Fig. 3). Comparable levels of anti-LPS serum IgGendpoint titers were elicited among all vaccinated groups on day42, with endpoint titers ranging from 1,024 to 4,096. LPS-specificIgA responses showed a similar trend, with comparable meanendpoint titers among all groups on day 28, one week after thelast immunization. While the anti-LPS IgA responses remainedrelatively high on day 42 in 2457T- and WR20-immunized ani-mals, significantly lower endpoint titers were seen in WR10- andWR30-inoculated animals. Interestingly, whereas the LPS-spe-cific IgG responses were comparable among the different groups,there was a significant reduction in the anti-IpaB IgG response inmice immunized with WR20 or WR30 compared to the responseto immunization with wild-type Shigella or WR10 (Fig. 3C). Min-

FIG. 3. Shigella-specific serum IgG and IgA endpoint titers in mice after intranasal immunization. Mice were administered saline, 2457T, WR10,WR20, or WR30 intranasally on days zero and 21. Serum LPS-specific IgG (A) and IgA (B) and IpaB-specific serum IgG (C) and IpaC-specific serumIgG (D) endpoint titers were assessed by ELISA from blood samples collected from individual mice (n 5 mice/group) on days 28 and 42 (d28 and d42).Data represent the means 1 standard error of the mean. Differences in mean endpoint titers were determined using two-way ANOVA analysis oflog-transformed titers. Asterisks are used to indicate a significant (P � 0.05) difference between an immunized group and mice inoculated with 2457T.

TABLE 3. In vitro and in vivo strain characterization

Strain% of

HeLa cellsinfecteda,b

Plaqueformation

% Plaquingefficiencyc

Plaquesize

(mm)

Serenytest

resultd

2457T 9.15 � 0.58 1.29 3WR10 9.80 � 0.32 1.31 3WR20 8.72 � 0.38 1.33 3WR30 3.59e,f g ND NDg 0WR30(pmsbB1) 9.84 � 0.67 0.89 ND

a Data from three separate assays are averaged.b Cells were considered infected if they contained at least one cytoplasmic

bacterium, and percent infection was determined by the following formula:(number of infected/total counted) � 100.

c Plaquing efficiency was determined using an MOI of 0.05 and is defined bythe following formula: (number of plaques/number of bacteria) � 100.

d Average rating from four guinea pigs 72 h after inoculation. Four eyes wereinoculated for the 2457T test, and 8 eyes were inoculated for the WR10, WR20,and WR30 tests.

e P � 0.05; determined using a one-way ANOVA.f Bacteria appeared filamentous inside the cytoplasm of HeLa cells.g The appearance of 3 to 4 extremely small opaque areas of cell clearing with

undefined borders was observed at an MOI of 5.

406 RANALLO ET AL. INFECT. IMMUN.

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

imal levels of IpaC-specific serum IgG were detected in all groups(Fig. 3D).

Mucosal responses induced by the S. flexneri msbB mutantswere assessed by determining anti-LPS and anti-Invaplex IgAtiters in intestinal and lung wash fluids collected two weeks(day 35) after the last immunization. Invaplex is a native com-plex isolated from water extracts of wild-type Shigella (43) andconsists of IpaB, IpaC, and LPS, major antigens recognizedafter natural infection with Shigella and providing enhancedsensitivity with ELISAs. Lung and intestinal wash fluids col-lected from saline-immunized animals did not contain detect-able levels of antigen-specific IgA, as expected (Fig. 4). Intes-tinal wash fluids contained comparable levels of antibodies forboth LPS and Invaplex across all groups (Fig. 4A and B). Theresponses in lung wash fluids were more complex and variable(Fig. 4C and D). LPS-specific lung IgA responses in miceimmunized with 2457T, WR20, and WR30 were of similarmagnitudes. However, WR10-immunized mice did not havedetectable levels of anti-LPS IgA in the lung (Fig. 4C). Thelevels of anti-Invaplex IgA were comparable among all groups

except for WR30-immunized mice, which had significantlylower levels.

In addition to antibody responses, the induction of antigen-specific cell-mediated responses was also determined twoweeks after the last immunization (day 35). Splenocytes ex-cised from individual mice were restimulated in vitro using S.flexneri 2a LPS or Invaplex (Table 4). Stimulation of cells fromsaline-inoculated mice did not induce cellular proliferation,with stimulation indices (SIs) below 2.0. Cells isolated from allanimals responded to the lymphocyte mitogen concanavalin Aat similar levels (range, 12.9 to 16.6). In contrast, cells frommice immunized with 2457T, WR10, WR20, and WR30 re-sponded to both LPS and Invaplex, indicating the induction ofShigella-specific cellular immune responses (Table 4). The pro-liferative responses in WR30-infected mice tended to be moremoderate (SI of 5.8 after LPS stimulation and 6.9 after Inva-plex stimulation) than the proliferation levels induced by thewild-type strain (SI of 8.4 after LPS and 10.6 after Invaplex) orthe single msbB mutants.

Analyzing serum IgG subclass responses and determining

FIG. 4. Shigella-specific mucosal IgA endpoint titers in mice after intranasal immunization. Intestinal (A and B) and lung (C and D) wash fluidswere collected two weeks after the second intranasal immunization (day 35) with saline, 2457T, WR10, WR20, or WR30 and assessed by ELISAfor LPS-specific (A and C) or Invaplex-specific (B and D) IgA endpoint titers. Data represent the means (n 5 mice/group) 1 standard errorof the mean. Significant (P � 0.05) differences in mean endpoint titers between groups immunized with WR10, WR20, or WR30 and miceimmunized with 2457T were determined using two-way ANOVA analysis of log-transformed titers and are indicated with asterisks.

VOL. 78, 2010 CHARACTERIZATION OF S. FLEXNERI msbB MUTANTS 407

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

the secretion of cytokines after in vitro antigen stimulationcharacterized the phenotype of the immune response. Serumsamples collected on day 42 from individual mice were ana-lyzed for Invaplex-specific IgG subclass responses. The anti-gen-specific serum IgG subclass profile elicited by all immu-nized groups was consistent with a mixed Th1/Th2 response(Fig. 5), with detectable levels of IgG1 (indicative of Th2responses) and IgG2a. The ratios of anti-Invaplex serum IgG1endpoint titers to serum IgG2a titers were �4 in groups inoc-ulated with 2457T, WR10, and 30, whereas the ratios calcu-lated for WR20 were �2, indicating a more balanced Th1/Th2response in WR20-inoculated animals. The phenotype of theimmune response was also assessed by measuring cytokinessecreted from splenocytes restimulated with S. flexneri 2a LPS(data not shown) or Invaplex (Table 5) in vitro. The resultssupport a mixed Th1 and Th2 response, with similar levels ofIL-12, IFN-�, IL-5, and IL-10 secreted from splenocytes ofmice immunized with 2457T, WR10, WR20, and WR30. Inter-

TABLE 4. Cellular proliferation after in vitro antigenic stimulationof splenocytes from mice intranasally inoculated

with S. flexneri 2a strains

Animaltreatment

SIa for splenocytes cultured with:

S. flexneri 2a LPS(1 �g/ml)

S. flexneri 2a Invaplex(5 �g/ml) ConAb (1 �g/ml)

Saline 1.2 0.9 (0/3) 1.3 0.8 (0/3) 16.4 1.6 (3/3)2457T 8.4 5.1 (4/5) 10.6 2.9 (4/5) 15.7 2.1 (5/5)WR10 7.6 2.5 (5/5) 12.5 1.2 (5/5) 14.9 1.9 (5/5)WR20 8.1 3.8 (4/5) 8.4 3.5 (4/5) 16.6 2.5 (5/5)WR30 5.8 2.1 (3/5) 6.9 3.3 (3/5) 12.9 4.3 (5/5)

a Values given represent the mean SI 1 standard deviation from the mean(number of responders/total number of mice in the group).

b Concanavalin A (ConA) is a lymphocyte mitogen and served as a positivestimulation control in this assay.

FIG. 5. Invaplex-specific serum IgG subclass responses in mice after intranasal immunization. Invaplex-specific serum IgG1 (A) and IgG2a(B) responses in mice after intranasal immunization were determine from blood samples collected on day 42. Data represent the means (n 5mice/group) 1 standard error of the mean endpoint titers.

408 RANALLO ET AL. INFECT. IMMUN.

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

estingly, cells from mice inoculated with WR10 had the highestlevels of IFN-� secretion after in vitro stimulation with Inva-plex.

Protective efficacy of S. flexneri msbB mutants in a mousepulmonary infection model. Mice intranasally immunized with2457T, WR10, WR20, WR30, or saline were challenged with alethal dose of 2457T (1 � 107 CFU) four weeks after their lastimmunization. Mortality was assessed on a daily basis for 14days (Fig. 6). All strains induced significant protection com-pared to mortality in saline-immunized mice, with WR20 dem-onstrating the lowest level of protection (P � 0.012). Interest-ingly, WR10 demonstrates the highest level of protection andis significantly (P � 0.008) more efficacious than WR20.

DISCUSSION

Numerous studies have demonstrated a clear link betweenunderacylated lipid A and reduced endotoxic potential. Al-though the molecular basis for this effect is not completelyunderstood, studies suggest that it is related to a reduction inToll-like receptor 4 (TLR4)-dependent activation via interac-tion with the endotoxin–MD-2 complex (7, 19). Since the ac-ylation pattern of lipid A can influence its biological activity,translational research into biosynthetic lipid A modificationshas been pursued as a potential way to create novel LPSspecies more suitable for inclusion into human biologics, such

as vaccines and adjuvants. A step toward this goal involves theconstruction and testing of genetic mutations in late acyltrans-ferases, such as msbB, which produce bacterial strains withunderacylated LPS and reduced ability to stimulate innateimmune responses. However, in the context of live bacterialvaccines, it is also important to consider how reduced endo-toxicity influences the nature and magnitude of acquired im-munity against protective bacterial antigens.

The mouse pulmonary model of shigellosis was chosen toevaluate the role of S. flexneri msbB because both innate andacquired immunity can be measured and correlated with pro-tective efficacy. In this model, virulent Shigella bacteria instilledby the intranasal route invade the mouse pulmonary epithe-lium and elicit an acute, cytokine-driven inflammatory re-sponse that can rapidly progress to suppurative pneumonia(45). Proinflammatory cytokine secretion after primary infec-tion is most likely due to recognition of bacterial products (i.e.,LPS) by key receptors (TLR4 and CD14), which are rapidlyupregulated on the bronchial epithelium and alveolar macro-phages in the presence of LPS (36). Studies with a plasmid-cured Shigella strain or a strain lacking a key invasion-relatedprotein (IpaB) suggest that cellular invasion and macrophagecell death are important for full virulence in this model (41,50). In contrast, mutants deficient in their ability to move withina cell [�virG(icsA)], which are highly attenuated in other animalmodels (guinea pigs and nonhuman primates) and humans(reviewed in reference 48), are virulent in mouse lungs, capa-ble of inducing a cytokine-driven pathology that leads to sig-nificant lethality (41).

The results from the 22-plex bead-based assay demonstratethat high doses (2.5 � 107 CFU) of wild-type Shigella inducethe production of 10 different chemokines and cytokines 72 hafter intranasal challenge. Consistent with a reduced endotoxicpotential, all three msbB deletion strains induced lower levelsof IL-1, IL-6, KC, MCP-1, IL-17, and MIP-1� in mouse lungsthan were induced in lungs infected with wild-type 2457T. Thebasis for reduced virulence (i.e., lethality) in mouse lungs ap-pears to be directly related to the production of less-endotoxicLPS. Evidence for this correlation comes from the finding thatmsbB single mutants induce lower levels of cytokine produc-tion and less mortality in the absence of any associated phe-notypes. Interestingly, reduced lethality could not be corre-lated with significant histopathological differences in lungtissue between the different treatment groups. That is, pneu-monia and hemorrhage with necrosuppurative bronchiolitis donot necessarily portend a lethal outcome (45). Moreover, the

TABLE 5. Secretion of cytokines after in vitro antigenic stimulation of splenocytes from mice intranasally inoculated with S. flexneri 2a strains

Treatment

Amt of indicated cytokine secreted (pg/ml)a

Th1-like Th2-like

IL-2 IL-12 IFN-� IL-4 IL-5 IL-10

Saline 45 3 0 37 0 1,621 0 13 21 4 0 42457T 46 13 13 35 958 3,429* 0 16 30 204 15 71WR10 49 2 23 16* 2,042 304* 0 20 71 333 48 107*WR20 45 10 0 23 580 2,708* 0 10 23 49 0 12WR30 47 15 12 39 1,286 4,097* 0 13 36 171 8 50

a Data are expressed as the mean 1 standard deviation. Asterisks indicate concentrations that are statistically significant compared to the results for the salinetreatment group.

FIG. 6. Protection against a lethal dose of wild-type S. flexneri 2astrain 2457T. Groups of 17 BALB/cJ mice were vaccinated twice (dayszero and 21) with the indicated strains or saline (gray). On day 41, micewere intranasally challenged with 1.2 � 107 CFU of 2457T, and sur-vival was recorded for 14 days. Survival rates after challenge are indi-cated on the y axis, and days after challenge on the x axis. P values weredetermined using the log-rank test.

VOL. 78, 2010 CHARACTERIZATION OF S. FLEXNERI msbB MUTANTS 409

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

pathology is consistent with the persistent colonization of thelung tissue (Table 2) and the ability to induce cell death inmurine macrophages (3). The lung pathology may also reflectthe finding that lung lavage fluids from all infected groupscontained comparable levels of TNF-�, a key cytokine respon-sible for causing lesions in experimentally infected animals (9).The TNF-� results do not coincide with a previous findingusing S. flexneri 5 msbB mutants in rabbit ileal loops (9). Thismost likely reflects the promiscuous nature of the murineTLR4, which can fail to effectively discriminate between penta-acylated and hexa-acylated LPS (15), especially at high MOIs(20). Indeed, reduced TNF-� secretion for each S. flexnerimsbB mutant was only detected when relatively low MOIs wereused to infect murine macrophages. Under these conditions,both single and double msbB mutants induced significantly lessTNF-�, MIP-1�, and IL-1 secretion in culture supernatants.Overall, these findings demonstrate that loss of msbB in S.flexneri 2a results in reduced endotoxic responses in mouselungs and cultured macrophages.

The msbB gene was originally identified in E. coli (K-12) asa high-copy-number suppressor of the conditionally lethal htrBmutation (6, 39). Although no growth phenotypes were attrib-uted to deletion of msbB in K-12, subsequent mutation ofmsbB in some pathogenic gram-negative bacteria has beenshown to induce growth defects, such as filamentation, sensi-tivity to MacConkey agar, and slow growth (28, 40). Deletionof both msbB genes in the S. flexneri 2a human challenge strain2457T (WR30) results in a slow-growth phenotype that is as-sociated with a filamentous bacterial morphology. WR30 alsodisplays a temperature-dependent sensitivity to growth onMacConkey agar plates (data not shown). All of these growthdefects could be recovered by expressing MsbB from a plas-mid, indicating that they were not due to secondary mutationselsewhere in the genome.

WR30 is less invasive in HeLa cells and does not formplaques in BHK cell monolayers. Both defects directly corre-late with a Sereny-negative phenotype. In Salmonella and Neis-seria gonorrhoeae msbB mutants, defects in cellular invasionwere attributed to either reduced secretion of Sip proteins orincreased susceptibility to innate mechanisms of intracellularkilling (11, 49). WR30 appears to have a functioning TTSS, asindicated by the controlled secretion of the Ipa proteins (seeFig. S4 in the supplemental material). Moreover, WR30 effi-ciently kills macrophages, a process that requires a TTSS thatcan secrete functional translocators (IpaB and -C) (37, 38).The phenotype for WR30 in epithelial cells may be a pleiotro-pic effect resulting from its filamentous morphology, eventhough log-phase cultures contain similar numbers of viablebacteria. The data presented in Table 3 and Fig. S3 in thesupplemental material indicate that WR30 induces uptake intoHeLa cells at a reduced efficiency and then fails to replicatenormally once inside the cytoplasm. The defects in cellularinvasion were complemented with MsbB1 expressed from alow-copy-number plasmid, suggesting that WR30 has not ac-quired secondary mutations. However, these observations arenot consistent with the results of a previously published study(9) where no in vitro growth or invasion-related defects wereobserved with an msbB double mutant. The conflicting resultsmay reflect the fact that late acyltransferases (like msbB) canbe strain-specific virulence factors in Shigella, similar to what

has been found for both Neisseria and Salmonella species.Another possible explanation could be related to the fact thatmsbB mutant backgrounds (in Salmonella) are reported tohave higher rates of spontaneous suppressor mutations (28).Extragenic suppressors picked up during strain constructioncould suppress growth phenotypes without affecting the pat-tern of lipid A acylation (28).

The mouse pulmonary vaccination-challenge model hasbeen used to evaluate a number of Shigella vaccine candidates,including live attenuated vaccine strains (26). Mice immunizedwith two sublethal doses of Shigella develop systemic (IgG andIgA) and mucosal (secretory IgA) antibodies to bacterial an-tigens and are protected (56 to 79%) against lethal challenge(45). Protection from challenge in this model appears to beantibody mediated, although the results of other studies sug-gest an essential role for IFN-� in resistance to primary infec-tion (50, 51). Immunization using two sublethal doses of eachmsbB derivative or wild-type Shigella induced equally signifi-cant serum antibody (IgA and IgG) responses to LPS. How-ever, this was not true for anti-IpaB serum responses, whichwere significantly reduced in animals inoculated with WR20and WR30 even though these strains clearly expressed wild-type levels of IpaB (see Fig. S4A and B in the supplementalmaterial). Anti-IpaC responses were below the level of detec-tion in the sera of all vaccinated groups, even in animals im-munized with 2457T. The lack of a detectable IpaC responsecould be a result of the immunizing dose being relatively lowcompared to the dose in previous studies where only a modestanti-IpaC response was detected (45).

Significant differences were observed in the magnitude ofthe mucosal immune responses in the lungs of mice in somegroups (WR10 and WR30), whereas the intestinal wash fluidsshowed comparable responses across all strains. While not aspronounced, the level of cell-mediated immunity was also re-duced in animals inoculated with WR30 compared to the levelin mice inoculated with 2457T. Despite these differences, therewere no variations noted in the phenotype of the response,with all strains inducing comparable levels of Invaplex-specificIgG1 and IgG2a, indicative of a mixed Th1/2 response. Whenmice immunized with 2457T or its msbB derivatives were sub-sequently challenged with a lethal dose of 2457T, the adaptiveimmune responses evoked in all 4 groups of mice correlatedwith significant protection from challenge compared to that insaline-immunized mice. WR10 induced the highest level ofprotection and is significantly (P � 0.01) more efficacious thanWR20. Splenocytes from WR10-immunized mice also inducedthe highest level of IFN-� after in vitro stimulation with Inva-plex. IFN-� plays a critical role in promoting the clearance ofintracellular shigellae (50). However, protection from lethalchallenge after immunization with wild-type S. flexneri 2a (2457T)can range from 56 to 79% (45), making it difficult to interpretthe increase in protection observed with WR10.

The data presented herein are consistent with previouslypublished work that shows that deletion of msbB in Shigellasignificantly reduces innate inflammatory responses comparedto those induced by wild-type strains (9). Most importantly, thereduction does not coincide with a consistent decrease in ac-quired serum or mucosal immunity or protective capacity. Liveattenuated vaccine strains, like SC602 (S. flexneri 2a), WRSS1(S. sonnei), and WRSd1 (S. dysenteriae 1), have the loss of the

410 RANALLO ET AL. INFECT. IMMUN.

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

virG(icsA) gene (8, 17, 47) as their primary attenuating feature.Although these vaccines are highly attenuated and immuno-genic, they induce mild fever and diarrhea in an unacceptablepercentage of human volunteers (reviewed in reference 48).Incorporation of an msbB deletion into existing virG(icsA)-based vaccine strains will likely reduce or eliminate these fe-brile reactions and increase the safety of these low-dose vac-cine candidates.

ACKNOWLEDGMENTS

We thank Edwin Oaks for the IpaB and IpaC monoclonal antibod-ies, Shigella Invaplex, and the mouse challenge stocks used in thesestudies. We also thank Edwin Oaks, Robert Bowden, and Akamol E.Suvarnapunya for critically reading the manuscript. Finally, we thankRichard Helm for completing the analysis of LPS and Suramya Fon-seka for cellular invasion assays.

The content of this publication does not necessarily reflect the viewsor policies of the U.S. Department of the Army or the U.S. Depart-ment of Defense, nor does the mention of trade names, commercialproducts, or organizations imply endorsement by the U.S. Govern-ment.

REFERENCES

1. Anisimov, A. P., R. Z. Shaikhutdinova, L. N. Pan’kina, V. A. Feodorova, E. P.Savostina, O. V. Bystrova, B. Lindner, A. N. Mokrievich, I. V. Bakhteeva,G. M. Titareva, S. V. Dentovskaya, N. A. Kocharova, S. N. Senchenkova, O.Holst, Z. L. Devdariani, Y. A. Popov, G. B. Pier, and Y. A. Knirel. 2007.Effect of deletion of the IpxM gene on virulence and vaccine potential ofYersinia pestis in mice. J. Med. Microbiol. 56:443–453.

2. Burland, V., Y. Shao, N. T. Perna, G. Plunkett, H. J. Sofia, and F. R.Blattner. 1998. The complete DNA sequence and analysis of the largevirulence plasmid of Escherichia coli O157:H7. Nucleic Acids Res. 26:4196–4204.

3. Cersini, A., M. C. Martino, I. Martini, G. Rossi, and M. L. Bernardini. 2003.Analysis of virulence and inflammatory potential of Shigella flexneri purinebiosynthesis mutants. Infect. Immun. 71:7002–7013.

4. Clements, A., D. Tull, A. W. Jenney, J. L. Farn, S. H. Kim, R. E. Bishop, J. B.McPhee, R. E. Hancock, E. L. Hartland, M. J. Pearse, O. L. Wijburg, D. C.Jackson, M. J. McConville, and R. A. Strugnell. 2007. Secondary acylation ofKlebsiella pneumoniae lipopolysaccharide contributes to sensitivity to anti-bacterial peptides. J. Biol. Chem. 282:15569–15577.

5. Clementz, T., J. J. Bednarski, and C. R. Raetz. 1996. Function of the htrBhigh temperature requirement gene of Escherichia coli in the acylation oflipid A: HtrB catalyzed incorporation of laurate. J. Biol. Chem. 271:12095–12102.

6. Clementz, T., Z. Zhou, and C. R. Raetz. 1997. Function of the Escherichiacoli msbB gene, a multicopy suppressor of htrB knockouts, in the acylationof lipid A. Acylation by MsbB follows laurate incorporation by HtrB. J. Biol.Chem. 272:10353–10360.

7. Coats, S. R., C. T. Do, L. M. Karimi-Naser, P. H. Braham, and R. P.Darveau. 2007. Antagonistic lipopolysaccharides block E. coli lipopolysac-charide function at human TLR4 via interaction with the human MD-2lipopolysaccharide binding site. Cell. Microbiol. 9:1191–1202.

8. Coster, T. S., C. W. Hoge, L. L. VanDeVerg, A. B. Hartman, E. V. Oaks,M. M. Venkatesan, D. Cohen, G. Robin, A. Fontaine-Thompson, P. J. San-sonetti, and T. L. Hale. 1999. Vaccination against shigellosis with attenuatedShigella flexneri 2a strain SC602. Infect. Immun. 67:3437–3443.

9. D’Hauteville, H., S. Khan, D. J. Maskell, A. Kussak, A. Weintraub, J.Mathison, R. J. Ulevitch, N. Wuscher, C. Parsot, and P. J. Sansonetti. 2002.Two msbB genes encoding maximal acylation of lipid A are required forinvasive Shigella flexneri to mediate inflammatory rupture and destruction ofthe intestinal epithelium. J. Immunol. 168:5240–5251.

10. DuPont, H. L., R. B. Hornick, A. T. Dawkins, M. J. Snyder, and S. B. Formal.1969. The response of man to virulent Shigella flexneri 2a. J. Infect. Dis.119:296–299.

11. Everest, P., J. Ketley, S. Hardy, G. Douce, S. Khan, J. Shea, D. Holden, D.Maskell, and G. Dougan. 1999. Evaluation of Salmonella typhimurium mu-tants in a model of experimental gastroenteritis. Infect. Immun. 67:2815–2821.

12. Fernandez-Prada, C. M., D. L. Hoover, B. D. Tall, A. B. Hartman, J. Kope-lowitz, and M. M. Venkatesan. 2000. Shigella flexneri IpaH(7.8) facilitatesescape of virulent bacteria from the endocytic vacuoles of mouse and humanmacrophages. Infect. Immun. 68:3608–3619.

13. Formal, S. B., E. V. Oaks, R. E. Olsen, M. Wingfield-Eggleston, P. J. Snoy,and J. P. Cogan. 1991. Effect of prior infection with virulent Shigella flexneri2a on the resistance of monkeys to subsequent infection with Shigella sonnei.J. Infect. Dis. 164:533–537.

14. Goldman, S. R., Y. Tu, and M. B. Goldberg. 2008. Differential regulation bymagnesium of the two MsbB paralogs of Shigella flexneri. J. Bacteriol.190:3526–3537.

15. Hajjar, A. M., R. K. Ernst, J. H. Tsai, C. B. Wilson, and S. I. Miller. 2002.Human Toll-like receptor 4 recognizes host-specific LPS modifications. Nat.Immunol. 3:354–359.

16. Hartman, A. B., C. J. Powell, C. L. Schultz, E. V. Oaks, and K. H. Eckels.1991. Small-animal model to measure efficacy and immunogenicity of Shi-gella vaccine strains. Infect. Immun. 59:4075–4083.

17. Hartman, A. B., and M. M. Venkatesan. 1998. Construction of a stableattenuated Shigella sonnei DeltavirG vaccine strain, WRSS1, and protectiveefficacy and immunogenicity in the guinea pig keratoconjunctivitis model.Infect. Immun. 66:4572–4576.

18. Jensen, V. B., J. T. Harty, and B. D. Jones. 1998. Interactions of the invasivepathogens Salmonella typhimurium, Listeria monocytogenes, and Shigellaflexneri with M cells and murine Peyer’s patches. Infect. Immun. 66:3758–3766.

19. Jerala, R. 2007. Structural biology of the LPS recognition. Int. J. Med.Microbiol. 297:353–363.

20. Kalupahana, R., A. R. Emilianus, D. Maskell, and B. Blacklaws. 2003.Salmonella enterica serovar Typhimurium expressing mutant lipid A withdecreased endotoxicity causes maturation of murine dendritic cells. Infect.Immun. 71:6132–6140.

21. Kaminski, R. W., K. R. Turbyfill, and E. V. Oaks. 2006. Mucosal adjuvantproperties of the Shigella invasin complex. Infect. Immun. 74:2856–2866.

22. Karow, M., O. Fayet, A. Cegielska, T. Ziegelhoffer, and C. Georgopoulos.1991. Isolation and characterization of the Escherichia coli htrB gene, whoseproduct is essential for bacterial viability above 33 degrees C in rich media.J. Bacteriol. 173:741–750.

23. Khan, S. A., P. Everest, S. Servos, N. Foxwell, U. Zahringer, H. Brade, E. T.Rietschel, G. Dougan, I. G. Charles, and D. J. Maskell. 1998. A lethal rolefor lipid A in Salmonella infections. Mol. Microbiol. 29:571–579.

24. Kim, S. H., W. Jia, R. E. Bishop, and C. Gyles. 2004. An msbB homologuecarried in plasmid pO157 encodes an acyltransferase involved in lipid Abiosynthesis in Escherichia coli O157:H7. Infect. Immun. 72:1174–1180.

25. Liu, T., R. Konig, J. Sha, S. L. Agar, C. T. Tseng, G. R. Klimpel, and A. K.Chopra. 2008. Immunological responses against Salmonella enterica serovarTyphimurium Braun lipoprotein and lipid A mutant strains in Swiss-Webstermice: potential use as live-attenuated vaccines. Microb. Pathog. 44:224–237.

26. Mallett, C. P., L. VanDeVerg, H. H. Collins, and T. L. Hale. 1993. Evaluationof Shigella vaccine safety and efficacy in an intranasally challenged mousemodel. Vaccine 11:190–196.

27. Mills, J. A., J. M. Buysse, and E. V. Oaks. 1988. Shigella flexneri invasionplasmid antigens B and C: epitope location and characterization with mono-clonal antibodies. Infect. Immun. 56:2933–2941.

28. Murray, S. R., D. Bermudes, K. S. de Felipe, and K. B. Low. 2001. Extragenicsuppressors of growth defects in msbB Salmonella. J. Bacteriol. 183:5554–5561.

28a.National Research Council. 1996. Guide for the care and use of laboratoryanimals. National Academy Press, Washington, DC.

29. Nonaka, T., T. Kuwabara, H. Mimuro, A. Kuwae, and S. Imajoh-Ohmi. 2003.Shigella-induced necrosis and apoptosis of U937 cells and J774 macro-phages. Microbiology 149:2513–2527.

30. Oaks, E. V., M. E. Wingfield, and S. B. Formal. 1985. Plaque formation byvirulent Shigella flexneri. Infect. Immun. 48:124–129.

31. Phalipon, A., and P. J. Sansonetti. 2007. Shigella’s ways of manipulating thehost intestinal innate and adaptive immune system: a tool box for survival?Immunol. Cell Biol. 85:119–129.

32. Post, D. M., M. R. Ketterer, N. J. Phillips, B. W. Gibson, and M. A. Apicella.2003. The msbB mutant of Neisseria meningitidis strain NMB has a defect inlipooligosaccharide assembly and transport to the outer membrane. Infect.Immun. 71:647–655.

33. Post, D. M., N. J. Phillips, J. Q. Shao, D. D. Entz, B. W. Gibson, and M. A.Apicella. 2002. Intracellular survival of Neisseria gonorrhoeae in male ure-thral epithelial cells: importance of a hexaacyl lipid A. Infect. Immun. 70:909–920.

34. Ranallo, R. T., S. Barnoy, S. Thakkar, T. Urick, and M. M. Venkatesan.2006. Developing live Shigella vaccines using lambda Red recombineering.FEMS Immunol. Med. Microbiol. 47:462–469.

35. Ranallo, R. T., S. Thakkar, Q. Chen, and M. M. Venkatesan. 2007. Immu-nogenicity and characterization of WRSF2G11: a second generation liveattenuated Shigella flexneri 2a vaccine strain. Vaccine 25:2269–2278.

36. Saito, T., T. Yamamoto, T. Kazawa, H. Gejyo, and M. Naito. 2005. Expres-sion of toll-like receptor 2 and 4 in lipopolysaccharide-induced lung injury inmouse. Cell Tissue Res. 321:75–88.

37. Schroeder, G. N., and H. Hilbi. 2008. Molecular pathogenesis of Shigellaspp.: controlling host cell signaling, invasion, and death by type III secretion.Clin. Microbiol. Rev. 21:134–156.

38. Schroeder, G. N., N. J. Jann, and H. Hilbi. 2007. Intracellular type IIIsecretion by cytoplasmic Shigella flexneri promotes caspase-1-dependentmacrophage cell death. Microbiology 153:2862–2876.

39. Somerville, J. E., Jr., L. Cassiano, B. Bainbridge, M. D. Cunningham, and

VOL. 78, 2010 CHARACTERIZATION OF S. FLEXNERI msbB MUTANTS 411

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

R. P. Darveau. 1996. A novel Escherichia coli lipid A mutant that producesan antiinflammatory lipopolysaccharide. J. Clin. Investig. 97:359–365.

40. Somerville, J. E., Jr., L. Cassiano, and R. P. Darveau. 1999. Escherichia colimsbB gene as a virulence factor and a therapeutic target. Infect. Immun.67:6583–6590.

41. Suzuki, T., Y. Yoshikawa, H. Ashida, H. Iwai, T. Toyotome, H. Matsui, andC. Sasakawa. 2006. High vaccine efficacy against shigellosis of recombinantnoninvasive Shigella mutant that expresses Yersinia invasin. J. Immunol.177:4709–4717.

42. Toso, J. F., V. J. Gill, P. Hwu, F. M. Marincola, N. P. Restifo, D. J. Schwart-zentruber, R. M. Sherry, S. L. Topalian, J. C. Yang, F. Stock, L. J. Freezer,K. E. Morton, C. Seipp, L. Haworth, S. Mavroukakis, D. White, S. Mac-Donald, J. Mao, M. Sznol, and S. A. Rosenberg. 2002. Phase I study of theintravenous administration of attenuated Salmonella typhimurium to pa-tients with metastatic melanoma. J. Clin. Oncol. 20:142–152.

43. Turbyfill, K. R., A. B. Hartman, and E. V. Oaks. 2000. Isolation and char-acterization of a Shigella flexneri invasin complex subunit vaccine. Infect.Immun. 68:6624–6632.

44. van der Ley, P., L. Steeghs, H. J. Hamstra, J. ten Hove, B. Zomer, and L. vanAlphen. 2001. Modification of lipid A biosynthesis in Neisseria meningitidislpxL mutants: influence on lipopolysaccharide structure, toxicity, and adju-vant activity. Infect. Immun. 69:5981–5990.

45. van de Verg, L. L., C. P. Mallett, H. H. Collins, T. Larsen, C. Hammack, and

T. L. Hale. 1995. Antibody and cytokine responses in a mouse pulmonarymodel of Shigella flexneri serotype 2a infection. Infect. Immun. 63:1947–1954.

46. Venkatesan, M. M., M. B. Goldberg, D. J. Rose, E. J. Grotbeck, V. Burland,and F. R. Blattner. 2001. Complete DNA sequence and analysis of the largevirulence plasmid of Shigella flexneri. Infect. Immun. 69:3271–3285.

47. Venkatesan, M. M., A. B. Hartman, J. W. Newland, V. S. Ivanova, T. L. Hale,M. McDonough, and J. Butterton. 2002. Construction, characterization, andanimal testing of WRSd1, a Shigella dysenteriae 1 vaccine. Infect. Immun.70:2950–2958.

48. Venkatesan, M. M., and R. T. Ranallo. 2006. Live-attenuated Shigella vac-cines. Expert Rev. Vaccines 5:669–686.

49. Watson, P. R., A. Benmore, S. A. Khan, P. W. Jones, D. J. Maskell, and T. S.Wallis. 2000. Mutation of waaN reduces Salmonella enterica serovar Typhi-murium-induced enteritis and net secretion of type III secretion system1-dependent proteins. Infect. Immun. 68:3768–3771.

50. Way, S. S., A. C. Borczuk, R. Dominitz, and M. B. Goldberg. 1998. Anessential role for gamma interferon in innate resistance to Shigella flexneriinfection. Infect. Immun. 66:1342–1348.

51. Way, S. S., A. C. Borczuk, and M. B. Goldberg. 1999. Thymic independenceof adaptive immunity to the intracellular pathogen Shigella flexneri serotype2a. Infect. Immun. 67:3970–3979.

Editor: A. Camilli

412 RANALLO ET AL. INFECT. IMMUN.

on April 25, 2021 by guest

http://iai.asm.org/

Dow

nloaded from