Research Article 261

IntroductionCells have three primary sources of energy: chemical potential,electrical potential and mechanical potential and only the first twoare well studied. Mechanical stress is a universal variable thataffects multiple physiological and pathological processes, includingangiogenesis, osteogenesis, osteoporosis, muscle growth, musculardystrophy, aortic aneurysms and tumor growth (Kumar and Weaver,2009; Wallace and McNally, 2009) as well as embryonicdevelopment, including differentiation and apoptosis (Shyu, 2009;Vogel and Sheetz, 2006). The dissipation of stress from local sitesof stimulation and the transduction of stress into biochemicalsignals takes place at multiple length scales that range frombiomolecules to ballerinas and on a variety of time scales frommilliseconds (Bustamante et al., 2004; Kung, 2005; Na et al.,2008) to years. To understand the role of mechanical forces in cellbiology, we need to be able to measure the stress distribution inspecific proteins in vitro, in vivo and in situ because thecytoskeleton is inhomogeneous and anisotropic. Several years agowe developed a Förster resonance energy transfer (FRET)-basedforce cassette that utilized two GFPs (Venus and Cerulean) linkedwith an -helix that could be inserted into a variety of proteins(Fanjie Meng; stFRET, a novel tool to study molecular force inliving cells and animals, PhD thesis, State University of New Yorkat Buffalo, 2008); Meng et al., 2008). Iwai and Uyeda later used asimilar approach to investigate ligand-induced stress in myosin(Iwai and Uyeda, 2008).

The sensitivity of a fluorescent stress sensor is limited by theshot noise of the fluorophores and the thermal fluctuations of stress

in the host and the probe. If the force–distance relationship of thelinker is nonlinear, as occurs in subunit unfolding, the forcesensitivity can be increased at the expense of linearity. An idealprobe would also have the same mechanical compliance as its hostprotein so that it would cause minimal interference with the normalphysiological function of the host. With these goals in mind, weconstructed a force probe that uses a spectrin repeat as the linker.Termed ‘sstFRET’ (spectrin stFRET) we measured its forcesensitivity in solution using DNA springs (Zocchi, 2009). Theseare floppy loops of single-stranded DNA (ssDNA) covalentlybound to two distant sites in the probe. Because it is floppy, ssDNAdoes not cause much stress in the protein. However, whencomplementary DNA is added, the double-stranded DNA (dsDNA)has a much longer persistence length, which causes the loop tostraighten and push apart the fluorophores with 5–7 pN (Qu et al.,2010) and thus decreases FRET.

To examine in vivo stresses, we transfected HEK and BAECcells with actinin-sstFRET and used time-lapse imaging to measurethe stress distribution in time and space. We found that cellsspontaneously undergo large changes in stress that were often notcorrelated with changes in cell shape, and thus were previouslyundetected. Stimulating the cells with thrombin, which inhibitsmyosin II, rapidly induces a variety of inflammatory responses(Bogatcheva et al., 2002; Garcia, 1992) that make the cells rapidlycontract. This contraction was associated with decreased stress inactinin, suggesting that actinin is mechanically not in series withactin.

SummaryMechanical forces are ubiquitous modulators of cell activity but little is known about the mechanical stresses in the cell. Geneticallyencoded FRET-based force sensors now allow the measurement of local stress in specific host proteins in vivo in real time. For aminimally invasive probe, we designed one with a mechanical compliance matching that of many common cytoskeleton proteins.sstFRET is a cassette composed of Venus and Cerulean linked by a spectrin repeat. The stress sensitivity of the probe was measuredin solution using DNA springs to push the donor and acceptor apart with 5–7 pN and this produced large changes in FRET. To measurecytoskeletal stress in vivo we inserted sstFRET into -actinin and expressed it in HEK and BAEC cells. Time-lapse imaging showedthe presence of stress gradients in time and space, often uncorrelated with obvious changes in cell shape. The gradients could be rapidlyrelaxed by thrombin-induced cell contraction associated with inhibition of myosin II. The tension in actinin fluctuated rapidly (scaleof seconds) illustrating a cytoskeleton in dynamic equilibrium. Stress in the cytoskeleton can be driven by macroscopic stresses appliedto the cell. Using sstFRET as a tool to measure internal stress, we tested the prediction that osmotic pressure increases cytoskeletal stress.As predicted, hypotonic swelling increased the tension in actinin, confirming the model derived from AFM. Anisotonic stress alsoproduced a novel transient (~2 minutes) decrease in stress upon exposure to a hypotonic challenge, matched by a transient increase withhypertonic stress. This suggests that, at rest, the stress axis of actinin is not parallel to the stress axis of actin and that swelling can reorientactinin to lie more parallel where it can absorb a larger fraction of the total stress. Protein stress sensors are opening new perspectives incell biology.

Key words: Actinin, Fluorescence energy transfer, Force, FRET, Osmotic pressure, Sensor, Stress

Accepted 27 September 2010Journal of Cell Science 124, 261-269 © 2011. Published by The Company of Biologists Ltddoi:10.1242/jcs.071928

Visualizing dynamic cytoplasmic forces with acompliance-matched FRET sensorFanjie Meng and Frederick Sachs*Center for Single Molecule Biophysics, Department of Physiology and Biophysics, State University of New York at Buffalo, 3435 Main Street,Buffalo, NY 14214, USA*Author for correspondence (sachs@buffalo.edu)

Jour

nal o

f Cel

l Sci

ence

Using sstFRET we tested the hypothesis that osmotic stress incells is not confined to the membrane but is shared by thecytoskeleton (Spagnoli et al., 2008). We applied anisotonic stressto HEK and BAEC cells transfected with sstFRET-actinin. Thestress increased with swelling as predicted by atomic forcemicroscopy (AFM) (Spagnoli et al., 2008), graphically illustratingthat osmotic stress is distributed in three dimensions and notconfined to the two dimensions of the membrane. We also observeda novel transient (~2 minute) decrease in stress (increase of FRET)with hypotonic challenge, and an inverse increase in stress with ahypertonic challenge. This suggests that the actinin axis at rest isnot parallel to the force generating the actin filament axis, but thatthe actinin axis becomes more parallel as the stress increases.

ResultsDevelopment and characterization of sstFRETFig. 1A shows the basic structure of the sstFRET cassette. Thelinker was subcloned from non-erythrocytic (-fodrin) isoform 1(NCBI reference sequence: NP_001123910), using the sequencefrom amino acid phenylalanine 1238 to lysine 1334. We added twoglycines flanking each end of the repeat to provide flexibility. We

then characterized the physical properties of purified sstFRETprotein by modifying the linker (An et al., 2006; Ortiz et al., 2005)with urea, trypsin and temperature (supplementary material Fig.S1A–C). The fluorophores are remarkably resistant to all threeperturbations (Fanjie Meng; stFRET, a novel tool to study molecularforce in living cells and animals, PhD thesis, State University ofNew York at Buffalo, 2008); Meng et al., 2008). The linker unfoldedupon treatment with 1–8 M urea, decreasing FRET as the probesmoved apart. Cleavage of the linker with trypsin eliminated FRET(supplementary material Fig. S1D,E), but surprisingly, elevatedtemperature reversibly increased FRET efficiency. This increasecould be caused by increased thermal energy acting to bend thelinker and thus bring the fluorophores closer together.

To investigate the force sensitivity of sstFRET, we pushed thefluorophores apart using DNA springs (Zocchi, 2009) linked to theexternal cysteines in each GFP. The contour length of a 60mer ofssDNA is ~20 nm and the persistence length is about 1 nm. Becausethe end-to-end distance of sstFRET is ~12 nm, the ssDNA loop isfloppy. Adding a complementary strand of DNA creates dsDNAwith a persistence length of ~50 nm, pushing apart the twofluorophores with ~20 kT of free energy (k being the Boltzmannconstant and T temperature) (Tseng et al., 2009), comparable to thedifference in energy between the folded and unfolded configurationsof a 100 amino acid protein (Zocchi, 2009). Zocchi’s group hasshown that the stress produced by dsDNA in this configuration is5–7 pN, limited in magnitude by kinks that develops in highlycurved dsDNA (Qu et al., 2010). The most complaint part ofsstFRET is the spectrin repeat that will rapidly unfold at ~20 pN(Law et al., 2003). The GFP fluorophores are rigid and capable ofwithstanding 100 pN without unfolding (Dietz and Rief, 2004).

To drive the probe with the DNA springs, we first made sstFRETprotein by fusing the sstFRET gene to vector pET-52b (+)(Novagen). We then purified the protein and covalently attached a60mer of thiolated ssDNA (cf. Fig. 1A) (Hwang et al., 2009). Thereaction of thiolated DNA to the protein was readily visualized byelectrophoresis (Fig. 1B). Under UV light, sstFRET fluorescesgreen and DNA stained with ethidium bromide fluoresces red, butwhen sstFRET is bound to DNA, the complex fluoresces yellow.Due to the negative charges of DNA added to the protein, thecomplex (Fig. 1B, yellow band) migrates faster than the freeprotein (Fig. 1B, green band). We studied plain sstFRET andsstFRET bound to DNA in solution.

Donor (Cerulean) excitation was at 433 nm and the emissionwas scanned from 450 nm to 600 nm. Fig. 1C shows the spectrawith the amplitudes normalized to the Venus emission peak. Addingthe ssDNA loop slightly reduced the FRET ratio relative tounliganded sstFRET (0.40–0.6, respectively) (Fig. 1D). The ssDNAmight have pushed the fluorophores apart by a small amount orchanged their relative angles. Whatever the cause, this energycould be released by cleavage of ssDNA with nucleases (Fig.1A,C,D). Adding the complementary strand of DNA pushed thefluorophores apart, decreasing the FRET ratio to ~0.3. The stressfrom dsDNA could be relieved by cleavage with EcoRI becausethe cut site is in the middle of the loop. Thus, sstFRET is sensitiveto forces in the physiologically relevant range and presents a widedynamic range so that 5–7 pN can cause a 50% decrease in FRET.

Measurements in living cellsActinin is a cytoskeletal crosslinker that forms homodimers betweenparallel actin filaments, where it functions as support scaffolding(Sjoblom et al., 2008). As a member of the spectrin superfamily,

262 Journal of Cell Science 124 (2)

Fig. 1. sstFRET and in vitro DNA stretching. (A)Scheme of sstFRETstructure and the DNA stretching experiments. Cyan represents the donorCerulean and yellow the acceptor Venus. The black coiled-coil part representsthe spectrin repeat domain and the red lines denote DNA. Purple arrows showthe direction of force and the width of the arrows indicates the force. Yellowarrows show energy transfer of sstFRET and the arrow width indicatesefficiency. (B)sstFRET–DNA complex on an agarose gel. First lane (right):the yellow upper band is the bound complex and the red lower band isunbound DNA. The green band in the second lane is sstFRET, and the thirdlane is free DNA (red). (C)Spectra of the complex before and after varioustreatments. Excitation at 433 nm and emission scan at 450–600 nm. Thespectra intensities were normalized to the Venus acceptor emission peaks toemphasize the changes in acceptor emission. (D)Calculated FRET ratio ofsstFRET–DNA complexes. One-tailed t-tests show that the sstFRET+ssDNAFRET ratio is significantly greater than sstFRET+dsDNA ratio (P<0.01).Values are means + s.e.m. (n3). Enzyme treatments with nuclease and EcoRIdid not affect the FRET ratio of the protein cassette (C,D).

Jour

nal o

f Cel

l Sci

ence

actinin is made of four spectrin repeat domains, an actin bindingdomain and a calmodulin homology domain (Golji et al., 2009).sstFRET with its spectrin repeat linker should be able to monitorstress in actinin with minimal perturbation of the host, and wegenetically incorporated sstFRET between spectrin repeat domains1 and 2 in -actinin (Fig. 2, cartoon inset). Transfecting BAEC andHEK cells with plasmids encoding actinin-sstFRET producedfluorescent cells that were sensitive to mechanical stress. Ascontrols, we expressed both the stress-free plain cassette and a 1:1mixture of Venus and Cerulean.

To calculate the FRET efficiency we explored methods thatwere reliable, independent of concentration and insensitive to thedifferential bleaching rates of the donor and acceptor (cf.supplementary material Figs S2–S4). We found that the best methodwas to measure the donor signal with donor excitation and theacceptor signal with acceptor excitation. This avoided the need foradditional bleed-through corrections (see Materials and Methods).After subtracting background, we divided the acceptor image bythe donor to obtain the FRET ratio. From the ratio we calculatedthe FRET efficiency of the unstressed probe to be �26% in bothsolution and in cells.

As expected for a crosslinked donor and acceptor, cellsexpressing plain sstFRET showed a significantly higher FRETratio than cells expressing a 1:1 mixture of the individual donorsand acceptors (Fig. 2A,B). Surprisingly, resting cells expressingactinin-sstFRET showed higher FRET ratio (the fluorophoreswere closer or better aligned) than cells expressing the sstFRETcassette alone. This might be caused by actinin homodimerizationcompressing sstFRET or altering the fluorophore angles (see alsosupplementary material Fig. S1C). We ruled out intermolecularenergy transfer between different actinin dimers because theFRET ratio was independent of expression level (supplementarymaterial Figs S2, S3). Energy transfer between antiparallel actinins

within a dimer was also unlikely because the fluorophores are toofar apart. Unstressed free sstFRET in cells had a FRET ratio of1.42, similar to that of the protein in solution. A 1:1 mixture offree donors and acceptors in cells gave a FRET ratio (1.05) thatwas the same as the mix of the two fluorophores in solution (Fig.2C,D).

Actinin-sstFRET localization in BAEC and HEK cellsTo examine whether inserting a relatively large probe like sstFRETinto actinin affects the cell biology, we compared the distributionto chimeric terminally labeled actinin-EGFP (a more traditionallabel) (Fig. 3). The actinin distribution of both labels in HEK cellswere indistinguishable, showing smooth actin fiber networks taggedby actinin (Fig. 3A). In BAECs, both actinins displayed a periodiclocalization along actin fibers (Fig. 3B). Cells de-membranatedwith Triton X-100 retained the actinin localization seen in theliving cell. The distinct localization patterns of actinin betweenHEKs and BAECs imply divergent roles for actinin stemmingfrom the time of differentiation.

Colocalization of actinin-sstFRET with actin stress fibersand focal adhesionsTo further test that labeled actinin did not interfere with normalphysiological function, we examined how actinin colocalized toboth focal adhesions and actin fibers (Fig. 4) using fixed cells.We expressed free sstFRET (a control), actinin-EGFP and actinin-sstFRET in BAECs and then fixed and stained the cells withphalloidin–Alexa Fluor 568. Both actinin-sstFRET and actinin-EGFP displayed the same periodic distribution along actin (Fig.4A). Because actinin scaffolds actin at focal adhesions, andvinculin is well known to bind to focal adhesions (Coll et al.,1995), we also used anti-vinculin antibodies with a secondaryantibody conjugated to Alexa Fluor 633 to colabel focal adhesions

263Real time detection of mechanical force in cytoskeleton

Fig. 2. FRET measurements of sstFRET in living cellsand in solution. (A)Images of cells expressing actinin-sstFRET, sstFRET alone and Venus+Cerulean 1:1.Cerulean/donor intensity is shown in cyan andVenus/acceptor intensity in yellow; calibration bar of a16 color lookup table is given on the right. The cartooninset shows the homologous domains of actinin and therelative position of the sstFRET cassette.(B)Comparison of the FRET ratio of the three cellgroups. The baseline was set at 1.0 and the ratioobserved with no energy transfer. (C)Solution imagesmeasuring donor, acceptor and FRET ratio images ofsstFRET protein, and a 1:1 mixture of donor andacceptor fluorophores in solution. (D)Histograms ofpixel counts showing no saturation of any channel. Aone-tailed t-test shows that FRET of the actinin-sstFRETgroup is greater than that of the free sstFRET group, andthat the sstFRET group is greater than that of theVenus+Cerulean coexpressing group (P<0.01). Scalebar: 10m. The lookup table is 16 colors.

Jour

nal o

f Cel

l Sci

ence

(Fig. 4B). Vinculin colocalized with both actinins but not withfree sstFRET, confirming that actinin-sstFRET is an innocuousprobe of actinin stress.

Cytoskeletal stresses in living cellsContraction, migration and mitosis are accompanied by biochemicalchanges that are likely to be accompanied by mechanical changes.We recorded 1000 minutes of time-lapse images of labeled HEKcells in normal media at room temperature (see Materials andMethods) (Fig. 5A,B). Looking at the cells in Fig. 5, the FRETratio increased slightly during the first 100 minutes (to frame 5),then decreased until 800 minutes (frame 40), and then increasedagain during the next 200 minutes. A video clip of the time seriesshows the correlation between stress and structural remodeling(see supplementary material Movies 1 and 2). We found a widevariety of stress modulation profiles, even between adjacent cellsin the same dish (Fig. 5C). For example (Fig. 5), Cell 1 showed agradual decline increase of stress. Cell 5 showed a relaxation ofstress and then a plateau that remained stable to the end of the timeseries. Cells 2, 3 and 4 displayed more complex patterns in timeand space (Fig. 5C). These widely variable gradients emphasizethe heterogeneity of clonal cells. We observed no time-dependentchanges in FRET for cells expressing the free probe, which arguesthat the stresses we observed arose from mechanical couplingthrough actinin (Fig. 5D,E). The sstFRET signals not only displayed

the slow gradients of the time-lapse series but also high frequency(seconds) fluctuations demonstrating that the stress in actinin isdynamic. There were no such fluctuations in cells expressing thefree cassette.

Thrombin induces rapid changes in actinin stressThrombin causes endothelial cell contraction by inactivating myosinlight chain phosphatase (Essler et al., 1998) and we studied howthese changes affect the stress in actinin. We observed the citedcontractions in cells expressing actinin-sstFRET (Fig. 6A).Thrombin produced an immediate decrease of tension followed bya sustained increase. The increase appears to represent a relaxationof constitutive stress by contraction of parallel myosin (Fig. 6A,FRET ratio plotting panels). Thrombin also reduced the magnitudeof force fluctuations compared to the control cells (Fig. 6B)consistent with an inhibition of myosin activity. Cells expressingfree sstFRET also contracted with thrombin, but they exhibited nochange in FRET (Fig. 6C). These results support use of our FRETcalculation methodology ratio because there were large changes incell anatomy but no change in FRET for the free probe.

Migrating cellsMigrating cells generate forces on the substrate that are larger atthe leading edge than at the trailing edge (du Roure et al., 2005).These forces must be matched by internal stresses in thecytoskeleton, and we found that actinin had higher stress at theleading edge and lower stress at the trailing edge (Fig. 6A,D,FRET ratio image). As mentioned above, actinin in these cellsshowed large amplitude and high speed force fluctuations (compareFig. 6D and 6E).

Force loading on actinin during an osmotic challengeAFM experiments suggest that osmotic stress is not confined to thecell membrane but is supported mostly by the cytoskeleton(Spagnoli et al., 2008). We tested the prediction by measuringactinin stress in cells subjected to anisotonic solutions. Initially wechallenged HEK cells (Fig. 7) and BAEC cells (Fig. 8) withdistilled water to exaggerate any effects. Some HEK cells quicklylysed (although BAECs could withstand distilled water for morethan an hour). To allow for more stable measurements with HEKcells, we titrated them with 30%, 50%, 75% and 85% distilledwater (in saline) (Fig. 7A). For the first 2 minutes in 30% distilledwater, we observed a transient increase in FRET, implying adecrease in tension. Although we thought this might be an effectof decreasing local ionic strength as water entered the cell, wevaried ionic strength on sstFRET in solution and found no effect.The paradoxical transient response to a hypotonic shock has notbeen previously reported. As discussed below, the effect mightrepresent a reorientation of actinin relative to the axis of actintension. After the transient response, the cells began to swell (asexpected) and actinin stress increased.

We then switched to 50% distilled water for 20 minutes and then75% distilled water, and found that the FRET ratio continued todecline. After 10 minutes of 75% distilled water, the FRET ratio haddecreased by more than 20% (from 1.8 to 1.4; Fig. 7B,C). Whencells were returned to bath saline, they shrank and the stress relaxed.We then performed another round of challenges using 75% and 85%distilled water. The FRET ratio showed a larger decline (31%, froma ratio of 1.6 to 1.1) compared with the original challenge (1.1 wasthe FRET ratio observed in cells co-transfected with a 1:1 mixtureof Venus and Cerulean; cf. Fig. 2). The low FRET ratio could be the

264 Journal of Cell Science 124 (2)

Fig. 3. Protein distribution of actinin-sstFRET and actinin C-terminal–EGFP. Studies were carried out using (A) HEK and (B) BAEC cells with andwithout Triton X-100 treatment to remove membranes. Actinin-sstFRETdistributions are displayed as the Venus/acceptor images and the actinin–EGFPdistributions as EGFP images. The distribution of labeled actinin is similarwith both probes. Enlarged images of the boxed areas are shown on the right.Scale bar: 10m.

Jour

nal o

f Cel

l Sci

ence

265Real time detection of mechanical force in cytoskeleton

Fig. 4. Colocalization of actinin-sstFRET to actin fibers and focal adhesions in BAECs. (A)Colocalization of sstFRET, actinin–EGFP and actinin-sstFRETwith actin stained with phalloidin–Alexa Fluor 568. YFP panels show signals from the acceptor Venus in sstFRET and actinin-sstFRET, and signals from EGFP inactinin–EGFP indicating the localization of these chimeric proteins. Phalloidin panels show actin fibers. (B)Colocalization of sstFRET, actinin–EGFP and actinin-sstFRET with vinculin immunostained by anti-vinculin and Alexa-Fluor-633-conjugated goat anti-rabbit secondary antibodies. Arrows point to the focal adhesions.Scale bar: 10m.

Fig. 5. Stress modulation in actinin in resting HEK cells. (A)Montage of FRET ratio images (left panel, 16 color lookup table with a calibration bar from 0 to2.5) and Venus/acceptor images (right panel) from a 1000-minute time series (50 frames at 20-minute intervals). Venus and Cerulean image intensities wereassigned to yellow and cyan, respectively. (B)Plot of the normalized average value of Venus/acceptor intensity, Cerulean/donor intensity and FRET ratios fromeach frame showing continuous stress changing in actinin. All data were normalized to the value of the first frame. In the first 25 frames, the sstFRET protein levelwas constant (green trace), the FRET ratio decreased (black trace), the Cerulean signal (cyan trace) increased due to the corresponding decrease in FRET. Fromframes 25 to 50, protein concentration gradually decreased and the FRET ratio also decreased until frame 40 and then started to increase. (C)The FRET ratios fromfive different cells over a 1000-minute time series. The cells displayed distinct time dependencies of the stress: cell 1, increasing stress; cell 2, decreasing stressduring the first 5 time frames then increasing until time frame 40, then decreasing again; cell 3, the stress remained constant (also showing that bleaching was not aproblem); cell 4, the stress decreased then flattened at frame 30; cell 5, the stress decreased then increased at frame 22, then flattened until frame 50. (D)Cellsexpressing free sstFRET as control for stress modulation in actinin. Montage of FRET ratios (left panel) and Venus/acceptor intensities (right panel) from a 1000-minute time series of an HEK cell expressing free sstFRET. Images show that stress-free sstFRET cannot sense any stress changing in cytoskeleton, ruling out anyartificial effects in A. (E)Plot of the normalized average value of Venus/acceptor intensity, Cerulean/donor intensity, and FRET ratios from each frame in D,showing the flat FRET ratio through the entire time series despite the fluctuations of donor and acceptor intensity.

Jour

nal o

f Cel

l Sci

ence

result of extreme osmotic pressure unfolding the spectrin linker andstretching it sufficiently so that there was no significant energytransfer. These osmotic effects on FRET were largely reversible,with FRET returning to 1.5 in normal saline (Fig. 7C). Thus, therewas no lasting dissociation of actinin from the network or breakdownof the network itself.

Were these FRET changes due to mechanical stress in actinin orpossibly the result of another environmental change? We appliedsimilar challenges to cells coexpressing the unlinked donor andacceptor (Fig. 7D,F) and to cells expressing the free cassette (Fig.7E,F). These cells showed similar morphological changes but nosignificant changes in FRET; the FRET changes were clearlycoupled through actinin. This unstressed probe data again supportsthe FRET calculation method because large changes in cell volume(probe concentration) did not change FRET.

We saw similar results in BAECs (Fig. 8), but because BAECscould withstand 100% distilled water, we simply followed theirbehavior over time. We again detected the transient increase inFRET (decrease in tension). After 1 hour in distilled water, thecells were quite swollen and the actinin stress increased by morethan 20% (FRET ratio changing from 1.8 to 1.4; Fig. 8A,B).Returning cells to bath saline caused them to shrink and to releasethe force on actinin (the FRET ratio increased by 14%, from 1.4to 1.6; Fig. 8B,C). A second round of exposure to 100% distilledwater swelled the cells even more dramatically, showing that theoriginal stresses produced some long term remodeling. Followingthis second round of distilled water stimulation, the cells begandetaching from the substrate and were fully rounded up within 3hours. During this time, the actinin stress increased (FRET ratio

from 1.6 to 1.3) and, as observed with the HEK cells, there was aplastic deformation of the cytoskeleton. The ability of BAECs towithstand an extreme osmotic challenge shows that they have amore robust cytoskeleton than HEK (under maximal stress theFRET in BAECs was 1.3 whereas that of HEKs was 1.1). Themechanical differences were mirrored by the differences in actinindistribution between the two cell types (cf. Fig. 2), but the basicintegrity of the cytoskeleton in both cell types was preservedbecause we could see labeled fibers, even after the cells had beenin distilled water for an hour (Fig. 8D).

The response of cells to a hypertonic challenge is more complexthan that of a hypotonic challenge as a result of fiber buckling andexcluded volumes. However, for the sake of generality, wechallenged both HEKs and BAECs with hypertonic stress(supplementary material Fig. S5). We again observed theparadoxical transient response, but in this case it was a transientincrease in tension. After 2 minutes, the cells shrank and thetension decreased. Returning the cells to normal saline caused thetension to increase again as actinin was stressed by swelling(supplementary material Fig. S5).

DiscussionAn ideal mechanical sensor has to satisfy four requirements:genetic coding, force sensitivity, compliance that matches the hostprotein, and no interference with normal function of the host.With a FRET pair that is linearly elastic, the maximum sensitivityoccurs when the nominal spacing is the characteristic Försterdistance (Fanjie Meng; stFRET, a novel tool to study molecularforce in living cells and animals, PhD thesis, State University of

266 Journal of Cell Science 124 (2)

Fig. 6. Thrombin decreased cytoskeletonstress and reduced tension fluctuations inBAECs. (A)BAECs expressing actinin-sstFRET were recorded at 20-second intervalsfor 100 frames. Thrombin (5 units/ml) perfusionwas started at the 20th time frame as marked bythe vertical dotted line. Donor, acceptor andFRET ratios of the first frame for one cell areshown in the images on the left, and the FRETratios of three individual cells are plotted on theright. (B)Control perfusion using plain salineproduced no effect. The FRET ratios of threeindividual cells are plotted, and the verticaldotted line marks the 20th time frame after theinitiation of perfusion. (C)Control BAECsexpressing free sstFRET and treated withthrombin showed no change, illustrating that thethrombin effect was transmitted through actinin.(D)Actinin-sstFRET displayed a wider stressfluctuation and migrating cells show the stressheterogeneity in the leading and lagging edges.Actinin-sstFRET BAECs monitored at 3-secondintervals for 100 frames. The first frame ofFRET ratio, Venus/acceptor and Cerulean/donorchannels are given on the left, and the FRETratios of three individual cells are plotted on theright. The inset is the calibration bar of a 16color lookup table. (E)Control, cells expressingfree sstFRET displayed no FRET fluctuations,indicating that expression of sstFRET withactinin is necessary for observation of thephysiological effects.

Jour

nal o

f Cel

l Sci

ence

New York at Buffalo, 2008); Meng et al., 2008). A simplecalculation shows that, at that operating point, FRET is linear withstrain. If the linker were made more compliant in an effort toincrease the force sensitivity, the probe would undergo largerthermal fluctuations that would tend to mask the improvement.However, if the force–distance relationship were nonlinear, becauseof domain unfolding (Ortiz et al., 2005), the relationship of FRETefficiency to strain could be improved, with a sacrifice in linearity.However, the issue of linearity is not crucial for experiments withoptical imaging because these do not measure the response ofsingle molecules, but the averages taken over the optical voxel.The voxel volume contains many molecules whose stress fluctuatesin time and hence is also averaged over the duration of theexposure. The voxels are likely to contain regions with differentstress as well as unlabeled components resulting from endogenousgene expression. Our experiments have focused on macroscopicgradients of stress (micrometer scale) and not on molecular stress.The genetic encoding allows us to specify that we are recordingaverages from a specific chemical species, but the finite resolutionof optical imaging will not allow us to measure the stress in agiven molecule.

The force sensitivity of sstFRET in solution measured withDNA springs showed that FRET is well modulated by forces in therange of 5–7 pN, forces clearly relevant to physiological levels ofstress (cf. Fig. 1). The compliance of sstFRET will be comparableto that expected for -actinin that has four of these repeats. Thefluorophores themselves are stiff and will not be significantlydeformed by biological stresses (Dietz and Rief, 2004). Thecorrelation of intracellular stress to external physiological stress

was made clear by Johnson and colleagues (Johnson et al., 2007),who showed that fluid shear stress applied to living cells canunfold spectrin repeats exposing cryptic cysteine residues withinthem.

We have shown that sstFRET can be incorporated into proteinswith no changes in distribution relative to the more commonterminal EGFP label (Figs 2–4). This result agrees with our earlierdata on the probe stFRET that contains a helical linker (FanjieMeng; stFRET, a novel tool to study molecular force in living cellsand animals, PhD thesis, State University of New York at Buffalo,2008); Meng et al., 2008). We have since created transgenicCaenorhabditis elegans with the probe inserted into collagen 19.When properly located in the sequence, the collagen distribution isnormal and the worms behave normally (Meng et al., 2011, inpress). Clearly the stress sensors can be made innocuous and canbe used to assess protein stresses in cells, tissues, organs andanimals.

The distinct distribution patterns of labeled actinin betweenHEKs and BAECs shows that gene expression and proteinlocalization were fixed at an embryonic stage and remainedremarkably stable for many passages in culture. What is thephysiological utility of these different distributions? As kidneycells, HEKs might have evolved to be sensitive to osmotic stress,whereas BAECs evolved to withstand constitutive shear and wallstress. BAECs could withstand distilled water for hours (atransmembrane pressure >5 Atm) (Spagnoli et al., 2008; Wan etal., 1995) with a minimal shape change (Figs 7, 8). Thus, there arestrong attachments between the upper and lower cell membranes,and these same links will make them resistant to shear stress.

267Real time detection of mechanical force in cytoskeleton

Fig. 7. Hypotonic challenge to HEKs stresses actinin. (A)Time-lapseimages of the FRET ratio (upper panel), Venus/acceptor (middle panel)and Cerulean/donor (lower panel) images of actinin-sstFRET cellsunder different hypotonic challenges. The treatments were 30% distilledwater (DW) for 20 minutes, then 50% DW for 20 minutes and 75% DWfor 10 minutes; then the bath was exchanged to saline for 30 minutes;and then 75% DW for 20 minutes, 85% DW for 10 minutes; then salinefor 30 minutes. FRET ratio images are displayed with a 16 color lookuptable with a calibration bar from 0 to 2.5. Venus and Cerulean imageintensities were assigned the colors yellow and cyan. (B)Mean valuesof Venus/acceptor, Cerulean/donor and FRET ratios for each frame of asingle cell. Data were normalized to the first frame. (C)FRET ratio ofactinin-sstFRET shows an opposite polarity transient response and animmediate increase of FRET during the first 2 minutes. Grayshadowing indicates distilled water and red shadowing indicates saline.(D,E)Data taken from a time-lapse series of FRET ratio images of acell coexpressing Venus and Cerulean (D) and expressing plainsstFRET (E). The latter show no swelling, indicating that the observedchanges in FRET with actinin-sstFRET arose through coupling toactinin. Cells were given a distilled water challenge then perfused withnormal saline, and this cycle was repeated twice. Images are displayedas in A. (F)Average FRET ratio plot of each frame of a cellcoexpressing Venus and Cerulean (upper panel) and plain sstFRET(lower panel) showing the flat FRET ratio through the time series. Thehypoosmotic challenge cycles are marked as in B. Scale bar: 10m.

Jour

nal o

f Cel

l Sci

ence

Stresses in actinin in resting cells were often not correlated withobvious changes in cell shape. When cells underwent contractionor expansion during random probing for migration (as in Fig. 5 andsupplementary material Movies 1 and 2), sstFRET did not registera change in stress. Only after the cells started to migrate (see Fig.5A,B, frame 23 and supplementary material Movies 1 and 2) didwe observe significant changes. The minimal stress observed duringrandom probing might partly reflect averaging over regions withnonuniform stress, i.e. FRET increases in one region and decreasesin another. The paradoxical transient responses we observed withosmotic stress suggest that, at rest, the actinin axis is not parallelto the actin axis, and that increasing stress pulls on it and aligns itin a more parallel orientation allowing it to share more tension.Nearly all materials have a positive Poisson constant – objects getthinner when stretched – so that stretching actin can also causeorthogonally oriented actinin to be compressed. In BAECs, weobserved large dynamic fluctuations of stress with lifetimes ofseconds (Fig. 6). These fluctuations represent the active dynamicsof the cytoskeleton and are not the result of photon noise becausethey are not seen with stress-free sstFRET (a detailed analysis ofthe actinin dynamics is in progress).

The results with osmotic challenge support the hypothesis thata significant component of osmotic stress is spread in threedimensions within the cytoskeleton and is not confined to themembrane (Spagnoli et al., 2008). Thus, the cell behaves not likea bag but like a sponge enclosed in a semipermeable membrane.The stress probes are clearly opening new areas of cell biology. Wehave begun to utilize the probes to explore stress in organs andwhole animals by making transgenic mice containing labeledactinin driven by a universal actin promoter. These mice not onlyprovide prelabeled cells of all tissues, but permit organ levelanalysis of stresses in real time. The mice develop and reproducenormally, emphasizing the innocuous nature of the actinin labeling(F.M. and F.S, unpublished results). We are now building atransgenic library with many different labeled cytoskeletal andextracellular proteins.

ConclusionsThe compliance-matched sstFRET sensor is reliable, displays highsensitivity, and causes no interference with host protein function.The probe has revealed time-dependent spatial gradients of stressthat promise to provide insights into a wide range of cell biology.

Materials and MethodsProtein–DNA complex synthesis and in vitro DNA stretchingA 60mer DNA, [AminoC6] GAGTGTGGAGCCTAGACCGTGA AT TCCTGGCAG -TGGTGCGACCGACGTGGAGCCTCCCTC [AmC7Q], and the complementarystrand were purchased from Operon (Huntsville, AL). The oligo has an aminomodification on both ends and an EcoRI cutting site in the middle. The sequence wasselected on the basis of a previously published study (Wan et al., 1995). 15 nmol ofamino-tagged DNA were incubated with 300 nmol heterobifunctional crosslinkerSMPB (succinimidyl 4-[p-maleimidophenyl] butyrate) (Pierce, Rockford, IL) in 20l conjugation buffer (100 mM sodium phosphate, 150 mM NaCl and 1 mM EDTAat pH 7.5) for 2 hours at room temperature. The amino groups of the DNA react withthe NHS-ester group of the crosslinker. The reaction mixture was passed twicethrough protein desalting spin columns (Pierce, Rockford, IL) to remove excessuncoupled crosslinkers. The DNA–crosslinker construct was then incubated with 1.5nmol of purified sstFRET protein in conjugation buffer with total volume 50 l. Bothdonor and acceptor in sstFRET have two free sulfhydryl groups at cysteines 48 and70. The 70 position is concealed inside the -barrel and inaccessible, and the 48position is only partially exposed to solution. In order to speed the reaction of themaleimides of the DNA–crosslinker complex to sulfhydryls at position 48, weincubated the mixture at 37°C for 30 minutes. Because DNA doesn’t interfere withthe FRET measurements, no further purification was necessary. To stretch sstFRET,15 nmol of complementary DNA was added to protein–single strand DNA complex.The solution was left at room temperature overnight to complete the annealing.

Cell imaging and FRET ratio calculationCell imaging was performed on an inverted Zeiss Axio Observer A1 equipped withan Andor Ixon DV897 back-illuminated cooled CCD camera. The images at thedonor emission wavelengths were recorded side by side using a Dual View(Photometrics) splitter with excitation alternately applied to the donor and acceptorwith appropriate excitation filters.

We calculated the FRET ratio R using the relationship:

where Ia is the acceptor emission intensity with acceptor excitation and Id is thedonor emission intensity with donor excitation. The acceptor intensity scales withprotein concentration and the donor signal scales with both protein concentration andquenching due to FRET. To calculate R without energy transfer, we used a dilute 1:1mixture of the two fluorophores and obtained RR01.05 both in solution

R = Ia / Id , (1)

268 Journal of Cell Science 124 (2)

Fig. 8. Hypotonic stress increases the force on actinin-sstFRET in BAECs. (A)Time-lapse images of the FRET ratio(upper panel), Venus/acceptor (middle panel) andCerulean/donor (lower panel) in cells challenged with distilledwater (DW; 16 color lookup table with a calibration bar of 0 to2.5; Venus and Cerulean assigned to yellow and cyan).(B)Average value of Venus/acceptor, Cerulean/donor and FRETratio of the cell in each frame. (C)FRET ratio of actinin-sstFRET in BAECs under hypoosmotic challenge showing theopposite polarity transient during the first 2 minutes afterhypotonic shock. Data are normalized and presented asdescribed in Fig. 4. (D)Actinin-sstFRET BAEC cell underdistilled water shock. Periodicity in the stress fibers remainsvisible even after 1 hour of exposure to distilled water and 1hour saline recovery so that the actin/actinin structure is notdestroyed by this extreme stimulus.

Jour

nal o

f Cel

l Sci

ence

(supplementary material Fig. S4) and in cells (Fig. 2). The FRET ratio of sstFRETin both cells (Fig. 2) and solution (supplementary material Fig. S4) was RRFRET1.42.

The FRET efficiency E is defined as the relative change of intensity referenced tothe same pair with no energy transfer:

where the subscript dFRET denotes the donor signal with energy transfer and dFRET

denotes the donor signal with no energy transfer. Combining equations (1) and (2):

In equation (3), IaFRET is the acceptor signal with no energy transfer, and IaFRET isacceptor signal with energy transfer. Because the acceptor signal only depends upona concentration that is fixed at a given point in time, IaFRETIaFRET and RFRET is theratio of the intensities without energy transfer, so that RFRETR0 is obtained from the1:1 mixture of fluorophores.

Simplifying equation (3):

which yields an efficiency for unstressed sstFRET of 26%.For time series image acquisition, we used Metamorph software and a Lumencor

LED illuminator from BioVision (Mountain View, CA). The 433 nm and 515 nmexcitation power was set at 25% with an exposure time of 50 milliseconds for eachtime point, at 20 minutes intervals, over a total experimental time span of 1000minutes.

Gene construction and protein purificationpEYFP–C1 Venus and pECFP–C1 Cerulean plasmids were generous gifts from DavidW. Piston. sstFRET gene construction was as described in our previous publication(Meng et al., 2008). The spectrin repeat linker was subcloned from non-erythrocytic 1(-fodrin) isoform 1 by primers 5�-GTACAGAGGAGATCTGGAGGCTTCCACA-GAGATGCTGATG-3� and 5�-GTCACCCAAGAATTCACGCCTCCCTTTGC-CTTGCGCTG-3�. Then, sstFRET gene was subcloned into prokaryotic expressionvector pET-52b (+) (Novagen, Gibbstown, NJ) for protein purification. BamHI andNotI restriction sites were introduced into sstFRET DNA fragment by primers 5�-GCTTCAGCTGGGATCCGGTGGTATGGTGAGCAAGG-3� and 5�-CCAGAT -CGCGGCCGCTTAGTGGTGATGATGGTGGTGATGATGCTTGTACAGCTCGTCC-3�. An 8-histidine tag followed by TAA stop codon was inserted in front of the NotIsite to make sure that the tag was located in the C-terminal and well-exposed tosolution.

To create chimeric gene constructs of -actinin, we subcloned the actinin geneinto pEYFP–C1 vector, where the YFP gene was removed beforehand. The primersand restriction enzyme sites introduced into PCR products for subcloning were:Actinin, sense, 5�-CAGATCCGCTAGCATGGACCATTATGATTCTCAGCAAA -CC-3� with NheI, anti-sense, 5�-GATCCCGGGCCCGCGGTACCTTAGAGGT -CACTCT CGCCGTAC-3� with KpnI. sstFRET were inserted into actinin at position300, which was located in the linker domain between first and second spectrin repeatdomains by restriction sites AgeI and NotI. The restriction enzyme sites wereintroduced into the host proteins using the site-directed mutagenesis kit fromStratagene (La Jolla, CA) with the host protein amino acid unchanged. All constructsequences were confirmed by DNA sequencing at Roswell-Park Cancer Institute(Buffalo, NY).

FRET ratio calculation and cell imagingWe used a fluorescence spectrometer (Aminco·Bowman series 2 luminescencespectrometer) to measure the fluorescence of purified proteins in solution. Allpurified proteins were exchanged into 10 mM Tris-HCl buffer before furtherprocessing. The measurement was performed at room temperature with 200 l of 1M protein. The spectrometer was set to: 4 nm bandpass, 1 nm step size, and 450–600 nm emission scan range with excitation at 433 nm. We used the FRET ratio Ras measure of the energy transfer index: RIAsstFRET 527nm/IDsstFRET475nm in whichIAsstFRET is the acceptor emission signal of sstFRET with excitation of the acceptorand IDsstFRET is the donor emission signal with excitation of the donor.

Cells were observed at room temperature using an Axio Observer A1 invertedmicroscope (Carl Zeiss, Thornwood, NY) and images were captured by an Ixon,cooled and back-illuminated, CCD camera (Andor, Belfast, UK). Donor and acceptorsignals were obtained using the donor filter set ET430/24X, ET470/24M and acceptorfilter set ET500/20X, ET535/30M (Chroma, Rockingham, VT). Images wereprocessed with ImageJ (http://rsb.info.nih.gov/ij). FRET ratio images were madeusing the equation RIVenus acceptor/ICerulean donor. Because the donor and acceptorchannel were obtained independently with the specified filter sets, we needed nobleed-through correction. The donor and acceptor images were background subtractedbefore calculating the FRET ratio.

Cell culture, transfection and protein expressingBAEC and HEK cells were cultured in Dulbecco’s modified Eagle’s medium (GIBCOInvitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and antibiotics.Cells were spread on 3.5-mm coverslips and allowed to grow for 24 hours. Fugene 6

E =IaF RET

RFRET− IaF RET

RFRET

IaFRETRFRET

, (3)

,E = 1 −R0RFRET

(4)

E = ( IdFRET − IdFRET ) / IdFRE T , (2)

(Roche, Indianapolis, IN) was used to deliver 2.0 g per coverslip of plasmid DNAto the cells. The cells were studied 24–36 hours following transfection.

We thank David Piston (Vanderbilt University) for providing uswith the mVenus and mCerulean vectors, Thomas Suchyna forthoughtful discussion, Phil Gottlieb for advice on the chemistry, MaryTeeling for cell culture and Ed Hurley from BioVision for helping withMetamorph software and LED illuminator. Special thanks to Wade J.Sigurdson and the confocal microscope facility in the School ofMedicine and Biomedical Sciences, University at Buffalo. This workwas supported by a grant from US National Institutes of Health.Deposited in PMC for release after 12 months.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/124/2/261/DC1

ReferencesAn, X., Zhang, X., Salomao, M., Guo, X., Yang, Y., Wu, Y., Gratzer, W., Baines, A. J.

and Mohandas, N. (2006). Thermal stabilities of brain spectrin and the constituentrepeats of subunits. Biochemistry 45, 13670-13676.

Bogatcheva, N. V., Garcia, J. G. and Verin, A. D. (2002). Molecular mechanisms ofthrombin-induced endothelial cell permeability. Biochemistry 67, 75-84.

Bustamante, C., Chemla, Y. R., Forde, N. R. and Izhaky, D. (2004). Mechanicalprocesses in biochemistry. Annu. Rev. Biochem. 73, 705-748.

Coll, J. L., Ben-Ze’ev, A., Ezzell, R. M., Rodriguez Fernandez, J. L., Baribault, H.,Oshima, R. G. and Adamson, E. D. (1995). Targeted disruption of vinculin genes inF9 and embryonic stem cells changes cell morphology, adhesion, and locomotion. Proc.Natl. Acad. Sci. USA 92, 9161-9165.

Dietz, H. and Rief, M. (2004). Exploring the energy landscape of GFP by single-moleculemechanical experiments. Proc. Natl. Acad. Sci. USA 101, 16192-16197.

du Roure, O., Saez, A., Buguin, A., Austin, R. H., Chavrier, P., Silberzan, P. andLadoux, B. (2005). Force mapping in epithelial cell migration. Proc. Natl. Acad. Sci.USA 102, 2390-2395.

Essler, M., Amano, M., Kruse, H. J., Kaibuchi, K., Weber, P. C. and Aepfelbacher, M.(1998). Thrombin inactivates myosin light chain phosphatase via Rho and its target Rhokinase in human endothelial cells. J. Biol. Chem. 273, 21867-21874.

Garcia, J. G. (1992). Molecular mechanisms of thrombin-induced human and bovineendothelial cell activation. J. Lab. Clin. Med. 120, 513-519.

Golji, J., Collins, R. and Mofrad, M. R. (2009). Molecular mechanics of the alpha-actinin rod domain: bending, torsional, and extensional behavior. PLoS Comput. Biol.5, e1000389.

Hwang, S. M., Li, J., Koo, N. Y., Choi, S. Y., Lee, S. J., Oh, S. B., Castro, R., Kim, J.S. and Park, K. (2009). Role of purinergic receptor in alpha fodrin degradation in ParC5 cells. J. Dent. Res. 88, 927-932.

Iwai, S. and Uyeda, T. Q. (2008). Visualizing myosin-actin interaction with a genetically-encoded fluorescent strain sensor. Proc. Natl. Acad. Sci. USA 105, 16882-16887.

Johnson, C. P., Tanbg, H. Y., Carag, C., Speicher, D. and Discher, D. E. (2007). Forcedunfolding of proteins within cells. Science 317, 663-666.

Kumar, S. and Weaver, V. M. (2009). Mechanics, malignancy, and metastasis: the forcejourney of a tumor cell. Cancer Metastasis Rev. 28, 113-127.

Kung, C. (2005). A possible unifying principle for mechanosensation. Nature 436, 647-654.Law, R., Liao, G., Harper, S., Yang, G., Speicher, D. W. and Discher, D. E. (2003).

Pathway shifts and thermal softening in temperature-coupled forced unfolding ofspectrin domains. Biophys. J. 85, 3286-3293.

Meng, F., Suchyna, T. M. and Sachs, F. (2008). A fluorescence energy transfer-basedmechanical stress sensor for specific proteins in situ. FEBS J. 275, 3072-3087.

Meng, F., Suchyna, T. M., Lazakovitch, E., Gronostajski, R. M. and Sachs, F. (2011).Real Time FRET Based Detection of Mechanical Stress in Cytoskeletal and ExtracellularMatrix Proteins, Cell. Mol. Bioeng., DOI: 10.1007. (in press).

Na, S., Collin, O., Chowdhury, F., Tay, B., Ouyang, M. X., Wang, Y. X. and Wang, N.(2008). Rapid signal transduction in living cells is a unique feature ofmechanotransduction. Proc. Natl. Acad. Sci. USA 105, 6626-6631.

Ortiz, V., Nielsen, S. O., Klein, M. L. and Discher, D. E. (2005). Unfolding a linkerbetween helical repeats. J. Mol. Biol. 349, 638-647.

Qu, H., Tseng, C. Y., Wang, Y., Levine, A. J. and Zocchi, G. (2010). The elastic energyof sharply bent nicked DNA. Europhys. Lett. 90, 18003

Shyu, K. G. (2009). Cellular and molecular effects of mechanical stretch on vascular cellsand cardiac myocytes. Clin. Sci. 116, 377-389.

Sjoblom, B., Salmazo, A. and Djinovic-Carugo, K. (2008). Alpha-actinin structure andregulation. Cell. Mol. Life Sci. 65, 2688-2701.

Spagnoli, C., Beyder, A., Besch, S. and Sachs, F. (2008). Atomic force microscopy analysisof cell volume regulation. Phys. Rev. E. Stat. Nonlin. Soft Matter Phys. 78, 031916.

Tseng, C. Y., Wang, A., Zocchi, G., Rolih, B. and Levine, A. J. (2009). Elastic energyof protein-DNA chimeras. Phys. Rev. E. Stat. Nonlin. Soft Matter Phys. 80, 061912.

Vogel, V. and Sheetz, M. (2006). Local force and geometry sensing regulate cell functions.Nat. Rev. Mol. Cell Biol. 7, 265-275.

Wallace, G. Q. and McNally, E. M. (2009). Mechanisms of muscle degeneration,regeneration, and repair in the muscular dystrophies. Annu. Rev. Physiol. 71, 37-57.

Wan, X., Harris, J. A. and Morris, C. E. (1995). Responses of neurons to extremeosmomechanical stress. J. Membr. Biol. 145, 21-31.

Zocchi, G. (2009). Controlling proteins through molecular springs. Annu. Rev. Biophys.38, 75-88.

269Real time detection of mechanical force in cytoskeleton

Jour

nal o

f Cel

l Sci

ence