vitamin e is essential for the tolerance of arabidopsis ... · vitamin e is essential for the...

Vitamin E is essential for the tolerance of Arabidopsisthaliana to metal-induced oxidative stress

VALÉRIE C. COLLIN*, FRANÇOISE EYMERY, BERNARD GENTY, PASCAL REY & MICHEL HAVAUX

CEA-Cadarache, IBEB, SBVME, Laboratoire d’Ecophysiologie Moléculaire des Plantes, UMR 6191 CNRS-CEA-UniversitéAix-Marseille II, F-13108 Saint-Paul-lez-Durance, France

ABSTRACT

Arabidopsis (Arabidopsis thaliana) plants were grown in ahydroponic culture system for 7 to 14 d in the absence orpresence of 75 mM Cd or 75 mM Cu. The Cu treatmentresulted in visual leaf symptoms, together with anthocyaninaccumulation and loss of turgor. Pronounced lipid peroxi-dation, which was detected by autoluminescence imagingand malondialdehyde titration, was observed in Cu-treatedleaves. The Cd treatment also resulted in loss of leaf pig-ments but lipid peroxidation and oxidative stress were lesspronounced than in the leaves exposed to Cu. Analysis oflow-molecular-weight chloroplast and cytosolic antioxi-dants (ascorbate, glutathione, tocopherols, carotenoids)and antioxidant enzymes (thiol-based reductases and per-oxidases) revealed relatively few responses to metal expo-sure. However, there was a marked increase in vitaminE (a-tocopherol) in response to Cd and Cu treatments.Ascorbate increased significantly in Cu-exposed leaves.Other antioxidants either remained stable or decreased inresponse to metal stress. Transcripts encoding enzymes ofthe vitamin E biosynthetic pathway were increased inresponse to metal exposure. In particular, VTE2 mRNAwas enhanced in Cu- and Cd-treated plants, while VTE5and hydroxylpyruvate dioxygenase (HPPD) mRNAs wereonly up-regulated in Cd-treated plants. Consistent increasesin HPPD transcripts and protein were observed. Thevitamin E-deficient (vte1) mutant exhibited an enhancedsensitivity towards both metals relative to the wild-type(WT) control. Unlike the vte1 mutants, which showedenhanced lipid peroxidation and oxidative stress in thepresence of Cu or Cd, the ascorbate-deficient (vtc2) mutantshowed WT responses to metal exposure. Taken together,these results demonstrate that vitamin E plays a crucial rolein the tolerance of Arabidopsis to oxidative stress inducedby heavy metals such as Cu and Cd.

Key-words: antioxidant; ascorbate; heavy metals; imaging;lipid peroxidation; spontaneous photon emission.

INTRODUCTION

Heavy metals have been classified based on their biologicalimportance (Schützendübel & Polle 2002; Valko, Morris &Cronin 2005). Fe is a micronutrient critical for growth anddevelopment in all living organisms. Metals like Cu, Ni andZn fulfil essential roles as trace elements for physiologicalprocesses. They act, for example, as enzyme cofactors, butare toxic at suboptimal levels. Finally, several heavy metalssuch as Cd or Pb have no known physiological function andare highly toxic to cells, even at low concentrations. Anotable exception, however, is the existence, in a diatom, ofa carbonic anhydrase with Cd as its metal centre (Park,Song & Morel 2007).

Metal toxicity is mediated through various mechanisms.Transition redox-active metals like Fe and Cu interferedirectly with cellular oxygen. Their autoxidation results inthe formation of reactive oxygen species (ROS) via Fenton-type reactions (Halliwell & Gutteridge 1986) and leads topro-oxidant conditions within cells. Another mechanism ofmetal toxicity, which is valid for all metals, is related to theirstrong ability to bind sulphur, nitrogen and oxygen atoms(Nieboer & Richardson 1980). Heavy metals can bind cys-teine residues in peptides and in low-molecular-weightcompounds like glutathione. Consequently, exposure tometals is often associated with severe changes in the cellredox status, due to glutathione depletion. Finally, as manyenzymes possess metallic cofactors, the replacement of onemetal by another one results in a strong inhibition of theiractivity. When exposed to toxic metal concentrations, livingcells generally exhibit severe oxidative injury generatedeither directly by redox-active metals or indirectly bymetal-induced metabolic perturbations (Valko et al. 2005).

Plants encounter exposure to heavy metals in naturalbedrock and due to atmospheric conditions, but alsofrequently as a result of human activity and increasingamounts of pollutants (Schützendübel & Polle 2002). Plantshave evolved a complex array of mechanisms to maintainoptimal metal levels and avoid the detrimental effects ofexcessively high concentrations (Clemens 2001). Whenthese homeostatic mechanisms are overwhelmed, plantssuffer metal-induced damage and pro-oxidant conditionswithin cells. However, higher plants are very well equippedwith antioxidant mechanisms (Mittler et al. 2004). Plantcells display an antioxidant network including numeroussoluble and membrane compounds, particularly in

Correspondence: M. Havaux. Fax: +33 4 4225 6265; e-mail:[email protected]

*Present addresses: Boyce Thompson Institute for Plant Research,Ithaca, NY 14853, USA.

Plant, Cell and Environment (2008) 31, 244–257 doi: 10.1111/j.1365-3040.2007.01755.x

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd244

mailto:[email protected]

mitochondria and in chloroplasts where respiratory andphotosynthetic electron transfer chains, respectively, takeplace. In the past years, the participation of enzymesinvolved in ROS scavenging, such as superoxide dismutase(SOD) or catalase (CAT), has been extensively investigatedin plant responses to metals. Numerous studies havereported that exposure to transition metals leads to oxida-tive injury, which is often associated with decreased activi-ties of these antioxidant enzymes (Schützendübel & Polle2002). Sandalio et al. (2001) showed a noticeable decreasein SOD, guaiacol peroxidase and CAT activities in peaplants grown in the presence of Cd. However, in Arabidop-sis plants exposed to Cu, Drazkiewicz, Skorzynska-Polit &Krupa (2004) observed a decrease in CAT activity, buthigher activities of SOD and guaiacol peroxidase.The levelsof expression of ascorbate peroxidase- and CAT-encodinggenes have been reported to depend on metal concentra-tion during Cd treatment in pea and to be differentiallyregulated as a function of organ type (Dixit, Pandey &Shyam 2001). More generally, there is little evidence thatincreased levels of antioxidants protect against the delete-rious effects of exposure to heavy metals (Schützendübel &Polle 2002).

Surprisingly, the involvement of other essential antioxi-dant mechanisms involving the low-molecular-weight com-pounds, vitamins C and E, in plant responses to metals ispoorly documented. In contrast, the involvement of thosevitamins in the resistance of plants to light-induced oxida-tive stress has been shown in a number of Arabidopsismutants deficient in ascorbate and/or tocopherol (Müller-Moulé, Havaux & Niyogi 2003; Havaux et al. 2005; Kanwis-cher et al. 2005). In other respects, growing evidence hints atthe essential roles of thiol peroxidases and thiol reductasesin plant responses to oxidative stress (Dietz 2003; VieiraDos Santos & Rey 2006). Organic peroxides can be detoxi-fied by peroxiredoxins (Prxs) (Dietz 2003) and glutathioneperoxidases (Gpxs) (Navrot et al. 2006), which are thiol-based heme-free peroxidases. Their most efficient electrondonors are thioredoxins (Trxs), which are small and ubiq-uitous disulfide oxidoreductases. One peculiar Trx, termedCDSP32 for chloroplastic drought-induced stress protein,plays a critical function in the tolerance of plants to oxida-tive stress (Broin et al. 2002; Rey et al. 2005). Trxs alsoreduce methionine sulfoxide reductases (Msrs) whichregenerate oxidized methionine and repair oxidized pro-teins (Vieira Dos Santos et al. 2005).

The involvement of thiol-based enzymes in theresponses of plants to metals is mostly unknown. An Ara-bidopsis mutant lacking the mitochondrial PrxII-F dis-plays inhibition of root growth during a Cd treatmentapplied in vitro (Finkemeier et al. 2005), but no change inPrxII-F protein level was observed in leaves of Arabidop-sis plants grown for 7 d in the presence of Cd (Gama et al.2007). In contrast, a substantial increase in Gpx abun-dance has been observed in Arabidopsis plants treated for7 d with Cd or Cu (Navrot et al. 2006). Note also that inthe presence of Cd, genes encoding a cytosolic Trx and aplastidial Prx have been found to be up-regulated in the

unicellular alga, Chlamydomonas reinhardtii (Lemaireet al. 1999; Gillet et al. 2006).

Using biochemical, imaging and genetic approaches, wehave analysed the level of oxidative stress and the abun-dance of various low-molecular-weight antioxidant com-pounds and thiol-based reductases or peroxidases inArabidopsis plants exposed to Cu or Cd. We show that thelevel of all thiol-based enzymes is not increased duringexposure to metals. In contrast, the level of vitamin E isstrongly enhanced during the treatments. Moreover, wereport that a mutant deficient in vitamin E is highly suscep-tible to both metals. These data indicate that vitamin Eparticipates in the protective mechanisms that counteractmetal-induced injury.

MATERIALS AND METHODS

Plant materials, growth conditions and heavymetal treatments

Arabidopsis [Arabidopsis thaliana (L.) Heynh] wild type(WT; ecotype Columbia), vtc2 and vte1 were grown on sandunder controlled conditions of light (200 mmol photonsm-2 s-1, 8 h photoperiod), temperature (22/18 °C, day/night)and relative humidity (55%). Plants were watered dailywith tap water and every 3 d with a Coïc–Lesaint nutritivesolution (Lesaint 1982). The vte1 mutant is affected in toco-pherol cyclase and consequently lacks vitamin E (Porfirovaet al. 2002). The vtc2 mutant has a missense mutationin At4g26850 (Jander et al. 2002), leading to a strongreduction of ascorbate content to about 20% of WT level.VTC2 has recently been identified as GDP-L-galactose-phosphorylase (Linster et al. 2007). Plants were transferredfrom sand to a hydroponic culture system with a Coïc–Lesaint nutritive solution 6 weeks after sowing. Plants wereallowed to acclimate to the hydroponic conditions for 1week, after which Cu(SO4)2 or CdSO4 was added to thenutritive solution at a final concentration of 75 mm. Thisconcentration was chosen after preliminary experiments:symptoms of toxicity were obvious, but plants were able tosurvive to this metal stress. Control plants were grown simi-larly, but without Cu or Cd.

Metal concentration

Leaves were washed in distilled water and dried for 4 d at55 °C. Mineralization was performed by microwave heatingin 65% HNO3. After filtration and dilution, metals werequantified by atomic absorption. Metal concentration wasdetermined using an inductively coupled plasma-opticalemission spectroscopy apparatus (ICP-OES, Varian VistaMPX, Varian, Palo Alto, CA, USA).

Chlorophylls, carotenoids and vitamin E

One leaf disc (diameter, 1 cm) was ground in 300 mL ofcold methanol. After filtration through a 0.45 mm PTFEfilter (Iso-Disc; SUPELCO, Sigma-Aldrich, St. Louis, MO,

Vitamin E and metal-induced oxidative stress 245

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Plant, Cell and Environment, 31, 244–257

USA), 75 mL of the extract was immediately analysed byhigh-performance liquid chromatography (HPLC), aspreviously described (Havaux et al. 2005). Pigments weredetected at 445 nm and a-tocopherol was detected by fluo-rescence (lex = 295 nm, lem = 340 nm). Running time was20 min, flow rate was 1.5 mL min-1, and the retention timeswere as follows: neoxanthin, 4.7 min; violaxanthin, 6 min;lutein, 8.4 min; chlorophyll b, 11.2 min; chlorophyll a,12 min, b-carotene, 14 min, a-tocopherol, 11.8 min.

Glutathione

Free thiols of glutathione were derived by monobromobi-mane (mBBr), and bimane conjugates were separated anddetected by HPLC as described by Carrier, Baryla &Havaux (2003).Total glutathione was measured by reducingdisulfide bounds with Tris-(2-carboxyethyl) phosphinehydrochloride (TCEP) (Picault et al. 2006). Non-proteinthiols were extracted from one leaf disc of 1 cm in diameterin 300 mL of 6.3 mm diethylene triamine-pentaacetic acid(DTPA), 40 mm N-acetyl-L-cysteine, 0.15% trifluoroaceticacid (TFA). Extracts were centrifuged (10 min at 15 000 g)and then filtered on nylon 0.2 mm membrane (Spin-XCostar, Cambridge, MA, USA). Cleared supernatants of125 mL were mixed with 225 mL of 0.2 m 4-(2-hydroxy-ethyl)-piperazine-1-propane-sulfonic acid (pH 8.2) in thepresence or absence of 0.5 mm TCEP. The reduction step byTCEP was performed in the dark at room temperature for45 min. Thiols were then derived for 20 min in the dark byadding 6 mL of 25 mm mBBr in acetonitrile. Reactions werestopped by adding 150 mL of cold 1 m methanesulfonicacid and 20 mL samples were analysed by reversed-phaseHPLC (A: TFA 0.1%; B: acetonitrile, 1 mL min-1). Bimanederivatives were detected by fluorescence (lex = 380 nm,lem = 470 nm). Calibration was performed using GSH fromSigma (St. Louis, MO, USA).

Ascorbic acid

Ascorbate was analysed by HPLC as described elsewhere(Havaux et al. 2005). Total ascorbate was measured byreducing dehydroascorbic acid to ascorbic acid with TCEP.Three leaf discs of 1 cm in diameter (about 100 mg) wereground in 750 mL of 0.1 m metaphosphoric acid. Sampleswere filtered through a 0.2 mm nylon membrane (Spin-XCostar). A 6 mL sample was immediately injected, and 6 mLwas treated for 4 h with 10 mm TCEP in darkness at 25 °C.Ascorbate was detected at 245 nm in sulphuric acid-acidified water (pH 2.5) with a retention time of 1 minunder a flow of 0.65 mL min-1.

Autoluminescence imaging

Singlet oxygen and excited triplet carbonyls producedduring lipid peroxidation are known to emit visible light inthe red (634 and 703 nm) and in the ultraviolet/blue (340 to460 nm), respectively (Havaux, Triantaphylidès & Genty2006). This photon emission was measured at room

temperature using a highly sensitive charge-coupled device(CCD) camera (VersArray LN/CCD 1340-1300B; RoperScientific,Trenton, NJ, USA), with a liquid N2 cooled sensorto enable measurement of faint light by signal integration(Havaux et al. 2006). Treated plants were dark-adapted for2 h before imaging. Acquisition time was 20 min. Full reso-lution of the CCD is 1300 ¥ 1340 pixels. On-CCD binning of2 ¥ 2 pixels was used to increase detection sensitivity, sothat the resulting resolution was 650 ¥ 670 pixels.

Biochemical determination of lipid peroxidation

Lipid peroxidation was assessed using HPLC measure-ments of malondialdehyde (MDA) content. MDA is athree-carbon, low-molecular-weight aldehyde that is pro-duced from radical attack on polyunsaturated fatty acids.Samples (leaf discs of 1 cm in diameter) were ground in750 mL of chilled ethanol:water (80:20, v/v). After centrifu-gation, 250 mL of the supernatant was combined with250 mL of 20% trichloroacetic acid (TCA), 0.01% butylatedhydroxytoluene (BHT) and 0.65% thiobarbituric acid(TBA). After heating at 95 °C for 20 min and centrifuga-tion, the MDA-(TBA)2 adduct was separated and quanti-fied by HPLC, as described by Havaux et al. (2005). Theaverage retention time of the MDA-(TBA)2 adduct was8 min.The levels of MDA were calculated using tetraethox-ypropane (Sigma) as a standard.

Western blot analysis

Arabidopsis thaliana leaves were ground in liquid nitrogenusing mortar and pestle and the powder was resuspended in50 mm b-mercaptoethanol, 1 mm phenylmethanesulfonylfluoride and 50 mm Tris-HCl pH 8. After centrifugation(30 000 g, 20 min, 4 °C), soluble proteins were precipitatedat -20 °C by adding 2 volumes of acetone to the superna-tant. The protein content was determined using a methodbased on bicinchoninic acid (BC Assay Reagent; Interchim,Montluçon, France). Proteins were separated using sodiumdodecyl sulphate–polyacrylamide gel electrophoresis(SDS–PAGE) (13%, w/v gel) and transferred on to a nitro-cellulose membrane (Pall Corporation, East Hills, NY,USA) using the Trans-blot cell apparatus from Bio-Rad(Hercules, CA, USA). Membranes were blocked for 1 h at25 °C in Tris-saline buffer containing 0.1% Tween-20 and5% dried milk. Incubation with primary and secondaryantibodies and signal detection were carried out asdescribed in Rey et al. (1998). Polyclonal antibodies raisedagainst Arabidopsis CDSP32 thioredoxin and BAS1 perox-iredoxin (Broin et al. 2002) were used at 1:800 and 1:10 000dilutions, respectively.The sera raised against poplar perox-iredoxin Q (Rouhier et al. 2004) and Arabidopsis peroxire-doxins II-E and II-B (Bréhelin et al. 2003) were used at1:1000 and 1:10 000 dilutions, respectively. The sera raisedagainst poplar plastid MsrA and Arabidopsis plastid MsrBproteins were used at 1:1000 dilutions (Vieira Dos Santoset al. 2005).

246 V. C. Collin et al.


For immunoblot analysis after electrophoresis undernative conditions, proteins were extracted as describedearlier in the absence of b-mercaptoethanol and separatedby PAGE (10%, w/v gel). Rabbit polyclonal antibodiesraised against HPPD, 4-hydroxyphenylpyruvate dioxyge-nase, were used at a 1:500 dilution (Garcia et al. 1999) anddetected using the goat anti-rabbit Alexa Fluor 680 IgGfrom Invitrogen (Cergy-Pontoise, France). Bound anti-bodies were detected at 680 nm using the Odyssey InfraredImager from NB Li-Cor (Lincoln, NE, USA). Immunoblotswere scanned, and the band intensities were measuredwith E-Capt software (Vilber Lourmat, Marne-la-Vallée,France).

Semi-quantitative RT-PCR

After grinding leaves in liquid nitrogen, total RNA wasextracted using the Plant RNeasy system (Qiagen,Valencia,CA, USA) and an extraction buffer containing 5 mm ethyl-enediaminetetraacetic acid. RNasin (Promega, Madison,WI, USA) was added to eluted RNA and 2 mg nucleic acidswere used for reverse transcription using the Omniscript kit(Qiagen) and T12 poly-dT (MWG, Ebersberg, Germany).PCR was performed using an equivalent of 50 ng nucleicacids, Taq DNA polymerase (Invitrogen) and forward andreverse oligonucleotides specific of each gene analysed(Table 1) supplied by MWG. After separation on agarosegels, PCR products were quantified using E-capt software(Vilber Lourmat).

RESULTS

Metal toxicity

Six-week-old Arabidopsis plants were transferred fromsand on to a nutritive solution containing either 75 mm Cu or75 mm Cd. The treatments led to metal accumulation inleaves: up to 15 mmol Cd g-1 dry weight in plants exposedfor 7 d to Cd and approximately 7 mmol Cu g-1 dry weight inplant treated for 7 d with Cu (data not shown).At 75 mm, Cu

appeared to be more toxic to Arabidopsis than Cd (Fig. 1a).Exposure to Cu resulted in loss of leaf turgor, anthocyaninaccumulation and necrosis of external mature leaves. Nosuch effect was observed in plants treated with Cd. Themost obvious symptom of Cd toxicity was a change in leafpigmentation. However, Cd-treated plants remained fullyturgescent and did not exhibit noticeable leaf necrosis. Thepale green/yellow phenotype was very pronounced inyoung leaves at the rosette centre and was attributable to astrong decrease in chlorophyll, as shown in Fig. 1b. Duringthe first days of the stress treatment, the chlorophyll con-centration tended to increase slightly, as did ascorbate andb-carotene (see further discussion). This could be related tothe beneficial effect of low Cd concentration on cell growth,which has been reported in plants (Xiong & Peng 2001;Arduini, Mariotti & Ercoli 2004) and in animals (VonZglinicki et al. 1992). In contrast, the chlorophyll concentra-tion remained stable in young leaves of Cu-treated plants.

Metal-induced oxidative stress

Tissue necrosis and anthocyanin accumulation, as observedin Cu-treated Arabidopsis plants, typically take place whenplants are exposed to oxidative stress. Lipid peroxidation isanother event that occurs in plants suffering from oxidativestress (Halliwell & Gutteridge 1986). Therefore, leaf lipidperoxidation was investigated in plants exposed to Cu orCd using a new imaging method based on the measurementof the photons spontaneously emitted by plants (Flor-Henry et al. 2004; Havaux et al. 2006). Spontaneous photonemission (SPE) originates from triplet carbonyls and singletoxygen produced during lipid peroxidation. Though veryweak, autoluminescence of plants can be measured with ahighly sensitive, liquid nitrogen-cooled CCD camera andlong integration times (Havaux et al. 2006). In controlplants grown on nutritive solution in the absence of Cu orCd, SPE was very low and nearly undetectable (Fig. 2a).However, exposing Arabidopsis to Cu for 7 d resulted in amarked increase in SPE. The SPE intensity increasedfurther when the Cu treatment was prolonged up to 14 d. In

Table 1. Oligonucleotides used for theRT-PCR experimentsName Gene Sequence (5′ to 3′)

Act2dir At5g09810 (ACT7) AAAATGGCCGATGGTGAGGATATAct2rev2 At5g09810 (ACT7) CAATACCGGTTGTACGACCACTHPPDRTfor At1g06590 CACAGATTCTGACACTGTCTTGGHPPDRTrev At1g06590 ACAAGGTTACAAGTTACACAATCTCGGGRRTfor At1g74470 ATTGTCGAAGGTTCACAGAATGGGGRRTrev At1g74470 TAGAGATGAAGAAAGGAGATAGACCVte1RTfor At4g32770 ATATGGGAACGGCTATATGATGGVte1RTrev At4g32770 GTGGCTTGAAGAAAGGGACCVte2RTfor At2g18950 CATATGGAGCAAAGTCATCTCGGVte2RTrev At2g18950 TAGCATTATATCAACACACCGAACCVte3RTfor At3g63410 GGTGACTCTCCTCTCCAGCVte3RTrev At3g63410 AGATAGGACTCGAATCTTTCTTTACCVte4RTfor At1g64970 CTTCAATCCCATTCTCTCCAGGVte4RTrev At1g64970 AGACTTAGAGTGGCTTCTGGCVte5RTfor At5g04490 GATATAATGGGACGTAAGTTTGGGVte5RTrev At5g04490 GTTTATGAGGGATTAATCTAATATCCG



striking contrast, SPE remained low in Cd-treated plants,even after a 14 d exposure to the metal; only the tip of someexternal leaves exhibited increased SPE. Lipid peroxidationwas also estimated with a more classical technique based onMDA titration and HPLC (Fig. 2b). Cu-stressed leavesaccumulated high amounts of MDA while Cd-treatedleaves showed only a slight increase in MDA relative tocontrols. In Fig. 2c, we plotted leaf autoluminescence inten-sity, calculated from SPE images from a number of leavestreated with Cu or Cd, versus the MDA concentration mea-sured in the corresponding leaves, and a good correlationwas obtained. This confirms that leaf autoluminescence andMDA reflect the same phenomenon, namely lipid peroxi-dation (Havaux et al. 2006). Thus, both SPE and MDAresults show that exposure to Cu induces oxidative stress inArabidopsis plants while this phenomenon is limited duringCd treatment.

Participation of antioxidant molecules andproteins in the responses to Cu and Cd

Plants possess panoply of enzymatic systems to protectthemselves against ROS or to repair oxidized macromol-ecules during stress. In the past years, growing evidence haspointed to the essential role of thiol peroxidases and thiolreductases in plant responses to oxidative stress (Dietz2003; Vieira Dos Santos & Rey 2006), but the participationof these types of enzymes in the responses to metals is at thepresent time unknown. The abundance of CDSP32, plas-tidial Prxs (2-cys Prx, PrxQ and PrxIIE), methionine sulfox-ide reductases (MsrA4, MsrB1 and MsrB2) and cytosolicPrxII-B was analysed by immunoblot in leaves of plants

subjected to various Cu or Cd concentrations for 2 or 7 d(Fig. 3). No significant change in protein abundance wasobserved during Cu stress. During Cd stress, the abundanceof oxidized MsrA4 increased by 40%, particularly after 2 or7 d at 50 mm.We also noticed that MsrB1 decreased by morethan 40% at all Cd concentrations while MsrB2 decreasedby more than 50% in response to 75 mm Cd. Similarly,CDSP32 and 2-cys Prx decreased by 20–30% after 2 or 7 dat this Cd concentration. Exposure to metals did not resultin any substantial change in the abundance of other Prxproteins. Together, these data reveal that exposure to Cu orto Cd does not result in substantially increased amounts ofmost of the thiol-containing reductases and peroxidasesanalysed.

Glutathione and ascorbate are soluble antioxidants thatare metabolically linked (Noctor & Foyer 1998). The totalascorbate content increased significantly (threefold) duringexposure to Cu, but not during Cd treatment (Fig. 4a). Inboth cases, the ascorbate pool was at more than 90% in itsreduced form (data not shown). During the first days of Cdstress (2–4 d), there was a slight increase in ascorbate andalso in other compounds such as chlorophyll (Fig. 1b) orb-carotene (see further discussion, Fig. 5a). During Cu andCd treatments, the level of total glutathione in leaves didnot change significantly relative to control conditions(Fig. 4b) and glutathione redox state was unchanged with aratio of 80% in reduced form (data not shown).

The levels of lipid-soluble antioxidants (carotenoids,vitamin E) were also measured by HPLC. As shownin Fig. 5a, the b-carotene level was not altered during Cutreatment while it strongly decreased in response to Cdexposure. A Cd-induced decrease in xanthophylls was

Figure 1. Cu and Cd toxicity inArabidopsis thaliana. (a) Six-week-oldArabidopsis plants exposed for 7 d to anutritive solution containing 75 mm Cu or75 mm Cd. Control plants were grown innutrient solution without Cu or Cd. (b)Chlorophyll concentration in leavesexposed to 75 mm Cu or 75 mm Cd (closedsymbols). Open symbols correspond tocontrol plants. Chlorophyll was measuredin leaf discs of 1 cm in diameter. Errorbars indicate SDs.

Control 75 mM Cu 75 mM Cd (a)

0

10000

20000

30000

0 5 10 15

Time (d)

Cd

0

10000

20000

30000

0 1 2 3 4 5 6 7 8

Time (d)

Ch

loro

ph

yll

(ng

pe

r dis

c).

Cu

(b)



also observed, so that a loss of all photosynthetic pig-ments (chlorophylls and carotenoids) was observedduring Cd treatment. The loss of chlorophyll observed inleaves treated with Cd is consistent with those in previousstudies reporting a similar phenomenon in other plantspecies (Abdel-Basset, Issa & Adams 1995; Baryla et al.2001). In the presence of Cu, the content of xanthophyllsremained stable. In striking contrast, a six- and fivefoldincrease in tocopherol concentration was measured in thepresence of Cu and Cd, respectively (Fig. 5b). In conclu-sion, the levels of two low-molecular-weight antioxidants

were found to be up-regulated in Arabidopsis in responseto metal stress: ascorbate for Cu and tocopherols for Cuand Cd.

Tolerance of the ascorbate-deficient vtc2mutant and of the tocopherol-deficient vte1mutant to Cu or Cd

We hypothesize that the antioxidant molecules ascorbateand tocopherol might have a protective function againstmetal toxicity by limiting oxidative damage. To test this

Figure 2. Lipid peroxidation inArabidopsis plants exposed to 75 mm Cuor 75 mm Cd. (a) Autoluminescenceimaging of lipid peroxidation.(b) Malondialdehyde (MDA)concentration in leaves of plants exposedto 75 mm Cu or 75 mm Cd. Control plantswere grown in nutrient solution withoutCd or Cu was added. Error bars indicateSDs. (c) Correlation betweenautoluminescence intensity and MDA inleaves of plants exposed to Cu or Cd. FW,fresh weight.

75 mM Cu 75 mM Cd

0 d

14 d

0

20

40

60

80

100

120

140

Control Cd Cu

MD

A (n

mole

s g

–1

FW

)

(a)

(c)

0

50

100

150

200

250

300

350

400

0 50 100 150 200

MDA (nmoles g–1 FW)

Auto

lum

inescence

(a.u

.)

Low High

(b)

7 d



hypothesis, we examined the responses to Cu and Cd ofArabidopsis mutants deficient in ascorbate or in vitaminE; the vtc2 mutant contains less than 20% of the WTascorbate level (Müller-Moulé et al. 2003), and the vte1mutant is completely deficient in tocopherol (Porfirovaet al. 2002). Interestingly, vte1 plants were found to beextremely sensitive to both Cu and Cd (Fig. 6). As soon as3 d after metal exposure, many leaves were dead or losttheir turgor, whereas vtc2 behaved like WT plants under

the same conditions. The autoluminescence images shownin Fig. 7 indicate that the high metal sensitivity of vte1 wasassociated with extensive lipid peroxidation and oxidativestress. The SPE data were confirmed by HPLC analyses ofthe MDA concentration in leaves, which showed lipid per-oxidation in vte1 during Cu and Cd stresses (Fig. 8). Fromthese data, we conclude that tocopherols play a crucialrole in the tolerance of Arabidopsis to heavy metals likeCu and Cd.

Figure 3. Western blots of a series ofantioxidative proteins: thioredoxinCDSP32, 2-Cys peroxiredoxin (Prx),Prx Q, Prx IIE, methionine sulfoxidereductases (Msr) MsrA4, MsrB1 andMsrB2. Plants were exposed to differentconcentrations (25, 50 and 75 mm) of Cuand Cd for several days (2 or 7 d).

2 2 2 2 7 7 7 7 2 2 2 7 7 d 0 25 50 75 25 50 75 0 0 25 75 25 75 mM

Cd Cu

CDSP32

2-Cys Prx

Prx Q

PrxIIB

Prx IIE

MsrA4Red →→→→Ox →→→→

MsrB1 →→→→MsrB2 →→→→

←←←← 32 kDa

←←←← 22 kDa

←←←← 16 kDa

←←←← 18 kDa

←←←← 17 kDa

←←←← 25 kDa

←←←← 17 kDa←←←← 15 kDa

Figure 4. (a) Ascorbate and (b)glutathione levels in Arabidopsis plantsexposed to 75 mm Cu or 75 mm Cd (closedsymbols). For the controls (opensymbols), no Cu or Cd was added to thenutritive solution in the hydroponicculture system. Measurements were doneon leaf discs of 1 cm in diameter. Errorbars indicate SDs.

(nm

ol p

er d

isc)

(nm

ol p

er d

isc)

(nm

ol p

er d

isc)

(nm

ol p

er d

isc)

(a)

(b)



Figure 5. (a) b-Carotene and (b)a-tocopherol levels in Arabidopsis plantsexposed to 75 mm Cu or 75 mm Cd (closedsymbols). For the controls (opensymbols), no Cu or Cd was added to thenutritive solution in the hydroponicculture system. Measurements were doneon leaf discs of 1 cm in diameter. Errorbars indicate SDs.

(ng

per d

isc)

(ng

per d

isc)

(mg

per d

isc)

a

(mg

per d

isc)

a

b b

(a)

(b)

Figure 6. Effects of Cu (75 mm for 3 d)or Cd (75 mm for 7 d) on Arabidopsisthaliana wild type (WT), vte1 and vtc2.

Control 75 mM Cu3 d 7 d

WT

vtc2

vte1

75 mM Cd



Effects of Cu and Cd on the tocopherolbiosynthetic pathway

The expression of seven key genes in the vitamin E biosyn-thetic pathway was analysed in Arabidopsis leaves usingsemi-quantitative RT-PCR and immunoblot analyses(Fig. 9). Hydroxylpyruvate dioxygenase (HPPD) catalysesthe synthesis of the polar head of vitamin E (DellaPenna& Last 2006; DellaPenna & Pogson 2006). Phytolkinase(VTE5) and geranylgeranyl reductase (GGR) catalyse thesynthesis of the phytyl tail. Homogentisate phytyltrans-ferase (VTE2) is located at the branching point after thesynthesis of polar head and phytyl tail and produces the

immediate tocopherol precursors. MPBQ methyltrans-ferase (VTE3), tocopherol cyclase (VTE1) and g-g-tocopherol methyltransferase (VTE4) are involved in thesynthesis of the different forms of tocopherols (a, b, g, d)from their immediate precursors. Under copper treatment,the VTE2 transcript accumulated while the expression ofthe other genes was unchanged (VTE1, VTE3, VTE4) orslightly decreased (VTE5, GGR, HPPD) (Fig. 8a). TheVTE2 transcript also accumulated during Cd treatment. Inaddition, Cd led also to a marked increase in HPPD tran-script level (Fig. 9a).The other genes examined in this studywere not up-regulated by Cd, except VTE5 after prolongedexposure (>7 d). Finally, we performed a search of the

Figure 7. Autoluminescence ofArabidopsis plants [wild type (WT) andvte1] exposed to Cu (75 mm for 3 d) or Cd(75 mm for 7 d).

WT

vte1

75 mM Cu 75 mM Cd3 d

Control7 d

Figure 8. High-performance liquidchromatography analysis of themalondialdehyde (MDA) level in leavesof wild type (WT) and vte1 plantsexposed to Cu (75 mm for 2 d) or Cd(75 mm for 7 d). Error bars indicate SDs.FW, fresh weight.

0

5

10

15

20

25

30

35

40

WT vte1

MD

A (

nm

ole

s g

–1

FW

)

MD

A (

nm

ole

s g

–1

FW

)

0 d

2 d

0

5

10

15

20

25

30

35

40

WT vte1

0 d

7 d

75 mM Cu 75 mM Cd



available antibodies raised against the products of the genesup-regulated by metal stress. We found a serum raisedagainst HPPD, but no antibody raised against VTE2 wasavailable. We carried out a Western analysis to investigateHPPD protein amount in leaves of plants exposed to heavymetals. Upon Cu treatment, no substantial change in theHPPD abundance was observed whereas exposure to Cdresulted in a progressive and substantial increase in HPPDprotein level (Fig. 9b).These results agree with the RT-PCRdata and reveal that at least one step of the vitamin Ebiosynthetic pathway is up-regulated in response to Cd,both at the transcript and protein levels.

DISCUSSION

Vitamin E is involved in the tolerance ofArabidopsis plants towards Cu or Cd toxicity

Vitamin E is a collective term for a group of lipid-solublecompounds, the tocopherols and tocotrienols,which are con-sidered to be major antioxidants in animals and humans(Bramley et al. 2000; Schneider 2005). Because vitamin E isessential for human nutrition,vitamin E functions and chem-istry have been studied most extensively in animal systemsand in artificial membranes. Tocopherols and tocotrienolsare able to terminate chain reactions of polyunsaturatedfatty acid free radicals generated by lipid peroxidation invitro, and this action is believed to be the most importantfunction of vitamin E in vivo in animal and human cells,although a number of additional functions have been sug-gested (Theriault et al. 1999;Azzi et al. 2004; Sen, Khanna &Roy 2006). Despite the fact that vitamin E is synthesizedexclusively by photosynthetic organisms, its function is muchless well documented in plants.Recent studies of tocopherol-

deficient mutants of A. thaliana and of the cyanobacteriumSynechocystis have yielded rather disappointing results ascomplete absence of tocopherols did not appreciably impacton their growth and photosynthesis under optimal or highlight stress conditions (Porfirova et al. 2002; Havaux et al.2005; Maeda et al. 2005). Consequently, the involvement ofvitamin E in oxidative stress resistance of plants has beenquestioned, and alternative functions have been reported,such as sugar transport under low temperature stress(Maeda et al. 2006), protection of lipids during seed dor-mancy and germination (Sattler et al. 2004) or participationin cellular signalling (Munné-Bosch et al. 2007).However,anArabidopsis double mutant lacking both vitamin E and thecarotenoid zeaxanthin was found to be sensitive to photo-oxidative stress (Havaux et al. 2005), indicating that vitaminE and carotenoids have overlapping functions and that thephototolerance of tocopherol-deficient single mutants wasactually due to an increased activity of carotenoids compen-sating for the loss of tocopherols. The present study clearlyshows that tocopherol is an antioxidant in Arabidopsisstressed by heavy metal exposure.

Oxidative stress induced by the redox-active metal Cu wasstrongly amplified when vitamin E was absent from Arabi-dopsis leaves. Compared to Cu, Cd was a weak inducer oflipid peroxidation, but oxidative stress became very pro-nounced when vitamin E was lacking.Those results demon-strate that vitamin E plays a crucial role in the tolerance ofArabidopsis plants to oxidative stress induced by Cu or Cd.This finding is in line with those of a number of studies onanimal cells or organs which have shown a protective role ofsupplemented vitamin E against Cu- or Cd-induced oxida-tive disorders (e.g. Mattie & Freedman 2001; Beytut et al.2003; Choi & Rhee 2003; Valko et al. 2005; Vijayavel et al.2006). The involvement of vitamin E in the resistance of

Figure 9. Effects of 75 mm Cu or 75 mmCd on the tocopherol biosynthesispathway. (a) RT-PCR analysis of thetranscript level of a series of gene of thevitamin E synthesis pathway: HPPD(hydroxypyruvate dioxygenase), GGR(geranylgeranyl reductase), VTE1(tocopherol cyclase), VTE2(homogentisate phytyltransferase), VTE3(MPBQ methyltransferase), VTE4(g-g-tocopherol methyltransferase), VTE5(phytol kinase). Actin was used as aloading control. The samples named ‘0 d’correspond to leaf samples taken fromplants grown in the hydroponic culturesystem plants before Cu or Cd was addedto the nutritive solution. Seven days later,we checked again the transcript levels inplants kept on a nutritive solution inwhich no Cu or Cd was added, and nosignificant changes in gene expressionwere observed compared to the ‘0 d’samples (not shown). (b) Western blotof HPPD.

VTE5 (x20)

GGR (x20)

ACT (x20)

HPPD (x30)

75 mM Cu

75 mM Cu 75 mM Cd

75 mM Cd

0 1 2 3 4 d 0 1 2 3 4 7 d

VTE1 (x25)

VTE2 (x25)

VTE3 (x25)

VTE4 (x25)

(a)

(b)

0 1 2 3 4 7 d 0 1 2 3 4 7 d

HPPD →→→→ ←←←← 100 kDa



Arabidopsis to metal toxicity is also supported by themarked accumulation of a-tocopherol, the major vitamin Ecomponent in leaves, during Cd or Cu stress. None of theother antioxidant systems examined in this study, exceptascorbate in Cu-treated leaves,was enhanced in Arabidopsisin response to heavy metal stress. The protective effect ofvitamin E against heavy metal toxicity seems to be ratherspecific because the ascorbate-deficient vtc2 mutant was notmore sensitive to Cd or Cu than WT. It is interesting to notethat the opposite has been found under photo-oxidativestress: vtc2 is very sensitive to high light intensities (Müller-Moulé et al. 2003), contrary to vte1 (Havaux et al. 2005). Wealso checked the behaviour of a number of other Arabidop-sis mutants,available in our laboratory,which are deficient indifferent antioxidant proteins, such as MsrB1, MsrB2 andsulfiredoxin (Vieira Dos Santos et al. 2005; Rey et al. 2007),and they did not exhibit a modified sensitivity to Cu or Cdcompared to WT (data not shown).

When tocopherols scavenge lipid peroxy radicals, a toco-pheroxyl radical is formed, which can be recycled back tothe corresponding tocopherol by reacting with ascorbate(Fryer 1993; Bramley et al. 2000). Therefore, the markedrise in the ascorbate level observed in Cu-exposed Arabi-dopsis leaves could increase the capacity of tocopherolrecycling and hence the antioxidant capacity of tocopherolsduring Cu-induced oxidative stress. This phenomenon wasnot observed in Cd-treated Arabidopsis plants. Becauseoxidative stress was relatively modest during Cd stress, it islikely that the requirement for ascorbate-mediated recy-cling of tocopherols was lower than during Cu stress.

Up-regulation of the vitamin E biosynthesispathway under heavy metal stress

The increased level of a-tocopherol in Arabidopsis leavesexposed to Cu or to Cd was associated with the up-regulation of a number of genes of the tocopherol biosyn-thetic pathway. Cd induced accumulation of HPPD andVTE2 transcripts within 2–3 d, as well as a delayed accumu-lation of VTE5 transcripts at later stages (>7 d). HPPD, theenzyme catalysing the synthesis of homogentisic acid, has akey location in the vitamin E pathway and likely regulatesthe whole pathway flux (DellaPenna & Last 2006; DellaP-enna & Pogson 2006). VTE2 catalyses the next step bycondensing homogentisic acid and phytyl-diphosphate.VTE2 activity has been shown to be limiting in unstressedArabidopsis (Collakova & DellaPenna 2003a) and also inArabidopsis exposed to high light and nutrient stress (Col-lakova & DellaPenna 2003b). Accordingly, VTE2 overex-pression increased total tocopherol levels up to fivefold inleaves (Collakova & DellaPenna 2003a).Thus, Cd treatmentof Arabidopsis plants up-regulated two important regula-tory steps of the vitamin E biosynthetic pathway, and thislikely contributed to increase the tocopherol level. Interest-ingly, the phytol kinase-encoding VTE5 gene is believed toplay an important role in tocopherol synthesis by recyclingchlorophyll-degradation-derived phytol towards the toco-pherol pathway (Valentin et al. 2006). As shown here and

also in a number of previous studies (e.g.Abdel-Basset et al.1995; Baryla et al. 2001), Cd toxicity is associated with amarked loss of chlorophyll.Therefore, we can speculate thatthe increase in VTE5 gene expression favoured tocopherolsynthesis in Cd-stressed leaves by providing tocopherolphytyl tails from chlorophyll breakdown products. Con-versely, Cu did not lead to any significant change in chloro-phyll concentration and in VTE5 expression. However,similarly to Cd, Cu induced a selective up-regulation ofVTE2 transcript level. This reinforces the idea that thislimiting step plays a role in the adjustment of the vitamin Ebiosynthetic pathway to environmental conditions, as previ-ously observed for high light and nutrient stress (Collakova& DellaPenna 2003b). Recently, tocopherol accumulationwas also observed in the green alga Chlamydomonasexposed to 50 mm Cu, and this phenomenon was accompa-nied with up-regulation of the VTE3 gene (Luis et al. 2006).It was suggested that the VTE3 transcript level could serve asa marker of the hardening of Chlamydomonas cells to Cu.Based on our results, the same suggestion could be proposedfor VTE2 in Arabidopsis challenged with Cu or Cd.

Heavy metals induced oxidative stress inArabidopsis leaves as revealed by SPE

Copper is a redox-active metal capable of catalysing theformation of hydroxyl radicals via a Haber–Weiss or Fenton-like reaction (Valko et al. 2005). Because of its ability togenerate ROS, Cu can directly initiate lipid peroxidation inplant tissues (Sandmann & Böger 1980; Baryla et al. 2000).This phenomenon was visualized here in Cu-treated Arabi-dopsis plants using a novel imaging method based on SPE.SPE imaging was previously used to map lipid peroxidationin leaves exposed to photo-oxidative stress (Havaux et al.2006; Johnson et al. 2007), wounding (Flor-Henry et al. 2004)or the elicitor cryptogein (Havaux et al. 2006).There are alsoa few examples of application to animals, for example, toimage oxidative stress in the brain of a rat (Kobayashi et al.1999). The intensity of the imaged SPE was well correlatedwith the intensity of lipid peroxidation measured by a varietyof biochemical assays (Havaux et al. 2006; Johnson et al.2007).As shown here by measuring concomitantly SPE andMDA, this correlation holds for metal stress. SPE fromCu-treated Arabidopsis plants was strongly increased rela-tive to untreated plants, indicating intense lipid peroxida-tion,particularly in the external leaves.SPE from Cd-treatedplants was low, with only the margin of some external leavesexhibiting a stimulated SPE. Therefore, we conclude thatoxidative stress is a rather minor component of Cd toxicity.However, mutational suppression of tocopherols stimulatedSPE, showing the involvement of this antioxidant in themaintenance of a low level of lipid peroxidation in thepresence of Cd.

Cadmium is a non-redox-reactive heavy metal. There-fore, oxidative stress in Cd-exposed organisms is likely to beinduced by indirect mechanisms (Valko et al. 2005). Deple-tion of glutathione and other antioxidant systems has beenreported in various plant species exposed to Cd (Sandalio



et al. 2001; Rodríguez-Serrano et al. 2006). Accordingly, weobserved that Cd treatment led to lowered amounts ofseveral thiol-based peroxidases/reductases and also todecreased concentrations of carotenoids. Cd can also inac-tivate metal-containing enzymes by metal substitution. Forinstance, in chloroplasts, Cd is able to replace the essentialCa ion in the photosystem (PS) II reaction centre (Sigfrids-son et al. 2004; Faller, Kinzler & Krieger-Liszkay 2005).Thisleads to an inhibition of the water-splitting oxygen-evolvingPSII complex (Van Duijvendijk-Matteoli & Desmet 1975),rendering PSII more susceptible to photoinhibition(Pagliano et al. 2006). It is likely that Cd-induced perturba-tions of the photochemical activity of leaves can favourchronic ROS production in the light. Moreover, when elec-tron donation to PSII is impaired, oxygen is taken up, aphenomenon that has been attributed to the formation ofhydroperoxides in the vicinity of PSII (Ivanov & Khoro-brykh 2003). It is clear that vitamin E could play a beneficialrole under Cd stress conditions by counteracting theproduction of organic peroxides in PSII. Accordingly,tocopherol has been reported to have a protective func-tion against photoinhibition of the PSII reaction centre(Krieger-Liszkay & Trebst 2006). Nevertheless, Cd-inducedoxidative stress was moderate and caused limited damagein WT Arabidopsis leaves, as revealed by SPE imaging.Oxidative stress became problematic in vte1 only, whentocopherols were absent, strengthening the idea that thechloroplast was a major target of Cd in Arabidopsis underour experimental conditions.

To the best of our knowledge, this study is the firstexample of application of SPE imaging to map oxidativestress induced in plants by heavy metals. Because of its highsensitivity that allowed us to visualize small variations oflipid peroxidation and its easy use, we believe that thismethod has the potential to become an important andwidely used tool for monitoring non-invasively metaltoxicity in intact plants.

ACKNOWLEDGMENTS

We wish to thank Patrick Carrier (CEA/Cadarache) forhelp with metal titration, Nathalie Verbruggen (ULB, Brus-sels) for useful discussions and Thomas Bollenbach forreading the manuscript and improving the English. We arealso grateful to Dr Nicolas Rouhier (INRA-UniversitéHenri Poincaré, Nancy I) for kind gift of the sera raisedagainst poplar PrxQ and MsrA, to Dr Yves Meyer (CNRS-Université de Perpignan) for providing the sera raisedagainst Arabidopsis peroxiredoxins II-B and II-E, and toDr Michel Matringe (CEA/Grenoble) for kind gift of theHPPD antibody. This work was supported by the program‘Toxicologie Nucléaire Environnementale’ (SIDDERE).

REFERENCES

Abdel-Basset R., Issa A.A. & Adams M.S. (1995) Chlorophyllaseactivity: effects of heavy metals and calcium. Photosynthetica 31,421–425.

Arduini I., Mariotti M. & Ercoli L. (2004) Low cadmium applica-tion increases miscanthus growth and cadmium translocation.Experimental and Environmental Botany 52, 89–100.

Azzi A., Gysin R., Kempna P., Munteanu A., Negis Y., Villacorta L.,Visarius T. & Zingg J.M. (2004) Vitamin E mediates cell signal-ing and regulation of gene expression. Annals of the New YorkAcademy of Sciences 1031, 86–95.

Baryla A., Laborde C., Montillet J.L., Triantaphylides C. & Chag-vardieff P. (2000) Evaluation of lipid peroxidation as a toxicitybioassay for plants exposed to copper. Environmental Pollution109, 131–135.

Baryla A., Carrier P., Franck F., Coulomb C., Sahut C. & Havaux M.(2001) Leaf chlorosis in oilseed rape plants (Brassica napus)grown on cadmium-polluted soil: causes and consequence forphotosynthesis and growth. Planta 212, 696–709.

Beytut E., Yuce A., Kamiloglu N.N. & Akskal M. (2003) Role ofdietary vitamin E in cadmium-induced oxidative damage in rab-bit’s blood, liver and kidney. International Journal for Vitaminand Nutritional Research 73, 351–355.

Bramley P.M., Elmadfa I., Kafatos A., Kelly F.J., Manios Y., Rox-borough H.E., Schuch W., Sheehy P.J.A. & Wagner K.-H. (2000)Vitamin E. Journal of the Science of Food and Agriculture 80,913–938.

Bréhelin C., Meyer E.H., de Souris J.P., Bonnard G. & Meyer Y.(2003) Resemblance and dissemblance of Arabidopsis type IIperoxiredoxins: similar sequences for divergent gene expression,protein localization, and activity. Plant Physiology 132, 2045–2057.

Broin M., Cuiné S., Eymery F. & Rey P. (2002) The plastidic2-cysteine peroxiredoxin is a target for a thioredoxin involved inthe protection of the photosynthetic apparatus against oxidativedamage. Plant Cell 14, 1417–1432.

Carrier P., Baryla A. & Havaux M. (2003) Cadmium distributionand microlocalization in oilseed rape (Brassica napus) afterlong-term growth on cadmium-contaminated soil. Planta 216,939–950.

Choi J.H. & Rhee S.J. (2003) Effects of vitamin E on renal dysfunc-tion in chronic cadmium-poisoned rats. Journal of Medical Food6, 209–215.

Clemens S. (2001) Molecular mechanisms of plant metal toleranceand homeostasis. Planta 212, 475–486.

Collakova E. & DellaPenna D. (2003a) Homogentisate phytyl-transferase activity is limiting for tocopherol biosynthesis in Ara-bidopsis. Plant Physiology 131, 632–642.

Collakova E. & DellaPenna D. (2003b) The role of homogentisatephytyltransferase and other tocopherol pathway enzymes in theregulation of tocopherol synthesis during abiotic stress. PlantPhysiology 133, 930–940.

DellaPenna D. & Last R.L. (2006) Progress in the dissection andmanipulation of plant vitamin E biosynthesis. Physiologia Plan-tarum 126, 356–368.

DellaPenna D. & Pogson B. (2006) Vitamin synthesis in plants:tocopherols and carotenoids. Annual Review of Plant Biology57, 711–738.

Dietz K.J. (2003) Plant peroxiredoxins. Annual Review of PlantBiology 54, 93–107.

Dixit V., Pandey V. & Shyam R. (2001) Differential antioxidativeresponses to cadmium in roots and leaves of pea (Pisum sativumL. cv. Azad). Journal of Experimental Botany 52, 1101–1109.

Drazkiewicz M., Skorzynska-Polit E. & Krupa Z. (2004) Copper-induced oxidative stress and antioxidant defence in Arabidopsisthaliana. Biometals 17, 379–387.

Faller P., Kinzler K. & Krieger-Liszkay A. (2005) Mechanism ofCd2+ toxicity: Cd2+ inhibits photoactivation of Photosystem II bycompetitive binding to the essential Ca2+ site. Biochimica et Bio-physica Acta 1706, 158–164.



Finkemeier I., Goodman M., Lamkemeyer P., Kandlbinder A.,Sweetlove L.J. & Dietz K.J. (2005) The mitochondrial type IIperoxiredoxin F is essential for redox homeostasis and rootgrowth of Arabidopsis thaliana under stress. Journal of Biologi-cal Chemistry 280, 12168–12180.

Flor-Henry M., Mccabe T.C., de Bruxelles G.L. & Roberts M.R.(2004) Use of a highly sensitive two-dimensional luminescenceimaging system to monitor endogenous bioluminescence in plantleaves. BMC Plant Biology 4, 19.

Fryer M.J. (1993) The antioxidant effects of thylakoid vitamin E(a-tocopherol). Plant, Cell & Environment 15, 381–392.

Gama F., Keech O., Eymery F., Finkemeier I., Gelhaye E., Garde-ström P., Dietz K.J., Rey P., Jacquot J.P. & Rouhier N. (2007) Themitochondrial type II peroxiredoxin from poplar. PhysiologiaPlantarum 129, 196–206.

Garcia I., Rodgers M., Pepin R., Hsieh T.F. & Matringe M. (1999)Characterization and subcellular compartmentation of recombi-nant 4-hydroxyphenylpyruvate dioxygenase from Arabidopsis intransgenic tobacco. Plant Physiology 119, 1507–1516.

Gillet S., Decottignies P., Chardonnet S. & Le Maréchal P. (2006)Cadmium response and redoxin targets in Chlamydomonas rein-hardtii: a proteomic approach. Photosynthesis Research 89, 201–211.

Halliwell B. & Gutteridge J.M.C. (1986) Iron and free radical reac-tions: two aspects of antioxidant protection. Trends in Biochemi-cal Science 11, 375.

Havaux M., Eymery F., Porfirova S., Rey P. & Dörmann P. (2005)Vitamin E protects against photoinhibition and photoxidativestress in Arabidopsis thaliana. The Plant Cell 17, 3451–3469.

Havaux M., Triantaphylidès C. & Genty B. (2006) Autolumines-cence imaging: a non-invasive tool for mapping oxidative stress.Trends in Plant Science 11, 480–484.

Ivanov B. & Khorobrykh S. (2003) Participation of photosyntheticelectron transport in production and scavenging of reactiveoxygen species. Antioxidants and Redox Signalling 5, 43–54.

Jander G., Norris S.R., Rounsley S.D., Bush D.F., Levin I.M. & LastR.L. (2002) Arabidopsis map-based cloning in the post-genomeera. Plant Physiology 129, 440–450.

Johnson M.P., Havaux M., Triantaphylides C., Ksas B., Pascal A.A.,Robert B., Davison P.A., Ruban A.V. & Horton P. (2007)Elevated zeaxanthin bound to oligomeric LHCII enhances theresistance of Arabidopsis to photo-oxidative stress by a lipid-protective, anti-oxidant mechanism. Journal of Biological Chem-istry 282, 22605–22618.

Kanwischer M., Porfirova S., Bergmuller E. & Dormann P. (2005)Alterations in tocopherol cyclase activity in transgenic andmutant plants of Arabidopsis affect tocopherol content, toco-pherol composition, and oxidative stress. Plant Physiology 137,713–723.

Kobayashi M., Takeda M., Ito K., Kato H. & Inaba H. (1999) Invivo imaging of spontaneous ultraweak photon emission from arat’s brain correlated with cerebral energy metabolism and oxi-dative stress. Neuroscience Research 34, 103–113.

Krieger-Liszkay A. & Trebst A. (2006) Tocopherol is the scavengerof singlet oxygen produced by the triplet states of chlorophyll inthe PSII reaction centre. Journal of Experimental Botany 57,1677–1684.

Lemaire S., Keryer E., Stein M., Schepens I., Issakidis-Bourguet E.,Gérard-Hirne C., Miginiac-Maslow M. & Jacquot J.P. (1999)Heavy-metal regulation of thioredoxin gene expression inChlamydomonas reinhardtii. Plant Physiology 120, 773–778.

Lesaint C. (1982) Coïc method: principle and practical application.Acta Horticulturae 126, 367–374.

Linster C.L., Gomez T.A., Christensen K.C., Adler L.N., YoungB.D., Brenner C. & Clarke S.G. (2007) Arabidopsis VTC2encodes a GDP-L-galactose phosphorylase, the last unknown

enzyme in the Smirnoff-Wheeler pathway to ascorbic acid inplants. Journal of Biological Chemistry 282, 18879–18885.

Luis P., Behnke K., Toepel J. & Wilhelm C. (2006) Parallel analysisof transcript levels and physiological key parameters allows theidentification of stress phase gene markers in Chlamydomonasreinhardtii under copper excess. Plant, Cell & Environment 29,2043–2054.

Maeda H., Sakuragi Y., Bryant D.A. & DellaPenna D. (2005) Toco-pherols protect Synechocystis sp. Strain PCC 6803 from lipidperoxidation. Plant Physiology 138, 1422–1435.

Maeda H., Song W., Sage T.L. & DellaPenna D. (2006) Tocopherolsplay a crucial role in low-temperature adaptation and phloemloading in Arabidopsis. Plant Cell 18, 2710–2732.

Mattie M.D. & Freedman J.H. (2001) Protective effects of aspirinand vitamin E (a-tocopherol) against copper- and cadmium-induced toxicity. Biochemical and Biophysical Research Com-munications 285, 921–925.

Mittler R., Vanderauwers S., Gollery M. & Van Breusegem F.(2004) Reactive oxygen gene network of plants. Trends in PlantScience 9, 490–498.

Müller-Moulé P., Havaux M. & Niyogi K.K. (2003) Zeaxanthindeficiency enhances the high light sensitivity of an ascorbate-deficient mutant of Arabidopsis. Plant Physiology 133, 748–760.

Munné-Bosch S., Weiler E.W., Alegre L., Müller M., Düchting P. &Falk J. (2007) a-Tocopherol may influence cellular signaling bymodulating jasmonic acid levels in plants. Planta 225, 681–691.

Navrot N., Collin V., Gualberto J., Gelhaye E., Hirasawa M., Rey P.,Knaff D.B., Issakidis E., Jacquot J.P. & Rouhier N. (2006) Plantglutathione peroxidases are functional peroxiredoxins distrib-uted in several subcellular compartments and regulated duringbiotic and abiotic stresses. Plant Physiology 142, 1364–1379.

Nieboer E. & Richardson D.H.S. (1980) The replacement of thenondescript term ‘heavy metal’ by a biologically significant andchemically significant classification of metal ions. EnvironmentalPollution B 1, 3–26.

Noctor G. & Foyer C.H. (1998) Ascorbate and glutathione: keepingactive oxygen under control. Annual Review in Plant Physiologyand Plant Molecular Biology 49, 249–279.

Pagliano C., Raviolo M., Dalla Vecchia F., Gabbrielli R., GonnelliC., Rascio N., Barbato R. & La Rocca N. (2006) Evidence forPSII donor-side damage and photoinhibition induced bycadmium treatment on rice (Oryza sativa L.). Journal of Photo-chemistry and Photobiology B: Biology 84, 70–78.

Park H., Song B. & Morel F.M. (2007) Diversity of the cadmium-containing carbonic anhydrase in marine diatoms and naturalwaters. Environmental Microbiology 9, 403–413.

Picault N., Cazale A.C., Beyly A., Cuiné S., Carrier P., Luu D.T.,Forestier C. & Peltier G. (2006) Chloroplast targeting of phy-tochelatin synthase in Arabidopsis: effects on heavy metal toler-ance and accumulation. Biochimie 88, 1743–1750.

Porfirova S., Bergmuller E., Tropf S., Lemke R. & Dormann P.(2002) Isolation of an Arabidopsis mutant lacking vitamin E andidentification of a cyclase essential for all tocopherol biosynthe-sis. Proceedings of the National Academy of Sciences of theUnited States of America 99, 12495–12500.

Rey P., Pruvot G., Becuwe N., Eymery F., Rumeau D. & Peltier G.(1998) A novel thioredoxin-like protein located in the chloro-plast is induced by water deficit in Solanum tuberosum L. plants.Plant Journal 13, 97–107.

Rey P., Cuiné S., Eymery F., Garin J., Court M., Jacquot J.P., RouhierN. & Broin M. (2005) Analysis of the proteins targeted byCDSP32, a plastidic thioredoxin participating in oxidative stressresponses. Plant Journal 41, 31–42.

Rey P., Becuwe N., Barrault M.B., Rumeau D., Havaux M.,Biteau B. & Toledano M.B. (2007) The Arabidopsis thaliana



sulfiredoxin is a plastidic cysteine-sulfinic acid reductaseinvolved in the photooxidative stress response. Plant Journal 49,505–514.

Rodríguez-Serrano M., Romero-Puertas M.C., Zabalza A., CorpasF.J., Gómez M., Del Río L.A. & Sandalio L.M. (2006) Cadmiumeffect on oxidative metabolism of pea (Pisum sativum L.) roots.Imaging of reactive oxygen species and nitric oxide accumula-tion in vivo. Plant, Cell & Environment 29, 1532–1544.

Rouhier N., Gelhaye E., Gualberto J.M., et al. (2004) Poplar perox-iredoxin Q. A thioredoxin-linked chloroplast antioxidant func-tional in pathogen defense. Plant Physiology 134, 1027–1038.

Sandalio L.M., Dalurzo H.C., Gomez M., Romero-Puertas M.C. &Rio L.A. (2001) Cadmium-induced changes in the growth andoxidative metabolism of pea plants. Journal of ExperimentalBotany 52, 2115–2126.

Sandmann G. & Böger P. (1980) Copper-mediated lipid peroxida-tion processes in photosynthetic membranes. Plant Physiology66, 797–800.

Sattler S.E., Gilliland L.U., Magallanes-Lundback M., Pollard M. &DellaPenna D. (2004) Vitamin E is essential for seed longevityand for preventing lipid peroxidation during germination. PlantCell 16, 1419–1432.

Schneider C. (2005) Chemistry and biology of vitamin E. MolecularNutrition and Food Research 49, 7–30.

Schützendübel A. & Polle A. (2002) Plant responses to abioticstresses: heavy metal-induced oxidative stress and protection bymycorrhization. Journal of Experimental Botany 53, 1351–1365.

Sen C.K., Khanna S. & Roy S. (2006) Tocotrienols: vitamin Ebeyond tocopherols. Life Sciences 78, 2088–2098.

Sigfridsson K.G.V., Bernat G., Mamedov F. & Styring S. (2004)Molecular interference of Cd2+ with Photosystem II. Biochimicaet Biophysica Acta 1659, 19–31.

Theriault A., Chao J.-T., Wang Q., Gapor A. & Adeli K. (1999)Tocotrienol: a review of its therapeutic potential. Clinical Bio-chemistry 32, 309–319.

Valentin H.E., Lincoln K., Moshiri F., et al. (2006) The Arabidopsisvitamin E pathway gene5-1 mutant reveals a critical role forphytol kinase in seed tocopherol biosynthesis. The Plant Cell 18,212–224.

Valko M., Morris H. & Cronin M.T. (2005) Metals, toxicity andoxidative stress. Current Medicinal Chemistry 12, 1161–1208.

Van Duijvendijk-Matteoli M.A. & Desmet G.M. (1975) On theinhibitory action of cadmium on the donor side of photosystemII in isolated chloroplasts. Biochimica et Biophysica Acta 408,164–169.

Vieira Dos Santos C. & Rey P. (2006) Plant thioredoxins are keyactors in oxidative stress response. Trends in Plant Science 11,329–334.

Vieira Dos Santos C., Cuiné S., Rouhier N. & Rey P. (2005) TheArabidopsis thaliana plastidic methionine sulfoxide reductase Bproteins. Sequence and activity characteristics, comparison of theexpression with plastidic methionine sulfoxide reductase A andinduction by photooxidative stress. Plant Physiology 138, 909–922.

Vijayavel K., Gopalakrishnan S., Thilagam H. & BalasubramanianM.P. (2006) Dietary ascorbic acid and alpha-tocopherol miti-gates oxidative stress induced by copper in the thornfish Teraponjarbua. Science of the Total Environment 372, 157–163.

Von Zglinicki T., Edwall C., Ostlund E., Lind B., Nordberg M.,Ringertz N.R. & Wroblewski J. (1992) Very low cadmium con-centrations stimulate DNA synthesis and cell growth. Journal ofCell Science 103, 1073–1081.

Xiong Z.-T. & Peng Y.-H. (2001) response of pollen germinationand tube growth to cadmium with special reference to low con-centration exposure. Ecotoxicology and Environmental Safety48, 51–55.

Received 2 August 2007; received in revised form 9 October 2007;accepted for publication 29 October 2007



vitamin e is essential for the tolerance of arabidopsis ... · vitamin e is essential for the...

Documents