vs sohal et al. nature 000 , 1-5 (2009) doi:10.1038/nature07991

VS Sohal et al. Nature 000, 1-5 (2009) doi:10.1038/nature07991 Gamma oscillations amplify signals and reduce noise in PY cells.

Upload: conan-ashley

Post on 30-Dec-2015

36 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

Gamma oscillations amplify signals and reduce noise in PY cells. VS Sohal et al. Nature 000 , 1-5 (2009) doi:10.1038/nature07991. - PowerPoint PPT Presentation

TRANSCRIPT

VS Sohal et al. Nature 000, 1-5 (2009) doi:10.1038/nature07991

Gamma oscillations amplify signals and reduce noise in PY cells.

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

GI Motility online (May 2006) | doi:10.1038/gimo46

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

DOI: 10.1038/NPHYS3211 Supplementary Information for

doi:10.1038/nature05150 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

GI Motility online (May 2006) | doi:10.1038/gimo31

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature05202 LETTERS

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Biotechnology: doi:10.1038/nbt

GI Motility online (May 2006) | doi:10.1038/gimo6

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

GI Motility online (May 2006) | doi:10.1038/gimo48

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7