biologyteacherorg.files.wordpress.com · web viewfigure 1. shows one base pair of a dna molecule....

AQA Biology

3.1.5 Nucleic Acid Structure3.4.2 DNA and Protein Synthesis

Name: ______________________

Lesson Exam Question Marks

Homework Checked

Date

Lesson 1 – Nucleotide and DNA Structure /25

Lesson 2 – DNA Replication /25

Lesson 3 – Transcription /13

Lesson 4 – Translation /24

of 34

Specification Sections

of 34

Key word list Anticodon A sequence of three adjacent nucleotides on a molecule of transfer RNA that is

complementary to a particular codon on a messenger RNA moleculeADP A nucleotide which combines in a condensation reaction, catalysed by ATP synthase,

with a phosphate molecule to form ATP. ATP

(adenosine triphosphate)

Nucleotide found in all living organisms, which is produced during respiration and is important in the transfer of energy

Clone A group of genetically identical organisms formed from a single parent as a result of asexual reproduction or by artificial means

Codon A sequence of three adjacent nucleotides in mRNA that codes for one amino acidComplimentary

base pairingSpecific rules for how the bases pair together. Adenine pairs with thymine with 2 hydrogen bonds. Guanine binds with cytosine with 3 hydrogen bonds.

Complementary DNA

DNA that is made from messenger RNA in a process that is the reverse of normal transcription

Condensation A chemical process in which two molecules combine to form a more complex one with the elimination of a simple substance, usually water

Conjugation The transfer of DNA from one cell to another by means of a thin tube between the two

DNA Deoxyribonucleic acid which is present in nearly all living organisms as the carrier of genetic information. A double helix made up of two polynucleotide

of 34

chains, running antiparallel to each other, with the sugar-phosphate backbone on the outside and organic bases bonded together by Hydrogen bonds in the centre of the helix. The nucleotides have a deoxyribose sugar and the bases adenine, thymine, guanine or cytosine.

DNA helicase An enzyme that acts on a specific region of the DNA molecule to break the hydrogen bonds between the bases causing the two strands to separate and expose the nucleotide bases in that region

DNA polymerase

Enzyme that joins DNA nucleotides together in a condensation reaction (forming phosphodiester bonds) during DNA replication.

DNA replication The process in which the double helix of a DNA molecule unwinds and each strand acts as a template on which a new strand is constructed

Double helix Structure of DNA made up of 2 strands of nucleotides running in opposite directions. Enzyme A protein or RNA that acts as a catalyst and so alters the speed of a biochemical

reaction Gene A section of DNA on a chromosome coding for one or more polypeptide

Genotype The genetic composition of an organismHydrogen bond Chemical bond formed between the positive charge on a hydrogen atom and the

negative charge on another atom of an adjacent moleculeHydrolysis The breaking down of large molecules into smaller ones by the addition of water

moleculesMitosis The type of nuclear division in which the daughter cells have the same number of

chromosomes as the parent cellMutagen Any agent that induces a mutationMutation A sudden change in the amount or the arrangement of the genetic material in the cell

Nucleotides Complex chemicals made up of an organic base, a sugar and a phosphate. They are the basic units of which the nucleic acids DNA and RNA are made

Organic base Part of a nucleotide - either adenine, thymine, cytosine, guanine or uracil. Pentose A sugar that possesses five carbon atoms

Peptide bond The chemical bond formed between two amino acids during condensationPhenotype The characteristics of an organism, often visible, resulting from both its genotype and

the effects of the environmentPhosphodiester

bondThe bond formed by a condensation reaction between the phosphate group of one nucleotide and the pentose sugar of another nucleotide.

Polynucleotide A polymer of monomers called nucleotides.Primary

structure of a protein

The sequence of amino acids that makes up the polypeptides of a protein

Quaternary structure of a

protein

A number of polypeptide chains linked together, and sometimes associated with non-protein groups to form a protein

RNA A polynucleotide which contains nucleotides that have the pentose sugar ribose rather than deoxyribose and contains the bases adenine, uracil, guanine or cytosine. Can be either mRNA, tRNA or rRNA.

RNA polymerase

Enzyme that joins together nucleotides to form messenger RNA during transcription

Secondary structure of a

protein

The way in which the chain of amino acids of the polypeptides of a protein is folded

Semi-conservative replication

The means by which DNA makes exact copies of itself by unwinding the double helix so that each chain acts as a template for the next

Tertiary structure of a

protein

The folding of a whole polypeptide chain in a precise way, as determined by the amino acids of which it is composed

Transcription Formation of messenger RNA molecules from the DNA that makes up a particular gene

of 34

Lesson 1 – Nucleotide and DNA Structure

By the end of this lesson you should be able to:

Describe the physical structure of DNA as a polymer of nucleotides Compare differences between DNA and RNA Describe the structure of ATP

Notes:

DNA is a nucleic acid. Nucleic acids are biological macromolecules containing oxygen, hydrogen, carbon, nitrogen and phosphorus. There are two types of nucleic acids: ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). Nucleic acids are made up of basic units called nucleotides. Each nucleotide is made up of a phosphate, a ribose sugar and a base.

of 34

Nucleotides bind together through condensation reactions to form a polynucleotide. Condensation reactions also join each nucleotide together between the phosphate group of one and a carbon of the pentose sugar of the other. This bond is known as a phosphodiester bond.

Each strand of DNA is joined by the bases. There are four different bases in DNA:

• thymine, T• adenine, A• guanine, G• cytosine, C

They always pair up in a particular way, called complementary base pairing: thymine always pairs with adenine (T–A), and guanine always pairs with cytosine (G–C). This means that there will always be equal amounts of A and T and equal amounts of C and G in each DNA molecule.

Bases form hydrogen bonds between them which hold the two strands of DNA together, lots of hydrogen bonds provides strength. There are more hydrogen bonds between Cytosine and Guanine so the more of these there are the more stable the DNA molecule.

RNA is a simpler molecule than DNA. It contains the bases A, C and G, but T is replaced with a different base called uracil (U). Apart from uracil in place of thymine, RNA is different to DNA in 2 other ways:

The sugar is ribose, not deoxyribose.

The nucleotide strand is a single strand, not double.

There are two different kinds of RNA – messenger RNA (mRNA) and transfer RNA (tRNA).

ATP has very similar structure to a nucleotide. It contains a ribose sugar, an adenine base but it has 3 phosphate groups.

of 34

Energy is stored in the bonds between the phosphates, when they are hydrolysed energy is released.

Phosphates that have been separated from ATP can be used to phosphorylate other molecules in cells to make them more reactive.

Hydrolysis of ATP to adenosine diphosphate (ADP) and an inorganic phosphate group (Pi) is catalysed by the enzyme ATP hydrolase. The hydrolysis of ATP can be coupled to energy-requiring reactions within cells. The inorganic phosphate released during the hydrolysis of ATP can be used to phosphorylate other compounds, often making them more reactive.

Recall Questions:

1. Name the 4 bases found in DNA, name the bonds that form between them2. Draw a nucleotide3. Draw a polynucleotide. Label the phosphodiester bond4. Which molecules make up the 'backbone' of a polynucleotide?5. Describe the difference between bacterial DNA and eukaryotic DNA6. What are histones ? 7. What is an intron?8. What is an exon?9. Apart from the nucleus where else can DNA be found in the cell of a eukaryote? 10. What are the two differences between DNA and RNA?11. What is the structure of ATP?12. What does the hydrolysis of ATP produce?13. Give the equation for the formation of ATP14. What are the differences between ATP and A DNA nucleotide?

Exam Questions:

Q1. The diagram shows a molecule of DNA. It is replicating.

(a) Name two substances in the region labelled X.

1._______________________________________

2. ___________________________________________(1)

of 34

Q2. (a) The diagram shows one pair of nucleotides of a DNA molecule.

Name

D

_________________________________________

E _________________________________________

F _________________________________________(3)

(b) Complete the table to give two differences between the structure of DNA and the structure of RNA.

DNA RNA

1

2

(2)

Q3. The diagram shows part of a DNA molecule.(a) DNA is a polymer. What is the evidence from the diagram that DNA is a polymer?

_________________________________________________

________________________________________________(1)

(b) Name the parts of the diagram labelled C, D and E.

Part C ________________________

Part D ________________________

of 34

Part E ________________________ (3)

(iii) In a piece of DNA, 34% of the bases were thymine.

Complete the table to show the names and percentages of the other bases (2)

Name of base Percentage

Thymine 34

34

Q4.Figure 1 shows a short section of a DNA molecule.

(a) Name parts R and Q.

(i) R ____________________

(ii) Q ____________________

(2)

(b) Name the bonds that join A and B.

__________________________________(1)

Q5.Figure 1 shows one base pair of a DNA molecule.

(a) Name part F of each nucleotide.

_______________________________________(1)

(b) Scientists determined that a sample of DNA contained 18% adenine.

What were the percentages of thymine and guanine in this sample of DNA?

Percentage of thymine

of 34

Percentage of guanine

(c) DNA and RNA can be found in bacteria.

Give two ways in which the nucleotides in DNA are different from the nucleotides in RNA.

1. _________________________________________________________________

2. _________________________________________________________________ (2)Q6.

Cells constantly hydrolyse ATP to provide energy.

(a) Describe how ATP is resynthesised in cells.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(2)

(b) Water is used to hydrolyse ATP.

Name the two products of ATP hydrolysis.

1. _________________________________________________________________

2. _________________________________________________________________(1)

(c) Give two ways in which the hydrolysis of ATP is used in cells.

1. _________________________________________________________________

___________________________________________________________________

2. _________________________________________________________________

___________________________________________________________________(2)

Q7. Adenosine triphosphate (ATP) is a nucleotide derivative.

Contrast the structures of ATP and a nucleotide found in DNA to give two differences.

1. _________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

of 34

2. _________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(2)

Recall Question Answers:

Question Answer1. Name the 4 bases found in DNA, name

the bonds that form between them Adenine - Thymine and Guanine -cytosine. Hydrogen bonds

2. Draw a nucleotide

3. Draw a polynucleotide. Label the phosphodiester bond

4. Which molecules make up the 'backbone' of a polynucleotide? Phosphates and pentose sugars

5. Describe the difference between bacterial DNA and eukaryotic DNA

Bacterial DNA is short, circular and not associated with proteins. Eukaryotic DNA is long, linear and associated with proteins to form chromosomes.

6. What are histones ? proteins that DNA wraps around to form chromatin which makes up chromosomes

7. What is an intron? Non-coding sections of DNA8. What is an exon? Coding sections of DNA9. Apart from the nucleus where else can

DNA be found in the cell of a eukaryote? Mitochondria (and chloroplasts in plant cells)

10. What are the three differences between DNA and RNA?

T is replaced with a different base called uracil (U), the sugar is ribose, not deoxyribose. The nucleotide strand is a single strand, not double.

11. What is the structure of ATP?It contains a ribose sugar, an adenine base but it has 3 phosphate groups

12. What does the hydrolysis of ATP produce? ADP + Pi

13. Give the equation for the formation of ATP ADP + Pi ATP

14. What are the differences between ATP and A DNA nucleotide?

ATP contains two more phosphate groups and is only made of adenine base DNA can have

of 34

Homework:

This is a copy of the original research paper, proposing a structure for DNA, published in 1953. Its significance was not realised straight away. The structure they proposed for DNA is still accepted today and has changed the face of science. They discovered the code for life.

A structure for Deoxyribose Nucleic Acid“The year 1953 could be said to mark, in biology at least, the end of history. Here is James Watson and Francis Crick's paper on the structure of DNA, which ushered in the new era with the celebrated understatement near the end.” (as published in NATURE magazine)”

2 April 1953MOLECULAR STRUCTURE OF NUCLEIC ACIDS

We wish to suggest a structure for the salt of deoxyribose nucleic acid (D.N.A.). This structure has novel features which are of considerable biological interest.

A structure for nucleic acid has already been proposed by Pauling and Corey (1). They kindly made their manuscript available to us in advance of publication. Their model consists of three intertwined chains, with the phosphates near the fibre axis, and the bases on the outside. In our opinion, this structure is unsatisfactory for two reasons: (1) We believe that the material which gives the X-ray diagrams is the salt, not the free acid. Without the acidic hydrogen atoms, it is not clear what forces would hold the structure together, especially as the negatively charged

phosphates near the axis will repel each other. (2) Some of the van der Waals distances appear to be too small.

Another three-chain structure has also been suggested by Fraser (in the press). In his model, the phosphates are on the outside and the bases on the inside, linked together by hydrogen bonds. This structure as described is rather ill-defined, and for this reason we shall not comment on it.

We wish to put forward a radically different structure for the salt of deoxyribose nucleic acid. This structure has two helical chains each coiled round the same axis (see diagram). We have made the usual chemical assumptions, namely, that each chain consists of phosphate diester groups joining ß-D-deoxyribofuranose residues with 3',5' linkages. The two chains (but not their bases) are related by a dyad perpendicular to the fibre axis. Both chains follow right- handed helices, but owing

of 34

to the dyad the sequences of the atoms in the two chains run in opposite directions. The bases are on the inside of the helix and the phosphates on the outside. The configuration of the sugar and the atoms near it is close to Furberg's 'standard configuration', the sugar being roughly perpendicular to the attached base. The distance of a phosphorus atom from the fibre axis is 10 A. As the phosphates are on the outside, cations have easy access to them.

The structure is an open one, and its water content is rather high. At lower water contents we would expect the bases to tilt so that the structure could become more compact.

The novel feature of the structure is the manner in which the two chains are held together by the purine and pyrimidine bases. The planes of the bases are perpendicular to the fibre axis. They are joined together in pairs, a single base from the other chain, so that the two lie side by side with identical z-co-ordinates. One of the pair must be a purine and the other a pyrimidine for bonding to occur. The hydrogen bonds are made as follows: purine position 1 to pyrimidine position 1; purine position 6 to pyrimidine position 6.

If it is assumed that the bases only occur in the structure in the most plausible tautomeric forms (that is, with the keto rather than the enol configurations) it is found that only specific pairs of bases can bond together. These pairs are: adenine (purine) with thymine (pyrimidine), and guanine (purine) with cytosine (pyrimidine).

In other words, if an adenine forms one member of a pair, on either chain, then on these assumptions the other member must be thymine; similarly for guanine and cytosine. The sequence of bases on a single chain does not appear to be restricted in any way. However, if only specific pairs of bases can be formed, it follows that if the sequence of bases on one chain is given, then the sequence on the other chain is automatically determined.

It has been found experimentally that the ratio of the amounts of adenine to thymine, and the ratio of guanine to cytosine, are always very close to unity for deoxyribose nucleic acid.

It is probably impossible to build this structure with a ribose sugar in place of the deoxyribose, as the extra oxygen atom would make too close a van der Waals contact. The previously published X-ray data on deoxyribose nucleic acid are insufficient for a rigorous test of our structure. So far as we can tell, it is roughly compatible with the experimental data, but it must be regarded as unproved until it has been checked against more exact results.

It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.

Full details of the structure, including the conditions assumed in building it, together with a set of co-ordinates for the atoms, will be published elsewhere.

We are much indebted to Dr. Jerry Donohue for constant advice and criticism, especially on interatomic distances. We have also been stimulated by a knowledge of the general nature of the unpublished experimental results and ideas of Dr. M. H. F. Wilkins, Dr. R. E. Franklin and their co-workers at King's College, London.

of 34

J. D. WATSON F. H. C. CRICK

TASK: Use the text to help you answer the questions below it in full sentences.

1. What are the 3 main differences between Watson & Crick’s and Pauling & Corey’s proposed

structures for DNA?

2. How do Watson & Crick briefly describe the shape of the double helix?

3. Describe the positions of the bases and the phosphates in relation to the helix.

4. What do they expect to happen to DNA in a lower water content?

5. Name the 4 bases.

6. Which bases are purines and which are pyramidines?

7. Put the bases into their pairs.

8. Describe the experimental evidence for base pairing.

of 34

9. Why can the double helix structure not be formed using a ribose sugar in place of the deoxyribose?

10. CHALLENGE: how does complimentary base pairing ‘suggest a possible copying mechanism for

the genetic material’?

Lesson 2 – DNA Replication

By the end of this lesson you should be able to: Explain how the structure of DNA is important to the replication process Describe the semiconservative replication of DNA Explain the experimental evidence that supports the semi-conservative model

Notes:

DNA has to replicate itself every time a cell divides so that both cells have identical copies of the entire genome. The method of replication is called semi conservative replication, this is because half (semi) of each new double helix is a strand that has come from the double helix of the original DNA molecule. It has been conserved from the parent cell.

Replication Steps:

1) The enzyme DNA helicase “unwinds” the double helix breaks the hydrogen bonds between the bases of the two DNA strands.

2) Each original strand then acts as a template to build a new strand. Free DNA nucleotides are attracted to the exposed bases on the template strands and they attach to the correct base through complementary base pairing. A with T and C with G.

3) The free nucleotides are joined to the new strand with condensation reactions catalysed by the enzyme DNA polymerase which forms hydrogen bonds between the bases on the two strands.

4) Each new DNA molecule contains one strand from the original DNA molecule and one new strand.

1) 2) 3) 4)

of 34

The structure of DNA is adapted to allow replication to occur efficiently – Watson and Crick identified this when they discovered the structure. They hydrogen bonds between the bases can be easily broken to allow both strands to be a template and complimentary base pairing means that replication of the new strands should be accurate as the correct bases can ONLY pair with each other due to their structure.

How DNA polymerase works

Each DNA strand has a directional structure due to the ends of each strand being either a sugar that’s attached to the 5th carbon 5’ (5 prime) end; or a hydroxyl group attached to the 3’ (3 prime) end.

DNA polymerase is only complimentary to the 3’ end of the template strand so it can only move along the template strand and add nucleotides in the 3’ to 5’ direction. This means the new strand is built 5’ to 3’ because the strands are antiparallel.

This means while one strand is continuously built the other is built in the other direction in sections as the DNA is unwound. The DNA polymerase on the opposite template strand has to detach and re-attach so it often moves more slowly

.

Experimental Evidence for Semi-conservative Replication:

Conservative replication was still considered a possibility until an experiment by a pair of scientists: Meselson and Stahl, proved that DNA replication was semi-conservative.

The experiment relies on the fact that nucleotides contain nitrogen and they used two isotopes of nitrogen one “light” 14N and one “heavy” 15N. DNA samples made with nucleotides containing the different isotopes of nitrogen can be seperated by their weight in a centrifuge. “Heavy” DNA will sink and “light” DNA will settle out higher up in the solution.

To get samples of “heavy” and “light” DNA Meselson and Stahl grew two cultures of bacteria in nutrient broth that contained either light nitrogen or heavy nitrogen so that it would be incorporated into their nucleotides.

The bacteria grown with the heavy nitrogen were then put into a broth containing only light nitrogen. This meant that when they replicated the parent or original DNA strand would contain the heavy nucleotides but to make the new DNA strands they would only be able to use light nucleotides. They took a sample after one

of 34

https://www.google.com/url?sa=i&rct=j&q=&esrc=s&frm=1&source=images&cd=&cad=rja&docid=6lEr57tyVMMvBM&tbnid=ztQ9nuUx6Lv_wM:&ved=0CAUQjRw&url=https://s10.lite.msu.edu/res/msu/botonl/b_online/library/bio201/mestahl.html&ei=eNFPUt-cMpC10QWz0oDgDw&bvm=bv.53537100,d.d2k&psig=AFQjCNEzk5TZrilypb-IgILcfhBtsqCTew&ust=1381048324700287

http://www.google.com/url?sa=i&rct=j&q=&esrc=s&frm=1&source=images&cd=&cad=rja&docid=gQnKyEETzC_H_M&tbnid=Ych2fP6qd4OfnM:&ved=0CAUQjRw&url=http://www.gida.de/testcenter/biologie/bio-dvd017/aufgabe_02.htm&ei=mdBPUufSJa620QXspICwCQ&bvm=bv.53537100,d.d2k&psig=AFQjCNEzk5TZrilypb-IgILcfhBtsqCTew&ust=1381048324700287

generation, if the DNA replication was conservative there should be two bands one of the original heavy DNA and one new lighter band for the new strand of DNA. If replication was semi-conservative, all the DNA would contain a mixture of heavy and light DNA as there would be one strand of each in the double helix and the band would settle half way between the heavy and light samples. This is what they found!

The second generation showed that this continued as a light band was seen this time. This is because the DNA molecule splits two strands would have been formed with the light DNA strand as the template and two would be a mix as they used the original heavy DNA as a template.

Recall Questions:

1. What type of reaction joins nucleotides? 2. Why is it known as “semiconservative replication?” 3. What evidence do we have to prove there are two strands? 4. What enzyme breaks the hydrogen bonds between bases? 5. What enzyme adds new nucleotides to the new strand? 6. Why is one strand known as the template strand? 7. State the enzymes involved in DNA replication. 8. State the function of DNA polymerase. 9. State the function of DNA helicase. 10. The free nucleotides pair up with the exposed bases on the DNA strands based on ...... (which principle?) 11. State the 5 steps of DNA replication

Exam Questions:

Q1. The enzymes DNA helicase and DNA polymerase are involved in DNA replication.

Describe the function of each of these enzymes.

DNA helicase _______________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

DNA polymerase _____________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(2)

of 34

https://www.google.com/url?sa=i&rct=j&q=&esrc=s&frm=1&source=images&cd=&cad=rja&docid=6lEr57tyVMMvBM&tbnid=ztQ9nuUx6Lv_wM:&ved=0CAUQjRw&url=https://s10.lite.msu.edu/res/msu/botonl/b_online/library/bio201/mestahl.html&ei=eNFPUt-cMpC10QWz0oDgDw&bvm=bv.53537100,d.d2k&psig=AFQjCNEzk5TZrilypb-IgILcfhBtsqCTew&ust=1381048324700287

Q2. The diagram shows a molecule of DNA. It is replicating.

Describe how, after the parent DNA strands separated, the second strand of DNA in region Y was formed.

__________________________________________________________

___________________________________________________________

____________________________________________________________

___________________________________________________________

____________________________________________________________

____________________________________________________________

____________________________________________________________ (3)

Q3. Give two features of DNA and explain how each one is important in the semi-conservative replication of DNA.

1. _________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

2. _________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(2)

Q4. Describe how DNA is replicated.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

of 34

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(6)

Q5. (a) Scientists determined that a sample of DNA contained 18% adenine. What were the percentages of thymine and guanine in this sample of DNA?

Percentage of thymine

Percentage of guanine

(2)

During replication, the two strands of a DNA molecule separate and each acts as a template for the production of a new strand.

Figure 2 represents DNA replication.

Figure 2

(b) Name the enzyme shown in Figure 2.

___________________________________________________________________(1)

The arrows in Figure 2 show the directions in which each new DNA strand is being produced.

(d) Use Figure 1, Figure 2 and your knowledge of enzyme action to explain why the arrows

of 34

point in opposite directions.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

_________________________________________________________________(4)

Q6. (a) Explain why the replication of DNA is described as semi-conservative.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(2)

(b) Bacteria require a source of nitrogen to make the bases needed for DNA replication. In an investigation of DNA replication some bacteria were grown for many cell divisions in a medium containing 14N, a light form of nitrogen. Others were grown in a medium containing 15N, a heavy form of nitrogen. Some of the bacteria grown in a 15N medium were then transferred to a 14N medium and left to divide once. DNA was isolated from the bacteria and centrifuged. The DNA samples formed bands at different levels, as shown in the diagram.

of 34

(i) What do tubes A and B show about the density of the DNA formed using the two different forms of nitrogen?

______________________________________________________________

______________________________________________________________(1)

(ii) Explain the position of the band in tube C.

______________________________________________________________

______________________________________________________________

______________________________________________________________(2)

of 34


Question Answer1. What type of reaction joins nucleotides?

Condensation

2. What is semi conservative replication?Half of the strands in each new DNA molecule are from the original DNA molecule

3. Why is it known as “semi-conservative” replication?

Because the original strand is split in two and half of each new strand comes from the original. Half is 'conserved'

4. What evidence do we have to prove there are two strands? The Meselson and Stahl experiment

5. What enzyme breaks the hydrogen bonds between bases? DNA helicase

6. What enzyme adds new nucleotides to the new strand? DNA polymerase

7. Why is one strand known as the template strand?

Because it acts as a template for new nucleotides to create a new strand with the correct complimentary base pairing.

8. State the enzymes involved in DNA replication. DNA Helicase, DNA polymerase

9. Which enzyme separates the strands in DNA replication? DNA Helicase

10. State the role of DNA polymerase Joins nucleotides together in condensation reactions

11. State the steps of DNA replication in order

1. DNA helicase separates the two strands by breaking the hydrogen bonds between bases. 2. Each strand acts as a template3. Free nucleotides attach to template strand through complimentary base pairing. 4. DNA polymerase joins nucleotides by reforming hydrogen bonds between bases5. Replication is semi-conservative as new DNA molecules contain one old strand and one new strand.

12. The free nucleotides pair up with the exposed bases on the DNA strands based on ...... (which principle?) Complementary base pairing

Homework: https://learn.genetics.utah.edu/content/basics/telomeres/ Read the article about telomeres and answer the following questions:

1. Why do DNA sequences get shorter every time they are replicated?

2. What role do telomeres play in DNA replication?

3. Why do telomeres get shorter each time DNA is replicated?

4. What does the enzyme telomerase do?

of 34

https://learn.genetics.utah.edu/content/basics/telomeres/

5. Why can understanding telomeres be useful? Lesson 3 – Transcription

By the end of this lesson you should be able to:

Describe the process of transcription and its importance in protein synthesis

Notes:

Protein synthesis is the process which produces proteins from the information in the DNA code. It takes place in two stages:

Transcription – the DNA code is copied (transcribed) into a single strand of RNA called messenger RNA. Translation – the mRNA is read by a ribosome and the code is “translated” into a polypeptide chain.

Transcription takes place in the nucleus of cells. It is necessary because the DNA molecule itself is a large molecule that cannot get through the nuclear pores, so smaller mRNA is used to ‘copy’ a section of DNA which codes for a protein and this mRNA then leaves the nucleus and joins with a ribosome where the protein is then synthesised (translation).

Stages of transcription:

1. RNA polymerase binds at the start codon. DNA Helicase binds breaks the hydrogen bonds on a section of DNA containing the gene for the desired protein. Bases are exposed.

2. RNA polymerase moves along one of the two DNA strands (the template strand). It joins free RNA nucleotides that are complementary to the exposed template strand to from a pre-mRNA strand. (Remember: the base T will be replaced by a U when making mRNA!)

3. The DNA bases re-join behind the RNA polymerase as it moves along.4. The RNA polymerase will stop and detach when it reaches a particular

DNA sequence at the end of the gene called a stop codon.5. Pre-mRNA is then be spliced before it leaves the nuclear pore to find a

ribosome.

Splicing

DNA contains regions which code for proteins (called exons) and regions of DNA that do not code for proteins (called introns).

In pre-mRNA both exons and introns are present, but the introns must be removed or ‘spliced out’ to only leave exons.

This happens in eukaryotes ONLY prokaryotes don’t have introns!

Remember: IN tr ons IN t errupt the exons so they are removed

of 34

Recall Questions:

1. Where does transcription occur in the cell?2. Name the enzymes involved in transcription and explain what they do.3. What happens when the RNA polymerase attaches to the DNA at the start codon?4. What happens when RNA polymerase reaches a stop codon?5. What is pre-mRNA?6. What happens during mRNA splicing? 7. Why does pre-mRNA need to be spliced?8. Even though DNA codes for proteins directly, why is mRNA needed to be made for making proteins?

Exam Questions:

Q1. (a) The table below shows the base sequence of part of a pre-mRNA molecule from a eukaryotic cell.

Complete the table with the base sequence of the DNA strand from which this pre-mRNA was transcribed.

DNA

A C G C A U U A U pre-mRNA

(1)

(b) In a eukaryotic cell, the base sequence of the mRNA might be different from the sequence of the pre-mRNA.

Explain why.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(2)

Q2. In a eukaryotic cell, transcription results in a molecule of pre-mRNA that is modified to produce mRNA. In a prokaryotic cell transcription produces mRNA directly.

(a) Explain this difference.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

of 34

___________________________________________________________________

___________________________________________________________________ (2)

Q3. (a) What is the role of RNA polymerase in transcription?

______________________________________________________________

______________________________________________________________(1)

(b) Figure 1 shows some molecules involved in protein synthesis.

Figure 1

Complete Figure 1 to show the bases on the DNA strand from which the mRNA was transcribed; (2)

Q4. (a) Complete the table to show the differences between DNA, mRNA and tRNA.

Type of nucleic acid Hydrogen bonds present ( ) or not present ( )

Number of polynucleotide strands in molecule

DNA

mRNA

(2)

(b) The diagram shows the bases on one strand of a piece of DNA.

(i) In the space below, give the sequence of bases on the pre-mRNA transcribed from this strand.

(2)

(ii) In the space below, give the sequence of bases on the mRNA produced by splicing this piece

of 34

of pre-mRNA.

(1)


Question Answer1. Where does transcription occur in the cell? In the nucleus

2. Name the enzymes involved in transcription and explain what they do.

DNA helicase – unwinds DNA section and exposes nucleotidesRNA polymerase – adds complementary RNA nucleotides to form pre-mRNA

3. What happens when the RNA polymerase attaches to the DNA at the start codon?

The hydrogen bonds between the DNA strands break, separating the strands and the DNA molecule unwinds

4. What happens when RNA polymerase reaches a stop codon? It stops making mRNA and detaches from the DNA.

5. What is pre-mRNA?mRNA that contains introns and exons – before it has been spliced

6. What happens during mRNA splicing? Introns removed and exons joined, and possibly rearranged, to form mRNA

7. Why does pre-mRNA need to be spliced? To remove introns (non-coding sections)8. Even though DNA codes for proteins directly,

why is mRNA needed to be made for making proteins?

Because DNA is too large to move out of the nucleus, so a section is copied onto mRNA

Homework:

Revision for induction quiz – Nucleic Acids

Task SCAN CODETask 1 – Print, complete and mark nucleic acids worksheet – pg. 9-15http://fdslive.oup.com/www.oup.com/oxed/secondary/science/Science_AQA_A_Level_Biology_Topic_Support.pdf

Task 2 – Complete Seneca sections 1.5.1-1.5.5 (will be set as an assignment on Seneca)

Task 3 – Complete Kerboodle Quiz (will be set as an assignment on kerboodle)

of 34

http://fdslive.oup.com/www.oup.com/oxed/secondary/science/Science_AQA_A_Level_Biology_Topic_Support.pdf


Lesson 4 – Translation

By the end of this lesson you should be able to: Describe the process of translation to form polypeptide chains Explain how mutations in the DNA sequence can affect the structure of a protein

Notes:

The genome is the entire set of genes or genetic material present in a cell or organism and the proteome is the entire complement of proteins that can be expressed from those genes. The sequence of bases in a gene codes for which amino acids are needed (in the right order) to build the protein.

A group of 3 bases codes for a particular amino acid. Each group of 3 bases that codes for a particular amino acid is known as a codon. Although each codon is specific to an amino acid, the genetic code is described as degenerate, or redundant, each amino acid may be coded for by more than one codon. It is important that the genetic code does not overlap, each nucleotide is part of only one codon. A single nucleotide cannot be part of two codons.

Ribosomes Structure:

The word ribosome is made from taking ‘ribo’ from ribonucleic acid and adding it to ‘soma’, the latin word for body. Ribosomes are made of mostly ribosomal RNA (rRNA) and some proteins – they have two parts: a large and a small subunit which fit either side of the mRNA strand. They do not have a membrane like other organelles e.g mitochondria and chloroplasts.

Ribosomes are found ‘free’ in the cytoplasm or bound to the endoplasmic reticulum (ER) to form rough ER. In a mammalian cell there can be as many as 10 million

ribosomes. Several ribosomes can be attached to the same mRNA strand at once.

After the mRNA (a complementary copy of the DNA sequence of a gene) is transcribed, it travels to a ribosome where it is translated into a polypeptide chain.

Translation requires another form of RNA – transfer RNA (tRNA).

tRNA structure:

of 34

• It is a short single strand of RNA (fixed length)

• It is folded into a ‘clover leaf’ shape and held together by hydrogen bonds between paired bases.

• It has an amino acid binding site - three exposed bases

It has an anticodon binding site – a series of three bases which are complementary to the codon on the mRNA which codes for the amino acid the tRNA molecule carries.

Translation is the second stage of protein synthesis. In both prokaryotes and eukaryotes translation occurs at the ribosomes.

Translation steps:

1. A ribosome attaches to the start codon on the mRNA. A tRNA molecule with a complementary anticodon to the start codon binds to the mRNA. It has a specific amino acid attached (always Methionine).

2. The ribosome moves along to the next codon, it can fit around two at a time. The process is repeated and the enzyme catalyses the condensation reaction between amino acids to join them with a peptide bond, forming a polypeptide.

3. The ribosome continues to move along the mRNA and tRNAs arrive with amino acids at each codon until a stop codon is reached. The ribosome, mRNA and tRNA separate and the polypeptide is complete.

Mutation

The amino acid sequence is determined by the sequence of bases in the gene that codes for it. A mutation is a change to the DNA base sequence. E.g one base could be substituted for another or a base could be deleted. As the order of the DNA bases in a gene determines the order of amino acids in a protein a mutation in a gene could change the primary structure of a protein. If a base is changed in a codon it could then code for a different amino acid (but not always!), the sequence of amino acids would be altered; and the protein made could be different or damaged.

Recall Questions:

1. Define proteome2. What is a ribosome made of?3. What is a codon?4. What does it mean by saying the DNA code is 'non overlapping'?5. Explain why the term 'degenerate' is used to describe the DNA code.6. What type of bond joins amino acids together?7. What is the product of translation?8. Where does translation take place?9. Describe the structure of tRNA10. What is an anti-codon?11. Which part of tRNA binds to the mRNA?12. What are the stop and start codons for?13. What is a mutation?14. How can a gene mutation result in a protein not being synthesised properly?

of 34

Exam Questions:

Q1.(a) Give the two types of molecule from which a ribosome is made.

___________________________________________________________________

___________________________________________________________________ (1)

Q2.(a) Complete the table to show the differences between DNA, mRNA and tRNA.

Type of nucleic acid Hydrogen bonds present ( ) or not present ( )

Number of polynucleotide strands in molecule

DNA

mRNA

tRNA

(2)

Q3. The mRNA codon for the amino acid tyrosine is UAU.

(i) Give the DNA triplet for tyrosine.

______________________________________________________________(1)

(ii) Give the tRNA anticodon for tyrosine.

______________________________________________________________(1)

Q4.(a) Figure 1 shows the exposed bases (anticodons) of two tRNA molecules involved in the synthesis of a protein.

Figure 1

Complete the boxes to show the sequence of bases found along the corresponding section of the coding DNA strand.

(2)

(b) Describe the role of tRNA in the process of translation.

___________________________________________________________________

of 34

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(3)

(c) Figure 2 shows the sequence of bases in a section of DNA coding for a polypeptide of seven amino acids.

Figure 2

TACAAGGTCGTCTTTGTCAAG

The polypeptide was hydrolysed. It contained four different amino acids. The number of each type obtained is shown in the table.

Amino acid Number present

Phe 2

Met 1

Lys 1

Gln 3

Use the base sequence shown in Figure 2 to work out the order of amino acids in the polypeptide. Write your answer in the table below.

Met

(2)

Q5. Describe the role of a ribosome in the production of a polypeptide. Do not include transcription in your answer.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(3)

Q6. Complete Figure 1 to show the bases forming the anticodons of the tRNA molecules.

of 34

(1)

Q7. Give two differences between the structure of mRNA and the structure of tRNA.

1. _________________________________________________________________

___________________________________________________________________

2. _________________________________________________________________

___________________________________________________________________(2)

Q8.(a) What is the proteome of a cell?

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(1)

(b) Starting with mRNA in the cytoplasm, describe how translation leads to the production of a polypeptide.

Do not include descriptions of transcription and splicing in your answer.

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________

___________________________________________________________________(5)

of 34


Question Answer1. Define proteome2. What is a ribosome made of? Proteins, RNA (NO MEMBRANE!)3. What is a protein made of? A polymer of amino acids

4. What is a codon? Triplet of bases that codes for an amino acid

5. What does it mean by 'non overlapping'?Each codon is read in sequence, separate from the codon before and after it. Codons do not share bases.

6. Explain the term 'degenerate'?

There are more possible combinations of codons than there are amino acids. Some amino acids are coded for by more than one codon

7. What is the product of translation? A polypeptide chain8. Where does translation take place? The ribosomes in cytoplasm or RER

9. What is tRNA?

Found in cytoplasm, has an amino binding site at one end and an anticodon on the other end, carries amino acids that are used to make proteins to the ribosomes

10. Describe the structure of tRNA

tRNA is folded, has hydrogen bonds holding the structure together, is a fixed size, has an anticodon, has an amino acid binding site

11. What is an anti-codon?Triplet of bases on tRNA which is complementary to binding site on mRNA.

12. Which part of tRNA binds to the mRNA? The anticodon binding site/loop

13. What are the stop and start codons for?Triplets that tell the cell when to start and stop production of the protein. Found at the beginning and end of the gene

14. What is a mutation?Change to the base sequence of DNA.

15. How can a gene mutation result in a protein not being synthesised properly?

Mutation changes sequence of bases so that it no longer codes for the same protein sequence.

Homework:

Revision for induction quiz - Protein synthesis

Task SCAN CODETask 1 – Print, complete and mark nucleic acids worksheet – pg. 43-49http://fdslive.oup.com/www.oup.com/oxed/secondary/science/Science_AQA_A_Level_Biology_Topic_Support.pdf

of 34



Task 2 – Complete Seneca sections 42 (will be set as an assignment on Seneca)

Task 3 – Complete Kerboodle Quiz (will be set as an assignment) (will be set as an assignment on kerboodle)

of 34

biologyteacherorg.files.wordpress.com · web viewfigure 1. shows one base pair of a dna molecule....

Documents