weighing the evidence today we will try to assess whether humans and chimpanzees share a common...
TRANSCRIPT
![Page 1: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/1.jpg)
Weighing the Evidence
Today we will try to assess whether humans and chimpanzees share a
common ancestor
NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS
![Page 2: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/2.jpg)
hypothesis: humans and chimpanzees share
a common ancestorOne of the core propositions of biological evolution is that organisms alive today can be traced back through time to a common ancestor. Evolutionary biologists assert that the more similar organisms are genetically, the more closely related they are, and the more likely they
are to have evolved from a recent common ancestor. In this activity, you will be considering whether the data you review supports the hypothesis that humans and chimpanzees share a
common ancestor.
2
![Page 3: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/3.jpg)
hypothesis: humans and chimpanzees share
a common ancestorYou will review each data set with your team members.
After you review each data set, consider with your team members whether you think that data set supports the hypothesis. Then record in the chart how confident you are that the hypothesis is true based on the evidence.
With each new data set you review, record your confidence level based on all the evidence you have reviewed to that point.
3
![Page 4: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/4.jpg)
We will break up into discussion
groups of 5 students
Have the weighing the evidence worksheet out the whole time.
4
![Page 5: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/5.jpg)
Data Set 1Physical traits in common between Chimps and
Humans
5
Data Set 1: Comparing Pan & Homo
![Page 6: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/6.jpg)
6
SkullsThe lower jaw of a chimpanzee juts out from its face whereas, the profile of a human tends to be more vertical
TeethAll non-human hominids, have canines which can serve as weapons. The teeth are also arranged in a U-shape, whereas human jaws are more parabolic
BrainHuman brains are much larger, do most of their growing after birth and areas of the cortex involved in learning are greatly expanded.
![Page 7: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/7.jpg)
Mystery of theMatching
Marks
7
![Page 8: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/8.jpg)
8
![Page 9: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/9.jpg)
DO I HAVE YOUR ATTENTION?For some reason, a GUNSHOT seems to suggest a CRIME SCENE…
with BULLETS…
and BULLET RIFLING MARKS…
![Page 10: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/10.jpg)
10
As everyone knows from CSI BULLET RIFLING MARKS are used to solve crimes.
HOW?
![Page 11: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/11.jpg)
11
RIGHT!They are used to COMPARE
bullets found at a crime scene,
with bullets that werefired from suspect guns
![Page 12: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/12.jpg)
Here are the marks from a crime scene
bullet…
12
![Page 13: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/13.jpg)
and here are the marks from bullets fired from four possible suspect
guns…
13
A B
C D
![Page 14: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/14.jpg)
Which bullet matches
the crime scene bullet?
14
A
Crime Scene:
![Page 15: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/15.jpg)
Which bullet matches the crime scene bullet?
15
B
Crime Scene:
![Page 16: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/16.jpg)
Which bullet matches the crime scene bullet?
16
C
Crime Scene:
![Page 17: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/17.jpg)
Which bullet matches the crime scene bullet?
17
D
Crime Scene:
![Page 18: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/18.jpg)
RIGHT! It’s a bullet shot from gun C.
18
C
Crime Scene:
So what does that tell us?
![Page 19: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/19.jpg)
YOU’VE GOT IT! The Crime Scene bullet and bullet C came from the
SAME GUN !
19
C
Crime Scene:
We could say the bullets had a “Common Origin”
![Page 20: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/20.jpg)
Many studies have told us that when any two items
with COMPLEX PATTERNS MATCH EACH OTHER
perfectly, we can be confident
that they had a…
COMMON ORIGIN !
![Page 21: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/21.jpg)
KEEP THIS IN MIND:When we find other
COMPLEX PATTERNS that MATCH,What does this tell us?
They had a…“COMMON ORIGIN”
This is our theme:Matching Complex Patterns =
COMMON ORIGIN
![Page 22: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/22.jpg)
What is this?
![Page 23: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/23.jpg)
Right, it’s a HUMAN KARYOTYPE
![Page 24: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/24.jpg)
A Human Karyotype has photos of all the matched pairs of human
chromosomes from one cell, stained to show banding patterns,
and arranged from long to short, with centromeres near the top.
Here are our numbers 6-9…
![Page 25: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/25.jpg)
On the next slide, you will see another kind of human
karyotype:It has diagrams of
the chromosomes, with only one member of each
pair, clearly showing their banding patterns…
![Page 26: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/26.jpg)
![Page 27: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/27.jpg)
And on the next slide, you will see a similar
diagrammatic karyotype,
but this is from a NON-HUMAN
SPECIES…
![Page 28: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/28.jpg)
![Page 29: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/29.jpg)
29
NEXT, we wll see both karyotypes together,
showing the matching chromosomes side by side:
each human chromosome is on the left…
each NON-human chromosome is on the right
As you COMPARE the CHROMOSOMES,side-by-side,
what is MOST surprising?
![Page 30: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/30.jpg)
30
What is most surprising?
![Page 31: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/31.jpg)
Did you notice how very SIMILAR they are? Here’s a closer look at the first
seven:
31
Any identical ones? What did we say about items with IDENTICAL COMPLEX PATTERNS?
![Page 32: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/32.jpg)
RIGHT!Identical Patterns = COMMON
ORIGIN
32
How would this applyto two different SPECIES
with IDENTICAL banding patternson their CHROMOSOMES?
RIGHT!They MUST have a Common Origin, or
a COMMON ANCESTOR !
![Page 33: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/33.jpg)
Time for a Revelation…
33
The clear chromosome evidence
of identical banding patterns
tells us that humans andchimpanzees must have had
a…
The non-human species is
the CHIMPANZEE
![Page 34: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/34.jpg)
COMMON ANCESTOR !
34
Somewhere, in our distant past,there was an ape-like species
thatgave rise to two lines of
ancestry.One branch led to modern
CHIMPS, the other branch led to HUMANS.DNA analysis and fossils tell us
thatthis split was around
6-7 million years ago (6-7 mya)
<---Common Ancestor
Chimps Us
6 mya
NOW
![Page 35: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/35.jpg)
As a groupDiscuss
35
Data Set 2: Comparing Chromosomes
![Page 36: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/36.jpg)
That’s pretty strong stuff...
36
And seems to conflict with Traditional Views!
Is there any other evidence that supports this conclusion?
Let’s take another look at thosechromosomes… [next set of slides]
![Page 37: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/37.jpg)
Part 2
![Page 38: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/38.jpg)
Data Set 3: The Chromosome Shuffle
Chromosomes contain all of our genetic code.Humans have 23 pairs of chromosomes that exist in nearly every cell in the body.
As part of natural genetic changes over time, chromosomes are rearranged in a number of different ways, including:inversions, deletions,
translocations, fission, fusion.
38
![Page 39: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/39.jpg)
CHROMOSOME PARTSAll Chromosomes have
telomeres at both ends(like shoelace aglets!)
39
HeadTelomere
Centromere
TailTelomere
ttagggttagggttagggttagggttagggttaggg…||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc…
Telomeres have a special DNA sequence…
![Page 40: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/40.jpg)
Data Set 3: The Chromosome Shuffle
As a group work on the handout
40
![Page 41: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/41.jpg)
Data Set 4: Human Chromosome 2
We’ll do this one together
41
![Page 42: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/42.jpg)
Let’s look at our two sets of chromosomes again, side-by-
side.
This time, Focus on their DIFFERENCES:What do you see in the
chimp chromosomes (on the right) that is DIFFERENT from
the human chromosomes (on the left)?
![Page 43: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/43.jpg)
43
How are they different?
![Page 44: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/44.jpg)
GOOD EYES!- Chimp’s #2 is shorter than our #2
-Chimp has an extra unmatched chromosome
What could have happenedto cause those differences?
Let’s take a closer look at those chromosomes…
![Page 45: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/45.jpg)
45
ANY IDEAS that might EXPLAIN the
“missing” part of the chimp’s #2 chromosome,AND the chimp’s “extra”
chromosome?
“Missing” part “Extra” in chimps
![Page 46: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/46.jpg)
46
Maybe the chimp’s“extra” chromosomewas once part of its
short #2.
Could the “extra”chromosome match the upper part of
our #2?
LET’S TRY IT…
![Page 47: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/47.jpg)
47
Nope!They don’t seem
to match.What else could
we try?
Turn the “extra” oneupside down?!
Let’s try it…
![Page 48: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/48.jpg)
48
![Page 49: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/49.jpg)
49
WOW !IT WORKED! They DO MATCH!
NOW, the next question:“How could this happen?”
- Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR
-Were there TWO shortchromosomes in our ancestor that
fused (joined) to make ONE in humans?
![Page 50: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/50.jpg)
Data Set 4: Human Chromosome 2Discuss in your groups
50
![Page 51: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/51.jpg)
51
We DO have a PROBLEM:“How did this difference happen?”
1. One split to make two, OR
And, we have two hypotheses (testable statements):
Let’s try the second one (fusion). How can we TEST that hypothesis?
2. Two fused (joined) to make one
![Page 52: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/52.jpg)
52
We could look for evidence offusion in the middle of our
#2 chromosome…
But, what kind of evidence can we look for?
Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…
![Page 53: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/53.jpg)
Data Set 5: Examining the DNAA bit of background first
53
![Page 54: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/54.jpg)
CHROMOSOME PARTSAll Chromosomes have
telomeres at both ends(like shoelace aglets!)
54
HeadTelomere
Centromere
TailTelomere
ttagggttagggttagggttagggttagggttaggg…||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc…
Telomeres have a special DNA sequence…
![Page 55: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/55.jpg)
DNA Sequence for Telomeres:
ttagggttagggttaggg…||||||||||||||||||aatcccaatcccaatccc…
55
HeadTelomere
Centromere
TailTelomere
NOTICE:Tandem Repeats in Telomeres:ttagggttagggttaggg…||||||||||||||||||aatcccaatcccaatccc…
Did you notice the repeated sequence: ttaggg?
“ttaggg” is repeated 800-1600 times in each Telomere
![Page 56: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/56.jpg)
56
Here’s another view ofa chromosome,
showing the telomeresuntwisted, and their typical
DNA sequence
It also shows that theupper (shorter) arm
above the centromereis called the “p-arm”, andthe lower (longer) arm is
called the “q-arm”
![Page 57: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/57.jpg)
57
Here are ends of the upper
telomeres of thechimp’s “short”
chromosome (left)…
Short #2 “Extra”
and its “extra”chromosome (right)
TELOMERE DNA CLOSE-UP
![Page 58: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/58.jpg)
58
When we turn the “extra”chromosome upside-
down,and try to connect it to
the“short” chromosome, it
onlyFITS one way (left)…
They do NOT fitwhen one telomere istwisted 180
o (right)
NOTICE!
![Page 59: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/59.jpg)
59
FURTHERMORE…When we lay the fusion area on its side,
we can see more clearly how the DNA sequence
changes at the fusion point.
Reading the top strand only, see:
T T A G G G C C C T A A
![Page 60: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/60.jpg)
60
THAT’S WHAT YOU WILL BE LOOKING FOR
When you are searching the DNA for the
Fusion Point, you will be lookingat only one strand of DNA
(since the “lower” strand is the predictable
complement of the “upper” strand).Look for something like this:…
ttagggttagggttagggccctaaccctaaccctaa…
Read this like lines of text in a book…Do you see where the multiple g’s (and no c’s) END,
and multiple c’s (and no g’s) BEGIN?
![Page 61: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/61.jpg)
61
What would this point be called?(where multiple g’s stop, and
multiple c’s begin)
This would be the FUSION POINTRaise your hand when you see that point
in this actual DNA strand below:
On which line does the change happen?
![Page 62: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/62.jpg)
62
Maybe this will show itmore clearly:
GOT THE PICTURE?
THERE’S the FUSION POINT !
![Page 63: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/63.jpg)
63
NOW…WHERE should we LOOK
for theFUSION POINT?
YES!Right in the MIDDLE
of our chromosome #2,where the two matching
chimp chromosomesoverlap !
2a
2b
![Page 64: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/64.jpg)
64
This would be BELOW theCENTROMERE, in the
“q-arm” of the chromosome,in the region known as
“2q13”,shown in red.
2b
2a
![Page 65: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/65.jpg)
65
I have gone to an online DNA databaseand printed out the DNA in that region.You could do this yourself, but, to save
time, I’ve done that for you…
So, where can we see the DNAfrom this region of our
#2 chromosometo examine?
![Page 66: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/66.jpg)
66
This 2q13 region gives us
52 pages of DNA!
This is what a page looks like…
On this page, thereare 57 lines, each line with
60 bases (letters),and that gives us…
3,420 bases per page!
![Page 67: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/67.jpg)
67
If these 52 pageswere attached
end-to-end,they would stretchabout 14 meters
(16 yards) aroundyour room!
AND… If ALL the DNA from ourENTIRE #2 chromosomewas printed out like this,
it would stretch about16 km (10 miles)!
![Page 68: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/68.jpg)
68
By the way…
Each number on the left edge equals the number of the first base (letter)
on that line.
And, a space has been inserted after every 10th base (letter)
to make counting easier.
1 gaattcttgt tctgtattta gaaacccact cacgttactt gatatttggg tatttaagtc 61 atgaaaggta tttcttctag gaagcagtga ttctaaagtg tatgcttaac cagtcagttg121 agtgtctact cttgtgtgtt cacaagtgtg cacaaagttt ttggtaaatt aagaatatta181 tttcaaataa attaatttca tccccatagg agccagttta tcagataatt catttttcat241 ttctgcaaat caatacacaa tgagctcata ttcagataaa tataatagtt tttctttatt
![Page 69: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/69.jpg)
69
You may noticewhen you are searching, that
the “ttaggg” patternis not perfect!
An occasional “c”slips in here and there,and you will see other
minor “glitches.”WHY?
If you said“MUTATIONS,”
you would be right.
![Page 70: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/70.jpg)
70
NOW, it’s YOUR turn! You get to SEARCH those 52 pages!
Are you ready???Just kidding!
Actually, you will formteams of 5, and
each team will search together(from the
“2q13” region)
![Page 71: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/71.jpg)
71
Each person looks forthat “Fusion Area” on
a different page.
When one of you findsit, show your partners.
Discuss your discovery with your partners, and answer the questions on your “SEARCH” worksheet
One of those pagesshould have the“Fusion Area”
![Page 72: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/72.jpg)
72
RECAPPROBLEM: How did our #2 chromosome
come to look identical to two chromosomesin chimpanzees”
TEST: Look for fusion evidencein the form of telomere DNA
in the middle of our #2chromosome
PREDICTIONS: If hypothesis is true, we should find two telomeres there;
If NOT true, should be NO telomeres there.
HYPOTHESIS: our #2 chromosome
was formed by the fusion oftwo chromosomes in an
ancestor, after chimps branched off.
Chimp Us
<--Common Ancestor
Fusion?
![Page 73: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/73.jpg)
73
GOSEARCHfor the
Tell-Tale Telomeres !
![Page 74: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/74.jpg)
74
Students search DNA in groups
Data Set 5: Searching the DNA
![Page 75: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/75.jpg)
Part 3
![Page 76: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/76.jpg)
DNA Search Lab Followup
76
Welcome back from yourSEARCH FOR
THE TELL-TALE TELOMERE
Let’s see what it tells us…
![Page 77: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/77.jpg)
77
108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg
RESULTS: Can you see the telomeres?
![Page 78: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/78.jpg)
78
RESULTS CLARIFIED:108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg
HeadTelomereof “extra”chrom. 2a
HeadTelomereof “short”chrom. 2b
FUSION POINT !
![Page 79: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/79.jpg)
79
108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta
Did you know… you’ve got FOSSILS in YOU !
All of you have these fossils,in the #2 chromosome of every cell !
Fossils are the remains of ancient life,and these are the telomeres of
two chromosomes from your ancient ancestor !
So, these telomeres are your very ownMOLECULAR FOSSILS !
Telo.2a
Telo.2b
![Page 80: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/80.jpg)
80
PREDICTIONS: If our hypothesis was true, we should find two telomeres there;
If NOT true, should be NO telomeres there.
Did we find telomeres there?
YES! Therefore…
Our hypothesis was supported:Our #2 chromosome WAS formed
from the FUSION of two chromosmesin an ancient ancestor after the
chimpanzees branched off.
CONCLUSION
![Page 81: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/81.jpg)
A Peek at the Chromosomes
of Other Apes…
81
On the next slide, you will see thechromosome diagrams for humans,
chimpanzees, gorillas, and orangutans,all the :”Great Apes”
They are shown side by side for easy comparison…
![Page 82: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/82.jpg)
82
The Chromosomesof Humans and Apes
Compared
For each number,the chromosomesare arranged in
this order(left to right):
human, chimpanzee,gorilla, orangutan
What is moststriking?
![Page 83: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/83.jpg)
83
RIGHT! They are ALL
Strikingly Similar!
And what do we knowwhen we find identical
or very similar patternson different items?
RIGHT!They had to have aCOMMON ORIGIN
Or, in this case…COMMON ANCESTRY
![Page 84: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/84.jpg)
84
Based on these chromosome comparisons…Biologists have been able to draw
a phylogenetic tree, showinghow primates are related to each other.
The following slide shows the tree(called a “Primate Cladogram”).
See if you can point to where the COMMON ANCESTORS
of Modern Primates would be LOCATED on the tree…
![Page 85: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/85.jpg)
85
Chimps Humans
![Page 86: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/86.jpg)
86
Did you find ALLof the
Common Ancestors?
Chimps
Humans
![Page 87: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/87.jpg)
Did you notice…
87
All the other apes had that“extra” chromosome, too?
This confirms that this isthe more PRIMITIVE (original)CONDITION, so our SINGLE#2 chromosome is the DERIVED CONDITION(the result of fusion)
![Page 88: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/88.jpg)
88
When we compare primates by using other features,
including DNA, different proteins, anatomy, physiology, and fossils,
Biologists have developed similarCladograms (Phylogenetic Trees),
like these…
MORE CONFIRMING EVIDENCE
![Page 89: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/89.jpg)
See how similarthey are?
Based on Albumin Protein Analysis:
Based on DNA Hybridization Analysis
![Page 90: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/90.jpg)
And here’s another one…
PRIMATE CLADOGRAM
Based on Genome Analysis
90
Humans
BonobosChimpanzees
Gorillas
Orangutans
Gibbons
Old WorldMonkeys
6 mya
8 mya
13 mya
18 mya
25-30 mya
SpeciesToday
Common Ancestor
Again, basically the same pattern
![Page 91: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/91.jpg)
91
When all the data point to essentially the same conclusions,
this strengthens those conclusions.
Biologically, humans are very closely related to the apes.
In fact, chimps are closer to US,than they are to gorillas!
Humans and chimps are even closer than zebras are to horses!
Biologists have even recommended thathumans and chimps be in the same genus!
![Page 92: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/92.jpg)
92
This may be hard for many to accept…But we are very special apes,
not just “ordinary animals.”
Because of our brain and our dexterity,humans have built amazing cultures
and environments not equaledanywhere else in the animal kingdom.
![Page 93: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/93.jpg)
LESSON WRAP-UPREALITY-CHECK QUESTIONS
MORE DNA SEARCHES
![Page 94: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/94.jpg)
Time for a REALITY CHECK Number your paper from 1-8 Based on the observed data…
Which are true… which are false?1. All chromosomes have telomeres at both ends.
2. All chromosomes have telomeres in their middles.
3. Identical complex patterns on different items means they had a common origin.
4. A hypothesis is a prediction.
94
![Page 95: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/95.jpg)
REALITY CHECK cont. Which are true… which are false?
5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor.
6. Humans evolved from monkeys.7. Humans evolved from chimpanzees.8. Humans & chimpanzees evolved from a
common ancestor.
95
![Page 96: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/96.jpg)
Confirmation: More Evidence
When we compare
ALL the DNA inour #2
chromosomewith ALL the DNA
in the two chimp
chromosomes…*
we find that it isall the same
DNA !
*(this is “synteny”)
![Page 97: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/97.jpg)
However…
When we compareALL the DNA in
our #2 chromosomewith DNA in Dogchromosomes…
we find that our #2is a patchwork of DNA
from 8 differentDog chromosomes!
(WHY?)
![Page 98: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/98.jpg)
If you said“More time since we
branched from ourCOMMON ANCESTOR
with dogs,SO, more time for
more chromosomechanges and other
mutations,”YOU GOT IT!
WHY?
![Page 99: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/99.jpg)
JUST SO WE’RE CLEAR, THIS IS JUST ONE OF MANY PIECES OF EVIDENCE FOR A RELATIONSHIP BETWEEN CHIMPS & HUMANS
![Page 100: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/100.jpg)
Telomere Tid-Bits
100
1. Telomeres apparently protect the endsof our chromosomes, keeping the gene-DNAfrom getting damaged.2. Each time our chromosomes replicateand cells divide, a little of each telomereis lost, so they get shorter as we age!
3. This is one reason why embryonic stem cellsare preferred over adult stem cells instem cell research.
![Page 101: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/101.jpg)
More Telomere Tid-Bits
101
4. There is an enzyme, telomerase, that canreplace some of the missing telomere DNA. It’s thought that defective telomerasecould be a cause of aging problems.
5. Telomeres and telomerase are the subjects ofmuch research into cancer, heart disease,brain function, and other problems of aging.
![Page 102: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/102.jpg)
KEY TO REALITY CHECK
102
1. All chromosomes have telomeres at both ends.
True 2. All chromosomes have telomeres in their middles.
False3. Identical complex patterns on different items means they had a common origin.
True4. A hypothesis is a prediction.
False
![Page 103: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC](https://reader037.vdocument.in/reader037/viewer/2022110322/56649d0b5503460f949defde/html5/thumbnails/103.jpg)
KEY TO REALITY CHECK (cont.)
103
5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor.
True6. Humans evolved from monkeys.
False7. Humans evolved from chimpanzees.
False8. Humans & chimpanzees evolved from a common ancestor.
TRUE!