weighing the evidence today we will try to assess whether humans and chimpanzees share a common...

103
Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS

Upload: thomasina-jordan

Post on 18-Dec-2015

214 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Weighing the Evidence

Today we will try to assess whether humans and chimpanzees share a

common ancestor

NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS

Page 2: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

hypothesis: humans and chimpanzees share

a common ancestorOne of the core propositions of biological evolution is that organisms alive today can be traced back through time to a common ancestor. Evolutionary biologists assert that the more similar organisms are genetically, the more closely related they are, and the more likely they

are to have evolved from a recent common ancestor. In this activity, you will be considering whether the data you review supports the hypothesis that humans and chimpanzees share a

common ancestor.

2

Page 3: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

hypothesis: humans and chimpanzees share

a common ancestorYou will review each data set with your team members.

After you review each data set, consider with your team members whether you think that data set supports the hypothesis. Then record in the chart how confident you are that the hypothesis is true based on the evidence.

With each new data set you review, record your confidence level based on all the evidence you have reviewed to that point.

3

Page 4: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

We will break up into discussion

groups of 5 students

Have the weighing the evidence worksheet out the whole time.

4

Page 5: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Data Set 1Physical traits in common between Chimps and

Humans

5

Data Set 1: Comparing Pan & Homo

Page 6: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

6

SkullsThe lower jaw of a chimpanzee juts out from its face whereas, the profile of a human tends to be more vertical

TeethAll non-human hominids, have canines which can serve as weapons. The teeth are also arranged in a U-shape, whereas human jaws are more parabolic

BrainHuman brains are much larger, do most of their growing after birth and areas of the cortex involved in learning are greatly expanded.

Page 7: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Mystery of theMatching

Marks

7

Page 8: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

8

Page 9: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

DO I HAVE YOUR ATTENTION?For some reason, a GUNSHOT seems to suggest a CRIME SCENE…

with BULLETS…

and BULLET RIFLING MARKS…

Page 10: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

10

As everyone knows from CSI BULLET RIFLING MARKS are used to solve crimes.

HOW?

Page 11: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

11

RIGHT!They are used to COMPARE

bullets found at a crime scene,

with bullets that werefired from suspect guns

Page 12: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Here are the marks from a crime scene

bullet…

12

Page 13: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

and here are the marks from bullets fired from four possible suspect

guns…

13

A B

C D

Page 14: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Which bullet matches

the crime scene bullet?

14

A

Crime Scene:

Page 15: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Which bullet matches the crime scene bullet?

15

B

Crime Scene:

Page 16: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Which bullet matches the crime scene bullet?

16

C

Crime Scene:

Page 17: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Which bullet matches the crime scene bullet?

17

D

Crime Scene:

Page 18: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

RIGHT! It’s a bullet shot from gun C.

18

C

Crime Scene:

So what does that tell us?

Page 19: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

YOU’VE GOT IT! The Crime Scene bullet and bullet C came from the

SAME GUN !

19

C

Crime Scene:

We could say the bullets had a “Common Origin”

Page 20: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Many studies have told us that when any two items

with COMPLEX PATTERNS MATCH EACH OTHER

perfectly, we can be confident

that they had a…

COMMON ORIGIN !

Page 21: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

KEEP THIS IN MIND:When we find other

COMPLEX PATTERNS that MATCH,What does this tell us?

They had a…“COMMON ORIGIN”

This is our theme:Matching Complex Patterns =

COMMON ORIGIN

Page 22: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

What is this?

Page 23: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Right, it’s a HUMAN KARYOTYPE

Page 24: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

A Human Karyotype has photos of all the matched pairs of human

chromosomes from one cell, stained to show banding patterns,

and arranged from long to short, with centromeres near the top.

Here are our numbers 6-9…

Page 25: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

On the next slide, you will see another kind of human

karyotype:It has diagrams of

the chromosomes, with only one member of each

pair, clearly showing their banding patterns…

Page 26: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC
Page 27: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

And on the next slide, you will see a similar

diagrammatic karyotype,

but this is from a NON-HUMAN

SPECIES…

Page 28: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC
Page 29: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

29

NEXT, we wll see both karyotypes together,

showing the matching chromosomes side by side:

each human chromosome is on the left…

each NON-human chromosome is on the right

As you COMPARE the CHROMOSOMES,side-by-side,

what is MOST surprising?

Page 30: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

30

What is most surprising?

Page 31: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Did you notice how very SIMILAR they are? Here’s a closer look at the first

seven:

31

Any identical ones? What did we say about items with IDENTICAL COMPLEX PATTERNS?

Page 32: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

RIGHT!Identical Patterns = COMMON

ORIGIN

32

How would this applyto two different SPECIES

with IDENTICAL banding patternson their CHROMOSOMES?

RIGHT!They MUST have a Common Origin, or

a COMMON ANCESTOR !

Page 33: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Time for a Revelation…

33

The clear chromosome evidence

of identical banding patterns

tells us that humans andchimpanzees must have had

a…

The non-human species is

the CHIMPANZEE

Page 34: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

COMMON ANCESTOR !

34

Somewhere, in our distant past,there was an ape-like species

thatgave rise to two lines of

ancestry.One branch led to modern

CHIMPS, the other branch led to HUMANS.DNA analysis and fossils tell us

thatthis split was around

6-7 million years ago (6-7 mya)

<---Common Ancestor

Chimps Us

6 mya

NOW

Page 35: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

As a groupDiscuss

35

Data Set 2: Comparing Chromosomes

Page 36: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

That’s pretty strong stuff...

36

And seems to conflict with Traditional Views!

Is there any other evidence that supports this conclusion?

Let’s take another look at thosechromosomes… [next set of slides]

Page 37: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Part 2

Page 38: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Data Set 3: The Chromosome Shuffle

Chromosomes contain all of our genetic code.Humans have 23 pairs of chromosomes that exist in nearly every cell in the body.

As part of natural genetic changes over time, chromosomes are rearranged in a number of different ways, including:inversions, deletions,

translocations, fission, fusion.

38

Page 39: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

CHROMOSOME PARTSAll Chromosomes have

telomeres at both ends(like shoelace aglets!)

39

HeadTelomere

Centromere

TailTelomere

ttagggttagggttagggttagggttagggttaggg…||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc…

Telomeres have a special DNA sequence…

Page 40: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Data Set 3: The Chromosome Shuffle

As a group work on the handout

40

Page 41: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Data Set 4: Human Chromosome 2

We’ll do this one together

41

Page 42: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Let’s look at our two sets of chromosomes again, side-by-

side.

This time, Focus on their DIFFERENCES:What do you see in the

chimp chromosomes (on the right) that is DIFFERENT from

the human chromosomes (on the left)?

Page 43: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

43

How are they different?

Page 44: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

GOOD EYES!- Chimp’s #2 is shorter than our #2

-Chimp has an extra unmatched chromosome

What could have happenedto cause those differences?

Let’s take a closer look at those chromosomes…

Page 45: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

45

ANY IDEAS that might EXPLAIN the

“missing” part of the chimp’s #2 chromosome,AND the chimp’s “extra”

chromosome?

“Missing” part “Extra” in chimps

Page 46: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

46

Maybe the chimp’s“extra” chromosomewas once part of its

short #2.

Could the “extra”chromosome match the upper part of

our #2?

LET’S TRY IT…

Page 47: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

47

Nope!They don’t seem

to match.What else could

we try?

Turn the “extra” oneupside down?!

Let’s try it…

Page 48: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

48

Page 49: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

49

WOW !IT WORKED! They DO MATCH!

NOW, the next question:“How could this happen?”

- Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR

-Were there TWO shortchromosomes in our ancestor that

fused (joined) to make ONE in humans?

Page 50: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Data Set 4: Human Chromosome 2Discuss in your groups

50

Page 51: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

51

We DO have a PROBLEM:“How did this difference happen?”

1. One split to make two, OR

And, we have two hypotheses (testable statements):

Let’s try the second one (fusion). How can we TEST that hypothesis?

2. Two fused (joined) to make one

Page 52: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

52

We could look for evidence offusion in the middle of our

#2 chromosome…

But, what kind of evidence can we look for?

Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

Page 53: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Data Set 5: Examining the DNAA bit of background first

53

Page 54: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

CHROMOSOME PARTSAll Chromosomes have

telomeres at both ends(like shoelace aglets!)

54

HeadTelomere

Centromere

TailTelomere

ttagggttagggttagggttagggttagggttaggg…||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc…

Telomeres have a special DNA sequence…

Page 55: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

DNA Sequence for Telomeres:

ttagggttagggttaggg…||||||||||||||||||aatcccaatcccaatccc…

55

HeadTelomere

Centromere

TailTelomere

NOTICE:Tandem Repeats in Telomeres:ttagggttagggttaggg…||||||||||||||||||aatcccaatcccaatccc…

Did you notice the repeated sequence: ttaggg?

“ttaggg” is repeated 800-1600 times in each Telomere

Page 56: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

56

Here’s another view ofa chromosome,

showing the telomeresuntwisted, and their typical

DNA sequence

It also shows that theupper (shorter) arm

above the centromereis called the “p-arm”, andthe lower (longer) arm is

called the “q-arm”

Page 57: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

57

Here are ends of the upper

telomeres of thechimp’s “short”

chromosome (left)…

Short #2 “Extra”

and its “extra”chromosome (right)

TELOMERE DNA CLOSE-UP

Page 58: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

58

When we turn the “extra”chromosome upside-

down,and try to connect it to

the“short” chromosome, it

onlyFITS one way (left)…

They do NOT fitwhen one telomere istwisted 180

o (right)

NOTICE!

Page 59: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

59

FURTHERMORE…When we lay the fusion area on its side,

we can see more clearly how the DNA sequence

changes at the fusion point.

Reading the top strand only, see:

T T A G G G C C C T A A

Page 60: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

60

THAT’S WHAT YOU WILL BE LOOKING FOR

When you are searching the DNA for the

Fusion Point, you will be lookingat only one strand of DNA

(since the “lower” strand is the predictable

complement of the “upper” strand).Look for something like this:…

ttagggttagggttagggccctaaccctaaccctaa…

Read this like lines of text in a book…Do you see where the multiple g’s (and no c’s) END,

and multiple c’s (and no g’s) BEGIN?

Page 61: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

61

What would this point be called?(where multiple g’s stop, and

multiple c’s begin)

This would be the FUSION POINTRaise your hand when you see that point

in this actual DNA strand below:

On which line does the change happen?

Page 62: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

62

Maybe this will show itmore clearly:

GOT THE PICTURE?

THERE’S the FUSION POINT !

Page 63: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

63

NOW…WHERE should we LOOK

for theFUSION POINT?

YES!Right in the MIDDLE

of our chromosome #2,where the two matching

chimp chromosomesoverlap !

2a

2b

Page 64: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

64

This would be BELOW theCENTROMERE, in the

“q-arm” of the chromosome,in the region known as

“2q13”,shown in red.

2b

2a

Page 65: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

65

I have gone to an online DNA databaseand printed out the DNA in that region.You could do this yourself, but, to save

time, I’ve done that for you…

So, where can we see the DNAfrom this region of our

#2 chromosometo examine?

Page 66: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

66

This 2q13 region gives us

52 pages of DNA!

This is what a page looks like…

On this page, thereare 57 lines, each line with

60 bases (letters),and that gives us…

3,420 bases per page!

Page 67: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

67

If these 52 pageswere attached

end-to-end,they would stretchabout 14 meters

(16 yards) aroundyour room!

AND… If ALL the DNA from ourENTIRE #2 chromosomewas printed out like this,

it would stretch about16 km (10 miles)!

Page 68: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

68

By the way…

Each number on the left edge equals the number of the first base (letter)

on that line.

And, a space has been inserted after every 10th base (letter)

to make counting easier.

1 gaattcttgt tctgtattta gaaacccact cacgttactt gatatttggg tatttaagtc 61 atgaaaggta tttcttctag gaagcagtga ttctaaagtg tatgcttaac cagtcagttg121 agtgtctact cttgtgtgtt cacaagtgtg cacaaagttt ttggtaaatt aagaatatta181 tttcaaataa attaatttca tccccatagg agccagttta tcagataatt catttttcat241 ttctgcaaat caatacacaa tgagctcata ttcagataaa tataatagtt tttctttatt

Page 69: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

69

You may noticewhen you are searching, that

the “ttaggg” patternis not perfect!

An occasional “c”slips in here and there,and you will see other

minor “glitches.”WHY?

If you said“MUTATIONS,”

you would be right.

Page 70: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

70

NOW, it’s YOUR turn! You get to SEARCH those 52 pages!

Are you ready???Just kidding!

Actually, you will formteams of 5, and

each team will search together(from the

“2q13” region)

Page 71: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

71

Each person looks forthat “Fusion Area” on

a different page.

When one of you findsit, show your partners.

Discuss your discovery with your partners, and answer the questions on your “SEARCH” worksheet

One of those pagesshould have the“Fusion Area”

Page 72: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

72

RECAPPROBLEM: How did our #2 chromosome

come to look identical to two chromosomesin chimpanzees”

TEST: Look for fusion evidencein the form of telomere DNA

in the middle of our #2chromosome

PREDICTIONS: If hypothesis is true, we should find two telomeres there;

If NOT true, should be NO telomeres there.

HYPOTHESIS: our #2 chromosome

was formed by the fusion oftwo chromosomes in an

ancestor, after chimps branched off.

Chimp Us

<--Common Ancestor

Fusion?

Page 73: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

73

GOSEARCHfor the

Tell-Tale Telomeres !

Page 74: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

74

Students search DNA in groups

Data Set 5: Searching the DNA

Page 75: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Part 3

Page 76: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

DNA Search Lab Followup

76

Welcome back from yourSEARCH FOR

THE TELL-TALE TELOMERE

Let’s see what it tells us…

Page 77: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

77

108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

RESULTS: Can you see the telomeres?

Page 78: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

78

RESULTS CLARIFIED:108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

HeadTelomereof “extra”chrom. 2a

HeadTelomereof “short”chrom. 2b

FUSION POINT !

Page 79: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

79

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta

Did you know… you’ve got FOSSILS in YOU !

All of you have these fossils,in the #2 chromosome of every cell !

Fossils are the remains of ancient life,and these are the telomeres of

two chromosomes from your ancient ancestor !

So, these telomeres are your very ownMOLECULAR FOSSILS !

Telo.2a

Telo.2b

Page 80: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

80

PREDICTIONS: If our hypothesis was true, we should find two telomeres there;

If NOT true, should be NO telomeres there.

Did we find telomeres there?

YES! Therefore…

Our hypothesis was supported:Our #2 chromosome WAS formed

from the FUSION of two chromosmesin an ancient ancestor after the

chimpanzees branched off.

CONCLUSION

Page 81: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

A Peek at the Chromosomes

of Other Apes…

81

On the next slide, you will see thechromosome diagrams for humans,

chimpanzees, gorillas, and orangutans,all the :”Great Apes”

They are shown side by side for easy comparison…

Page 82: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

82

The Chromosomesof Humans and Apes

Compared

For each number,the chromosomesare arranged in

this order(left to right):

human, chimpanzee,gorilla, orangutan

What is moststriking?

Page 83: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

83

RIGHT! They are ALL

Strikingly Similar!

And what do we knowwhen we find identical

or very similar patternson different items?

RIGHT!They had to have aCOMMON ORIGIN

Or, in this case…COMMON ANCESTRY

Page 84: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

84

Based on these chromosome comparisons…Biologists have been able to draw

a phylogenetic tree, showinghow primates are related to each other.

The following slide shows the tree(called a “Primate Cladogram”).

See if you can point to where the COMMON ANCESTORS

of Modern Primates would be LOCATED on the tree…

Page 85: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

85

Chimps Humans

Page 86: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

86

Did you find ALLof the

Common Ancestors?

Chimps

Humans

Page 87: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Did you notice…

87

All the other apes had that“extra” chromosome, too?

This confirms that this isthe more PRIMITIVE (original)CONDITION, so our SINGLE#2 chromosome is the DERIVED CONDITION(the result of fusion)

Page 88: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

88

When we compare primates by using other features,

including DNA, different proteins, anatomy, physiology, and fossils,

Biologists have developed similarCladograms (Phylogenetic Trees),

like these…

MORE CONFIRMING EVIDENCE

Page 89: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

See how similarthey are?

Based on Albumin Protein Analysis:

Based on DNA Hybridization Analysis

Page 90: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

And here’s another one…

PRIMATE CLADOGRAM

Based on Genome Analysis

90

Humans

BonobosChimpanzees

Gorillas

Orangutans

Gibbons

Old WorldMonkeys

6 mya

8 mya

13 mya

18 mya

25-30 mya

SpeciesToday

Common Ancestor

Again, basically the same pattern

Page 91: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

91

When all the data point to essentially the same conclusions,

this strengthens those conclusions.

Biologically, humans are very closely related to the apes.

In fact, chimps are closer to US,than they are to gorillas!

Humans and chimps are even closer than zebras are to horses!

Biologists have even recommended thathumans and chimps be in the same genus!

Page 92: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

92

This may be hard for many to accept…But we are very special apes,

not just “ordinary animals.”

Because of our brain and our dexterity,humans have built amazing cultures

and environments not equaledanywhere else in the animal kingdom.

Page 93: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

LESSON WRAP-UPREALITY-CHECK QUESTIONS

MORE DNA SEARCHES

Page 94: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Time for a REALITY CHECK Number your paper from 1-8 Based on the observed data…

Which are true… which are false?1. All chromosomes have telomeres at both ends.

2. All chromosomes have telomeres in their middles.

3. Identical complex patterns on different items means they had a common origin.

4. A hypothesis is a prediction.

94

Page 95: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

REALITY CHECK cont. Which are true… which are false?

5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor.

6. Humans evolved from monkeys.7. Humans evolved from chimpanzees.8. Humans & chimpanzees evolved from a

common ancestor.

95

Page 96: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Confirmation: More Evidence

When we compare

ALL the DNA inour #2

chromosomewith ALL the DNA

in the two chimp

chromosomes…*

we find that it isall the same

DNA !

*(this is “synteny”)

Page 97: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

However…

When we compareALL the DNA in

our #2 chromosomewith DNA in Dogchromosomes…

we find that our #2is a patchwork of DNA

from 8 differentDog chromosomes!

(WHY?)

Page 98: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

If you said“More time since we

branched from ourCOMMON ANCESTOR

with dogs,SO, more time for

more chromosomechanges and other

mutations,”YOU GOT IT!

WHY?

Page 99: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

JUST SO WE’RE CLEAR, THIS IS JUST ONE OF MANY PIECES OF EVIDENCE FOR A RELATIONSHIP BETWEEN CHIMPS & HUMANS

Page 100: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

Telomere Tid-Bits

100

1. Telomeres apparently protect the endsof our chromosomes, keeping the gene-DNAfrom getting damaged.2. Each time our chromosomes replicateand cells divide, a little of each telomereis lost, so they get shorter as we age!

3. This is one reason why embryonic stem cellsare preferred over adult stem cells instem cell research.

Page 101: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

More Telomere Tid-Bits

101

4. There is an enzyme, telomerase, that canreplace some of the missing telomere DNA. It’s thought that defective telomerasecould be a cause of aging problems.

5. Telomeres and telomerase are the subjects ofmuch research into cancer, heart disease,brain function, and other problems of aging.

Page 102: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

KEY TO REALITY CHECK

102

1. All chromosomes have telomeres at both ends.

True 2. All chromosomes have telomeres in their middles.

False3. Identical complex patterns on different items means they had a common origin.

True4. A hypothesis is a prediction.

False

Page 103: Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC

KEY TO REALITY CHECK (cont.)

103

5. Our #2 chromosome was formed by the fusion of 2 chromosomes in an early ancestor.

True6. Humans evolved from monkeys.

False7. Humans evolved from chimpanzees.

False8. Humans & chimpanzees evolved from a common ancestor.

TRUE!