weiland meyer - algae, protists & fungi plenary

An update on DNA barcoding of human pathogenic fungi

Meyer, W1, Serena, C1, Firacative, C1, Kröger, B1, Arabatzis, M2, Robert, V3, de Hoog, S3, Balajee, A4, Velegrak, A2

1 Molecular Mycology Research Laboratory, Sydney Medical School – Westmead, University

of Sydney, Westmead Millennium Institute, Westmead Hospital, Westmead, NSW, Australia 2 Medical School, University of Athens, Athens, Greece 3 CBS-Fungal Biodiversity Center, 3508 AD Utrecht, The Netherlands4 Mycotic Diseases Branch, Centers for Disease Control and Prevention, Atlanta, GA, USA

E-mail: [email protected]

© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011

Major Issues in Medical Mycology

• Constant increase in invasive fungal infections

• Insufficiency of the current identification techniques (morphology/physiology)

• Limited available therapies • Emergence of resistant fungal strains


Urgent need to improve fungal identification to enable a substantial improvement in clinical diseases outcome!Urgent need to improve fungal identification to enable a substantial improvement in clinical diseases outcome!

Blastomycoses

Zygomycoses

Candidiasis

© D.Ellis

© S. Chen

© D.Marriott

Sequence based identification strategies are the new “gold standard” for species ID

However, there are major problems with sequence based ID:

(A) Lack of a universally accepted appropriate genetic locus

(B) Lack of quality controlled sequence databases

(C) Arbitrary defined cut-off points for species ID

Molecular diagnostic tools

Achieve rapid and accurate detection and identification of fungi from cultures or clinical specimens


COX1 Alternative loci:

ITS1/2 region D1/D2 LSU rDNA geneHistone spacerTUBACTElongation FactorAFTOL genes: RNA polymerase genes RPB1

RPB2

does not work for many fungi

A DNA Barcode for fungi?

used since the 1990’s


LSU data show coinciding similarities among species!

ACT1 data resolved all investigated species!

LSU, COX1, RPB1 and RPB2, ACT1© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011

The International Sub-commission on Fungal Barcoding has proposed the ITS region as the prime fungal barcode or the default region for species identification (http://www.allfungi.com/its-barcode.php).

Fungal specific primers: SR6R: 5’ AAGTATAAGTCGTAACAAGG 3’LR1: 5’ GGTTGGTTTCTTTCCT 3’

[Vilgalys & Hesters (1990) J. of Bacteriol. 20: 4238-4246]


Steps towards a Fungal DNA barcode- - All Fungi Barcode of Life Planning WorkshopSmithsonian Conservation and Research Center, Front Royal, Virginia 13-15 May 2007

- Fungal DNA barcoding meeting Amsterdam April 2011 Large multi-centre and multi national study [ITS, LSU, SSU, RPB1 {RPB2, MCM7}]ITS, LSU, SSU, RPB1 {RPB2, MCM7}] (Conrad Schoch, Keith Seifert, John Spouge, Vincent Robert, Elena Bolchacova & more than 130 global colaborators )


Pezizomycotina Basidiomycota Saccharomycotina Basal AllPezizomycotina Basidiomycota Saccharomycotina Basal All

John Spounge, NCBI

18S rDNA or SSU 5.8S rDNA 28S rDNA or LSU 1800 bp 159 bp 3396 bp

IGS ITS 1 ITS 2 IGS 361 bp 231 bp

D1 D2 D3 D4/5 D6/7a/7b D8 D9/10 D11/12 V1/2 V3/4 V5 V7 V8 V9

SR1R SR6R/ITS1

5.8S/ITS2

ITS3 LR1/ITS4

LROR LR12LR16

• RPB1 consistently produced the best results, followed by ITS

• Multigene combinations had slight improvements

• Ease of amplification makes the ITS the current best compromise choice for a fungal DNA barcode

Outcomes


Schoch et al. The internal transcribed spacer as a universal DNA barcode marker for fungi. Submitted to PNAS October 2011Schoch et al. The internal transcribed spacer as a universal DNA barcode marker for fungi. Submitted to PNAS October 2011

35733573

56675667

1 1 23 23

10 10

13.1.2009

3863 Fungal Barcodes13.1.2009

3863 Fungal Barcodes

4.8.2010



13.4.2011



29.11.2011




If medical fungi are blasted:

e.g. Candida albicans

no results !!!!!!

www.boldsystems.org

ITS1/2 region


~172,000 full-length fungal ITS sequences are available in Genbank

PROBLEMS

many sequences containing mistakes:

limited taxonomic coverage.

the total number of currently available fungal ITS sequences, represents less than 1% of the estimated 1.5 million fungal species

• as a result of experimental errors • misidentification of the species• exchange of cultures

Public databases: GenBank = EMBL = DDJB


Comparative sequence based identification is only

meaningful if:

• well-curated, robust and reliable databases are available • that are populated with sequence data from:

• the strains have been rigorously validated in terms of

their nomenclature

type or reference strains (where possible) a wide range of clinical strains a wide variety of target species


New Quality controlled ITS sequence database at the Molecular Mycology Research Laboratoryat: http://www.mycologylab.org/BioloMICSID.aspx

1

23

4

5

67

8© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011

• ITS database of Medical Fungi at: http://www.mycologylab.org 476 strains representing 182 human pathogenic fungal species (of 200 species which cause commonly human/animal diseases from the 1.5 Mill fungal species estimated to exist)

• Quality controlled in-house ITS data offer a higher accuracy and better predictive value for the correct identification of clinically important fungi than GenBank

• Other well-curated ITS database e.g. are:

Need to be integrated into BOLD

Quality Controlled Database


http://www.mycologylab.org/

Established: January 2010

Founding Coordinators: A/Prof. Wieland Meyer (University of Sydney, Australia)

Prof. Sybren de Hoog (CBS-KNAW, The Netherlands)

Dr. Arun Balajee (CDC, USA)

Current Coordinators: A/Prof. Wieland Meyer (e-mail: [email protected])

Prof. Sybren de Hoog (e-mail: [email protected])

Objectives: (1) to establish a medical barcode database as part of BOLD by incorporating the different already existing fungal group specific databases,

(2) to extend the number of quality controlled ITS sequences to cover all medical

important fungi over the next 3 years,

(3) to incorporate this sequences into BOLD, and

(4) to achieve a special status as quality controlled reference sequences for those

sequences within Genbank.

Membership: The working group is open to everybody who is interested on molecular identification of pathogenic fungi.


University of Aix Marseille

University of Sydney

CBS

Institute Pasteur

ParisOthers

Joined ITS Database for

Human/Animal Pathogenic

Fungi

Major outcomes of the first meeting of the working group: TIMM5 2-5.10.2011 Valencia, Spain

BOLDBOLD GenbankGenbank

Incorporating Sequence & MALDI-TOF MS

data

Next Meeting at 18Th ISHAM Congress 11-15.6.2012 in Berlin German

Next Meeting at 18Th ISHAM Congress 11-15.6.2012 in Berlin German


Sequence based ID currently based on a cut-off point of 98-99% similarity with the type culture of

the species in question.

However, population based studies showed that the sequences variation in

clinical samples is much higher as those type culture dependent cut-off values.


Molecular species borders currently undefined!

Currently type culture based cut off point: 99%

Carolina Serena/Wieland Meyer

Type Culture Based Cut-Off Point: 98-99%

Clinical sample based cut-off value: 91.5% similarityClinical sample based cut-off value: 91.5% similarity


Chytridium confervae

Calic ium tricolor

Mycocal ici um albonigrum

Geom yces pannorum

Pneumocyst is carini i

Schizosaccharomyces pombe

Linderina pennispora

Cantharellus tubaeform is

Basidi obolus ranarum

Eurot iales

Onygenales

Chaetothyrial es

Sordariales

Ophiostomatal esDiaporthalesXylarial es

Hypocreales

Mi croascal es

Lecanoral es

Dothi deales

P leosporales

“Demat iaceae”

Leot iales

Pezizales

Hemiascomycetes

Uredinales

Spori diales

Til letial esUstilagi nales

Tremel lales

S tereales

Agari cales

Glom ales

Harpellales

Entom ophthorales

Mucorales

Chytridiales

Mort ierellales

Leot iales

Zygomycota

Basidiomycota

Ascomycota

Chytridiomycota

ITS works well

ITS not variable enough

ITS variable within species

Sybren de Hoog© WMeyer, USYD, Australia, BOL4 Adelaide Nov 2011

Raises the question: Is the ITS region the best barcode for fungi?Raises the question: Is the ITS region the best barcode for fungi?

• 21 complete fungal genomes• 1 complete plant genome• 3 complete animal genomes• 531 euKaryote Orthologous Groups (KOGs) of proteins• 531 single gene trees• 1 super gene tree


Should we continue with the genes that we are currently using?Should we continue with the genes that we are currently using?

Should we continue with the genes that we are currently using ?

Robert et al. 2011

For fungal ID most likely a combination of genes is needed


DNA barcoding of pathogenic fungi as the basis for the development of novel

standardized diagnostic tools

CI’s: Wieland Meyer (University of Sydney, Australia)

Vincent Robert (CBS/BioAware, The Netherlands/Belgium)

David Ellis (SA Pathology, Australia)

Sharon Chen (Westmead Hospital, Australia)

AI’s: Conrad Schoch (GenBank, USA)

Arun Balajee (CDC, USA)

Aristea Velegraki (University of Athens, Greece)

Sybren de Hoog (CBS, The Netherlands)

Atlas of Living Australia (Canberra, Australia)

APP1031952New Project:

2012-2014


AimsAim 1. Identification of the most informative genetic locus/loci to be

used for DNA barcoding of pathogenic fungi, by applying comparative genomics to all currently publically available

fungal genomes

Aim 2. Identification, design and testing of potential primers for the amplification of these loci from a wide range of pathogenic fungi

Aim 3. Generation of DNA barcodes and integration into reference databases for automated molecular identification of fungi accessible via the world-wide-web

Aim 4. Application of the novel identification system in the clinical setting

The identified locus/loci will form the basis for the development of new barcode identification tools, which will revolutionize the identification of

fungal pathogens in the clinical or quarantine setting.

The identified locus/loci will form the basis for the development of new barcode identification tools, which will revolutionize the identification of

fungal pathogens in the clinical or quarantine setting.


2 position available: 1) Postdoc with experience in Bioinformatics/whole genome analysis 2) RA with experience in microbiology/mycology/molecular biology

Project Impact:


• Loop-mediated isothermal amplification (LAMP)• Rolling circle amplification (RCA)• Reverse line blot (RLP)• Quantitative real-time PCR (qPCR)• Specifically primed PCR• Probing with microarrays• MALDI-TOF

DNA Barcoding - Basis for the Development of New Molecular Identification Methods:


Application of DNA barcoding

Longitudinal studies of Airway Colonization in Cystic Fibrosis patients and influence on disease progression

microbiome studies

via next-generation sequencing of sequential sputum samples


AcknowledgementsMolecular Mycology Research Laboratory, University of Sydney, Sydney Medical School – Westmead Hospital

Carolina Firacative, Benjamin Kröger, Carolina Serena, Heide-Marie Daniel, Krystyna Maszewska, Matthew Huynh, Clement Kin Ming Tsui, Nathalie van de Wiele, Sharon Chen, Wieland Meyer

Centre for Infectious Disease and Microbiology, Westmead Hospital

Fanrong Kong, Ying Sun, Catriona Halliday, Xianyu Zeng, Guy Porter, Ok-Cha Lee, Tania Sorrell

CBS-Fungal Biodiversity Center, Utrecht, The NetherlandsBioAware, Hannut, Belgium

Vincent Robert

Mycology Reference Laboratory, Department of Microbiology, Medical School, University of Athens, Athens, Greece

Aristea Velegraki, Michael Arabatzis

NIH, NCBI, Genbank, Bethesda MD, USA

Conrad Schoch, John Spouge

LifeTech, USA

Elena Bolchacova

# 352303 to WM APP1031952

Funding: EC-FP7-228310; Sloan Foundation to VR


weiland meyer - algae, protists & fungi plenary

Education

bol4 adelaide

fungal barcodes wmeyer

fungal identification

fungal dnabarcode wmeyer

fungal barcoding

fungal dna barcode

prime fungal barcode

act1 wmeyer