Welcome Back!Vocabulary Do Now

▫Chromosomes: strands of DNA wrapped around proteins and coiled tightly

▫Define the following in your own words DNA Heredity Traits

Unit 4.1DNA Structure

andReplication

A. Discovery of DNA structure• Many scientists worked to determine the source of

heredity▫ Heredity: the passing of traits from parent to offspring

• How are these traits passed on?▫ First scientists determined that chromosomes

controlled heredity and are made of DNA and proteins ▫ Then scientists determined that DNA was the chemical

that controlled characteristics (traits) of the organisms▫ Then the race was on to reveal the chemical structure

of the DNA molecule

A. Discovery of DNA structure• Rosalind Franklin was the first to

take a clear “picture” of DNA using X-ray crystallography. The “picture” offered a clue of the shape of DNA.

• Watson and Crick received credit for finalizing the model of DNA by using the picture taken by Franklin.

B. DNA- the Blueprint of Life

•DNA stands for deoxyribonucleic acid.

•DNA is the blueprint for life. Every living thing uses DNA as a code for making proteins which determine traits. ▫Ex: DNA contains the

instructions for making the proteins (called pigments) which give your eyes color.

• DNA is packaged into chromosomes ▫strands of DNA wrapped around

proteins and coiled tightly

• Chromosomes are found in the nucleus of eukaryotic cells. Prokaryotic cells have chromosome free-floating in the cytoplasm.

B. DNA- the Blueprint of Life

C. Structure of the DNA molecule• DNA is composed of two strand

that are twisted together in a double helix. A double helix is a twisted ladder.

• The building blocks of DNA are called nucleotides. A nucleotide consists of three parts: ▫A sugar (named deoxyribose).▫A phosphate group.▫A nitrogen base. There are four

possible nitrogen bases in a DNA molecule: Adenine (A)Thymine (T) Guanine (G) Cytosine (C)

C. Structure of the DNA molecule• The sides of the ladder are made

of sugar and phosphate. The rungs of the ladder are the nitrogen base pairs.

• The nucleotides are arranged into two strands that are held together by weak hydrogen bonds between the nitrogen bases.

• The nitrogen bases bond in a specific way▫Adenine – Thymine (A-T)▫Guanine – Cytosine (G-C)

• This pattern is called complementary base pairing

HydrogenBond

Check Yourself

D. DNA ReplicationIf I started as one cell, how did all of

my cells get a copy of DNA?

• Because DNA is so important, when a cell divides, it must pass on an exact copy of the DNA to its daughter cells so they can function.

• Therefore, DNA is copied (replicated) during interphase, (specifically the “S”-phase), immediately before the cell begins mitosis.

E. Process of DNA Replication1. An enzyme breaks the

hydrogen bonds between the paired nitrogen bases. This allows DNA to “unzip” as the two strands move apart.

2. The newly unpaired nucleotides are paired (A-T and G-C) with extra nucleotides present in the nucleus. This process is catalyzed by another enzyme.

3. Enzymes then link the nucleotides along the newly constructed side of the DNA ladder by bonding sugar to phosphate backbone.

4. The DNA is proofread by enzymes for any errors.

E. Process of DNA Replication

F. Result of DNA replication• Two identical DNA molecules

have been produced. ▫Each “daughter” DNA molecule is

composed of one “old” strand and one “new” strand (semi-conservative).

• Each copy of DNA is packaged as a chromatid on a doubled chromosome.

• After mitosis, each daughter cell will receive one of the two copies of DNA. This happens when the doubled chromosome is split.

Check Yourself

DNA Cutout

Welcome Back!•Turn in cut-out homework•Vocabulary Do Now

▫Codon: every three bases in a sequence of mRNA

▫Anticodon: three bases on tRNA▫Gene: a section of DNA; used as the

blueprint for making a protein; composed of a specific sequence of nucleotides

▫Polypeptide: a long chain of amino acids

4.2 Protein Synthesis

Protein SynthesisA. Importance of Protein

Synthesis•Every inherited trait is

controlled by one or more proteins. ▫ Protein synthesis is the process that

makes those proteins•Each cell must produce

different proteins, based on the function of that cell. ▫Ex: Only blood cells need to

produce the protein hemoglobin.

Hemoglobin

B. DNA Controls the Production of Proteins.• A section of DNA, called a gene, is

used as the blueprint for making a protein.

• Each gene is composed of a specific sequence of nucleotides.

• Sequence can be represented by writing the order of the N-Bases▫ Ex: DNA sequence of insulin CCATAGCACGTTACAACGTGA

• The cell knows what protein to make

based on the sequence. Therefore the order of the bases matter!

•Proteins are made of amino acids. •Each codon directs the cell to place a

specific amino acid in a particular protein as the protein is built.▫For example, CAA in DNA codes for the

amino acid “valine”▫If this sequence was the third segment of a

gene, valine would be the third amino acid in the chain

C. Protein Synthesis Requires RNA•RNA is made up of a single

strand of nucleotides. ▫Nucleotides: sugar (ribose),

phosphate, and a nitrogen base.▫ All RNA has a different sugar (ribose)

which cannot bind to thymine. Thus RNA must use a different nitrogen

base (uracil) as a substitute for thymine This means that in mRNA, A bonds with U

NOT T

•There are 3 types: ▫mRNA (messenger)▫tRNA (transfer)▫rRNA (ribosomal)

•A codon is every three bases in a sequence of mRNA.▫A codon is like a single word

in a sentence.▫Only by putting the words

(codons) in the correct order can you create a meaningful sentence (protein)

•When working on problems we use the “mRNA” codon to find the corresponding acid.

DNA and the Workings of a Cell

• Sequence 1 – HumanC CATAGCACGT TACAACGTGAAGGTAA

• Sequence 2 – CowCCGTAGCATGTTACAACGCGAAGGCAC

The SnorksMore practice with codon charts!

Vocabulary Do Now•DNA: Deoxyribonucleic acid

▫Nucleic acid; A molecule that encodes the genetic instructions used in the development and functioning of all known living organisms.

▫Nucleotides: Deoxyribose sugar, Phosphate, Nitrogen-bases (Guanine, Cytosine, Adenine, Thymine)

•RNA: Ribonucleic acid ▫Nucleic acid; plays an active role within cells by

catalyzing biological reactions, controlling gene expression or sensing and communicating responses to cellular signals. One of these active processes is protein synthesis

▫Nucleotides: Ribose sugar, Phosphate, Nitrogen-bases (Guanine, Cytosine, Adenine, Uracil)

Let’s Get To Work…•If you have not finished the following

assignments, you must complete them by the end of the block today.▫Nucleotide Cut Out▫The Snorks

•Assignments should be completed neatly and thoroughly.

•You will be working INDEPENDENTLY. ▫If you have music, listen to it at a level that your

other classmates CANNOT hear. •If you finish both assignments, see Ms. Fields

Welcome Back!•Vocabulary Do Now:

▫The Central Dogma: Describes the sequence in which information is

passed to express your traits (controlled by protein).

▫Transcription: first step of protein synthesis Purpose: to rewrite the DNA code as mRNA .

▫Translation: second step of protein synthesis Purpose: use mRNA to build the protein.

More practice with DNA and RNA

•Egad! A new Snork was discovered on the planet Dee Enae

•Your task is as follows:▫Copy down the Snork’s DNA sequence▫Translate into RNA sequence▫Find the corresponding amino acids using

your codon chart▫Discover the new Snork’s phenotype▫Draw him

Swaggy Snork •Gene 1: CAG TCG TTT•Gene 2: ATG GGG CTT CTC TTT•Gene 3: GAA GAG GAG GGG•Gene 4: CAA CGC CGA•Gene 5: GTG TAA•Gene 6: AGA GGG CAT•Gene 7: CTA TAA GAA GAC GGG TGT•Gene 8: CAA CTA CTA CGC•Gene 9: AAA AGA CCA•Gene 10: TCT ATA ACA

Genes Amino Acid Sequence TraitGene 1 - body covering val - ser - leu hairless

val - ser - lys hairy

Gene 2 - body style tyr - pro - glu - glu - lys plump

val - pro - thr - glu - lys skinny

Gene 3 - legs leu - leu - leu - pro 3 legged

leu - leu - ser - ala 2 legged

Gene 4 - head shape ala - val - val round head

val - ala - ala square headGene 5 - tails his - ile tail

his - his no tail

Gene 6 – body color ser - pro - val green & orange Hair | blue striped skin

val - phe - tyr red & orange Hair & purple polka dot skin

Gene 7 - eyes asp - ile - leu - leu - pro - thre small eyes asp - ile - pro - pro - pro - thre large round eyes

Gene 8 - mouth val - asp - asp - ala small, circular mouth

asp - asp - asp - ala rarge, rectangular mouth

Gene 9 - ears phe - ser - gly pointed standing-up ears

phe - phe - gly rounded floppy earsGene 10 - arms arg - tyr - cys - lys long spaghetti like arms

arg - arg - asp - thre short stumpy arms

Go Further•DNA/RNA Review Packet

▫Complete tonight for homework (if you do not finish in class)

▫YES it must be COLORED and YES you must ANSWER THE QUESTIONS

Welcome Back•Vocabulary Do Now:• Gene Regulation is the process that

determines which genes will be expressed (used to make a protein)

The Central Dogma: the central axis around which all other biological concepts rotate• Describes the sequence in which information is

passed to express your traits (controlled by protein).

• DNA --------------- RNA ---------------- Protein (Transcription) (Translation)

D. Process of Protein Synthesis (two steps)Step 1: Transcription• Occurs in the nucleus. • Purpose: to rewrite the DNA

code as mRNA .

• DNA cannot leave the nucleus (it is too big) to go the ribosomes where proteins are made. ▫ It must send the instructions

using RNA

Step 1: TranscriptionSteps:• 1. mRNA copies the DNA when the

DNA unzips one section called a gene▫ One gene = one protein

• 2. mRNA is constructed one nucleotide at a time using one side of the DNA as a template

• 3. mRNA leaves the nucleus through a small opening in the nuclear membrane called a pore

• 4. The DNA rezips the gene The protein is not yet

synthesized! The code has been transcribed and needs to be translated!

Step 2: Translation• Occurs in the ribosome. • Purpose: use mRNA to build

the protein.

• In the cytoplasm of the cell, translation occurs at the ribosome▫ Ribosomes are made of rRNA

(ribosomal RNA) and proteins

▫ The ribosome holds mRNA in place and helps link amino acids together to make a protein.

Steps:1. The mRNA enters the ribosome

▫ The mRNA “start” codon (AUG) attaches to the ribosome

2. tRNA (transfer RNA) carries an amino acid to the ribosome

▫In order for the tRNA to leave the amino acid at the ribosome, the tRNA must bond with a complementary codon on the mRNA

3. The ribosome allows the tRNA anticodon to bond and the complementary codon on the mRNA to pair

▫ tRNA anticodon: made of three bases at the bottom of each tRNA

Step 2: Translation

4. The amino acid is removed from the tRNA by an enzyme.

▫ As each new amino acid arrives on a tRNA, amino acids are bonded together IN ORDER by a peptide bond to form a polypeptide

5. When the ribosome reaches a “stop” codon, it releases the mRNA and the string of amino acids separately

▫ The string of amino acids folds and coils to shape the protein

Check Yourself

Exit Ticket: 3-2-1• On index card:

▫ 3 things you learned this week

▫ 2 things you still have questions on

▫ 1 comment for Ms. Fields

• Work on: ▫ Transcription/

translation WS▫ What you don’t finish

will be for homework

• Have a great weekend!

Result of Protein Synthesis•Cells respond to their environment by

producing different types and amounts of protein

•The cell produces proteins that are:▫Structural: forming part of the cell materials▫Functional: such as enzymes, hormones or

chemicals in cell chemistry

Welcome Back!•Turn in completed work

▫Transcription & Translation Worksheet▫DNA – The Double Helix Worksheet▫Snorks

•Turn in bin = Ms. Fields desk

To Do: •Test tomorrow!

▫Cell Division Mitosis Meiosis

•To Do:▫Review Sheet▫Alien Protein Synthesis

Result of Protein Synthesis•All of an organisms cells have the same DNA

but the cells differ based on the expression of the genes▫Multicellular organisms begin as

undifferentiated masses of cells. Variation in DNA activities determine cell types.

▫Different types of cells expressing different genes leads to differentiation. Only specific parts of the DNA are activated in

those cells. Once a cell differentiates, the process cannot be

reversed. Ex: we have muscle cells, nerve cells and others

Result of Protein Synthesis•All of an organisms cells have the same DNA

but the cells differ based on the expression of the genes▫Gene Regulation is the process that

determines which genes will be expressed (used to make a protein) This can be affected by a cell’s history and/or

environment Proteins may be overproduced, under produced

or produced at incorrect times Ex: injury, repair, cancer

Result of Protein Synthesis•Each individual in a sexually reproducing

population has a slightly differing sequence of nucleotides in DNA when compared to other organisms of the same species ▫The different sequences lead to different

proteins which produce different traits (i.e., variation) Ex: two humans with different eye color

4. Gene regulation• All of an organism’s cells have the

same DNA, but cells differ based on the expression of the genes.

• Gene regulation is the process which determines which genes will be expressed (used to make a protein).

• Different types of cells expressing different genes leads to cell specialization. ▫Ex: Muscle cells, skin cells, and

nerve cells have very different functions but the same DNA. It depends on which genes are “turned on”.

G. Mutations• Occurs due to a mistake during replication or protein

synthesis. • Results: necessary protein is not made or is defective.• Two types of gene mutations:• 1. Point mutations occur when a single base is replaced

with a different base. May result in the change of a single amino acid within the protein

• Ex. Sickle Cell Anemia, GAT-TAC-A GAG-TAC-A

2. Frameshift mutations occur when a single base is added or deleted to the sequence. The earlier in the gene sequence the base is added or deleted; the more amino acids will be changed.

• Ex. Huntington’s Disease is caused by the insertion of several bases. GAT-TAC-ATT GAT-TAA-CAT-T

It's caused by mutations in the huntingtin gene, which lead to the build-up of damaging proteins in brain cells