Optimization of qPCR for Detection of PPO in ApplesJustin L. Woodard, Samuel P. Hayes, Ann Taylor

Department of Chemistry, Wabash College, 301 W. Wabash Ave, Crawfordsville, IN 47933

Procedure

Serial Dilution Procedure

In the end it was found that EF would act as the best control in detecting levels of PPO in apples and tobacco in future experiments. The lowest C(t) of PPO during the temperature gradient trials was 24.59 at the approximate temperature of 50.8° C, and for EF it was 25.17 at an approximate temperature of 56.3 °C. The ideal range for comparison between these two primers is 52.0°C to 52.4°C. After optimizing the qPCR with the primers the future goal is to examine how wounding apples and tobacco plants impacts PPO levels. In order to test how PPO levels change a non-bruised and bruised DNA sample is taken from the apples. In the tobacco plants DNA is extracted from a control, a sample bruised with tweezers, and another covered in salicylic acid. In order reach these steps in showing how PPO levels change in apples and tobacco, the primers and qPCR must be further optimized with the goal of an R2 value greater than 0.980.

Results and Future Work

http://www.bio-rad.com/webroot/web/pdf/lsr/literature/Bulletin_5279.pdf

Guardo, M. (2013) A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.), PLoS One. 8(10).

Schmidt, G. (2010) Stable Internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress, Mol Genet Genomics. 283, 233-241.

References

48 50 52 54 56 58 60 62 641517192123252729313335

Temperature (°C)

C(t)

PPO Temperature Optimization

Temperature gradient testing of PPO was in the range of 50OC-62OC. The lowest C(t) value was found to be 24.59 at 50.8OC.

The goal of this experiment was to find a way to measure concentrations of polyphenol oxidase (PPO) in apples and apply this to a classroom setting alongside a case study of PPO. PPO is typically pigmented clear, but when it reacts with oxygen the clear appearance is catalyzed and turned into a brown pigmentation in plants. This is also true in apples and is the main cause of the browning of apples. Arctic apples do not brown and were the source of inspiration for the case study and experiments.

In order to find the concentration of PPO in an apple RNA was isolated for reverse transcription, and DNA was also isolated. Three control primers were tested for comparison with the primer meant to replicate the PPO gene. The Actin primer was designed from Guardo’s paper, “A Multidisciplinary Approach Providing New Insights into Fruit Flesh Browning Physiology in Apple” and very little success was obtained with this primer. Next, GAPDH and EF control primers tested in order to find a replacement for Actin. Both GAPDH and EF proved to be more effective controls than the Actin tested, but between the two EF was more reliable. This conclusion was made due to more consistent serial dilution data.

The results were based on the C(t) value given by the CFX 96 Bio-Rad qPCR instrument. The instrument assigned an arbitrary fluorescence value and the number of cycles required for a sample to reach the fluorescence value was the C(t) value. For serial dilutions it was hypothesized that the more concentrated samples would have a smaller C(t) value. This was proven true since having a higher concentration would mean more DNA and reaching the fluorescence value would require less cycles.

Abstract

48 50 52 54 56 58 60 6223.5

2424.5

2525.5

2626.5

2727.5

28

Temperature (°C)C

(t)

EF Temperature Optimization

Temperature gradient testing of EF in the range of 50OC-60OC. The lowest C(t) value was found to be 25.17 at 56.3OC.

0 1 2 3 4 5 6 70

5

10

15

20

25

30

35

40

f(x) = 3.27142857142857 x + 15.0866666666667R² = 0.950363873929206

-log[Dilution]

C(t)

PPO Serial Dilution

C(t) vs. the –log of the amount of dilution of DNA sample.

0 1 2 3 4 5 6 7 8 915.00

20.00

25.00

30.00

35.00

40.00f(x) = 1.02690743450619 x + 30.3970314544307R² = 0.890331064851235

-log([C(t))]

C(t)

EF Serial Dilution

C(t) vs. the –log of the amount of dilution of DNA sample.

Thanks to the Eli Lilly Summer Undergraduate Research Grant and the Haines Fund for the Study of Biochemistry at Wabash College.

Acknowledgements

The temperature proved to play an important role in the amount of DNA that was able to be replicated. If the temperature was far enough below the melting point the primer would anneal but not complete the extension step. When the annealing and extension temperature was above the optimal value the primer would not anneal. In both cases the amplification of DNA is stopped due to too a large enough temperature difference from the primer’s melting point. The temperature gradient helped to discover the optimal temperature to run PPO in conjunction with one of the other three tested control genes.

Optimizing qPCRThe C(t) value is the amount of cycles required for the amount of fluorescence detected to reach a

value assigned by the CFX 96 Bio-Rad qPCR instrument. In the figures below the y-axis is the number of relative fluorescence units, which is a unit of measurement in detecting fluorescence. The x-axis is the number of cycles that have occurred. The horizontal green line is the amount of fluorescence assigned by the qPCR instrument. The C(t) value is determined when the fluorescence detected in a sample crosses that line. In a few cases it was found to be possible that the amount of fluorescence in a sample would level out on the graph. This occurred due to the concentration of DNA in the sample reaching a large enough value to where there was not enough dye to bind to all the DNA in the solution.

A C(t) value allows for relative comparison of the amounts of DNA in different samples. A larger C(t) value would imply beginning with a lower concentration of DNA while a smaller C(t) value would represent a larger starting concentration of DNA. The same C(t) value between two samples would imply equal concentrations between the two.

What is a C(t) value?

PCR is a method of DNA replication that uses three steps in order to accomplish replication. The first step is denaturation, which splits the double stranded DNA into two single strands. Second, the primer binds to the target site on the DNA strand, also called annealing. Third is extension, the primer copies the desired sequence. The cycle then repeats for the desired amount of steps. A simple method of cloning DNA, but one that does not allow for the determination of the starting amount of DNA in a sample.

Quantitative Polymerase Chain Reaction, or qPCR, quantitatively allows for the determination of the starting amount of DNA. It uses the similar protocol to that of PCR: denaturing annealing, and extending the DNA and primer. After these steps occur there are now two identical double stranded pieces of DNA. QPCR uses a fluorescent dye that attaches to double stranded DNA and is detected by a fluorescence reader in the instrument. In order to optimize qPCR there are two tests that must be performed. The first is to find the ideal temperature of each primer by running a temperature gradient. Next, it must be proven that the starting amount of DNA alters the ending amount of DNA by running serial dilutions. A temperature gradient and serial dilutions were performed in order to examine the optimal conditions under which to perform qPCR with the following primers: PPO, Actin, glyceraldehydes 3-phosphate dehydrogenase (GAPDH), and Elongation Factor 1α (EF).

PCR vs. qPCR

The serial dilution procedure is important because it validates optimization and the quantitative nature of the primers. The PPO, Actin, GAPDH, and EF primers were all tested to prove they had been optimized and could act quantitatively. In order to do this eight samples were prepared, each with a decreasing concentration of DNA. The DNA samples used for testing of the PPO and Actin primers were taken from golden delicious apples, and the GAPDH and EF primers were tested with tobacco of the nicotiana benthamiana species. If the primers were quantitative then it was hypothesized that as the concentration of DNA in each sample decreased the C(t) value would increase. In an optimized qPCR procedure the graph of log of dilution amount would be linear or near linear. Once optimization of qPCR was validated, it is possible to compare the C(t) values of known concentrations of DNA to unknown concentrations. The goal of optimization is when graphing to get the R2 value to be greater than 0.980. This goal was unable to be achieved with the R2 values of PPO and EF being 0.9504 and 0.8903 respectively. This was most likely due to possible pipeting error during the creation of the master mix. If the amount of dilution of each sample was slightly different than believed, this would create error that would cause the R2 value to be less than ideal.

Bruise one side of an apple

Extract RNA from apple

Perform DNase treatment on RNA

Perform Reverse Transcription

Perform qPCR on cDNA

Store RNA in -80oC and DNA in -20oC

Bruise one side of an apple

Extract gDNA from apple

Prepare primers for use

Perform qPCR on gDNA

Store gDNA samples in -20oC

C(t) vs. Relative Fluorescence Units graph of PPO temperature gradient

C(t) vs. Relative Fluorescence Units graph of PPO serial dilution

PPOCCTACTCACAAAGCCCAAGCGTTCCTTGGGACGTGAGGTCTCATGCAACGCCACAAACAATGACAATTTGATCAAGCACAGTCCAAACTAGACAGGAGAAATGTGCTTCTTGGICTIGGAGG

EFAACCTTGACTGGTACAAGGGCCCAACCCTTCTTGAGGCTCTTGACCAGATTAATGAGCCCAAGAGGCCCTCAGACAA