wssv

Experimental susceptibility of different life-stages

of the giant freshwater prawn, Macrobrachium rosenbergii

(de Man), to white spot syndrome virus (WSSV)

R B Pramod Kiran1, K V Rajendran1, S J Jung2 and M J Oh2

1 Central Institute of Fisheries Education, Mumbai, India

2 Yosu National University, Yosu, Korea

Abstract

Studies were conducted by injecting/feeding whitespot syndrome virus (WSSV) derived from infectedshrimp, Penaeus monodon (Fabricius), to differentlife-stages, namely post-larvae, juveniles, sub-adultsand adults of Macrobrachium rosenbergii (de Man).The disease was also induced in brood stock, andthe eggs and larvae derived from these animals weresubsequently tested for WSSV infection. All thestages except egg used for the experiment werefound WSSV positive in histopathology, crossinfection bioassay and polymerase chain reaction(PCR) analysis. Experimentally infected post-larvaeand juveniles showed a high percentage of mortalityand an increased rate of cannibalism. The cumu-lative mortality in post-larvae was up to 28%; with28–40% cannibalism resulting in a maximum lossof up to 68%. In juveniles, observed mortality andcannibalism were 10–20% and 6.7–30.0%, respect-ively, and the maximum loss recorded was 50%. Insub-adults, mortality ranged from 2.8 to 6.7%,cannibalism was up to 20% and the total loss wasup to 26.7%. Sub-adults and adults were found tobe more tolerant to the infection as evidenced bythe mortality pattern. A nested (two-step) PCRresulted in a 570-bp product specific to WSSV inall stages, except the eggs.

Keywords: white spot syndrome virus (WSSV),freshwater prawn, Macrobrachium rosenbergii, his-topathology, polymerase chain reaction.

Introduction

White spot syndrome virus (WSSV) causes themost serious epizootic in cultured penaeid shrimp(Wang, White, Redman & Lightner 1999). Theepizootic started in 1992, and spread through eastand south-east Asia, Indonesia and into India andother shrimp growing countries of the region(Nunan, Poulos & Lightner 1998). The WSSV isa serious threat because it infects a wide spectrum ofcrustaceans, some of which will not die as a resultof the virus, but act as carriers (Flegel 1996;Rajendran, Vijayan, Santiago & Krol 1999).

Against this backdrop of the disastrous diseaseoutbreak in the marine shrimp culture system, thegiant freshwater prawn Macrobrachium rosenbergiiis widely considered as an alternative culturespecies. The culture of this species has developedrapidly in some tropical areas. Nevertheless, it isfound that the freshwater prawn is also susceptibleto WSSV infection to a certain extent (Peng, Lo,Ho, Chang & Kou 1998). Rajendran et al. (1999)provided the experimental proof for the suscepti-bility of M. rosenbergii to WSSV and showed thatthe virus does not cause serious mortality in theadult stage of the prawn. Although Peng et al.(1998) have detected WSSV in M. rosenbergii usingpolymerase chain reaction (PCR), they did notrecord the susceptibility of different life-stages interms of mortality and the histopathologicalmanifestation in the experimentally or naturallyinfected prawn. With this background, the presentstudy was undertaken to determine the effect ofWSSV on different life-stages such as egg, larva,post-larva, juvenile, sub-adult and adult ofM. rosenbergii through experimental infection and

Journal of Fish Diseases 2002, 25, 201–207

Correspondence K V Rajendran, Central Institute of Fisheries

Education, J.P. Road, Versova, Andheri (W), Mumbai-400 061,

India

(e-mail: [email protected])

201� 2002

Blackwell Science Ltd

the resultant mortality, histopathological manifes-tations of the infection, cross-infection (bioassay)analysis and PCR-based detection to verify theinfectivity. We have also attempted to find outwhether the virus would transmit vertically, byexperimentally challenging the brood stock prawnand subsequently, analysing the eggs and larvaederived from the brooder.

Materials and methods

Experimental animals

Early life-stages such as post-larvae, juveniles andsub-adults of M. rosenbergii were procured fromthe freshwater prawn hatchery of the Division ofAquaculture, Central Institute of Fisheries Educa-tion, Mumbai. Wild, adult prawns were collectedfrom Bhivandi, Maharashtra, India. For bioassaystudies, 60-day old Penaeus monodon (PCR negat-ive stock) were collected from a farm with nohistory of white spot infection and were main-tained in the laboratory. All the stages ofM. rosenbergii and P. monodon used in theexperiment were tested for WSSV, prior to theexperimental infection.

Maintenance of prawns

Post-larvae were kept in 5-L glass aquaria with astocking density of five animals per litre andjuveniles in 30-L aquaria with two animals perlitre. Sub-adult groups were kept in 50-L plastictubs with a stocking density of one prawn perlitre. Adult prawns were kept in FiberglassReinforced Plastic (FRP), tanks (300-L) (KiraEquipment, India) with five animals in an experi-mental unit. Brooders were kept in 300-L FRPtanks for studies on eggs and larvae. Daily waterexchange (20–80%) was given in all the experi-mental tanks. The post-larvae and juveniles werefed with egg custard, and sub-adults and adultswith commercial pellet feed at the rate of 5%body weight. Water temperature during theexperiment was between 18 and 21 �C and pHranged from 7.5 to 8.5. Continuous aeration wasprovided in the experimental facility.

For bioassay, shrimp were acclimatized for a weekand maintained in filtered sea water of 12& salinity.Daily, 20–30% water exchange was given. Theanimals were fed with pellet feed at the rate of 5%body weight throughout the experimental period.

Experimental infection

White spot syndrome infected P. monodon werecollected from a shrimp farm, which recorded aserious outbreak of the disease. The samples weretransported on ice and stored at �80 �C until used.The gills, stomach and epidermal layer collectedfrom frozen infected shrimp were used for challengetrials according to the methods followed byTakahashi, Itami, Kondo, Maeda, Fujii, Tomona-ga, Supamattaya & Boonyaratpalin (1994) andRajendran et al. (1999). In the oral feeding trials,the experimental animals were fed with macerated/homogenized infected tissue ad libitum for 2 daysin the case of post-larvae, and 7 days (two feedingsper day at 5% body weight) for juveniles, sub-adultsand adults. For injection treatment, 1 g tissue washomogenized in 1 mL PBS, centrifuged at 400 · gfor 10 min at 4 �C, and the supernatant was filteredthrough a 0.45-lm membrane filter, diluted usingPBS (1/10 v/v) and injected intramuscularly intothe abdominal segment (0.1% v/w of body). In allinjection treatments, only a single injection wasgiven to the experimental animal. Control animalswere given a single injection with sterile PBS. Inorder to examine whether the pathogen wouldtransmit from mother to offspring, viral extract wasadministered into the brooders in a single injectionand they were maintained till they spawned.Subsequently, eggs and 2-day-old-larvae derivedfrom the experimentally infected brooders werecollected for PCR analysis.

Histopathology

The procedure described by Bell & Lightner (1988)was followed in the histological studies. In the case ofpost-larvae and juveniles, two animals each werecollected every week during the experiment and fixedin Davidson’s fixative. In the case of adults and sub-adults, freshly dead and moribund animals werecollected during the experiment, and various organswere dissected out and fixed. The tissue sections werestained with haematoxylin, counterstained witheosin and observed under the microscope. Thephotomicrographs were taken using a Lieca MPS 32camera (Leica Microsystems, Wetzlar, Germany).

Cross-infection bioassay

For challenge bioassay, the tissue filtrates wereprepared according to the protocol described by

Journal of Fish Diseases 2002, 25, 201–207 R B Promod Kiran et al. WSSV in Macrobrachium

202� 2002


Takahashi et al. (1994) and Rajendran et al. (1999)using the gills, stomach and epidermal tissues of theexperimentally infected prawns. The filtrate wasadministered intramuscularly to healthy P. monodon.

Polymerase chain reaction

The various life-stages viz. egg, larvae and post-larvae (whole) and soft tissues from the head ofjuveniles, sub-adults and adults (100 mg approxi-mately) of experimentally infected prawns werehomogenized in 200 lL of Tris-NaCl-EDTA(TNE) buffer [50 mm Tris, 10 mm ehylenedi-aminetetraacetic acid (EDTA), 1.5% NaCl;pH 7.5] using a glass tissue homogeniser. Thehomogenate was centrifuged at 400 · g for 10 minat 4 �C and the supernatant was used for theisolation of DNA. The isolation of the nucleic acidwas carried out using the high pure PCR TemplatePreparation Kit (Boehringer Mannheim, Indiana-polis, USA). Tissue homogenates from an unin-fected M. rosenbergii and a naturally infectedP. monodon were used as negative and positivecontrols, respectively. The WSSV-specific primerpairs, P1: 5¢- ATCATGGCTGCTTCACAGAC -3¢; P2: 5¢- CGCTGGAGAGGACAAGACAT-3¢;P3: 5¢- TCTTCATCAGATGCTACTGC -3¢; P4:5¢- TAACGCTATCCAGTATCACG -3¢ reportedby Kimura, Yamano, Nakano, Momoyama, Hir-aoka & Inouye (1996) were used for nested (two-step) WSSV diagnostic PCR. Polymerase chainreaction amplifications were performed in a finalvolume of 20 lL of reaction mixture containing50 mm KCl, 10 mm Tris–HCl, 1.5 mm MgCl2,0.1% Triton X-100, 0.2 mm of each dNTPs,15 pmol of each primer, 10 ng of template DNAand 1 unit of Taq DNA Polymerase. The ampli-fication was performed in a GeneAmp 2400thermal cycler (Perkin Elmer, Norwalk, USA).One microlitre of the post-PCR mixture using theprimer pair P1/P2 was used as the template for thesecond PCR (same conditions as above) with theprimer pair P3/P4. The products were analysed on1.5% agarose gel containing ethidium bromide andvisualized using a UV transilluminator.

Results

The details of each experiment and day-wisemortality are given in the tables (Tables 1–4). Allthe stages of M. rosenbergii except eggs used in theexperimental infection were found susceptible to

WSSV. However, the degree of susceptibilityshowed variation among different life-stages of theprawn. Presence of white spots on the carapace wasfound to be of consistent occurrence in all stages,but was more prominent in adults (Figs 1a–c).Penaeus monodon used for a comparative analysisshowed 100% mortality in 5–7 days. Histologicalsections of different target tissues from the repre-sentative samples of experimental animals showedthe characteristic features of WSSV infection inpenaeid shrimp.

Post-larvae were found weak and lethargic at5 days post-infection feeding and the first mortalitywas observed on the same day (Table 1). In 15 daysof experiment, cumulative mortality reached 28%in one experimental tank. Dead and moribundlarvae revealed very tiny white spots on the carapaceupon observation under the microscope. A signifi-cant observation made in the experiment was theincreased cannibalism among the experimentallyinfected animals. While the cannibalism observed incontrol aquaria was 4%, the experimentally infectedanimals showed 28–40% cannibalism.

Out of the 50 juveniles kept in four aquaria, thefirst mortality was recorded 5 days post-infection inone aquarium (Table 2). Cumulative mortalityranged from 10 to 20% in different experimentalaquaria during the 15-day experiment. Cannibalismin the experimental aquaria ranged from 6.7 to30.0%. The control animals were found healthyand no cannibalism was observed in this group.

In sub-adults, the first mortality was observed onthe seventh day post-infection feeding. In the15 days of experiment, cumulative mortalityobserved in different experimental tanks rangedfrom 2.8 to 6.7% and the observed cannibalism was20% (Table 3).

In the case of adults, intramuscularly injected, thefirst signs of infection, such as weakness andlethargy, were observed after 15 days. The firstmortality was observed on the 18th day post-injection. However, during the 10–15 days ofinfection, exuvia (carapace) of the moulted animalsshowed white spots and streaks characteristic ofWSSV infection. No other external manifestation orbehavioural change was noticed during the experi-mental period. In the case of per os infection con-tinuously for 7 days, first mortality was observed for24 days post-feeding. The animals were otherwisehealthy throughout the 30-day experimental period(Table 4). In this case also, the carapace of moultedanimals showed prominent white spots/patches.


203� 2002


Histopathology

Post-larvae, juveniles, sub-adults and adults of theexperimentally infected M. rosenbergii showed

histological manifestations similar to that foundin spontaneously infected penaeid shrimp(Wongteerasupaya, Vickers, Sriurairatana, Nash,Akarajamorn, Boonsaeng, Panyim, Tassanakajon,

Figures 1 Photomicrographs of carapace and tissue sections from experimentally infected freshwater prawn, M. rosenbergii: (a) Carapace

of adult prawn showing white spots; (b) white spots on the carapace of post-larva (·100); (c) white spots on the carapace of juvenile

(·100); (d) subcuticular ectodermal layer and connective tissue of the gut of juvenile showing hypertrophied nuclei with marginated

chromatin (arrow heads) and deeply stained basophilic intranuclear inclusions (arrows) (H&E, ·1000); (e) gut wall of post-larva

showing intranuclear inclusions (H&E, ·400).

Table 1 Details of the mortality pattern and cannibalism in post-larvae of Macrobrachium rosenbergii as result of experimental infection

by WSSV

Initial

stockDay-wise mortality (no.) Cumulative mortality

Cannibalism

Aquaria/tank (no.) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 No. % (no.)

Experiment 1 25 0 0 0 0 1 3 0 0 0 0 1 0 1 1 0 7 28 10

Experiment 2 25 0 0 0 0 1 2 1 0 0 0 1 0 0 0 0 5 20 9

Experiment 3 25 0 0 0 0 1 0 1 0 0 0 0 1 0 0 0 3 12 7

Control 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1


204� 2002


Withyachumnarnkul & Flegel 1995; Wang, Tang,Kou & Chen 1997). However, severity of degen-eration and number of viral inclusions in the targettissues were far less than that seen in penaeidshrimp. Gill lamellae showed intranuclear inclu-sions, hypertrophied nuclei, chromatin marginationand karyorhexis. The cuticular ectodermal layer ofthe gut showed a large number of variably sized,deeply stained basophilic intranuclear inclusions(Fig. 1d, e). Marked nuclear hypertrophy andchromatin margination were also observed.

Bioassay

Healthy uninfected P. monodon on injection withthe tissue filtrate prepared from the experimentally

infected prawn tissues, showed the typical signs ofWSSV infection at 10 days post-injection. Simi-larly, the animals which were challenged by feedinginfected prawn tissue, also showed the typical signsat 10 days post-infection. Animals were found weakand lethargic, and carapace showed heavy whitespots. Cumulative mortality reached 100% by20 days post-infection in all experimental groups.However, control animals in both the groups didnot show any signs of the disease.

Polymerase chain reaction

Electrophoresis of the PCR products of the first stepamplification did not reveal the presence of viralDNA (expected 982 bp product) in any of the

Table 2 Details of the mortality pattern and cannibalism in juveniles of Macrobrachium rosenbergii as a result of experimental infection

by white spot syndrome virus (WSSV)

Initial


Cannibalism


Experiment 1 15 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 2 13 1

Experiment 2 15 0 0 0 0 1 0 0 0 0 0 2 0 0 0 0 3 20 3

Control 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Experiment 3 10 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 10 3

Experiment 4 10 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 2 20 2

Control 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Table 4 Details of the mortality pattern in adults of Macrobrachium rosenbergii as a result of experimental infection by white spot

syndrome virus (WSSV)

InitialDay-wise mortality (no.)

Tank stock (no.) 0–5 5–10 10–15 15–20 20–25 25–30

Experiment 1 (i.m) 5 0 0 0 1 0 0

Experiment 2 (i.m) 5 0 0 0 0 0 0

Control 5 0 0 0 0 0 0

Experiment 3 (per os) 5 0 0 0 0 1 0

Control 5 0 0 0 0 0 0

i.m: intra muscular injection.

Table 3 Details of the mortality pattern and cannibalism in sub-adults of Macrobrachium rosenbergii as a result of experimental

infection by white spot syndrome virus (WSSV)

Initial


Cannibalism


Experiment 1 30 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 2 6.7 6

Control 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1

Experiment 2 35 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2.8 0

Control 35 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0


205� 2002


life-stages of M. rosenbergii. However, in the nested(second step) PCR, clear amplification was observedin larvae, post-larvae, juveniles, sub-adults andadults, and the PCR product of 570 bp wasdetected (Fig. 2). However, eggs derived fromexperimentally challenged brooders did not showany amplification.

Discussion

Investigations to find the susceptibility of variousaquatic crustaceans including freshwater prawn toWSSV have been carried out by many workers (Lo,Ho, Peng, Chen, Hsu, Chiu, Chang, Liu, Su, Wang& Kou 1996; Chang, Chen & Wang 1998;Kanchanaphum, Wongteerasupaya, Sitidilokratana,Boonsaeng, Panyim, Tassanakajon, With-yachumnarnkul & Flegel 1998; Peng et al. 1998;Wang, Lo, Chang & Kou 1998; Rajendran et al.1999). However, the susceptibility of different life-stages of the prawn to WSSV through experimentalinfection has not been investigated in terms ofpathogenicity of the virus and the resultant mor-tality. The present study, using various life-stages ofM. rosenbergii, showed that all the stages in the lifecycle of freshwater prawn are susceptible to WSSV.It also provides conclusive evidence for the suscep-tibility through mortality of the experimentallyinfected animals, histopathological manifestations,cross-infection bioassay and PCR based detection.

It has been observed that early life-stages such aspost-larvae and juveniles are more susceptible thanthe late stages, as they showed increased percentageof mortality in a short period of time. Cannibalismis a common phenomenon in freshwater prawn,especially during moulting (Sandifer & Smith1985; Brock 1993). During the present study, it

was found that there was a significant increase in thecannibalistic rate among the post-larval and juvenilestages. Horizontal transmission through cannibal-ism plays a significant role in disease disseminationof WSSV. The observed mortality, which can beattributed to the WSSV infection and the canni-balism together, represent a high percentage of lossin the post-larval stage (68%). Therefore, thepresent study demonstrates that WSSV infectionin post-larval and juvenile stages, in which thepercentage of mortality and cannibalism is high, canbe very critical in determining the success ofhatchery operations.

The sub-adults and adults were found moretolerant than the early larval stages, as the cumu-lative mortality in sub-adult animals was found tobe 10%. Besides, cannibalism was also found to beless when compared with the early larval stages.Nevertheless, the experimentally infected animalsshowed distinct white spots on the carapace andmarked histopathological manifestations in thetarget tissues. In the case of adults, which wereintramuscularly injected with the viral extract, theseverity was found to be greater when comparedwith the animals which were given infection per os.Although the adult stage showed pronounced whitepatches on the carapace, the mortality patternindicated that this stage can tolerate the viralinfection to a large extent. This is in accordancewith the observations made by Rajendran et al.(1999). Eggs derived from experimentally chal-lenged brooders did not show any WSSV infection.However, the larvae hatched out of these eggs werefound positive for WSSV infection in two-stepPCR. As the eggs were found negative for thepresence of WSSV, it is presumed that the larvaemight have infected through contaminated water.

Figure 2 Nested PCR assay on DNA from different life stages of freshwater prawn, M. rosenbergii, experimentally infected with white

spot syndrome virus (WSSV). Agarose gel electrophoresis of the nested PCR products showing the amplification pattern. Lane 1: 1 kb

DNA marker (Bioneer Co., Chungbuk, Korea); Lane 2: negative control (uninfected M. rosenbergii); Lane 3: positive control (naturally

infected P. monodon); Lanes 4–9: egg, larva, post-larva, juvenile, sub-adult and adult, respectively. Arrowhead indicates the amplicon in

the second step PCR (570 bp) of the WSSV.


206� 2002


Nevertheless, repeated experiments using manybrooders are required to prove the existence ornon-existence of vertical transmission.

It can be concluded that, except the post-larvaland juvenile stages, all other life-stages ofM. rosenbergii are tolerant to WSSV. Besides themortality pattern exhibited by the experimentallyinfected prawns, cross infection bioassay and histo-pathological manifestation also indicated the in-creased tolerance of M. rosenbergii. The resultsobtained in the bioassay involving experimentallyinfected M. rosenbergii and P. monodon showed thatcumulative mortality in infected P. monodon reached100% only by the 20th day post-infection. Thisdelay in the mortality might be because of the lowlevels of virus in M. rosenbergii. Histopatho-logical observations also corroborate the fact thatthe number of viral inclusions and the severity ofcellular destruction in the target tissues ofM. rosenbergii were far less than that seen in infectedP. monodon.

Acknowledgements

The authors are thankful to the Director, CentralInstitute of Fisheries Education, Mumbai, forproviding facilities for the research work. Thanksare also due to Dr C. S. Purushothaman for hiscritical reading of the manuscript.

References

Bell T.A. & Lightner D.V. (1988) A Handbook of NormalPenaeid Shrimp Histology. World Aquaculture Society, Baton

Rouge, LA.

Brock J.A. (1993) A synopsis of pathology, diseases, and

production problems of cultured Macrobrachium, with an

emphasis on experiences in Hawaiian prawn farming. In: CRCHandbook of Mariculture I, Crustacean Aquaculture (ed. by

J.P. Mcvey), pp. 361–392. CRC Press Inc., FL.

Chang P.S., Chen H.C. & Wang Y.C. (1998) Detection of white

spot syndrome associated baculovirus in experimentally

infected wild shrimp, crab, lobsters by in situ hybridization.

Aquaculture 164, 233–242.

Flegel T.W. (1996) A turning point for sustainable aquaculture:

the white spot virus crisis in Asian shrimp culture. AquacultureAsia 1, 29–34.

Kanchanaphum P., Wongteerasupaya C., Sitidilokratana N.,

Boonsaeng V., Panyim S., Tassanakajon A.,

Withyachumnarnkul B. & Flegel T.W. (1998) Experimental

transmission of white spot syndrome virus (WSSV) from crabs

to shrimp Penaeus monodon. Diseases of Aquatic Organisms 34,

1–7.

Kimura T., Yamano K., Nakano H., Momoyama K., Hiraoka M.

& Inouye K. (1996) Detection of penaeid rod-shaped DNA

virus (PRDV) by PCR. Fish Pathology 31, 93–98.

Lo C.F., Ho C.H., Peng S.E., Chen C.H., Hsu H.C., Chiu Y.L.,

Chang C.F., Liu K.F., Su M.S., Wang C.H. & Kou G.H.

(1996) White spot syndrome baculovirus (WSBV) detected in

cultured and captured shrimp, crabs and other arthropods.

Diseases of Aquatic Organisms 27, 215–225.

Nunan L.M., Poulos B.T. & Lightner D.V. (1998) The detec-

tion of white spot syndrome virus (WSSV) and yellow head

virus (YHV) in imported commodity shrimp. Aquaculture160, 19–30.

Peng S.E., Lo C.F., Ho C.H., Chang C.F. & Kou G.H. (1998)

Detection of white spot baculovirus (WSBV) in giant fresh-

water prawn, Macrobrachium rosenbergii, using polymerase

chain reaction. Aquaculture 164, 253–262.

Rajendran K.V., Vijayan K.K., Santiago T.C. & Krol R.M.

(1999) Experimental host range and histopathology of white

spot syndrome virus (WSSV) infection in shrimp, prawns,

crabs and lobsters from India. Journal of Fish Diseases 22,

183–191.

Sandifer P.A. & Smith T.I.J. (1985) Freshwater prawn. In:

Crustacean and Mollusk Aquaculture in the United States (ed. by

J.V. Huner & E.E. Brown), pp. 63–125. AVI Publishing Co,

Inc., Westport.

Takahashi Y., Itami T., Kondo M., Maeda M., Fujii R.,

Tomonaga S., Supamattaya K. & Boonyaratpalin S. (1994)

Electron microscopic evidence of bacilliform virus infection in

kuruma shrimp (Penaeus japonicus). Fish Pathology 29,

121–125.

Wang Y.C., Lo C.F., Chang P.S. & Kou G.H. (1998) Experi-

mental infection of white spot baculovirus in some cultured

and wild decapods in Taiwan. Aquaculture 164, 221–231.

Wang C.S., Tang K.F.J., Kou G.H. & Chen S.N. (1997) Light

and electron microscopic evidence of white spot disease in the

giant tiger shrimp, Penaeus monodon (Fabricius), and kuruma

shrimp, Penaeus japonicus (Bate), cultured in Taiwan. Journalof Fish Diseases 20, 323–331.

Wang Q., White B.L., Redman R.M. & Lightner D.V. (1999)

Per os challenge of Litopenaeus vannamei postlarvae and

Farfantepenaeus duorarum juveniles with six geographic

isolates of white spot syndrome virus. Aquaculture 170,

179–194.

Wongteerasupaya C., Vickers J.E., Sriurairatana S., Nash G.L.,

Akarajamorn A., Boonsaeng V., Panyim S., Tassanakajon A.,

Withyachumnarnkul B. & Flegel T.W. (1995) A non-occlu-

ded, systemic baculovirus that occurs in cells of ectodermal

and mesodermal origin and causes high mortality in the black

tiger prawn Penaeus monodon. Diseases of Aquatic Organisms21, 69–77.

Received: 1 September 2001Accepted: 19 November 2001


207� 2002


wssv

Documents