you must answer in a complete sentence! 1.write three complete sentences contrasting dna and rna....
TRANSCRIPT
You must answer in a complete sentence!
1. Write three complete sentences contrasting DNA and RNA. Each sentence must have information about each nucleic acid.
Sugar (ribose/deoxyribose); bases (thymine/uracil); single vs. double stranded; one type vs. three types,
DNA is much longer (codes for everything); DNA found only in nucleus
Reorder and rewrite!
2. Rearrange and rewrite the major events of transcription and translation in the order that they occur.
A. The complete polypeptide is released.B. Messenger RNA is transcribed from DNAC. Amino acids are joined until a stop codon is reached.D. mRNA leaves the nucleusE. tRNA brings methionine to the start codonF. mRNA goes to ribosome
Reorder and rewrite!
2. Rearrange the major events of transcription and translation in the order that they occur.
B. Messenger RNA is transcribed from DNAD. mRNA leaves the nucleusF. mRNA goes to ribosomeE. tRNA brings methionine to the start codonC. Amino acids are joined until a stop codon is reached.A. The complete polypeptide is released.
You must answer in a complete sentence!
3. Write three complete sentences contrasting DNA replication and transcription. Each sentence must have information about each process.
Enzymes used; types of nucleotides added; final
product; replicaton fork in DNA/promoter site in
DNA for transcription; direction of process
You must answer in a complete sentence!
4. What are the three types of RNA and their functions? (Abbreviations are allowed)
mRNA = carries message from DNA to ribosomerRNA = part of ribosome, helps make proteinstRNA = carries amino acids to ribosome, converts mRNA into protein
SHOW YOUR WORK!
5. Transcribe and translate the following DNA template:
TACGGACCCCTTTAAATGCTGGTTGACACT
AUGCCUGGGGAAAUUUACGACCAACUGUGAMET PRO GLY GLU ISO TYR ASP GLN LEU STOP
NO NEED for complete sentences!
6. Use the following DNA sequence to show examples of the three different types of gene mutations. Write the mutated sequence, circle the mutation and label the mutation type. You should end up with three separate DNA sequences.
TA C G G A C C CSubstitution, Deletion (Frameshift ), Insertion
(Frameshift )
You must answer in a complete sentence!
7. Write one or two sentences that relate the following vocabulary terms: TATA box, promoter, RNA polymerase, gene, transcription. Please underline each vocabulary word used.
A TATA box helps RNA polymerase bind to the promoter of a gene during
transcription.
You must make a pretty picture!
8. Draw a picture of DNA molecule that is three nucleotides long. Label the parts of one nucleotide, show appropriate base-paring rules and label the hydrogen bond(s).
You must make a pretty picture!
8. Draw a picture of DNA molecule that is three nucleotides long. Label the parts of one nucleotide, show appropriate base-paring rules and label the hydrogen bond(s).
You must answer in a complete sentence!
9. Write a few sentences that relate the following vocabulary terms—codon; anticodon; tRNA; mRNA; nucleotide; amino acid; polypeptide. Please underline each vocabulary word used. • Three nucleotides on mRNA comprise a
codon, which are complementary to anticodons on tRNA. Each tRNA molecule carries a specific amino acid, which are joined by bonds to form a polypeptide chain.
Complete sentence!
10. What is the basic function of hox genes?
• Hox genes direct the formation of a body plan in multicellular organisms during development.
Complete sentences!11. Describe two examples of situations where
genes are regulated, and explain why they are regulated.
• Lac operon in bacteria, to turn on genes responsible for digesting lactose only when lactose is present
• Hox genes during embryonic development in multicellular organisms, to differentiate the developing cells into specialized cells (use some portions of DNA but not others).