yuelin zhang,weihua fan,mark kinkema,xinli, and xinnian dong by di wu and brian kahnamelli
TRANSCRIPT
Interaction of NPR1 with basic leucine zipper protein
transcription factors that bind sequences required for salicylic acid induction of the PR-1 gene
YUELIN ZHANG,WEIHUA FAN,MARK KINKEMA,XINLI, AND XINNIAN DONG
By Di Wu and Brian Kahnamelli
Introduction◦ What is SAR?◦ What did we know about NPR1 Before This Paper?◦ What did we want to learn about NPR1?
Yeast Two-Hybrid Screen◦ Mechanism of Action◦ Limitations of YTH
Why in Tomato? Experiments
◦ Yeast Two-Hybrid Screens◦ In Vitro Binding Affinity◦ Gel Shift Assays
Presentation Outline
Basic Leucine Zipper Transcription Factors (bZIP)
Summary of Results Impact and Implications Future Research
Presentation Outline
Do you know…How many potential diseases are there during the growth period of Rice?
More than 70!
Rice Blast
Rice Bacterial Blight
Rice false smut
Why SAR is fascinating?
1, Broad-spectrum resistance2, Relatively long-term resistance3, “healthy” resistance
What is SAR?
Systemic Acquired Resistance
How to study SAR genetically?
Forward genetic screen.
NPR1 BackgroundGroup Screens Mutants
obtained The year when finished
Screening strategy
Ryals, Novartis
Non-immunity (NIM)
nim1-1 to nim1-6
1995 Infection assay after SAR elicitor treatment
Dong, Duke No PR-gene expression (NPR)
npr1-1 1994 BGL2::GUS reporter system
In 1997, NPR1 gene was mapped and the protein sequence was examined.
Question Break
What do you know about NPR1 protein?
**Wonderful time to improve your Participation Grade**
Structural features of NPR1
593 amino acids, 67 kD Two protein-protein interaction domains:
BTB/POZ and Ankyrin repeats Contains NLS Multiple phosphorylation sites Multiple conserved cysteine residues No DNA binding domain
npr 1-1
BTB ARD
S S
NLSnpr 1-2 nim 1-2
Proposals to dissect NPR1 function in SAR signal pathway
SA receptor?◦ No SA binding activity
Subcellular localization? ◦ Accumulation in nucleus after SAR induction
Transcription factor?◦ No bona fide DNA binding domain
Screen for NPR1-interacting proteins (NIPs)
Purpose◦ To test protein-protein interactions
Requirements◦ Reporter construct of interest in yeast◦ cDNA prey library with spliced activating domain
Activating domain interacts with RNA pol to transcribe the reporter gene
◦ cDNA bait construct with spliced Yeast DNA binding domain (BD) Binding domain interacts with promoter region of the reporter
gene Preparation
◦ Transfect yeast cells with both plasmids and grow on medium complementary to your reporter assay
Yeast Two-Hybrid Screen
Yeast Two-Hybrid Screen
Bait Construct:•Plasmid Vector•cDNA sequence of interest•Binding domain
Prey Construct:•Plasmid Vector•cDNA sequence of interest•Activating domain
Yeast Two-Hybrid Screen
Reporter GeneBD
ADPrey
Bait
RNA Pol
Can you think of any limitations of the Yeast Two-Hybrid experiment?
Question Break
False Positive Results◦ A) Bait already possess an Activating Domain◦ B) Means of selection is error prone◦ C) Prey possess a yeast binding domain – highly
unlikely False Negative Results
◦ A) Post Translational Modifications Ex. Phosphorylation
◦ B) Scaffold protein interaction◦ C) Internal Yeast Error
Protein Folding or Transcription error occurs
Limitations of the YTH Screen
Tomato Library was better characterized than Arabidopsis Library
Tomato Library possessed a positive control◦ PTO-PTI◦ Remove some possibility of False Negative
The quality of a yeast two-hybrid experiment hinges on the quality of a library◦ Is what you’re finding legitimate??◦ Is what you’re not finding legitimate?
Tomato Library
Experimentation
Perform Yeast Two-Hybrid Experiment with known Tomato homologue of NPR1◦ Referred to as TomNPR1
Use NPR1 homologue of NPR1as bait◦ Transfect Yeast with gene, spliced to DNA binding
domain (BD) Screen cDNA Library for potential binding (Prey)
◦ Transfect the same yeast with gene Use of Leucine Drop out Plates
◦ Reporter genes allow yeast to produce Leucine and grow
Experiment 1 – Screen in Tomato Library
Yeast Two-Hybrid Screen
Leucine or β-gal ActivityBD
ADPrey
TomNPR1
RNA Pol
Researchers found NIF1 gene led to positive Y2H result◦ Leucine production, β-gal activity and colony
survival
Results
Results – Figure 1a
Results – Figure 1a
Test each component alone to test for individual activity◦ None found alone
Sequence and Characterize NIF1◦ Search Genebank for homologous structures in
Arabidopsis◦ NIF1 codes for last 2/3 of a bZIP Transcription
Factor Found Three candidates: AHBP-1b (TGA2),
TGA6, and OBF5(TGA2)◦ All are bZIP Transcription Factors
Experiment 2 – Looking into Arabidopsis
Experiment 2 – Looking into Arabidopsis
Figure 2. Sequence similarity between NIF1 and associated homologues
Perform same experimentation in Arabidopsis to confirm that Tomato homologues respond under similar conditions
Only considering 3 possible candidates (bZIP proteins)◦ AHBP-1b, TGA-6, and OBF5 as prey◦ NPR1 as Bait
Experiment 2 – Looking into Arabidoposis
All three bZIP proteins were capable of stimulating a Leucine and β-gal activity indicating protein-protein interaction
Results
Results – Figure 1a
Results – Figure 1a
Results – Figure 1b
Conclude: All three TFs show increased function when compared to the negative control. NPR1 can potentially interact with all of these TFs.
Because Yeast Two-Hybrid is error prone, confirmation by means of other experimentation is required
Researchers aimed to confirm results by performing an in vitro binding test◦ Ni-NTA Resin Pull down Assay (Co-Purification)
Experiment 3 – In Vitro Binding
Experiment 3 – Protocol for pull-down assay
Poly-histidine Tag
NTAScaffold
Ni-NTA resin
Poly-histidine Tag
NTAScaffold
Ni-NTA resinHis-tagged TGANPR1
Experiment 3 – Protocol for pull-down assay
Results – Figure 3
NPR1 & AHBP-1b
Crude Extract
of NPR1
NPR1 & O
BF5
NPR1 & AHBP-1b
(alternate preparatio
n)
NPR1 & Resin
alone
(Neg. C
ontrol)
Experiment 4 – Truncated NPR1 Aim to find regions of NPR1 involved in TGA
binding Create truncated NPR1 gene constructs Perform Yeast Two-Hybrid Screens with AHBP-1b
(TGA2) prey expressed along with truncated NPR1 bait◦ 1-177aa – amino term, 1st exon◦ 1-432aa – amino term, 1st exon, ankyrin repeat domain◦ 178-593aa – ankyrin repeat domain, carboxyl term◦ 1-593aa – Total Protein
Truncations along exon/intron boundries
Active regions appear to be amino end in combination with ankyrin domains◦ 1-432 segment shows activity equal to WT◦ N-terminus alone shows little activity◦ Ankyrin Repeat alone shows little activity
Results
Results – Figure 4a
Figure 4a. Specific regions of NPR1 appear to be more important in regards to binding affinity
Introduce point mutations into highly conserved amino acids within the Ankyrin repeat domains ◦ npr1-1 – histidine 334 to tyrosine◦ npr1-2 – cysteine 150 to tyrosine
Perform Yeast Two Hybrid Screens with these mutants and observe activity
Experiment 5 – Introducing Point Mutations
Base Switches:
Experiment 5 – Introducing Point Mutations
CysteineHistadine Tyrosine
Mutations into conserved amino acids lead to complete abolishment of activity
Results
Results – Figure 4b and 4c
Figure 4b. X-gal and Leucine drop out plates showing loss of activity in npr1-1 and npr1-2 mutants
Figure 4c. Immunoblot of NPR1 protein expression levels in WT and mutant constructs
Basic leucine zipper (bZIP) transcription factors
Marc Jakoby et al. 2002
Primary structure of bZIP domain
Hydrophobic interaction surface of the helices
O'Shea et al. 1991
Leucine Zipper TFs
Marc Jakoby et al. 2002
Binding DNA sequences with an ACGT core.
http://www.bmb.psu.edu/faculty/tan/lab/gallery_protdna.html
MADS-box TFs
Recognizing the CArG-box
Basics about TGA familyPlant bZIP transcription factors are classified into 10 groups
Group D/ TGA/OBF family
Clade II (TGA2/AHBP-1b, OBF5/ TGA5, TGA6)
TGA2
Question: What phenotypes would you expect if the construct 35S::TGA2CT is introduced into col-0 background?
NT: N-terminal region
bZIP: required for DNA binding
CT: responsible for NPR1 binding
TGA factors bind specifically to variants of the palindrome TGACGTCA. Two of these sequences separated by 4 bps are called an activation sequence-1 (as-1).
Aimed to characterize the function of AHBP-1b
PR-1 promoter region has as-1-like element◦ Known to interact with bZIP proteins
Test binding affinity of AHBP-1b to PR-1 promoter ◦ Radio-labeled promoter region◦ Non-labeled promoter region◦ Non-labeled as-1-like sequence
Experiment 6 – AHBP-1b analysis
Electrophoretic mobility shift assay (EMSA)
Question: How is TGA binding to PR1 promoter sequence possible even without NPR1?
as-1-like element: CTCTACGTCACTATTTTACTTACGTCATAGATG
Mutated version: CTCTAttctACTATTTTACTTAttctATAGATG
Results: Figure 5
Band shift observed when AHBP-1b was present
Competitive binding seen between labeled and non-labeled promoter region
Non-competitive binding seen between labeled promoter region and mutated as-1-like element
AHBP-1b can specifically bind the PR-1 promoter region in vitro
Results
Summary – What Have We Shown?
TomNPR interacts with NIF1 NPR1 interacts with TGA transcription
factors via Ankyrin repeat and N-terminus domain◦ Binding is specific and altered by single amino
acid changes TGA transcription factors interact with the
binding domains of PR genes◦ TGA2 binds to promoter region of PR1 specifically
Research helped to further connect SA to SAR by connecting another link in the pathway◦ Showed potential for redundancy as seen in three
bZIPs capable of binding to NPR1 Added to body of knowledge regarding
NPR1
Impact and Implications
Examine bZIP and NPR1 in vivo Loss of function and gain of function
mutants◦ Look at mutants lacking specific TGA TFs alone
and in combination◦ What else can NPR1 and TGAs activate?
Regulation◦ How is NPR1 activity regulated?
What else would you be interested in knowing?
Future Research
TGA 2,5, and 6 have essential, redundant, and overlapping roles
TGA 5 over expression is sufficient to stimulate SAR
NPR1 regulation sensitive to redox changes
Future Research
Future Research
How to further confirm the physical interaction between TGA factors and NPR1 in vivo?
Co-immunoprecipitation
In vivo protein fragment complementation assay (PCA)◦ Bimolecular fluorescence complementation (BiFC)◦ Restoration of dihydrofolate reductase (DHFR) acitivity
Protein fragment Complementation Assay (PCA) using DHFR enzyme
No interaction
interaction
I’m a protoplast.
Subramaniam et al. 2001 Nat. Biotechnol.
Subramaniam et al. 2001 Nat. Biotechnol.
Protein fragment Complementation Assay (PCA) using DHFR enzyme
Questions?